>Feature sequence01 3 170 gene locus_tag LOCUS_00010 3 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 788 144 gene locus_tag LOCUS_00020 788 144 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_00020 1127 2689 gene locus_tag LOCUS_00030 gene glsF 1127 2689 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_00030 2909 4282 gene locus_tag LOCUS_00040 gene gor 2909 4282 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812173.1 protein_id gnl|my_center|LOCUS_00040 4379 5161 gene locus_tag LOCUS_00050 4379 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_00050 5158 5601 gene locus_tag LOCUS_00060 5158 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5591 6268 gene locus_tag LOCUS_00070 5591 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6478 7122 gene locus_tag LOCUS_00080 6478 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8290 7166 gene locus_tag LOCUS_00090 gene phaC1 8290 7166 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_00090 8442 8885 gene locus_tag LOCUS_00100 8442 8885 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072666.1 protein_id gnl|my_center|LOCUS_00100 8885 9325 gene locus_tag LOCUS_00110 8885 9325 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_00110 9485 10597 gene locus_tag LOCUS_00120 9485 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_00120 11926 11225 gene locus_tag LOCUS_00130 gene yiaD 11926 11225 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_00130 12055 12882 gene locus_tag LOCUS_00140 12055 12882 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_00140 12983 14590 gene locus_tag LOCUS_00150 12983 14590 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_00150 14792 15541 gene locus_tag LOCUS_00160 gene rlmJ 14792 15541 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TK0 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 15736 16221 gene locus_tag LOCUS_00170 15736 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16214 17338 gene locus_tag LOCUS_00180 16214 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19320 17509 gene locus_tag LOCUS_00190 19320 17509 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_00190 19586 20755 gene locus_tag LOCUS_00200 19586 20755 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222055.1 protein_id gnl|my_center|LOCUS_00200 22967 20844 gene locus_tag LOCUS_00210 22967 20844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23267 23656 gene locus_tag LOCUS_00220 23267 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24628 25941 gene locus_tag LOCUS_00230 gene czcC 24628 25941 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_00230 25938 27170 gene locus_tag LOCUS_00240 25938 27170 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_00240 27185 30319 gene locus_tag LOCUS_00250 27185 30319 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_00250 30389 31216 gene locus_tag LOCUS_00260 30389 31216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31244 31588 gene locus_tag LOCUS_00270 31244 31588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31643 31993 gene locus_tag LOCUS_00280 31643 31993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32512 32123 gene locus_tag LOCUS_00290 32512 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32829 33143 gene locus_tag LOCUS_00300 32829 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33140 33442 gene locus_tag LOCUS_00310 33140 33442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33442 33690 gene locus_tag LOCUS_00320 33442 33690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33913 35499 gene locus_tag LOCUS_00330 33913 35499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35650 35979 gene locus_tag LOCUS_00340 35650 35979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35982 36401 gene locus_tag LOCUS_00350 35982 36401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36391 37023 gene locus_tag LOCUS_00360 36391 37023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37324 38193 gene locus_tag LOCUS_00370 37324 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38262 38555 gene locus_tag LOCUS_00380 38262 38555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38555 38737 gene locus_tag LOCUS_00390 38555 38737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 38734 39090 gene locus_tag LOCUS_00400 38734 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39097 40017 gene locus_tag LOCUS_00410 39097 40017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40014 40568 gene locus_tag LOCUS_00420 40014 40568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40651 40953 gene locus_tag LOCUS_00430 40651 40953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40957 41376 gene locus_tag LOCUS_00440 40957 41376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42115 41654 gene locus_tag LOCUS_00450 42115 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43292 42507 gene locus_tag LOCUS_00460 43292 42507 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPC2 protein_id gnl|my_center|LOCUS_00460 43372 43908 gene locus_tag LOCUS_00470 43372 43908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 43921 44769 gene locus_tag LOCUS_00480 43921 44769 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707146.1 protein_id gnl|my_center|LOCUS_00480 45759 44809 gene locus_tag LOCUS_00490 gene corA 45759 44809 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAG5 protein_id gnl|my_center|LOCUS_00490 45891 46514 gene locus_tag LOCUS_00500 45891 46514 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_00500 50401 46547 gene locus_tag LOCUS_00510 50401 46547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 50450 50617 gene locus_tag LOCUS_00520 50450 50617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51873 50647 gene locus_tag LOCUS_00530 51873 50647 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_00530 52034 54166 gene locus_tag LOCUS_00540 gene prc 52034 54166 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_00540 54980 54222 gene locus_tag LOCUS_00550 54980 54222 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_00550 55191 56534 gene locus_tag LOCUS_00560 gene cabC1 55191 56534 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_00560 56738 57946 gene locus_tag LOCUS_00570 56738 57946 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_00570 57960 58235 gene locus_tag LOCUS_00580 57960 58235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_00580 58239 59618 gene locus_tag LOCUS_00590 gene pntB 58239 59618 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 protein_id gnl|my_center|LOCUS_00590 60714 59890 gene locus_tag LOCUS_00600 60714 59890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_00600 61533 60721 gene locus_tag LOCUS_00610 61533 60721 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_00610 61813 65514 gene locus_tag LOCUS_00620 gene metH 61813 65514 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071290.1 protein_id gnl|my_center|LOCUS_00620 67620 65599 gene locus_tag LOCUS_00630 67620 65599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68363 67623 gene locus_tag LOCUS_00640 68363 67623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68440 70080 gene locus_tag LOCUS_00650 68440 70080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 71353 70055 gene locus_tag LOCUS_00660 71353 70055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71877 71350 gene locus_tag LOCUS_00670 71877 71350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 73019 71874 gene locus_tag LOCUS_00680 gene gspL 73019 71874 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT4 protein_id gnl|my_center|LOCUS_00680 74196 73051 gene locus_tag LOCUS_00690 gene xcpX 74196 73051 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_00690 74828 74187 gene locus_tag LOCUS_00700 gene xcpW 74828 74187 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_00700 75277 74828 gene locus_tag LOCUS_00710 75277 74828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 75827 75267 gene locus_tag LOCUS_00720 75827 75267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 76338 75907 gene locus_tag LOCUS_00730 gene xcpT 76338 75907 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_00730 77636 76410 gene locus_tag LOCUS_00740 gene xcpS 77636 76410 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_00740 79214 77673 gene locus_tag LOCUS_00750 gene xcpR 79214 77673 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_00750 80374 79232 gene locus_tag LOCUS_00760 80374 79232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 80961 80371 gene locus_tag LOCUS_00770 gene cheB2 80961 80371 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_00770 81446 80970 gene locus_tag LOCUS_00780 81446 80970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82300 81443 gene locus_tag LOCUS_00790 gene cheR 82300 81443 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_00790 86002 82319 gene locus_tag LOCUS_00800 86002 82319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 86264 86177 gene locus_tag LOCUS_t00010 86264 86177 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 86355 86282 gene locus_tag LOCUS_t00020 86355 86282 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 86515 86440 gene locus_tag LOCUS_t00030 86515 86440 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 87226 86627 gene locus_tag LOCUS_00810 gene pgsA 87226 86627 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419911.1 protein_id gnl|my_center|LOCUS_00810 89119 87356 gene locus_tag LOCUS_00820 gene uvrC 89119 87356 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_00820 90041 89373 gene locus_tag LOCUS_00830 gene gacA 90041 89373 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51373 protein_id gnl|my_center|LOCUS_00830 90452 90365 gene locus_tag LOCUS_t00040 90452 90365 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 90594 90986 gene locus_tag LOCUS_00840 gene tusD 90594 90986 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072358.1 protein_id gnl|my_center|LOCUS_00840 90983 91309 gene locus_tag LOCUS_00850 90983 91309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 91320 91610 gene locus_tag LOCUS_00860 91320 91610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 91707 92726 gene locus_tag LOCUS_00870 91707 92726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_00870 94475 93084 gene locus_tag LOCUS_00880 gene cysG 94475 93084 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_00880 95797 94475 gene locus_tag LOCUS_00890 gene serS 95797 94475 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL5 protein_id gnl|my_center|LOCUS_00890 96302 95901 gene locus_tag LOCUS_00900 gene crcB 96302 95901 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5P3 protein_id gnl|my_center|LOCUS_00900 97731 96370 gene locus_tag LOCUS_00910 97731 96370 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_00910 98369 97728 gene locus_tag LOCUS_00920 gene lolA 98369 97728 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39917 protein_id gnl|my_center|LOCUS_00920 100700 98385 gene locus_tag LOCUS_00930 gene ftsK 100700 98385 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M3 protein_id gnl|my_center|LOCUS_00930 101274 102221 gene locus_tag LOCUS_00940 gene trxB1 101274 102221 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_00940 102228 102992 gene locus_tag LOCUS_00950 gene aat 102228 102992 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE23 protein_id gnl|my_center|LOCUS_00950 103021 103722 gene locus_tag LOCUS_00960 gene ate 103021 103722 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 protein_id gnl|my_center|LOCUS_00960 103836 104054 gene locus_tag LOCUS_00970 gene infA 103836 104054 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P997 protein_id gnl|my_center|LOCUS_00970 106433 104163 gene locus_tag LOCUS_00980 gene clpA 106433 104163 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_00980 106912 106544 gene locus_tag LOCUS_00990 gene clpS 106912 106544 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_00990 107177 107410 gene locus_tag LOCUS_01000 gene cspD 107177 107410 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 protein_id gnl|my_center|LOCUS_01000 108746 107484 gene locus_tag LOCUS_01010 gene icd 108746 107484 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_01010 108982 109575 gene locus_tag LOCUS_01020 108982 109575 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_01020 109993 109538 gene locus_tag LOCUS_01030 gene moaE 109993 109538 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704805.1 protein_id gnl|my_center|LOCUS_01030 110250 109996 gene locus_tag LOCUS_01040 gene moaD 110250 109996 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX96 protein_id gnl|my_center|LOCUS_01040 110879 110250 gene locus_tag LOCUS_01050 gene moaC 110879 110250 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX95 protein_id gnl|my_center|LOCUS_01050 110959 111438 gene locus_tag LOCUS_01060 110959 111438 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_01060 111417 112580 gene locus_tag LOCUS_01070 gene mnmA 111417 112580 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_01070 112577 113197 gene locus_tag LOCUS_01080 gene hflD 112577 113197 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR5 protein_id gnl|my_center|LOCUS_01080 113326 114708 gene locus_tag LOCUS_01090 gene purB 113326 114708 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K9 protein_id gnl|my_center|LOCUS_01090 114708 115850 gene locus_tag LOCUS_01100 114708 115850 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_01100 115885 116304 gene locus_tag LOCUS_01110 115885 116304 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767420.1 protein_id gnl|my_center|LOCUS_01110 116369 116860 gene locus_tag LOCUS_01120 116369 116860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 117600 116932 gene locus_tag LOCUS_01130 117600 116932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 120181 118001 gene locus_tag LOCUS_01140 120181 118001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 122579 120408 gene locus_tag LOCUS_01150 gene glcB 122579 120408 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM95 protein_id gnl|my_center|LOCUS_01150 123610 122753 gene locus_tag LOCUS_01160 gene ttcA 123610 122753 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM4 protein_id gnl|my_center|LOCUS_01160 124468 123677 gene locus_tag LOCUS_01170 124468 123677 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_01170 125847 124627 gene locus_tag LOCUS_01180 125847 124627 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_01180 127021 125921 gene locus_tag LOCUS_01190 127021 125921 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_01190 127272 128342 gene locus_tag LOCUS_01200 127272 128342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_01200 128388 128969 gene locus_tag LOCUS_01210 128388 128969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 130232 129138 gene locus_tag LOCUS_01220 gene tqsA 130232 129138 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01220 130311 131285 gene locus_tag LOCUS_01230 130311 131285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 131904 131290 gene locus_tag LOCUS_01240 131904 131290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_01240 133611 132043 gene locus_tag LOCUS_01250 133611 132043 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759730.1 protein_id gnl|my_center|LOCUS_01250 133896 134144 gene locus_tag LOCUS_01260 133896 134144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134141 135136 gene locus_tag LOCUS_01270 134141 135136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 135224 136444 gene locus_tag LOCUS_01280 135224 136444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 137372 136437 gene locus_tag LOCUS_01290 137372 136437 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 protein_id gnl|my_center|LOCUS_01290 137804 137460 gene locus_tag LOCUS_01300 gene bolA 137804 137460 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348065.1 protein_id gnl|my_center|LOCUS_01300 138098 138463 gene locus_tag LOCUS_01310 138098 138463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 138707 138471 gene locus_tag LOCUS_01320 138707 138471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 138706 139686 gene locus_tag LOCUS_01330 gene mdh 138706 139686 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_01330 140240 140731 gene locus_tag LOCUS_01340 140240 140731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 140871 142079 gene locus_tag LOCUS_01350 140871 142079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 142140 143285 gene locus_tag LOCUS_01360 142140 143285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 143291 148708 gene locus_tag LOCUS_01370 143291 148708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 149507 148887 gene locus_tag LOCUS_01380 149507 148887 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R9 protein_id gnl|my_center|LOCUS_01380 149736 150464 gene locus_tag LOCUS_01390 gene cysH 149736 150464 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_01390 150673 152961 gene locus_tag LOCUS_01400 150673 152961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 154020 153046 gene locus_tag LOCUS_01410 gene cysB 154020 153046 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_01410 154137 154919 gene locus_tag LOCUS_01420 154137 154919 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNM0 protein_id gnl|my_center|LOCUS_01420 155851 154943 gene locus_tag LOCUS_01430 155851 154943 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_01430 155977 156561 gene locus_tag LOCUS_01440 155977 156561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 157028 156636 gene locus_tag LOCUS_01450 157028 156636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 157700 157032 gene locus_tag LOCUS_01460 157700 157032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 157820 158251 gene locus_tag LOCUS_01470 157820 158251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 158315 159361 gene locus_tag LOCUS_01480 gene mtnA 158315 159361 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 protein_id gnl|my_center|LOCUS_01480 159442 160083 gene locus_tag LOCUS_01490 gene mtnB 159442 160083 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9N3 protein_id gnl|my_center|LOCUS_01490 160080 160625 gene locus_tag LOCUS_01500 gene mtnD 160080 160625 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB9 protein_id gnl|my_center|LOCUS_01500 160625 161332 gene locus_tag LOCUS_01510 gene mtnC 160625 161332 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_01510 161961 162989 gene locus_tag LOCUS_01520 gene oruR 161961 162989 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_01520 163843 163112 gene locus_tag LOCUS_01530 163843 163112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 164425 166254 gene locus_tag LOCUS_01540 164425 166254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 166370 167509 gene locus_tag LOCUS_01550 166370 167509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 167509 168750 gene locus_tag LOCUS_01560 167509 168750 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229356.1 protein_id gnl|my_center|LOCUS_01560 169073 173284 gene locus_tag LOCUS_01570 169073 173284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 173500 174702 gene locus_tag LOCUS_01580 173500 174702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 174726 177845 gene locus_tag LOCUS_01590 174726 177845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 177925 178974 gene locus_tag LOCUS_01600 177925 178974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_01600 179537 179049 gene locus_tag LOCUS_01610 gene menG 179537 179049 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_01610 180220 179534 gene locus_tag LOCUS_01620 180220 179534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 182457 180220 gene locus_tag LOCUS_01630 182457 180220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 184829 182523 gene locus_tag LOCUS_01640 184829 182523 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_01640 185112 186377 gene locus_tag LOCUS_01650 185112 186377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 188043 186445 gene locus_tag LOCUS_01660 188043 186445 CDS product putative GMC-type oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMV7 protein_id gnl|my_center|LOCUS_01660 188654 188064 gene locus_tag LOCUS_01670 188654 188064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 190376 188757 gene locus_tag LOCUS_01680 190376 188757 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_01680 190984 190373 gene locus_tag LOCUS_01690 190984 190373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 191536 191273 gene locus_tag LOCUS_01700 191536 191273 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_01700 192968 191646 gene locus_tag LOCUS_01710 192968 191646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 196774 192965 gene locus_tag LOCUS_01720 196774 192965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 198537 196774 gene locus_tag LOCUS_01730 198537 196774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 200503 198527 gene locus_tag LOCUS_01740 200503 198527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 202179 200500 gene locus_tag LOCUS_01750 202179 200500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 203075 202185 gene locus_tag LOCUS_01760 203075 202185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 205464 203077 gene locus_tag LOCUS_01770 205464 203077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 208262 205767 gene locus_tag LOCUS_01780 gene hrpB 208262 205767 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_01780 208419 209015 gene locus_tag LOCUS_01790 208419 209015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_01790 209538 209098 gene locus_tag LOCUS_01800 209538 209098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 212345 209709 gene locus_tag LOCUS_01810 212345 209709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 212508 213140 gene locus_tag LOCUS_01820 212508 213140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 213194 215131 gene locus_tag LOCUS_01830 gene mnmC 213194 215131 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_01830 215529 215275 gene locus_tag LOCUS_01840 215529 215275 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJD4 protein_id gnl|my_center|LOCUS_01840 216091 215612 gene locus_tag LOCUS_01850 216091 215612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_01850 216754 216167 gene locus_tag LOCUS_01860 216754 216167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972333.1 protein_id gnl|my_center|LOCUS_01860 218823 216751 gene locus_tag LOCUS_01870 gene ligA 218823 216751 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL9 protein_id gnl|my_center|LOCUS_01870 219742 218816 gene locus_tag LOCUS_01880 gene zipA 219742 218816 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I5 protein_id gnl|my_center|LOCUS_01880 223292 219795 gene locus_tag LOCUS_01890 gene smc 223292 219795 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_01890 223656 224507 gene locus_tag LOCUS_01900 gene cysZ 223656 224507 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QN8 protein_id gnl|my_center|LOCUS_01900 225271 224576 gene locus_tag LOCUS_01910 225271 224576 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_01910 226168 225722 gene locus_tag LOCUS_01920 226168 225722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 226798 226565 gene locus_tag LOCUS_01930 226798 226565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 227756 227037 gene locus_tag LOCUS_01940 gene purC 227756 227037 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_01940 228560 227787 gene locus_tag LOCUS_01950 228560 227787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_01950 229198 228557 gene locus_tag LOCUS_01960 229198 228557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 230076 229195 gene locus_tag LOCUS_01970 gene dapA 230076 229195 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_01970 230318 230854 gene locus_tag LOCUS_01980 gene gcvR 230318 230854 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9I3 protein_id gnl|my_center|LOCUS_01980 230911 231375 gene locus_tag LOCUS_01990 gene bcp 230911 231375 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_01990 232842 231757 gene locus_tag LOCUS_02000 232842 231757 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_02000 233096 232842 gene locus_tag LOCUS_02010 233096 232842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_02010 233354 234745 gene locus_tag LOCUS_02020 233354 234745 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W8 protein_id gnl|my_center|LOCUS_02020 235805 234756 gene locus_tag LOCUS_02030 gene nadA 235805 234756 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NMW2 protein_id gnl|my_center|LOCUS_02030 236932 236087 gene locus_tag LOCUS_02040 236932 236087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 237492 236935 gene locus_tag LOCUS_02050 237492 236935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 238319 237696 gene locus_tag LOCUS_02060 238319 237696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 239611 238316 gene locus_tag LOCUS_02070 gene amt 239611 238316 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_02070 241297 240056 gene locus_tag LOCUS_02080 gene cfaS 241297 240056 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_02080 242160 241315 gene locus_tag LOCUS_02090 242160 241315 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 protein_id gnl|my_center|LOCUS_02090 243419 242157 gene locus_tag LOCUS_02100 243419 242157 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_02100 244993 243419 gene locus_tag LOCUS_02110 gene phr 244993 243419 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 protein_id gnl|my_center|LOCUS_02110 245912 244995 gene locus_tag LOCUS_02120 245912 244995 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_02120 246862 245909 gene locus_tag LOCUS_02130 246862 245909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_02130 247077 247002 gene locus_tag LOCUS_t00050 247077 247002 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 248013 247264 gene locus_tag LOCUS_02140 gene queC 248013 247264 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_02140 248638 247997 gene locus_tag LOCUS_02150 gene queE 248638 247997 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK3 protein_id gnl|my_center|LOCUS_02150 249456 248689 gene locus_tag LOCUS_02160 249456 248689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 250032 249466 gene locus_tag LOCUS_02170 250032 249466 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 protein_id gnl|my_center|LOCUS_02170 251416 250127 gene locus_tag LOCUS_02180 gene tolB 251416 250127 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP93 protein_id gnl|my_center|LOCUS_02180 252143 251421 gene locus_tag LOCUS_02190 252143 251421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 252565 252143 gene locus_tag LOCUS_02200 gene tolR 252565 252143 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_02200 253265 252576 gene locus_tag LOCUS_02210 gene tolQ 253265 252576 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_02210 253675 253262 gene locus_tag LOCUS_02220 253675 253262 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_02220 254706 253672 gene locus_tag LOCUS_02230 gene ruvB 254706 253672 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 protein_id gnl|my_center|LOCUS_02230 255455 254853 gene locus_tag LOCUS_02240 gene ruvA 255455 254853 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_02240 256013 255495 gene locus_tag LOCUS_02250 gene ruvC 256013 255495 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU1 protein_id gnl|my_center|LOCUS_02250 256904 256179 gene locus_tag LOCUS_02260 gene pmpR 256904 256179 CDS product transcriptional regulatory protein PmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51423 protein_id gnl|my_center|LOCUS_02260 258737 256968 gene locus_tag LOCUS_02270 gene aspS 258737 256968 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_02270 259067 259513 gene locus_tag LOCUS_02280 259067 259513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 260674 259610 gene locus_tag LOCUS_02290 260674 259610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 261556 260687 gene locus_tag LOCUS_02300 261556 260687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_02300 261692 261988 gene locus_tag LOCUS_02310 261692 261988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 protein_id gnl|my_center|LOCUS_02310 262134 263363 gene locus_tag LOCUS_02320 262134 263363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 263564 264784 gene locus_tag LOCUS_02330 263564 264784 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268907.1 protein_id gnl|my_center|LOCUS_02330 264781 265359 gene locus_tag LOCUS_02340 gene roxR 264781 265359 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_02340 266104 265340 gene locus_tag LOCUS_02350 266104 265340 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_02350 266541 266101 gene locus_tag LOCUS_02360 266541 266101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_02360 266872 268593 gene locus_tag LOCUS_02370 gene proS 266872 268593 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ED56 protein_id gnl|my_center|LOCUS_02370 269768 268746 gene locus_tag LOCUS_02380 269768 268746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530995.1 protein_id gnl|my_center|LOCUS_02380 269945 270688 gene locus_tag LOCUS_02390 269945 270688 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_02390 272388 270700 gene locus_tag LOCUS_02400 272388 270700 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_02400 273025 272381 gene locus_tag LOCUS_02410 273025 272381 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_02410 273218 273814 gene locus_tag LOCUS_02420 273218 273814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 273811 274734 gene locus_tag LOCUS_02430 gene dhmA 273811 274734 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_02430 275945 275100 gene locus_tag LOCUS_02440 gene ada 275945 275100 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_02440 277280 276096 gene locus_tag LOCUS_02450 277280 276096 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_02450 277456 279276 gene locus_tag LOCUS_02460 gene recQ 277456 279276 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_02460 280010 279483 gene locus_tag LOCUS_02470 280010 279483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 280654 281922 gene locus_tag LOCUS_02480 280654 281922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 281934 282353 gene locus_tag LOCUS_02490 281934 282353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 283942 282422 gene locus_tag LOCUS_02500 283942 282422 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_02500 284948 284046 gene locus_tag LOCUS_02510 gene ephC 284948 284046 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_02510 285307 285017 gene locus_tag LOCUS_02520 285307 285017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 286559 285300 gene locus_tag LOCUS_02530 286559 285300 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_02530 286715 287077 gene locus_tag LOCUS_02540 gene arsC 286715 287077 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_02540 287182 287778 gene locus_tag LOCUS_02550 gene wrbA 287182 287778 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_02550 287778 288131 gene locus_tag LOCUS_02560 287778 288131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 288124 288846 gene locus_tag LOCUS_02570 288124 288846 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104955.1 protein_id gnl|my_center|LOCUS_02570 288843 289811 gene locus_tag LOCUS_02580 288843 289811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_02580 289804 291495 gene locus_tag LOCUS_02590 289804 291495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_02590 291500 292933 gene locus_tag LOCUS_02600 291500 292933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 292930 293910 gene locus_tag LOCUS_02610 292930 293910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_02610 293919 295334 gene locus_tag LOCUS_02620 293919 295334 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 protein_id gnl|my_center|LOCUS_02620 297468 295387 gene locus_tag LOCUS_02630 297468 295387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 298372 297470 gene locus_tag LOCUS_02640 298372 297470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 303327 298369 gene locus_tag LOCUS_02650 303327 298369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 306196 303473 gene locus_tag LOCUS_02660 306196 303473 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061456.1 protein_id gnl|my_center|LOCUS_02660 307484 306207 gene locus_tag LOCUS_02670 307484 306207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 307876 307532 gene locus_tag LOCUS_02680 307876 307532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 310386 307873 gene locus_tag LOCUS_02690 gene nirB 310386 307873 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 protein_id gnl|my_center|LOCUS_02690 310777 312258 gene locus_tag LOCUS_02700 gene crnA 310777 312258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_02700 312311 313990 gene locus_tag LOCUS_02710 312311 313990 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_02710 316446 314137 gene locus_tag LOCUS_02720 316446 314137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 317615 316524 gene locus_tag LOCUS_02730 317615 316524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 319129 318293 gene locus_tag LOCUS_02740 319129 318293 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701513.1 protein_id gnl|my_center|LOCUS_02740 320215 319577 gene locus_tag LOCUS_02750 320215 319577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 321670 321038 gene locus_tag LOCUS_02760 321670 321038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_02760 322782 321781 gene locus_tag LOCUS_02770 gene rr07 322782 321781 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_02770 323404 322835 gene locus_tag LOCUS_02780 323404 322835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_02780 324124 323492 gene locus_tag LOCUS_02790 324124 323492 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 protein_id gnl|my_center|LOCUS_02790 324431 325567 gene locus_tag LOCUS_02800 324431 325567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_02800 327337 326015 gene locus_tag LOCUS_02810 327337 326015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 328158 327334 gene locus_tag LOCUS_02820 328158 327334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_02820 328512 328162 gene locus_tag LOCUS_02830 gene pilZ 328512 328162 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_02830 329556 328546 gene locus_tag LOCUS_02840 gene holB 329556 328546 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_02840 330244 329606 gene locus_tag LOCUS_02850 gene tmk 330244 329606 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_02850 331322 330234 gene locus_tag LOCUS_02860 331322 330234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_02860 332354 331560 gene locus_tag LOCUS_02870 gene pabC 332354 331560 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_02870 333634 332396 gene locus_tag LOCUS_02880 gene fabF1 333634 332396 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 protein_id gnl|my_center|LOCUS_02880 334209 333964 gene locus_tag LOCUS_02890 gene acpP 334209 333964 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_02890 335101 334361 gene locus_tag LOCUS_02900 gene fabG 335101 334361 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_02900 336038 335106 gene locus_tag LOCUS_02910 336038 335106 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_02910 337154 336117 gene locus_tag LOCUS_02920 gene plsX 337154 336117 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_02920 337629 337432 gene locus_tag LOCUS_02930 gene rpmF 337629 337432 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_02930 338163 337642 gene locus_tag LOCUS_02940 338163 337642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390869.1 protein_id gnl|my_center|LOCUS_02940 338301 338894 gene locus_tag LOCUS_02950 gene maf-1 338301 338894 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG2 protein_id gnl|my_center|LOCUS_02950 339980 339009 gene locus_tag LOCUS_02960 339980 339009 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_02960 340654 339980 gene locus_tag LOCUS_02970 340654 339980 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_02970 341973 340654 gene locus_tag LOCUS_02980 341973 340654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 342649 345579 gene locus_tag LOCUS_02990 gene rne 342649 345579 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY6 protein_id gnl|my_center|LOCUS_02990 346693 345668 gene locus_tag LOCUS_03000 gene murB 346693 345668 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_03000 347244 346690 gene locus_tag LOCUS_03010 gene ptpA 347244 346690 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_03010 348001 347234 gene locus_tag LOCUS_03020 gene kdsB 348001 347234 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_03020 348996 347998 gene locus_tag LOCUS_03030 gene lpxK 348996 347998 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUI0 protein_id gnl|my_center|LOCUS_03030 350751 349000 gene locus_tag LOCUS_03040 gene msbA 350751 349000 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF3 protein_id gnl|my_center|LOCUS_03040 351167 350748 gene locus_tag LOCUS_03050 gene exbD 351167 350748 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_03050 351763 351164 gene locus_tag LOCUS_03060 351763 351164 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_03060 353942 351903 gene locus_tag LOCUS_03070 gene comA 353942 351903 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_03070 353958 354083 gene locus_tag LOCUS_03080 353958 354083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 354428 354952 gene locus_tag LOCUS_03090 354428 354952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_03090 355641 354925 gene locus_tag LOCUS_03100 gene lolD 355641 354925 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_03100 356878 355634 gene locus_tag LOCUS_03110 356878 355634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_03110 357088 357993 gene locus_tag LOCUS_03120 357088 357993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 358154 359185 gene locus_tag LOCUS_03130 gene aguA 358154 359185 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_03130 359271 360188 gene locus_tag LOCUS_03140 gene aguB 359271 360188 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_03140 360278 361078 gene locus_tag LOCUS_03150 360278 361078 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 protein_id gnl|my_center|LOCUS_03150 362239 361097 gene locus_tag LOCUS_03160 362239 361097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_03160 362749 362513 gene locus_tag LOCUS_03170 362749 362513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_03170 363830 362751 gene locus_tag LOCUS_03180 gene apbE 363830 362751 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44550 protein_id gnl|my_center|LOCUS_03180 365076 363847 gene locus_tag LOCUS_03190 gene nqrF 365076 363847 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_03190 365714 365094 gene locus_tag LOCUS_03200 gene nqrE 365714 365094 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_03200 366400 365729 gene locus_tag LOCUS_03210 gene nqrD 366400 365729 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_03210 367241 366393 gene locus_tag LOCUS_03220 gene nqrC 367241 366393 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_03220 368488 367241 gene locus_tag LOCUS_03230 gene nqrB 368488 367241 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_03230 369837 368491 gene locus_tag LOCUS_03240 gene nqrA 369837 368491 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_03240 371929 370490 gene locus_tag LOCUS_03250 371929 370490 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FC43 protein_id gnl|my_center|LOCUS_03250 372685 372104 gene locus_tag LOCUS_03260 372685 372104 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_03260 373624 372749 gene locus_tag LOCUS_03270 gene tesB 373624 372749 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208625.1 protein_id gnl|my_center|LOCUS_03270 374143 373913 gene locus_tag LOCUS_03280 374143 373913 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263045.1 protein_id gnl|my_center|LOCUS_03280 374709 374308 gene locus_tag LOCUS_03290 374709 374308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 375133 374849 gene locus_tag LOCUS_03300 375133 374849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 375380 378868 gene locus_tag LOCUS_03310 gene mfd 375380 378868 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_03310 379050 379970 gene locus_tag LOCUS_03320 379050 379970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 381781 380582 gene locus_tag LOCUS_03330 381781 380582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704093.1 protein_id gnl|my_center|LOCUS_03330 382526 381795 gene locus_tag LOCUS_03340 382526 381795 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRB0 protein_id gnl|my_center|LOCUS_03340 383089 382526 gene locus_tag LOCUS_03350 383089 382526 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_03350 384258 383086 gene locus_tag LOCUS_03360 384258 383086 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_03360 385265 384258 gene locus_tag LOCUS_03370 gene nagZ 385265 384258 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SA0 protein_id gnl|my_center|LOCUS_03370 385755 385279 gene locus_tag LOCUS_03380 385755 385279 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_03380 386438 385773 gene locus_tag LOCUS_03390 gene psrA 386438 385773 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_03390 387918 386584 gene locus_tag LOCUS_03400 387918 386584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_03400 388774 387929 gene locus_tag LOCUS_03410 388774 387929 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_03410 389698 389027 gene locus_tag LOCUS_03420 389698 389027 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHG2 protein_id gnl|my_center|LOCUS_03420 390231 389698 gene locus_tag LOCUS_03430 390231 389698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 393041 390237 gene locus_tag LOCUS_03440 gene topA 393041 390237 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB5 protein_id gnl|my_center|LOCUS_03440 393355 394251 gene locus_tag LOCUS_03450 393355 394251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 394293 394742 gene locus_tag LOCUS_03460 394293 394742 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_03460 395483 394812 gene locus_tag LOCUS_03470 395483 394812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 395765 396379 gene locus_tag LOCUS_03480 gene lexA 395765 396379 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5I2 protein_id gnl|my_center|LOCUS_03480 396363 396875 gene locus_tag LOCUS_03490 396363 396875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_03490 397006 397818 gene locus_tag LOCUS_03500 397006 397818 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_03500 398117 397896 gene locus_tag LOCUS_03510 398117 397896 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_03510 400354 398186 gene locus_tag LOCUS_03520 gene rlmL 400354 398186 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_03520 400703 400912 gene locus_tag LOCUS_03530 gene rmf 400703 400912 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74VV4 protein_id gnl|my_center|LOCUS_03530 402027 401017 gene locus_tag LOCUS_03540 gene pyrD 402027 401017 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_03540 404785 402395 gene locus_tag LOCUS_03550 404785 402395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_03550 405851 404799 gene locus_tag LOCUS_03560 405851 404799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267183.1 protein_id gnl|my_center|LOCUS_03560 408895 406082 gene locus_tag LOCUS_03570 408895 406082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 410395 408989 gene locus_tag LOCUS_03580 410395 408989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_03580 412430 410457 gene locus_tag LOCUS_03590 gene gbt 412430 410457 CDS product glycine/betaine transmethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 protein_id gnl|my_center|LOCUS_03590 415235 412626 gene locus_tag LOCUS_03600 gene pepN 415235 412626 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_03600 415566 415228 gene locus_tag LOCUS_03610 415566 415228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 416453 415566 gene locus_tag LOCUS_03620 gene nadK 416453 415566 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_03620 417656 416577 gene locus_tag LOCUS_03630 417656 416577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 419192 417825 gene locus_tag LOCUS_03640 419192 417825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_03640 419941 419865 gene locus_tag LOCUS_t00060 419941 419865 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 420049 419974 gene locus_tag LOCUS_t00070 420049 419974 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 420377 420189 gene locus_tag LOCUS_03650 420377 420189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 420964 420374 gene locus_tag LOCUS_03660 gene atuR 420964 420374 CDS product atu genes repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 protein_id gnl|my_center|LOCUS_03660 421151 422950 gene locus_tag LOCUS_03670 421151 422950 CDS product terpene utilization protein AtuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_03670 422950 423816 gene locus_tag LOCUS_03680 gene atuB 422950 423816 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_03680 423821 425437 gene locus_tag LOCUS_03690 gene atuC 423821 425437 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_03690 425452 426612 gene locus_tag LOCUS_03700 gene atuD 425452 426612 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_03700 426743 427549 gene locus_tag LOCUS_03710 gene ech2 426743 427549 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207706.1 protein_id gnl|my_center|LOCUS_03710 427552 429501 gene locus_tag LOCUS_03720 gene atuF 427552 429501 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_03720 429623 431455 gene locus_tag LOCUS_03730 429623 431455 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 protein_id gnl|my_center|LOCUS_03730 432590 432132 gene locus_tag LOCUS_03740 432590 432132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069443.1 protein_id gnl|my_center|LOCUS_03740 433068 432754 gene locus_tag LOCUS_03750 433068 432754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 434325 433108 gene locus_tag LOCUS_03760 434325 433108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_03760 434538 435305 gene locus_tag LOCUS_03770 434538 435305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 435667 435335 gene locus_tag LOCUS_03780 435667 435335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 435921 437027 gene locus_tag LOCUS_03790 435921 437027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 438097 437069 gene locus_tag LOCUS_03800 gene cmoB 438097 437069 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G4 protein_id gnl|my_center|LOCUS_03800 438888 438094 gene locus_tag LOCUS_03810 gene cmoA 438888 438094 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_03810 439042 438966 gene locus_tag LOCUS_t00080 439042 438966 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 439481 439125 gene locus_tag LOCUS_03820 439481 439125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_03820 439764 439462 gene locus_tag LOCUS_03830 gene ihfA 439764 439462 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H6 protein_id gnl|my_center|LOCUS_03830 442148 439779 gene locus_tag LOCUS_03840 gene pheT 442148 439779 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_03840 443179 442160 gene locus_tag LOCUS_03850 gene pheS 443179 442160 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_03850 443670 443314 gene locus_tag LOCUS_03860 gene rplT 443670 443314 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_03860 443898 443704 gene locus_tag LOCUS_03870 gene rpmI 443898 443704 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_03870 444411 443944 gene locus_tag LOCUS_03880 gene infC 444411 443944 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_03880 444727 444651 gene locus_tag LOCUS_t00090 444727 444651 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 446892 444865 gene locus_tag LOCUS_03890 gene uvrB 446892 444865 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_03890 446977 448209 gene locus_tag LOCUS_03900 gene aspC 446977 448209 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_03900 448302 448377 gene locus_tag LOCUS_t00100 448302 448377 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 448742 448434 gene locus_tag LOCUS_03910 448742 448434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 452216 448881 gene locus_tag LOCUS_03920 452216 448881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 455627 452229 gene locus_tag LOCUS_03930 455627 452229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 457282 455702 gene locus_tag LOCUS_03940 457282 455702 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_03940 460358 457479 gene locus_tag LOCUS_03950 460358 457479 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804175.1 protein_id gnl|my_center|LOCUS_03950 461015 463357 gene locus_tag LOCUS_03960 461015 463357 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_03960 463507 463432 gene locus_tag LOCUS_t00110 463507 463432 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 463585 463510 gene locus_tag LOCUS_t00120 463585 463510 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 463809 464498 gene locus_tag LOCUS_03970 463809 464498 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_03970 465163 464495 gene locus_tag LOCUS_03980 465163 464495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_03980 465329 466558 gene locus_tag LOCUS_03990 465329 466558 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_03990 466590 467144 gene locus_tag LOCUS_04000 466590 467144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 468090 467134 gene locus_tag LOCUS_04010 468090 467134 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 protein_id gnl|my_center|LOCUS_04010 468242 469150 gene locus_tag LOCUS_04020 gene htpX 468242 469150 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 protein_id gnl|my_center|LOCUS_04020 471175 470045 gene locus_tag LOCUS_04030 471175 470045 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_04030 471391 471567 gene locus_tag LOCUS_04040 471391 471567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 472829 471666 gene locus_tag LOCUS_04050 gene pdxB 472829 471666 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_04050 473068 473586 gene locus_tag LOCUS_04060 473068 473586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 473590 475563 gene locus_tag LOCUS_04070 473590 475563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 475560 478661 gene locus_tag LOCUS_04080 475560 478661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 478642 479397 gene locus_tag LOCUS_04090 478642 479397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 479399 479695 gene locus_tag LOCUS_04100 479399 479695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 479903 480622 gene locus_tag LOCUS_04110 479903 480622 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_04110 480668 481180 gene locus_tag LOCUS_04120 480668 481180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 481177 481689 gene locus_tag LOCUS_04130 481177 481689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 481686 482618 gene locus_tag LOCUS_04140 481686 482618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 483294 482743 gene locus_tag LOCUS_04150 483294 482743 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 protein_id gnl|my_center|LOCUS_04150 483395 484747 gene locus_tag LOCUS_04160 gene mdtK 483395 484747 CDS product multidrug resistance protein MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDZ8 protein_id gnl|my_center|LOCUS_04160 485237 484752 gene locus_tag LOCUS_04170 485237 484752 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_04170 485466 486170 gene locus_tag LOCUS_04180 485466 486170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 487398 486316 gene locus_tag LOCUS_04190 487398 486316 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_04190 487661 487401 gene locus_tag LOCUS_04200 gene tusA 487661 487401 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_04200 488934 487654 gene locus_tag LOCUS_04210 gene ampG 488934 487654 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367956.1 protein_id gnl|my_center|LOCUS_04210 489110 489766 gene locus_tag LOCUS_04220 489110 489766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 490778 489834 gene locus_tag LOCUS_04230 gene purU 490778 489834 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIP8 protein_id gnl|my_center|LOCUS_04230 491791 490775 gene locus_tag LOCUS_04240 491791 490775 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_04240 491970 493097 gene locus_tag LOCUS_04250 491970 493097 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_04250 493244 493627 gene locus_tag LOCUS_04260 493244 493627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 493868 493659 gene locus_tag LOCUS_04270 493868 493659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 494514 494011 gene locus_tag LOCUS_04280 494514 494011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 494623 495021 gene locus_tag LOCUS_04290 494623 495021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 495867 495103 gene locus_tag LOCUS_04300 gene dhrS4 495867 495103 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_04300 496987 495953 gene locus_tag LOCUS_04310 496987 495953 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_04310 498188 496980 gene locus_tag LOCUS_04320 498188 496980 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_04320 499291 498398 gene locus_tag LOCUS_04330 499291 498398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_04330 500516 499482 gene locus_tag LOCUS_04340 500516 499482 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_04340 502101 500509 gene locus_tag LOCUS_04350 502101 500509 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228753.1 protein_id gnl|my_center|LOCUS_04350 503121 502165 gene locus_tag LOCUS_04360 503121 502165 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702266.1 protein_id gnl|my_center|LOCUS_04360 503388 503131 gene locus_tag LOCUS_04370 503388 503131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 503308 504357 gene locus_tag LOCUS_04380 503308 504357 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 protein_id gnl|my_center|LOCUS_04380 504861 506195 gene locus_tag LOCUS_04390 504861 506195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 506439 507188 gene locus_tag LOCUS_04400 506439 507188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 507721 507242 gene locus_tag LOCUS_04410 507721 507242 CDS product NrdH-like redox domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941229.1 protein_id gnl|my_center|LOCUS_04410 507961 507791 gene locus_tag LOCUS_04420 507961 507791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 508014 510404 gene locus_tag LOCUS_04430 508014 510404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 510592 511884 gene locus_tag LOCUS_04440 510592 511884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 512208 511948 gene locus_tag LOCUS_04450 512208 511948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 512392 512907 gene locus_tag LOCUS_04460 512392 512907 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729045.1 protein_id gnl|my_center|LOCUS_04460 513017 513586 gene locus_tag LOCUS_04470 513017 513586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_04470 514853 513774 gene locus_tag LOCUS_04480 514853 513774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 515260 516318 gene locus_tag LOCUS_04490 515260 516318 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_04490 517567 516620 gene locus_tag LOCUS_04500 gene bioH 517567 516620 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_04500 518291 517695 gene locus_tag LOCUS_04510 518291 517695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 518910 518326 gene locus_tag LOCUS_04520 518910 518326 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 protein_id gnl|my_center|LOCUS_04520 519113 521518 gene locus_tag LOCUS_04530 519113 521518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 522523 521600 gene locus_tag LOCUS_04540 522523 521600 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206238.1 protein_id gnl|my_center|LOCUS_04540 522924 524381 gene locus_tag LOCUS_04550 522924 524381 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246501.1 protein_id gnl|my_center|LOCUS_04550 525344 524529 gene locus_tag LOCUS_04560 525344 524529 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705155.1 protein_id gnl|my_center|LOCUS_04560 527060 525537 gene locus_tag LOCUS_04570 527060 525537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_04570 528006 527572 gene locus_tag LOCUS_04580 528006 527572 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114472.1 protein_id gnl|my_center|LOCUS_04580 528082 528585 gene locus_tag LOCUS_04590 528082 528585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_04590 529054 528692 gene locus_tag LOCUS_04600 529054 528692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 531357 529051 gene locus_tag LOCUS_04610 531357 529051 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_04610 531604 531383 gene locus_tag LOCUS_04620 531604 531383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 532112 531759 gene locus_tag LOCUS_04630 532112 531759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 532698 532147 gene locus_tag LOCUS_04640 532698 532147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 533039 532755 gene locus_tag LOCUS_04650 533039 532755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 533901 533083 gene locus_tag LOCUS_04660 533901 533083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 535802 533898 gene locus_tag LOCUS_04670 gene copA 535802 533898 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_04670 535927 536682 gene locus_tag LOCUS_04680 gene copR 535927 536682 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_04680 536672 538093 gene locus_tag LOCUS_04690 gene ybcZ 536672 538093 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253793.1 protein_id gnl|my_center|LOCUS_04690 540408 538246 gene locus_tag LOCUS_04700 gene fadB 540408 538246 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_04700 541728 540517 gene locus_tag LOCUS_04710 541728 540517 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 protein_id gnl|my_center|LOCUS_04710 542013 542768 gene locus_tag LOCUS_04720 542013 542768 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_04720 543206 543424 gene locus_tag LOCUS_04730 543206 543424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 545505 543460 gene locus_tag LOCUS_04740 545505 543460 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_04740 547381 545819 gene locus_tag LOCUS_04750 gene yhcX 547381 545819 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_04750 549007 547523 gene locus_tag LOCUS_04760 549007 547523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_04760 550733 549441 gene locus_tag LOCUS_04770 550733 549441 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_04770 551205 550684 gene locus_tag LOCUS_04780 gene ccmE 551205 550684 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_04780 551455 551261 gene locus_tag LOCUS_04790 gene ccmD 551455 551261 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N4 protein_id gnl|my_center|LOCUS_04790 552210 551455 gene locus_tag LOCUS_04800 552210 551455 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408171.1 protein_id gnl|my_center|LOCUS_04800 552879 552214 gene locus_tag LOCUS_04810 552879 552214 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ8 protein_id gnl|my_center|LOCUS_04810 553517 552876 gene locus_tag LOCUS_04820 gene ccmA 553517 552876 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE3 protein_id gnl|my_center|LOCUS_04820 553696 554100 gene locus_tag LOCUS_04830 553696 554100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 554169 554345 gene locus_tag LOCUS_04840 554169 554345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 557322 554575 gene locus_tag LOCUS_04850 557322 554575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 560152 557525 gene locus_tag LOCUS_04860 560152 557525 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266756.1 protein_id gnl|my_center|LOCUS_04860 561300 560383 gene locus_tag LOCUS_04870 gene metR 561300 560383 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812755.1 protein_id gnl|my_center|LOCUS_04870 561553 563862 gene locus_tag LOCUS_04880 gene metE 561553 563862 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3Z9 protein_id gnl|my_center|LOCUS_04880 566418 564067 gene locus_tag LOCUS_04890 566418 564067 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_04890 567064 566408 gene locus_tag LOCUS_04900 567064 566408 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482817.1 protein_id gnl|my_center|LOCUS_04900 567821 567048 gene locus_tag LOCUS_04910 gene mmyX 567821 567048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039534.1 protein_id gnl|my_center|LOCUS_04910 568836 567832 gene locus_tag LOCUS_04920 gene mmyD 568836 567832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039533.1 protein_id gnl|my_center|LOCUS_04920 569852 569127 gene locus_tag LOCUS_04930 569852 569127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 570233 571093 gene locus_tag LOCUS_04940 570233 571093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_04940 572078 573379 gene locus_tag LOCUS_04950 gene fadI 572078 573379 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK23 protein_id gnl|my_center|LOCUS_04950 573509 575767 gene locus_tag LOCUS_04960 gene fadE 573509 575767 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_04960 576141 577097 gene locus_tag LOCUS_04970 576141 577097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963134.1 protein_id gnl|my_center|LOCUS_04970 577193 578119 gene locus_tag LOCUS_04980 577193 578119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206808.1 protein_id gnl|my_center|LOCUS_04980 578327 578599 gene locus_tag LOCUS_04990 578327 578599 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178089.1 protein_id gnl|my_center|LOCUS_04990 578596 578877 gene locus_tag LOCUS_05000 578596 578877 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532246.1 protein_id gnl|my_center|LOCUS_05000 579416 580309 gene locus_tag LOCUS_05010 579416 580309 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 protein_id gnl|my_center|LOCUS_05010 580881 580414 gene locus_tag LOCUS_05020 580881 580414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_05020 581116 583431 gene locus_tag LOCUS_05030 581116 583431 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114386.1 protein_id gnl|my_center|LOCUS_05030 583559 584005 gene locus_tag LOCUS_05040 583559 584005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 584032 586311 gene locus_tag LOCUS_05050 584032 586311 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence02 439 663 gene locus_tag LOCUS_05060 439 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55482 protein_id gnl|my_center|LOCUS_05060 939 1100 gene locus_tag LOCUS_05070 939 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1146 1412 gene locus_tag LOCUS_05080 1146 1412 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_05080 1412 2224 gene locus_tag LOCUS_05090 1412 2224 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535029.1 protein_id gnl|my_center|LOCUS_05090 2361 3437 gene locus_tag LOCUS_05100 2361 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3462 3671 gene locus_tag LOCUS_05110 3462 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4405 3788 gene locus_tag LOCUS_05120 4405 3788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_05120 5230 4460 gene locus_tag LOCUS_05130 5230 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5839 5231 gene locus_tag LOCUS_05140 5839 5231 CDS product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705671.1 protein_id gnl|my_center|LOCUS_05140 6211 6561 gene locus_tag LOCUS_05150 6211 6561 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_05150 6771 7037 gene locus_tag LOCUS_05160 6771 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768491.1 protein_id gnl|my_center|LOCUS_05160 7159 7572 gene locus_tag LOCUS_05170 7159 7572 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_05170 9203 7848 gene locus_tag LOCUS_05180 9203 7848 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 protein_id gnl|my_center|LOCUS_05180 9560 10480 gene locus_tag LOCUS_05190 9560 10480 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 10624 10893 gene locus_tag LOCUS_05200 10624 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 10871 12640 gene locus_tag LOCUS_05210 10871 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 13133 14506 gene locus_tag LOCUS_05220 13133 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 14506 15195 gene locus_tag LOCUS_05230 14506 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 15179 16561 gene locus_tag LOCUS_05240 15179 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_05240 16606 18744 gene locus_tag LOCUS_05250 16606 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 18978 19457 gene locus_tag LOCUS_05260 gene bsaA 18978 19457 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT3 protein_id gnl|my_center|LOCUS_05260 21466 19739 gene locus_tag LOCUS_05270 21466 19739 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_05270 21912 21463 gene locus_tag LOCUS_05280 21912 21463 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_05280 22351 21917 gene locus_tag LOCUS_05290 22351 21917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_05290 22673 22362 gene locus_tag LOCUS_05300 22673 22362 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817043.1 protein_id gnl|my_center|LOCUS_05300 22759 23634 gene locus_tag LOCUS_05310 22759 23634 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_05310 24407 23736 gene locus_tag LOCUS_05320 24407 23736 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110067.1 protein_id gnl|my_center|LOCUS_05320 26240 24444 gene locus_tag LOCUS_05330 26240 24444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 26525 26343 gene locus_tag LOCUS_05340 26525 26343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 26621 27358 gene locus_tag LOCUS_05350 26621 27358 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_05350 27447 27866 gene locus_tag LOCUS_05360 27447 27866 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_05360 28040 28504 gene locus_tag LOCUS_05370 28040 28504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 29085 29759 gene locus_tag LOCUS_05380 29085 29759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 30571 29873 gene locus_tag LOCUS_05390 30571 29873 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 protein_id gnl|my_center|LOCUS_05390 30881 31720 gene locus_tag LOCUS_05400 30881 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 31836 32012 gene locus_tag LOCUS_05410 31836 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 32391 33989 gene locus_tag LOCUS_05420 32391 33989 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_05420 34068 35675 gene locus_tag LOCUS_05430 34068 35675 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_05430 35706 37253 gene locus_tag LOCUS_05440 35706 37253 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_05440 37528 37776 gene locus_tag LOCUS_05450 37528 37776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265623.1 protein_id gnl|my_center|LOCUS_05450 37997 38956 gene locus_tag LOCUS_05460 37997 38956 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_05460 39268 40491 gene locus_tag LOCUS_05470 39268 40491 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_05470 40618 41889 gene locus_tag LOCUS_05480 40618 41889 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_05480 41930 43159 gene locus_tag LOCUS_05490 41930 43159 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_05490 43211 44596 gene locus_tag LOCUS_05500 43211 44596 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_05500 45777 44761 gene locus_tag LOCUS_05510 45777 44761 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_05510 46138 46488 gene locus_tag LOCUS_05520 46138 46488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 46640 47044 gene locus_tag LOCUS_05530 gene yuxK 46640 47044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_05530 47080 48321 gene locus_tag LOCUS_05540 gene chrA 47080 48321 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_05540 48427 49290 gene locus_tag LOCUS_05550 48427 49290 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_05550 49444 49938 gene locus_tag LOCUS_05560 49444 49938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105926.1 protein_id gnl|my_center|LOCUS_05560 50194 50940 gene locus_tag LOCUS_05570 50194 50940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 52029 51085 gene locus_tag LOCUS_05580 gene rr07 52029 51085 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_05580 52233 53564 gene locus_tag LOCUS_05590 52233 53564 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946567.1 protein_id gnl|my_center|LOCUS_05590 53579 54493 gene locus_tag LOCUS_05600 53579 54493 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_05600 54490 55428 gene locus_tag LOCUS_05610 54490 55428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_05610 55425 56273 gene locus_tag LOCUS_05620 55425 56273 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_05620 56270 57025 gene locus_tag LOCUS_05630 56270 57025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 57338 57901 gene locus_tag LOCUS_05640 57338 57901 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970757.1 protein_id gnl|my_center|LOCUS_05640 57956 59299 gene locus_tag LOCUS_05650 57956 59299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 59315 60781 gene locus_tag LOCUS_05660 59315 60781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 61826 61167 gene locus_tag LOCUS_05670 61826 61167 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_05670 62427 63278 gene locus_tag LOCUS_05680 62427 63278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 63450 63374 gene locus_tag LOCUS_t00130 63450 63374 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63820 64158 gene locus_tag LOCUS_05690 gene sugE 63820 64158 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095268.1 protein_id gnl|my_center|LOCUS_05690 64233 64934 gene locus_tag LOCUS_05700 64233 64934 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_05700 64934 66031 gene locus_tag LOCUS_05710 64934 66031 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806895.1 protein_id gnl|my_center|LOCUS_05710 66043 68694 gene locus_tag LOCUS_05720 66043 68694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 68803 69276 gene locus_tag LOCUS_05730 68803 69276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 71621 69612 gene locus_tag LOCUS_05740 gene rep 71621 69612 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ8 protein_id gnl|my_center|LOCUS_05740 71917 72684 gene locus_tag LOCUS_05750 71917 72684 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_05750 72771 73853 gene locus_tag LOCUS_05760 gene rffG 72771 73853 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 protein_id gnl|my_center|LOCUS_05760 73850 74401 gene locus_tag LOCUS_05770 gene rfbC-2 73850 74401 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_05770 75384 74398 gene locus_tag LOCUS_05780 75384 74398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 76604 75408 gene locus_tag LOCUS_05790 76604 75408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 77749 76604 gene locus_tag LOCUS_05800 77749 76604 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337933.1 protein_id gnl|my_center|LOCUS_05800 79090 77864 gene locus_tag LOCUS_05810 79090 77864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 80387 79197 gene locus_tag LOCUS_05820 80387 79197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 81835 80648 gene locus_tag LOCUS_05830 81835 80648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 83456 82008 gene locus_tag LOCUS_05840 83456 82008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142002.1 protein_id gnl|my_center|LOCUS_05840 84622 83453 gene locus_tag LOCUS_05850 84622 83453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 86248 84770 gene locus_tag LOCUS_05860 gene comM 86248 84770 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 protein_id gnl|my_center|LOCUS_05860 86687 87715 gene locus_tag LOCUS_05870 86687 87715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 88202 88666 gene locus_tag LOCUS_05880 88202 88666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 90632 88668 gene locus_tag LOCUS_05890 90632 88668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 90883 90632 gene locus_tag LOCUS_05900 90883 90632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073988.1 protein_id gnl|my_center|LOCUS_05900 91217 91555 gene locus_tag LOCUS_05910 gene glnK 91217 91555 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_05910 91610 92881 gene locus_tag LOCUS_05920 91610 92881 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_05920 93827 93039 gene locus_tag LOCUS_05930 93827 93039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 94637 93891 gene locus_tag LOCUS_05940 94637 93891 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_05940 95502 94735 gene locus_tag LOCUS_05950 95502 94735 CDS product fructose 2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_05950 96624 95557 gene locus_tag LOCUS_05960 96624 95557 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_05960 97433 96621 gene locus_tag LOCUS_05970 97433 96621 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 protein_id gnl|my_center|LOCUS_05970 98753 97545 gene locus_tag LOCUS_05980 98753 97545 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701009.1 protein_id gnl|my_center|LOCUS_05980 98951 99859 gene locus_tag LOCUS_05990 98951 99859 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402775.1 protein_id gnl|my_center|LOCUS_05990 99910 100587 gene locus_tag LOCUS_06000 99910 100587 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423213.1 protein_id gnl|my_center|LOCUS_06000 101907 101053 gene locus_tag LOCUS_06010 gene speE 101907 101053 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_06010 102399 104300 gene locus_tag LOCUS_06020 gene speA 102399 104300 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIP8 protein_id gnl|my_center|LOCUS_06020 104432 104779 gene locus_tag LOCUS_06030 gene hcaC 104432 104779 CDS product 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSZ2 protein_id gnl|my_center|LOCUS_06030 104855 105388 gene locus_tag LOCUS_06040 104855 105388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 106758 105790 gene locus_tag LOCUS_06050 gene xerC 106758 105790 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51566 protein_id gnl|my_center|LOCUS_06050 107876 107163 gene locus_tag LOCUS_06060 107876 107163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_06060 108758 107901 gene locus_tag LOCUS_06070 gene dapF 108758 107901 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTD4 protein_id gnl|my_center|LOCUS_06070 108927 109343 gene locus_tag LOCUS_06080 108927 109343 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_06080 110296 109367 gene locus_tag LOCUS_06090 110296 109367 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 protein_id gnl|my_center|LOCUS_06090 110524 111441 gene locus_tag LOCUS_06100 110524 111441 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 protein_id gnl|my_center|LOCUS_06100 111611 112570 gene locus_tag LOCUS_06110 111611 112570 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 protein_id gnl|my_center|LOCUS_06110 112628 113032 gene locus_tag LOCUS_06120 112628 113032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 113087 113653 gene locus_tag LOCUS_06130 113087 113653 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969974.1 protein_id gnl|my_center|LOCUS_06130 113738 114913 gene locus_tag LOCUS_06140 113738 114913 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088460.1 protein_id gnl|my_center|LOCUS_06140 114946 115464 gene locus_tag LOCUS_06150 114946 115464 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_06150 117046 115682 gene locus_tag LOCUS_06160 117046 115682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071880.1 protein_id gnl|my_center|LOCUS_06160 117989 117408 gene locus_tag LOCUS_06170 117989 117408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 118228 119007 gene locus_tag LOCUS_06180 118228 119007 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_06180 120010 119141 gene locus_tag LOCUS_06190 120010 119141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 120097 121008 gene locus_tag LOCUS_06200 120097 121008 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205322.1 protein_id gnl|my_center|LOCUS_06200 122444 121131 gene locus_tag LOCUS_06210 122444 121131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 122963 122640 gene locus_tag LOCUS_06220 122963 122640 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_06220 124455 123244 gene locus_tag LOCUS_06230 gene lipL 124455 123244 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_06230 124705 125109 gene locus_tag LOCUS_06240 124705 125109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 126511 125270 gene locus_tag LOCUS_06250 gene lysA 126511 125270 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_06250 126767 126576 gene locus_tag LOCUS_06260 126767 126576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 128152 126764 gene locus_tag LOCUS_06270 gene argH 128152 126764 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_06270 128328 129386 gene locus_tag LOCUS_06280 128328 129386 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_06280 129417 130169 gene locus_tag LOCUS_06290 129417 130169 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_06290 130534 130845 gene locus_tag LOCUS_06300 130534 130845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 protein_id gnl|my_center|LOCUS_06300 131853 131023 gene locus_tag LOCUS_06310 131853 131023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_06310 132220 133149 gene locus_tag LOCUS_06320 gene hemC 132220 133149 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPS4 protein_id gnl|my_center|LOCUS_06320 133155 133868 gene locus_tag LOCUS_06330 gene hemD 133155 133868 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_06330 134016 135011 gene locus_tag LOCUS_06340 134016 135011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 135008 136303 gene locus_tag LOCUS_06350 135008 136303 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_06350 136415 137617 gene locus_tag LOCUS_06360 136415 137617 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763607.1 protein_id gnl|my_center|LOCUS_06360 137943 138239 gene locus_tag LOCUS_06370 137943 138239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 138347 139354 gene locus_tag LOCUS_06380 gene srkA 138347 139354 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM98 protein_id gnl|my_center|LOCUS_06380 139747 140367 gene locus_tag LOCUS_06390 139747 140367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 141550 140498 gene locus_tag LOCUS_06400 141550 140498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 142249 141554 gene locus_tag LOCUS_06410 142249 141554 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_06410 142454 142963 gene locus_tag LOCUS_06420 gene rppH 142454 142963 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRK9 protein_id gnl|my_center|LOCUS_06420 142956 145229 gene locus_tag LOCUS_06430 gene ptsP 142956 145229 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_06430 146148 145567 gene locus_tag LOCUS_06440 146148 145567 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089436.1 protein_id gnl|my_center|LOCUS_06440 146969 146286 gene locus_tag LOCUS_06450 146969 146286 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_06450 148145 147186 gene locus_tag LOCUS_06460 gene hemB 148145 147186 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_06460 148513 150648 gene locus_tag LOCUS_06470 148513 150648 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_06470 151311 150712 gene locus_tag LOCUS_06480 151311 150712 CDS product putative pseudouridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JV8 protein_id gnl|my_center|LOCUS_06480 152164 151409 gene locus_tag LOCUS_06490 152164 151409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_06490 152238 153119 gene locus_tag LOCUS_06500 152238 153119 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_06500 153124 153915 gene locus_tag LOCUS_06510 gene lgt 153124 153915 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87077 protein_id gnl|my_center|LOCUS_06510 153912 154745 gene locus_tag LOCUS_06520 gene thyA 153912 154745 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_06520 154836 155348 gene locus_tag LOCUS_06530 gene folA 154836 155348 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBI9 protein_id gnl|my_center|LOCUS_06530 155922 155485 gene locus_tag LOCUS_06540 155922 155485 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 protein_id gnl|my_center|LOCUS_06540 156736 156008 gene locus_tag LOCUS_06550 156736 156008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 157300 156770 gene locus_tag LOCUS_06560 157300 156770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381502.1 protein_id gnl|my_center|LOCUS_06560 158762 157494 gene locus_tag LOCUS_06570 158762 157494 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_06570 159452 158772 gene locus_tag LOCUS_06580 159452 158772 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_06580 159615 161444 gene locus_tag LOCUS_06590 159615 161444 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_06590 161467 162423 gene locus_tag LOCUS_06600 gene qmcA 161467 162423 CDS product protein QmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA53 protein_id gnl|my_center|LOCUS_06600 162423 162881 gene locus_tag LOCUS_06610 162423 162881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 protein_id gnl|my_center|LOCUS_06610 162893 165766 gene locus_tag LOCUS_06620 gene glnE 162893 165766 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_06620 165861 166784 gene locus_tag LOCUS_06630 gene ilvE 165861 166784 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_06630 166795 167853 gene locus_tag LOCUS_06640 gene rfaF 166795 167853 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_06640 167982 168674 gene locus_tag LOCUS_06650 167982 168674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 168812 169834 gene locus_tag LOCUS_06660 168812 169834 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_06660 169831 170940 gene locus_tag LOCUS_06670 169831 170940 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266461.1 protein_id gnl|my_center|LOCUS_06670 170937 171839 gene locus_tag LOCUS_06680 gene rfaP 170937 171839 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF7 protein_id gnl|my_center|LOCUS_06680 171836 172759 gene locus_tag LOCUS_06690 171836 172759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 172756 174096 gene locus_tag LOCUS_06700 172756 174096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 174205 175662 gene locus_tag LOCUS_06710 174205 175662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 176712 175783 gene locus_tag LOCUS_06720 gene lpxL 176712 175783 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_06720 176966 178393 gene locus_tag LOCUS_06730 gene hldE 176966 178393 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF4 protein_id gnl|my_center|LOCUS_06730 179369 178578 gene locus_tag LOCUS_06740 179369 178578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_06740 180579 179362 gene locus_tag LOCUS_06750 180579 179362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_06750 180894 182228 gene locus_tag LOCUS_06760 gene waaA 180894 182228 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_06760 183607 182180 gene locus_tag LOCUS_06770 183607 182180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_06770 183960 185846 gene locus_tag LOCUS_06780 gene thiC 183960 185846 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ08 protein_id gnl|my_center|LOCUS_06780 185876 186511 gene locus_tag LOCUS_06790 185876 186511 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707476.1 protein_id gnl|my_center|LOCUS_06790 186530 186985 gene locus_tag LOCUS_06800 186530 186985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_06800 187120 187929 gene locus_tag LOCUS_06810 gene cpdA 187120 187929 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_06810 187989 188579 gene locus_tag LOCUS_06820 187989 188579 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105725.1 protein_id gnl|my_center|LOCUS_06820 188650 190536 gene locus_tag LOCUS_06830 gene parE 188650 190536 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPK3 protein_id gnl|my_center|LOCUS_06830 190610 192850 gene locus_tag LOCUS_06840 gene parC 190610 192850 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_06840 194510 193050 gene locus_tag LOCUS_06850 194510 193050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 195328 194507 gene locus_tag LOCUS_06860 195328 194507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_06860 196854 195493 gene locus_tag LOCUS_06870 196854 195493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 197041 197967 gene locus_tag LOCUS_06880 197041 197967 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_06880 199010 198078 gene locus_tag LOCUS_06890 gene poxA 199010 198078 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_06890 199585 199016 gene locus_tag LOCUS_06900 gene efp 199585 199016 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2B3 protein_id gnl|my_center|LOCUS_06900 199608 200630 gene locus_tag LOCUS_06910 199608 200630 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_06910 200778 202673 gene locus_tag LOCUS_06920 200778 202673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105244.1 protein_id gnl|my_center|LOCUS_06920 202887 204956 gene locus_tag LOCUS_06930 gene fimX 202887 204956 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_06930 206188 204935 gene locus_tag LOCUS_06940 206188 204935 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105245.1 protein_id gnl|my_center|LOCUS_06940 206398 207630 gene locus_tag LOCUS_06950 206398 207630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 208636 207761 gene locus_tag LOCUS_06960 208636 207761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 209599 208775 gene locus_tag LOCUS_06970 209599 208775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 210742 209711 gene locus_tag LOCUS_06980 gene rsgA 210742 209711 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_06980 210986 211843 gene locus_tag LOCUS_06990 210986 211843 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_06990 211967 212512 gene locus_tag LOCUS_07000 gene orn 211967 212512 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_07000 212599 213453 gene locus_tag LOCUS_07010 212599 213453 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261857.1 protein_id gnl|my_center|LOCUS_07010 213540 213935 gene locus_tag LOCUS_07020 213540 213935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 protein_id gnl|my_center|LOCUS_07020 215648 214056 gene locus_tag LOCUS_07030 gene ybiT 215648 214056 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346507.1 protein_id gnl|my_center|LOCUS_07030 216435 215749 gene locus_tag LOCUS_07040 216435 215749 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 protein_id gnl|my_center|LOCUS_07040 216622 217701 gene locus_tag LOCUS_07050 216622 217701 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 protein_id gnl|my_center|LOCUS_07050 217714 218814 gene locus_tag LOCUS_07060 217714 218814 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 protein_id gnl|my_center|LOCUS_07060 220025 218961 gene locus_tag LOCUS_07070 gene queG 220025 218961 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_07070 220235 221776 gene locus_tag LOCUS_07080 gene nnr 220235 221776 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_07080 221850 222293 gene locus_tag LOCUS_07090 221850 222293 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_07090 222345 223736 gene locus_tag LOCUS_07100 gene amiB 222345 223736 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_07100 223764 225644 gene locus_tag LOCUS_07110 gene mutL 223764 225644 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_07110 225713 226111 gene locus_tag LOCUS_07120 225713 226111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 226251 227240 gene locus_tag LOCUS_07130 gene miaA 226251 227240 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_07130 227377 227655 gene locus_tag LOCUS_07140 227377 227655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 227818 229185 gene locus_tag LOCUS_07150 gene hflX 227818 229185 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ08 protein_id gnl|my_center|LOCUS_07150 229210 230334 gene locus_tag LOCUS_07160 229210 230334 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_07160 230334 231227 gene locus_tag LOCUS_07170 gene hflC 230334 231227 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_07170 231340 231534 gene locus_tag LOCUS_07180 231340 231534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 231540 232718 gene locus_tag LOCUS_07190 gene hisZ 231540 232718 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_07190 232741 234033 gene locus_tag LOCUS_07200 gene purA 232741 234033 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_07200 234554 234111 gene locus_tag LOCUS_07210 gene trx 234554 234111 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_07210 234870 234667 gene locus_tag LOCUS_07220 234870 234667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 235051 234965 gene locus_tag LOCUS_t00140 235051 234965 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 235385 237907 gene locus_tag LOCUS_07230 gene rnr 235385 237907 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_07230 237918 238676 gene locus_tag LOCUS_07240 gene rlmB 237918 238676 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_07240 239234 238680 gene locus_tag LOCUS_07250 239234 238680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 240087 239326 gene locus_tag LOCUS_07260 240087 239326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 240417 240761 gene locus_tag LOCUS_07270 gene rpsF 240417 240761 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFV4 protein_id gnl|my_center|LOCUS_07270 241096 241326 gene locus_tag LOCUS_07280 gene rpsR 241096 241326 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV1 protein_id gnl|my_center|LOCUS_07280 241350 241802 gene locus_tag LOCUS_07290 gene rplI 241350 241802 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIT1 protein_id gnl|my_center|LOCUS_07290 241943 243334 gene locus_tag LOCUS_07300 gene dnaB 241943 243334 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_07300 243344 244462 gene locus_tag LOCUS_07310 gene alr 243344 244462 CDS product alanine racemase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN4 protein_id gnl|my_center|LOCUS_07310 244449 245816 gene locus_tag LOCUS_07320 gene radA 244449 245816 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_07320 246089 245841 gene locus_tag LOCUS_07330 246089 245841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 246691 246083 gene locus_tag LOCUS_07340 246691 246083 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_07340 247077 246715 gene locus_tag LOCUS_07350 247077 246715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 248779 247112 gene locus_tag LOCUS_07360 248779 247112 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_07360 249684 248917 gene locus_tag LOCUS_07370 249684 248917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 249810 251066 gene locus_tag LOCUS_07380 gene glyA 249810 251066 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_07380 251132 251611 gene locus_tag LOCUS_07390 gene nrdR 251132 251611 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_07390 251781 252917 gene locus_tag LOCUS_07400 gene ribD 251781 252917 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNS4 protein_id gnl|my_center|LOCUS_07400 253098 253763 gene locus_tag LOCUS_07410 253098 253763 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 protein_id gnl|my_center|LOCUS_07410 253910 255016 gene locus_tag LOCUS_07420 gene ribB 253910 255016 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_07420 255072 255491 gene locus_tag LOCUS_07430 255072 255491 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_07430 255610 256080 gene locus_tag LOCUS_07440 gene ribH 255610 256080 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_07440 256080 256544 gene locus_tag LOCUS_07450 gene nusB 256080 256544 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_07450 256626 257585 gene locus_tag LOCUS_07460 gene thiL 256626 257585 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_07460 257646 258140 gene locus_tag LOCUS_07470 gene pgpA 257646 258140 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_07470 258409 259641 gene locus_tag LOCUS_07480 gene cph2 258409 259641 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 protein_id gnl|my_center|LOCUS_07480 261643 259703 gene locus_tag LOCUS_07490 gene dxs 261643 259703 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYU8 protein_id gnl|my_center|LOCUS_07490 262623 261727 gene locus_tag LOCUS_07500 gene ispA 262623 261727 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261435.1 protein_id gnl|my_center|LOCUS_07500 262861 262613 gene locus_tag LOCUS_07510 gene xseB 262861 262613 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL1 protein_id gnl|my_center|LOCUS_07510 263088 265007 gene locus_tag LOCUS_07520 263088 265007 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 protein_id gnl|my_center|LOCUS_07520 265575 266555 gene locus_tag LOCUS_07530 gene dusC 265575 266555 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_07530 267607 266558 gene locus_tag LOCUS_07540 267607 266558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_07540 268301 267897 gene locus_tag LOCUS_07550 gene ectC 268301 267897 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 protein_id gnl|my_center|LOCUS_07550 269798 268461 gene locus_tag LOCUS_07560 gene ectB 269798 268461 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_07560 270484 269888 gene locus_tag LOCUS_07570 gene ectA 270484 269888 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC1 protein_id gnl|my_center|LOCUS_07570 271019 270441 gene locus_tag LOCUS_07580 271019 270441 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_07580 271270 272694 gene locus_tag LOCUS_07590 gene opuE 271270 272694 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_07590 272691 273650 gene locus_tag LOCUS_07600 272691 273650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_07600 273892 274851 gene locus_tag LOCUS_07610 gene folE2 273892 274851 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_07610 275467 274934 gene locus_tag LOCUS_07620 275467 274934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 276406 275567 gene locus_tag LOCUS_07630 gene znuB 276406 275567 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_07630 277361 276399 gene locus_tag LOCUS_07640 gene znuA 277361 276399 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_07640 278701 277373 gene locus_tag LOCUS_07650 278701 277373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67918 protein_id gnl|my_center|LOCUS_07650 279161 278757 gene locus_tag LOCUS_07660 279161 278757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 279722 280540 gene locus_tag LOCUS_07670 279722 280540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347357.1 protein_id gnl|my_center|LOCUS_07670 282301 280703 gene locus_tag LOCUS_07680 282301 280703 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_07680 282627 283058 gene locus_tag LOCUS_07690 282627 283058 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_07690 283139 283786 gene locus_tag LOCUS_07700 283139 283786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 285276 283879 gene locus_tag LOCUS_07710 gene cysS 285276 283879 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 protein_id gnl|my_center|LOCUS_07710 285734 285300 gene locus_tag LOCUS_07720 gene hisI 285734 285300 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_07720 287848 285932 gene locus_tag LOCUS_07730 gene thrS 287848 285932 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_07730 288130 290325 gene locus_tag LOCUS_07740 288130 290325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 290297 291166 gene locus_tag LOCUS_07750 290297 291166 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_07750 292467 291244 gene locus_tag LOCUS_07760 292467 291244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 292846 294132 gene locus_tag LOCUS_07770 292846 294132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948429.1 protein_id gnl|my_center|LOCUS_07770 295207 294194 gene locus_tag LOCUS_07780 295207 294194 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948430.1 protein_id gnl|my_center|LOCUS_07780 296427 295204 gene locus_tag LOCUS_07790 296427 295204 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948432.1 protein_id gnl|my_center|LOCUS_07790 296918 296604 gene locus_tag LOCUS_07800 gene amrZ 296918 296604 CDS product alginate and motility regulator Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091802.1 protein_id gnl|my_center|LOCUS_07800 297238 298209 gene locus_tag LOCUS_07810 gene nahR 297238 298209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_07810 299163 298240 gene locus_tag LOCUS_07820 gene queD 299163 298240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_07820 299195 300532 gene locus_tag LOCUS_07830 299195 300532 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_07830 300648 300986 gene locus_tag LOCUS_07840 300648 300986 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_07840 301080 302711 gene locus_tag LOCUS_07850 301080 302711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 302784 303296 gene locus_tag LOCUS_07860 302784 303296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 303296 305359 gene locus_tag LOCUS_07870 303296 305359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 306401 305397 gene locus_tag LOCUS_07880 306401 305397 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_07880 308002 306407 gene locus_tag LOCUS_07890 308002 306407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 310531 308012 gene locus_tag LOCUS_07900 310531 308012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 311733 310543 gene locus_tag LOCUS_07910 311733 310543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 312144 314897 gene locus_tag LOCUS_07920 312144 314897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 315144 314965 gene locus_tag LOCUS_07930 315144 314965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 315173 315892 gene locus_tag LOCUS_07940 315173 315892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 315913 316581 gene locus_tag LOCUS_07950 315913 316581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 316595 317089 gene locus_tag LOCUS_07960 316595 317089 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_07960 317086 317313 gene locus_tag LOCUS_07970 317086 317313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 317304 318473 gene locus_tag LOCUS_07980 317304 318473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 319582 318494 gene locus_tag LOCUS_07990 319582 318494 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_07990 319770 319582 gene locus_tag LOCUS_08000 319770 319582 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDM0 protein_id gnl|my_center|LOCUS_08000 319755 319937 gene locus_tag LOCUS_08010 319755 319937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 319975 321771 gene locus_tag LOCUS_08020 gene acdB 319975 321771 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_08020 321977 323755 gene locus_tag LOCUS_08030 321977 323755 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_08030 324512 323880 gene locus_tag LOCUS_08040 324512 323880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 325230 324580 gene locus_tag LOCUS_08050 gene nalC 325230 324580 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113837.1 protein_id gnl|my_center|LOCUS_08050 325565 326524 gene locus_tag LOCUS_08060 325565 326524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_08060 328140 326647 gene locus_tag LOCUS_08070 gene hapE 328140 326647 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_08070 328371 329369 gene locus_tag LOCUS_08080 328371 329369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 329556 329837 gene locus_tag LOCUS_08090 329556 329837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 330005 331327 gene locus_tag LOCUS_08100 330005 331327 CDS product heavy metal RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 protein_id gnl|my_center|LOCUS_08100 331324 332673 gene locus_tag LOCUS_08110 331324 332673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 332670 335795 gene locus_tag LOCUS_08120 332670 335795 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 protein_id gnl|my_center|LOCUS_08120 336123 340436 gene locus_tag LOCUS_08130 336123 340436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 340503 341447 gene locus_tag LOCUS_08140 340503 341447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 341839 341450 gene locus_tag LOCUS_08150 341839 341450 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525346.1 protein_id gnl|my_center|LOCUS_08150 342071 344503 gene locus_tag LOCUS_08160 342071 344503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 344798 345853 gene locus_tag LOCUS_08170 344798 345853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_08170 347020 345995 gene locus_tag LOCUS_08180 347020 345995 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391138.1 protein_id gnl|my_center|LOCUS_08180 347198 347122 gene locus_tag LOCUS_t00150 347198 347122 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 349308 347305 gene locus_tag LOCUS_08190 gene rpoD 349308 347305 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_08190 351392 349368 gene locus_tag LOCUS_08200 gene dnaG 351392 349368 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_08200 352127 351681 gene locus_tag LOCUS_08210 352127 351681 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_08210 352363 352148 gene locus_tag LOCUS_08220 gene rpsU 352363 352148 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V8 protein_id gnl|my_center|LOCUS_08220 352542 353615 gene locus_tag LOCUS_08230 gene tsaD 352542 353615 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_08230 354095 353649 gene locus_tag LOCUS_08240 354095 353649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 355738 354233 gene locus_tag LOCUS_08250 355738 354233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 356196 355708 gene locus_tag LOCUS_08260 356196 355708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 357183 356284 gene locus_tag LOCUS_08270 357183 356284 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_08270 357803 357180 gene locus_tag LOCUS_08280 357803 357180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 358039 358395 gene locus_tag LOCUS_08290 gene folB 358039 358395 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_08290 358392 358892 gene locus_tag LOCUS_08300 358392 358892 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_08300 359887 358889 gene locus_tag LOCUS_08310 359887 358889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 360294 359866 gene locus_tag LOCUS_08320 360294 359866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 361129 360371 gene locus_tag LOCUS_08330 gene ptr1 361129 360371 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_08330 362346 361102 gene locus_tag LOCUS_08340 gene cca 362346 361102 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF8 protein_id gnl|my_center|LOCUS_08340 362631 363521 gene locus_tag LOCUS_08350 gene pagO 362631 363521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_08350 363769 364746 gene locus_tag LOCUS_08360 363769 364746 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_08360 366005 364923 gene locus_tag LOCUS_08370 366005 364923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 366600 366121 gene locus_tag LOCUS_08380 366600 366121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 369884 366753 gene locus_tag LOCUS_08390 369884 366753 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_08390 371017 369881 gene locus_tag LOCUS_08400 371017 369881 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_08400 372097 371261 gene locus_tag LOCUS_08410 gene apaH 372097 371261 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_08410 372501 372109 gene locus_tag LOCUS_08420 gene apaG 372501 372109 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 protein_id gnl|my_center|LOCUS_08420 373307 372498 gene locus_tag LOCUS_08430 gene rsmA 373307 372498 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_08430 374412 373315 gene locus_tag LOCUS_08440 gene pdxA 374412 373315 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A45 protein_id gnl|my_center|LOCUS_08440 375700 374393 gene locus_tag LOCUS_08450 gene surA 375700 374393 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_08450 377861 375693 gene locus_tag LOCUS_08460 gene lptD 377861 375693 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 protein_id gnl|my_center|LOCUS_08460 378013 378999 gene locus_tag LOCUS_08470 378013 378999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_08470 379111 379845 gene locus_tag LOCUS_08480 379111 379845 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_08480 379900 380574 gene locus_tag LOCUS_08490 gene rpe 379900 380574 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN25 protein_id gnl|my_center|LOCUS_08490 381083 380661 gene locus_tag LOCUS_08500 381083 380661 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968030.1 protein_id gnl|my_center|LOCUS_08500 381372 382481 gene locus_tag LOCUS_08510 381372 382481 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266766.1 protein_id gnl|my_center|LOCUS_08510 384822 382756 gene locus_tag LOCUS_08520 384822 382756 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921329.1 protein_id gnl|my_center|LOCUS_08520 385265 386752 gene locus_tag LOCUS_08530 gene trpE 385265 386752 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20580 protein_id gnl|my_center|LOCUS_08530 386749 387357 gene locus_tag LOCUS_08540 gene trpG 386749 387357 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_08540 387357 388433 gene locus_tag LOCUS_08550 gene trpD 387357 388433 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_08550 388430 389236 gene locus_tag LOCUS_08560 gene trpC 388430 389236 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_08560 389971 389339 gene locus_tag LOCUS_08570 gene vfr 389971 389339 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_08570 390159 390584 gene locus_tag LOCUS_08580 390159 390584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_08580 390581 391009 gene locus_tag LOCUS_08590 390581 391009 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_08590 391021 391824 gene locus_tag LOCUS_08600 gene speD 391021 391824 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_08600 392600 391986 gene locus_tag LOCUS_08610 gene coq7 392600 391986 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_08610 392734 394209 gene locus_tag LOCUS_08620 392734 394209 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_08620 397033 394256 gene locus_tag LOCUS_08630 gene retS 397033 394256 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112323.1 protein_id gnl|my_center|LOCUS_08630 398192 397113 gene locus_tag LOCUS_08640 398192 397113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 398176 398358 gene locus_tag LOCUS_08650 398176 398358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 399738 398452 gene locus_tag LOCUS_08660 gene purD 399738 398452 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_08660 401491 399923 gene locus_tag LOCUS_08670 gene purH 401491 399923 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_08670 401883 401572 gene locus_tag LOCUS_08680 401883 401572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 402935 401880 gene locus_tag LOCUS_08690 gene dusB 402935 401880 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 protein_id gnl|my_center|LOCUS_08690 402934 403197 gene locus_tag LOCUS_08700 402934 403197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 404481 403117 gene locus_tag LOCUS_08710 404481 403117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_08710 405604 404726 gene locus_tag LOCUS_08720 gene prmA 405604 404726 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN40 protein_id gnl|my_center|LOCUS_08720 407025 405673 gene locus_tag LOCUS_08730 gene accC 407025 405673 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_08730 407492 407037 gene locus_tag LOCUS_08740 407492 407037 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_08740 407943 407500 gene locus_tag LOCUS_08750 gene aroQ1 407943 407500 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_08750 410133 408190 gene locus_tag LOCUS_08760 gene dsbD 410133 408190 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS7 protein_id gnl|my_center|LOCUS_08760 410404 411396 gene locus_tag LOCUS_08770 410404 411396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_08770 411455 412072 gene locus_tag LOCUS_08780 411455 412072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 412423 413382 gene locus_tag LOCUS_08790 gene qor 412423 413382 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229250.1 protein_id gnl|my_center|LOCUS_08790 414041 413508 gene locus_tag LOCUS_08800 gene ppa 414041 413508 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_08800 414788 414213 gene locus_tag LOCUS_08810 414788 414213 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_08810 415254 414847 gene locus_tag LOCUS_08820 415254 414847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 416740 415478 gene locus_tag LOCUS_08830 gene pfp 416740 415478 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_08830 417293 417616 gene locus_tag LOCUS_08840 417293 417616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 418353 418865 gene locus_tag LOCUS_08850 418353 418865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 418890 419315 gene locus_tag LOCUS_08860 418890 419315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 419445 421754 gene locus_tag LOCUS_08870 419445 421754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477318.1 protein_id gnl|my_center|LOCUS_08870 422082 422459 gene locus_tag LOCUS_08880 422082 422459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 422726 423286 gene locus_tag LOCUS_08890 422726 423286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 423375 423935 gene locus_tag LOCUS_08900 423375 423935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 424892 424293 gene locus_tag LOCUS_08910 424892 424293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 424961 425359 gene locus_tag LOCUS_08920 424961 425359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 425453 425875 gene locus_tag LOCUS_08930 425453 425875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_08930 426008 426577 gene locus_tag LOCUS_08940 426008 426577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700774.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence03 914 477 gene locus_tag LOCUS_08950 914 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1413 979 gene locus_tag LOCUS_08960 1413 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2371 1982 gene locus_tag LOCUS_08970 2371 1982 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_08970 2860 2522 gene locus_tag LOCUS_08980 gene glnK 2860 2522 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_08980 3983 3099 gene locus_tag LOCUS_08990 gene trx-1 3983 3099 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379146.1 protein_id gnl|my_center|LOCUS_08990 6323 4203 gene locus_tag LOCUS_09000 6323 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7540 6515 gene locus_tag LOCUS_09010 gene oruR 7540 6515 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 protein_id gnl|my_center|LOCUS_09010 7691 8122 gene locus_tag LOCUS_09020 7691 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8283 10880 gene locus_tag LOCUS_09030 8283 10880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_09030 11702 11046 gene locus_tag LOCUS_09040 11702 11046 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339137.1 protein_id gnl|my_center|LOCUS_09040 12703 11786 gene locus_tag LOCUS_09050 gene fieF 12703 11786 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHZ2 protein_id gnl|my_center|LOCUS_09050 13498 12710 gene locus_tag LOCUS_09060 13498 12710 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 protein_id gnl|my_center|LOCUS_09060 14591 13674 gene locus_tag LOCUS_09070 14591 13674 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_09070 15259 14588 gene locus_tag LOCUS_09080 gene pcm 15259 14588 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_09080 16068 15298 gene locus_tag LOCUS_09090 gene surE 16068 15298 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ0 protein_id gnl|my_center|LOCUS_09090 17153 16065 gene locus_tag LOCUS_09100 gene truD 17153 16065 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_09100 17640 17146 gene locus_tag LOCUS_09110 gene ispF 17640 17146 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Z0 protein_id gnl|my_center|LOCUS_09110 18353 17625 gene locus_tag LOCUS_09120 gene ispD 18353 17625 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05029 protein_id gnl|my_center|LOCUS_09120 18669 18337 gene locus_tag LOCUS_09130 18669 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 19968 18676 gene locus_tag LOCUS_09140 gene eno 19968 18676 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_09140 20891 20031 gene locus_tag LOCUS_09150 gene kdsA 20891 20031 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 protein_id gnl|my_center|LOCUS_09150 22518 20884 gene locus_tag LOCUS_09160 gene pyrG 22518 20884 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_09160 23998 22634 gene locus_tag LOCUS_09170 gene tilS 23998 22634 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHJ7 protein_id gnl|my_center|LOCUS_09170 25263 24187 gene locus_tag LOCUS_09180 gene accA 25263 24187 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR2 protein_id gnl|my_center|LOCUS_09180 28828 25304 gene locus_tag LOCUS_09190 gene dnaE 28828 25304 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_09190 29592 28930 gene locus_tag LOCUS_09200 gene rnhB 29592 28930 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8X6 protein_id gnl|my_center|LOCUS_09200 30769 29627 gene locus_tag LOCUS_09210 gene lpxB 30769 29627 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_09210 31542 30766 gene locus_tag LOCUS_09220 gene lpxA 31542 30766 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_09220 32027 31587 gene locus_tag LOCUS_09230 gene fabZ 32027 31587 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_09230 33160 32138 gene locus_tag LOCUS_09240 gene lpxD 33160 32138 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH3 protein_id gnl|my_center|LOCUS_09240 33688 33188 gene locus_tag LOCUS_09250 33688 33188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 36051 33697 gene locus_tag LOCUS_09260 gene opr86 36051 33697 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_09260 37466 36138 gene locus_tag LOCUS_09270 gene rseP 37466 36138 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E6 protein_id gnl|my_center|LOCUS_09270 38665 37469 gene locus_tag LOCUS_09280 gene dxr 38665 37469 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS2 protein_id gnl|my_center|LOCUS_09280 39501 38665 gene locus_tag LOCUS_09290 gene cdsA 39501 38665 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG8 protein_id gnl|my_center|LOCUS_09290 40316 39495 gene locus_tag LOCUS_09300 gene uppS 40316 39495 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAV7 protein_id gnl|my_center|LOCUS_09300 41007 40450 gene locus_tag LOCUS_09310 gene frr 41007 40450 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG6 protein_id gnl|my_center|LOCUS_09310 41767 41033 gene locus_tag LOCUS_09320 gene pyrH 41767 41033 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_09320 42856 41975 gene locus_tag LOCUS_09330 gene tsf 42856 41975 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_09330 43748 42978 gene locus_tag LOCUS_09340 gene rpsB 43748 42978 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_09340 44039 44815 gene locus_tag LOCUS_09350 gene map 44039 44815 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_09350 44824 47490 gene locus_tag LOCUS_09360 gene glnD 44824 47490 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT0 protein_id gnl|my_center|LOCUS_09360 47587 48768 gene locus_tag LOCUS_09370 47587 48768 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_09370 48778 49128 gene locus_tag LOCUS_09380 48778 49128 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098619.1 protein_id gnl|my_center|LOCUS_09380 49247 50281 gene locus_tag LOCUS_09390 gene dapD 49247 50281 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P9 protein_id gnl|my_center|LOCUS_09390 50329 51462 gene locus_tag LOCUS_09400 gene dapE 50329 51462 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_09400 51629 53227 gene locus_tag LOCUS_09410 51629 53227 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 protein_id gnl|my_center|LOCUS_09410 54005 53298 gene locus_tag LOCUS_09420 54005 53298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 54829 54071 gene locus_tag LOCUS_09430 54829 54071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 57908 54888 gene locus_tag LOCUS_09440 57908 54888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268876.1 protein_id gnl|my_center|LOCUS_09440 58151 58750 gene locus_tag LOCUS_09450 58151 58750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 58879 59355 gene locus_tag LOCUS_09460 58879 59355 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 protein_id gnl|my_center|LOCUS_09460 59362 59901 gene locus_tag LOCUS_09470 59362 59901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482675.1 protein_id gnl|my_center|LOCUS_09470 60084 61187 gene locus_tag LOCUS_09480 60084 61187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_09480 61184 62290 gene locus_tag LOCUS_09490 61184 62290 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_09490 63208 62498 gene locus_tag LOCUS_09500 63208 62498 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_09500 63517 63218 gene locus_tag LOCUS_09510 63517 63218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268691.1 protein_id gnl|my_center|LOCUS_09510 64513 64331 gene locus_tag LOCUS_09520 64513 64331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 64970 66973 gene locus_tag LOCUS_09530 64970 66973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09530 69100 66947 gene locus_tag LOCUS_09540 69100 66947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 69194 71236 gene locus_tag LOCUS_09550 gene metG 69194 71236 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN0 protein_id gnl|my_center|LOCUS_09550 71239 72294 gene locus_tag LOCUS_09560 71239 72294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_09560 72552 72337 gene locus_tag LOCUS_09570 72552 72337 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 protein_id gnl|my_center|LOCUS_09570 73435 72539 gene locus_tag LOCUS_09580 73435 72539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_09580 73612 74472 gene locus_tag LOCUS_09590 73612 74472 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 protein_id gnl|my_center|LOCUS_09590 75156 74518 gene locus_tag LOCUS_09600 75156 74518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 75270 75569 gene locus_tag LOCUS_09610 gene yhbQ 75270 75569 CDS product UPF0213 protein YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKM4 protein_id gnl|my_center|LOCUS_09610 76268 75660 gene locus_tag LOCUS_09620 76268 75660 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_09620 76964 76434 gene locus_tag LOCUS_09630 76964 76434 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_09630 77200 78663 gene locus_tag LOCUS_09640 77200 78663 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224852.1 protein_id gnl|my_center|LOCUS_09640 79223 78855 gene locus_tag LOCUS_09650 79223 78855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 protein_id gnl|my_center|LOCUS_09650 80390 79263 gene locus_tag LOCUS_09660 80390 79263 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_09660 80639 82519 gene locus_tag LOCUS_09670 80639 82519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_09670 82693 83277 gene locus_tag LOCUS_09680 82693 83277 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC0 protein_id gnl|my_center|LOCUS_09680 83274 83873 gene locus_tag LOCUS_09690 gene rnfB 83274 83873 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE80 protein_id gnl|my_center|LOCUS_09690 83870 86596 gene locus_tag LOCUS_09700 83870 86596 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX2 protein_id gnl|my_center|LOCUS_09700 86655 87680 gene locus_tag LOCUS_09710 86655 87680 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_09710 87677 88327 gene locus_tag LOCUS_09720 87677 88327 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_09720 88320 89027 gene locus_tag LOCUS_09730 88320 89027 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_09730 89069 89614 gene locus_tag LOCUS_09740 89069 89614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 89659 90000 gene locus_tag LOCUS_09750 89659 90000 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523720.1 protein_id gnl|my_center|LOCUS_09750 90697 90107 gene locus_tag LOCUS_09760 90697 90107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 91578 90841 gene locus_tag LOCUS_09770 91578 90841 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_09770 91752 92393 gene locus_tag LOCUS_09780 gene nth 91752 92393 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE75 protein_id gnl|my_center|LOCUS_09780 92561 93316 gene locus_tag LOCUS_09790 92561 93316 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_09790 94536 93457 gene locus_tag LOCUS_09800 94536 93457 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_09800 95441 94533 gene locus_tag LOCUS_09810 gene rimK 95441 94533 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 protein_id gnl|my_center|LOCUS_09810 95886 95455 gene locus_tag LOCUS_09820 95886 95455 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_09820 96446 96054 gene locus_tag LOCUS_09830 gene gloA 96446 96054 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0Q1 protein_id gnl|my_center|LOCUS_09830 97806 96583 gene locus_tag LOCUS_09840 gene argG 97806 96583 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_09840 98099 98773 gene locus_tag LOCUS_09850 gene rnt 98099 98773 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK2 protein_id gnl|my_center|LOCUS_09850 100132 99530 gene locus_tag LOCUS_09860 100132 99530 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_09860 101128 100376 gene locus_tag LOCUS_09870 101128 100376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 101799 101170 gene locus_tag LOCUS_09880 101799 101170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 102944 101802 gene locus_tag LOCUS_09890 102944 101802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_09890 103455 103120 gene locus_tag LOCUS_09900 gene grxD 103455 103120 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_09900 105071 103506 gene locus_tag LOCUS_09910 gene hyuB 105071 103506 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_09910 105360 106568 gene locus_tag LOCUS_09920 gene argD 105360 106568 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_09920 106565 107479 gene locus_tag LOCUS_09930 gene argF 106565 107479 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_09930 108690 107542 gene locus_tag LOCUS_09940 108690 107542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_09940 109823 108687 gene locus_tag LOCUS_09950 109823 108687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 protein_id gnl|my_center|LOCUS_09950 111736 110249 gene locus_tag LOCUS_09960 gene glpK1 111736 110249 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_09960 114067 112409 gene locus_tag LOCUS_09970 114067 112409 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_09970 114912 114208 gene locus_tag LOCUS_09980 gene rstA 114912 114208 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_09980 115939 118830 gene locus_tag LOCUS_09990 gene nrdA 115939 118830 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_09990 118949 120277 gene locus_tag LOCUS_10000 118949 120277 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ19 protein_id gnl|my_center|LOCUS_10000 120680 120889 gene locus_tag LOCUS_10010 120680 120889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 121495 123135 gene locus_tag LOCUS_10020 121495 123135 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525042.1 protein_id gnl|my_center|LOCUS_10020 123277 124710 gene locus_tag LOCUS_10030 123277 124710 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_10030 125049 127001 gene locus_tag LOCUS_10040 gene kefB 125049 127001 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_10040 127440 127018 gene locus_tag LOCUS_10050 127440 127018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 128006 127572 gene locus_tag LOCUS_10060 128006 127572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 130553 128967 gene locus_tag LOCUS_10070 gene prfC 130553 128967 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU03 protein_id gnl|my_center|LOCUS_10070 131304 130804 gene locus_tag LOCUS_10080 gene rimI 131304 130804 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_10080 132050 131301 gene locus_tag LOCUS_10090 132050 131301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 133683 132136 gene locus_tag LOCUS_10100 gene leuA 133683 132136 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_10100 135445 133757 gene locus_tag LOCUS_10110 135445 133757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 136008 135397 gene locus_tag LOCUS_10120 136008 135397 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262238.1 protein_id gnl|my_center|LOCUS_10120 137816 136155 gene locus_tag LOCUS_10130 gene groL 137816 136155 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_10130 138146 137856 gene locus_tag LOCUS_10140 gene groS 138146 137856 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30720 protein_id gnl|my_center|LOCUS_10140 139263 138499 gene locus_tag LOCUS_10150 139263 138499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 139464 140222 gene locus_tag LOCUS_10160 gene speA 139464 140222 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_10160 140285 140605 gene locus_tag LOCUS_10170 140285 140605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 141894 140623 gene locus_tag LOCUS_10180 gene ampG 141894 140623 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_10180 142027 142983 gene locus_tag LOCUS_10190 142027 142983 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_10190 142997 143908 gene locus_tag LOCUS_10200 142997 143908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 144046 145401 gene locus_tag LOCUS_10210 144046 145401 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 protein_id gnl|my_center|LOCUS_10210 145398 146090 gene locus_tag LOCUS_10220 145398 146090 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137884.1 protein_id gnl|my_center|LOCUS_10220 146169 146504 gene locus_tag LOCUS_10230 146169 146504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 148243 146585 gene locus_tag LOCUS_10240 gene aceF 148243 146585 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59638 protein_id gnl|my_center|LOCUS_10240 151034 148359 gene locus_tag LOCUS_10250 gene aceE 151034 148359 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_10250 152182 151262 gene locus_tag LOCUS_10260 152182 151262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 152759 152208 gene locus_tag LOCUS_10270 152759 152208 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_10270 153018 154382 gene locus_tag LOCUS_10280 153018 154382 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_10280 154354 155211 gene locus_tag LOCUS_10290 gene nadC 154354 155211 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 protein_id gnl|my_center|LOCUS_10290 156052 155318 gene locus_tag LOCUS_10300 156052 155318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 157676 156141 gene locus_tag LOCUS_10310 157676 156141 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218639.1 protein_id gnl|my_center|LOCUS_10310 158326 157673 gene locus_tag LOCUS_10320 158326 157673 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215603.1 protein_id gnl|my_center|LOCUS_10320 159967 158360 gene locus_tag LOCUS_10330 159967 158360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 160709 160173 gene locus_tag LOCUS_10340 gene pilE 160709 160173 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_10340 161522 160980 gene locus_tag LOCUS_10350 gene pilE 161522 160980 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_10350 161956 163674 gene locus_tag LOCUS_10360 gene pilB 161956 163674 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_10360 163677 164909 gene locus_tag LOCUS_10370 gene pilC 163677 164909 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_10370 164918 165850 gene locus_tag LOCUS_10380 gene pilD 164918 165850 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U2 protein_id gnl|my_center|LOCUS_10380 165850 166449 gene locus_tag LOCUS_10390 gene coaE 165850 166449 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_10390 166489 166686 gene locus_tag LOCUS_10400 166489 166686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 167778 166846 gene locus_tag LOCUS_10410 167778 166846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 protein_id gnl|my_center|LOCUS_10410 169008 167806 gene locus_tag LOCUS_10420 gene argJ 169008 167806 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 protein_id gnl|my_center|LOCUS_10420 171775 169046 gene locus_tag LOCUS_10430 gene secA 171775 169046 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_10430 172907 171975 gene locus_tag LOCUS_10440 172907 171975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_10440 173083 173520 gene locus_tag LOCUS_10450 173083 173520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 174556 173642 gene locus_tag LOCUS_10460 gene lpxC 174556 173642 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_10460 175902 174730 gene locus_tag LOCUS_10470 gene ftsZ 175902 174730 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_10470 177172 175964 gene locus_tag LOCUS_10480 gene ftsA 177172 175964 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_10480 177998 177201 gene locus_tag LOCUS_10490 177998 177201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 178918 177995 gene locus_tag LOCUS_10500 gene ddlB 178918 177995 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJJ5 protein_id gnl|my_center|LOCUS_10500 180333 178915 gene locus_tag LOCUS_10510 gene murC 180333 178915 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_10510 181399 180323 gene locus_tag LOCUS_10520 gene murG 181399 180323 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_10520 182640 181396 gene locus_tag LOCUS_10530 gene ftsW 182640 181396 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY9 protein_id gnl|my_center|LOCUS_10530 183955 182630 gene locus_tag LOCUS_10540 gene murD 183955 182630 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_10540 185048 183966 gene locus_tag LOCUS_10550 gene mraY 185048 183966 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_10550 186388 185048 gene locus_tag LOCUS_10560 gene murF 186388 185048 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU1 protein_id gnl|my_center|LOCUS_10560 187869 186385 gene locus_tag LOCUS_10570 gene murE 187869 186385 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_10570 189608 187866 gene locus_tag LOCUS_10580 gene ftsI 189608 187866 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_10580 189874 189605 gene locus_tag LOCUS_10590 gene ftsL 189874 189605 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX18 protein_id gnl|my_center|LOCUS_10590 190812 189871 gene locus_tag LOCUS_10600 gene rsmH 190812 189871 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIP3 protein_id gnl|my_center|LOCUS_10600 191266 190823 gene locus_tag LOCUS_10610 gene mraZ 191266 190823 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 protein_id gnl|my_center|LOCUS_10610 191775 192710 gene locus_tag LOCUS_10620 gene rbgA 191775 192710 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE00 protein_id gnl|my_center|LOCUS_10620 194189 193341 gene locus_tag LOCUS_10630 gene rsmI 194189 193341 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY0 protein_id gnl|my_center|LOCUS_10630 194504 196384 gene locus_tag LOCUS_10640 194504 196384 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_10640 196773 197309 gene locus_tag LOCUS_10650 gene gmhA 196773 197309 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_10650 197310 197879 gene locus_tag LOCUS_10660 197310 197879 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_10660 200002 197993 gene locus_tag LOCUS_10670 200002 197993 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103757.1 protein_id gnl|my_center|LOCUS_10670 200423 200028 gene locus_tag LOCUS_10680 gene sspB 200423 200028 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707593.1 protein_id gnl|my_center|LOCUS_10680 201065 200427 gene locus_tag LOCUS_10690 gene sspA 201065 200427 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_10690 201823 201155 gene locus_tag LOCUS_10700 gene petC 201823 201155 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_10700 203112 201823 gene locus_tag LOCUS_10710 203112 201823 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_10710 203702 203109 gene locus_tag LOCUS_10720 203702 203109 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2N1 protein_id gnl|my_center|LOCUS_10720 204374 203976 gene locus_tag LOCUS_10730 gene rpsI 204374 203976 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW8 protein_id gnl|my_center|LOCUS_10730 204815 204387 gene locus_tag LOCUS_10740 gene rplM 204815 204387 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M9 protein_id gnl|my_center|LOCUS_10740 206211 205126 gene locus_tag LOCUS_10750 gene zapE 206211 205126 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_10750 206956 206297 gene locus_tag LOCUS_10760 206956 206297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112747.1 protein_id gnl|my_center|LOCUS_10760 207068 207604 gene locus_tag LOCUS_10770 207068 207604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 208923 207709 gene locus_tag LOCUS_10780 gene sat 208923 207709 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_10780 209936 209037 gene locus_tag LOCUS_10790 209936 209037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_10790 210768 210010 gene locus_tag LOCUS_10800 210768 210010 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_10800 210927 212039 gene locus_tag LOCUS_10810 210927 212039 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_10810 213234 212167 gene locus_tag LOCUS_10820 gene hisC1 213234 212167 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX0 protein_id gnl|my_center|LOCUS_10820 214577 213270 gene locus_tag LOCUS_10830 gene hisD 214577 213270 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_10830 215233 214574 gene locus_tag LOCUS_10840 gene hisG 215233 214574 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_10840 216514 215252 gene locus_tag LOCUS_10850 gene murA 216514 215252 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_10850 216779 216525 gene locus_tag LOCUS_10860 216779 216525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094334.1 protein_id gnl|my_center|LOCUS_10860 217573 216833 gene locus_tag LOCUS_10870 217573 216833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_10870 217807 218775 gene locus_tag LOCUS_10880 gene kdsD 217807 218775 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_10880 218775 219320 gene locus_tag LOCUS_10890 218775 219320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_10890 219317 219874 gene locus_tag LOCUS_10900 219317 219874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 219855 220415 gene locus_tag LOCUS_10910 219855 220415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 220420 221145 gene locus_tag LOCUS_10920 220420 221145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_10920 221362 222843 gene locus_tag LOCUS_10930 221362 222843 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNU5 protein_id gnl|my_center|LOCUS_10930 222960 223259 gene locus_tag LOCUS_10940 222960 223259 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_10940 223270 223743 gene locus_tag LOCUS_10950 gene ptsN 223270 223743 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_10950 223740 224594 gene locus_tag LOCUS_10960 223740 224594 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_10960 224610 224876 gene locus_tag LOCUS_10970 gene ptsH 224610 224876 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_10970 225014 226366 gene locus_tag LOCUS_10980 225014 226366 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_10980 227310 226489 gene locus_tag LOCUS_10990 227310 226489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706977.1 protein_id gnl|my_center|LOCUS_10990 228731 227376 gene locus_tag LOCUS_11000 gene pmbA 228731 227376 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_11000 228755 229285 gene locus_tag LOCUS_11010 228755 229285 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_11010 230834 229383 gene locus_tag LOCUS_11020 230834 229383 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178532.1 protein_id gnl|my_center|LOCUS_11020 231663 230812 gene locus_tag LOCUS_11030 231663 230812 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268866.1 protein_id gnl|my_center|LOCUS_11030 235603 231668 gene locus_tag LOCUS_11040 gene yhdP 235603 231668 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261174.1 protein_id gnl|my_center|LOCUS_11040 236246 235605 gene locus_tag LOCUS_11050 236246 235605 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_11050 236740 236246 gene locus_tag LOCUS_11060 gene mreD 236740 236246 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA13 protein_id gnl|my_center|LOCUS_11060 237594 236737 gene locus_tag LOCUS_11070 gene mreC 237594 236737 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_11070 238748 237705 gene locus_tag LOCUS_11080 gene mreB 238748 237705 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_11080 238934 239221 gene locus_tag LOCUS_11090 gene gatC 238934 239221 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_11090 239218 240684 gene locus_tag LOCUS_11100 gene gatA 239218 240684 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_11100 240684 242129 gene locus_tag LOCUS_11110 gene gatB 240684 242129 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_11110 242954 242247 gene locus_tag LOCUS_11120 242954 242247 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPE7 protein_id gnl|my_center|LOCUS_11120 243310 244113 gene locus_tag LOCUS_11130 gene cbpA 243310 244113 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_11130 244555 244205 gene locus_tag LOCUS_11140 244555 244205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 245202 244552 gene locus_tag LOCUS_11150 gene stp1 245202 244552 CDS product serine/threonine phosphoprotein phosphatase Stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087627.1 protein_id gnl|my_center|LOCUS_11150 246434 245409 gene locus_tag LOCUS_11160 246434 245409 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_11160 247519 246467 gene locus_tag LOCUS_11170 247519 246467 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_11170 247644 249140 gene locus_tag LOCUS_11180 gene pepA 247644 249140 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_11180 249140 249565 gene locus_tag LOCUS_11190 249140 249565 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552284.1 protein_id gnl|my_center|LOCUS_11190 249618 250193 gene locus_tag LOCUS_11200 249618 250193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 250294 253086 gene locus_tag LOCUS_11210 gene valS 250294 253086 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887M3 protein_id gnl|my_center|LOCUS_11210 253117 253908 gene locus_tag LOCUS_11220 253117 253908 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_11220 254690 254010 gene locus_tag LOCUS_11230 254690 254010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence04 3241 869 gene locus_tag LOCUS_11240 gene ppsA 3241 869 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 protein_id gnl|my_center|LOCUS_11240 3460 4335 gene locus_tag LOCUS_11250 3460 4335 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q9 protein_id gnl|my_center|LOCUS_11250 5179 4454 gene locus_tag LOCUS_11260 5179 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5415 5176 gene locus_tag LOCUS_11270 5415 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6297 5590 gene locus_tag LOCUS_11280 6297 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11280 6705 6442 gene locus_tag LOCUS_11290 6705 6442 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035652.1 protein_id gnl|my_center|LOCUS_11290 6840 7163 gene locus_tag LOCUS_11300 6840 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7234 7680 gene locus_tag LOCUS_11310 7234 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10633 7733 gene locus_tag LOCUS_11320 10633 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 11912 11727 gene locus_tag LOCUS_11330 11912 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11330 12787 12479 gene locus_tag LOCUS_11340 12787 12479 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889189.1 protein_id gnl|my_center|LOCUS_11340 15300 12982 gene locus_tag LOCUS_11350 15300 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 16639 15428 gene locus_tag LOCUS_11360 16639 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 17513 16758 gene locus_tag LOCUS_11370 17513 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 18901 17513 gene locus_tag LOCUS_11380 18901 17513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 20471 19287 gene locus_tag LOCUS_11390 20471 19287 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_11390 23260 20669 gene locus_tag LOCUS_11400 gene acnA 23260 20669 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065152.1 protein_id gnl|my_center|LOCUS_11400 24717 23587 gene locus_tag LOCUS_11410 gene prpC 24717 23587 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_11410 25982 25089 gene locus_tag LOCUS_11420 gene prpB 25982 25089 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P70 protein_id gnl|my_center|LOCUS_11420 26821 26138 gene locus_tag LOCUS_11430 26821 26138 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103931.1 protein_id gnl|my_center|LOCUS_11430 29246 27180 gene locus_tag LOCUS_11440 29246 27180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 30538 29513 gene locus_tag LOCUS_11450 30538 29513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 32342 30699 gene locus_tag LOCUS_11460 32342 30699 CDS product outer membrane protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208426.1 protein_id gnl|my_center|LOCUS_11460 33464 32412 gene locus_tag LOCUS_11470 33464 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120313.1 protein_id gnl|my_center|LOCUS_11470 34310 33501 gene locus_tag LOCUS_11480 34310 33501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098072.1 protein_id gnl|my_center|LOCUS_11480 36197 34590 gene locus_tag LOCUS_11490 36197 34590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 37143 36331 gene locus_tag LOCUS_11500 37143 36331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208423.1 protein_id gnl|my_center|LOCUS_11500 37579 38754 gene locus_tag LOCUS_11510 37579 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 40163 39012 gene locus_tag LOCUS_11520 gene rlmG 40163 39012 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVH4 protein_id gnl|my_center|LOCUS_11520 40408 41745 gene locus_tag LOCUS_11530 gene rimO 40408 41745 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_11530 41855 42718 gene locus_tag LOCUS_11540 41855 42718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_11540 43025 43999 gene locus_tag LOCUS_11550 43025 43999 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_11550 45143 44169 gene locus_tag LOCUS_11560 45143 44169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 45776 46423 gene locus_tag LOCUS_11570 45776 46423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 46484 47257 gene locus_tag LOCUS_11580 gene rluA 46484 47257 CDS product ribosomal large subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIK1 protein_id gnl|my_center|LOCUS_11580 47426 49090 gene locus_tag LOCUS_11590 gene aarF 47426 49090 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X3 protein_id gnl|my_center|LOCUS_11590 49215 49913 gene locus_tag LOCUS_11600 49215 49913 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071371.1 protein_id gnl|my_center|LOCUS_11600 50833 50240 gene locus_tag LOCUS_11610 gene nfuA 50833 50240 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_11610 50963 51211 gene locus_tag LOCUS_11620 50963 51211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 51331 52992 gene locus_tag LOCUS_11630 gene cysI 51331 52992 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_11630 52976 53494 gene locus_tag LOCUS_11640 52976 53494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_11640 54546 53548 gene locus_tag LOCUS_11650 54546 53548 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_11650 55637 54570 gene locus_tag LOCUS_11660 gene sohB 55637 54570 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_11660 56314 55667 gene locus_tag LOCUS_11670 56314 55667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_11670 57234 56392 gene locus_tag LOCUS_11680 57234 56392 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_11680 58925 57231 gene locus_tag LOCUS_11690 gene fimL 58925 57231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_11690 59368 60849 gene locus_tag LOCUS_11700 gene nhaB 59368 60849 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL08 protein_id gnl|my_center|LOCUS_11700 61630 60905 gene locus_tag LOCUS_11710 gene dnaQ 61630 60905 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104689.1 protein_id gnl|my_center|LOCUS_11710 62088 61630 gene locus_tag LOCUS_11720 gene rnhA 62088 61630 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_11720 62917 62147 gene locus_tag LOCUS_11730 62917 62147 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_11730 63095 62937 gene locus_tag LOCUS_11740 63095 62937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 63079 63855 gene locus_tag LOCUS_11750 gene gloB 63079 63855 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKA9 protein_id gnl|my_center|LOCUS_11750 63974 65587 gene locus_tag LOCUS_11760 gene mltD 63974 65587 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_11760 65577 67421 gene locus_tag LOCUS_11770 65577 67421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 protein_id gnl|my_center|LOCUS_11770 67556 67368 gene locus_tag LOCUS_11780 67556 67368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 67555 69297 gene locus_tag LOCUS_11790 67555 69297 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_11790 69297 70373 gene locus_tag LOCUS_11800 69297 70373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_11800 70373 71434 gene locus_tag LOCUS_11810 70373 71434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_11810 71431 73023 gene locus_tag LOCUS_11820 71431 73023 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067565.1 protein_id gnl|my_center|LOCUS_11820 73086 73883 gene locus_tag LOCUS_11830 73086 73883 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_11830 75881 73944 gene locus_tag LOCUS_11840 gene ppiD 75881 73944 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_11840 76342 76067 gene locus_tag LOCUS_11850 gene hupB 76342 76067 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_11850 79268 76869 gene locus_tag LOCUS_11860 gene lon 79268 76869 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 protein_id gnl|my_center|LOCUS_11860 80626 79337 gene locus_tag LOCUS_11870 gene clpX 80626 79337 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_11870 81465 80794 gene locus_tag LOCUS_11880 gene clpP 81465 80794 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R80 protein_id gnl|my_center|LOCUS_11880 82993 81683 gene locus_tag LOCUS_11890 gene tig 82993 81683 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR5 protein_id gnl|my_center|LOCUS_11890 83305 83230 gene locus_tag LOCUS_t00160 83305 83230 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 83426 83350 gene locus_tag LOCUS_t00170 83426 83350 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83601 83525 gene locus_tag LOCUS_t00180 83601 83525 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 83776 84633 gene locus_tag LOCUS_11900 gene folD 83776 84633 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_11900 84842 84648 gene locus_tag LOCUS_11910 84842 84648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 86598 84925 gene locus_tag LOCUS_11920 gene glnS 86598 84925 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YQ1 protein_id gnl|my_center|LOCUS_11920 86738 87235 gene locus_tag LOCUS_11930 gene ppiB 86738 87235 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_11930 87239 87868 gene locus_tag LOCUS_11940 gene ppiB 87239 87868 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_11940 87868 88596 gene locus_tag LOCUS_11950 gene lpxH 87868 88596 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 protein_id gnl|my_center|LOCUS_11950 89257 88655 gene locus_tag LOCUS_11960 gene miaE 89257 88655 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_11960 89465 90370 gene locus_tag LOCUS_11970 gene htrB 89465 90370 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_11970 90610 93210 gene locus_tag LOCUS_11980 gene acnB 90610 93210 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHQ6 protein_id gnl|my_center|LOCUS_11980 94000 93314 gene locus_tag LOCUS_11990 94000 93314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 94650 94009 gene locus_tag LOCUS_12000 94650 94009 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_12000 94969 96474 gene locus_tag LOCUS_12010 94969 96474 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703212.1 protein_id gnl|my_center|LOCUS_12010 96779 97282 gene locus_tag LOCUS_12020 96779 97282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 98749 97307 gene locus_tag LOCUS_12030 98749 97307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 99935 100141 gene locus_tag LOCUS_12040 99935 100141 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_12040 100342 101061 gene locus_tag LOCUS_12050 gene pirA 100342 101061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488956.1 protein_id gnl|my_center|LOCUS_12050 101145 101675 gene locus_tag LOCUS_12060 101145 101675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701028.1 protein_id gnl|my_center|LOCUS_12060 102450 101815 gene locus_tag LOCUS_12070 gene pmtA 102450 101815 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_12070 103906 102494 gene locus_tag LOCUS_12080 103906 102494 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_12080 104964 104119 gene locus_tag LOCUS_12090 gene djlA 104964 104119 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGU4 protein_id gnl|my_center|LOCUS_12090 105439 106119 gene locus_tag LOCUS_12100 105439 106119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 107039 106134 gene locus_tag LOCUS_12110 107039 106134 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194983.1 protein_id gnl|my_center|LOCUS_12110 108017 107250 gene locus_tag LOCUS_12120 108017 107250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 109229 108186 gene locus_tag LOCUS_12130 gene appY 109229 108186 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_12130 109444 110250 gene locus_tag LOCUS_12140 109444 110250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_12140 110477 110788 gene locus_tag LOCUS_12150 110477 110788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 111385 110798 gene locus_tag LOCUS_12160 111385 110798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 111646 113886 gene locus_tag LOCUS_12170 111646 113886 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_12170 114485 113883 gene locus_tag LOCUS_12180 114485 113883 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_12180 115309 114599 gene locus_tag LOCUS_12190 115309 114599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 115725 116957 gene locus_tag LOCUS_12200 115725 116957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 117463 117059 gene locus_tag LOCUS_12210 117463 117059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365982.1 protein_id gnl|my_center|LOCUS_12210 120074 117516 gene locus_tag LOCUS_12220 120074 117516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 120321 121208 gene locus_tag LOCUS_12230 120321 121208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 121278 121505 gene locus_tag LOCUS_12240 121278 121505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 121588 123132 gene locus_tag LOCUS_12250 121588 123132 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085809.1 protein_id gnl|my_center|LOCUS_12250 123846 123160 gene locus_tag LOCUS_12260 123846 123160 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_12260 124504 123827 gene locus_tag LOCUS_12270 124504 123827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 125844 124501 gene locus_tag LOCUS_12280 125844 124501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083238.1 protein_id gnl|my_center|LOCUS_12280 126080 129289 gene locus_tag LOCUS_12290 gene dnaE2 126080 129289 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_12290 130141 129344 gene locus_tag LOCUS_12300 130141 129344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728108.1 protein_id gnl|my_center|LOCUS_12300 130954 130376 gene locus_tag LOCUS_12310 130954 130376 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706207.1 protein_id gnl|my_center|LOCUS_12310 131245 132102 gene locus_tag LOCUS_12320 131245 132102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 132296 132087 gene locus_tag LOCUS_12330 132296 132087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 132646 133056 gene locus_tag LOCUS_12340 132646 133056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 134070 133141 gene locus_tag LOCUS_12350 gene etfA 134070 133141 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_12350 134821 134072 gene locus_tag LOCUS_12360 gene etfB 134821 134072 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_12360 135320 136978 gene locus_tag LOCUS_12370 135320 136978 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_12370 137877 137080 gene locus_tag LOCUS_12380 137877 137080 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_12380 139485 137959 gene locus_tag LOCUS_12390 139485 137959 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_12390 139876 139502 gene locus_tag LOCUS_12400 139876 139502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 139875 140633 gene locus_tag LOCUS_12410 gene cobB 139875 140633 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRF3 protein_id gnl|my_center|LOCUS_12410 140728 141801 gene locus_tag LOCUS_12420 140728 141801 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_12420 142732 141881 gene locus_tag LOCUS_12430 142732 141881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 143848 142847 gene locus_tag LOCUS_12440 143848 142847 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_12440 144136 144975 gene locus_tag LOCUS_12450 144136 144975 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_12450 145091 145819 gene locus_tag LOCUS_12460 145091 145819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 145842 148046 gene locus_tag LOCUS_12470 gene gidA 145842 148046 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_12470 148128 149498 gene locus_tag LOCUS_12480 148128 149498 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_12480 149773 150117 gene locus_tag LOCUS_12490 149773 150117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 150121 150585 gene locus_tag LOCUS_12500 150121 150585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 150717 151529 gene locus_tag LOCUS_12510 150717 151529 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_12510 152171 151608 gene locus_tag LOCUS_12520 152171 151608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 152969 155392 gene locus_tag LOCUS_12530 152969 155392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 156813 155536 gene locus_tag LOCUS_12540 gene metY 156813 155536 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_12540 157979 157077 gene locus_tag LOCUS_12550 157979 157077 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904224.1 protein_id gnl|my_center|LOCUS_12550 158221 158379 gene locus_tag LOCUS_12560 158221 158379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 159573 158365 gene locus_tag LOCUS_12570 159573 158365 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_12570 159700 160293 gene locus_tag LOCUS_12580 159700 160293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 160765 160373 gene locus_tag LOCUS_12590 160765 160373 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263648.1 protein_id gnl|my_center|LOCUS_12590 161159 161072 gene locus_tag LOCUS_t00190 161159 161072 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 161894 161439 gene locus_tag LOCUS_12600 gene yiiD 161894 161439 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074046.1 protein_id gnl|my_center|LOCUS_12600 162450 161887 gene locus_tag LOCUS_12610 162450 161887 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_12610 162638 164116 gene locus_tag LOCUS_12620 gene cyaB 162638 164116 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_12620 164182 165729 gene locus_tag LOCUS_12630 gene abgT 164182 165729 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 protein_id gnl|my_center|LOCUS_12630 166629 165796 gene locus_tag LOCUS_12640 gene queF 166629 165796 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I037 protein_id gnl|my_center|LOCUS_12640 167498 166725 gene locus_tag LOCUS_12650 gene yadH 167498 166725 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T0 protein_id gnl|my_center|LOCUS_12650 168426 167491 gene locus_tag LOCUS_12660 168426 167491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_12660 169218 168544 gene locus_tag LOCUS_12670 gene gpmA 169218 168544 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_12670 170227 169484 gene locus_tag LOCUS_12680 170227 169484 CDS product TENA/THI-4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113940.1 protein_id gnl|my_center|LOCUS_12680 172402 170348 gene locus_tag LOCUS_12690 gene tgpA 172402 170348 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_12690 173361 172405 gene locus_tag LOCUS_12700 173361 172405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_12700 174281 173361 gene locus_tag LOCUS_12710 174281 173361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_12710 175530 174307 gene locus_tag LOCUS_12720 gene metZ 175530 174307 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_12720 177335 175806 gene locus_tag LOCUS_12730 gene purF 177335 175806 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_12730 177841 177350 gene locus_tag LOCUS_12740 177841 177350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 178571 177966 gene locus_tag LOCUS_12750 178571 177966 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104736.1 protein_id gnl|my_center|LOCUS_12750 179818 178580 gene locus_tag LOCUS_12760 gene folC 179818 178580 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_12760 180730 179855 gene locus_tag LOCUS_12770 gene accD 180730 179855 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_12770 181590 180784 gene locus_tag LOCUS_12780 gene trpA 181590 180784 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_12780 182811 181600 gene locus_tag LOCUS_12790 gene trpB 182811 181600 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_12790 183445 182795 gene locus_tag LOCUS_12800 gene trpF 183445 182795 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW1 protein_id gnl|my_center|LOCUS_12800 184306 183497 gene locus_tag LOCUS_12810 gene truA 184306 183497 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX9 protein_id gnl|my_center|LOCUS_12810 187420 184463 gene locus_tag LOCUS_12820 gene fimV 187420 184463 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_12820 188581 187568 gene locus_tag LOCUS_12830 gene usg 188581 187568 CDS product USG-1 protein homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87014 protein_id gnl|my_center|LOCUS_12830 189693 188581 gene locus_tag LOCUS_12840 gene asd 189693 188581 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUZ3 protein_id gnl|my_center|LOCUS_12840 190884 189811 gene locus_tag LOCUS_12850 gene leuB 190884 189811 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_12850 191597 190959 gene locus_tag LOCUS_12860 gene leuD 191597 190959 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_12860 193024 191609 gene locus_tag LOCUS_12870 gene leuC 193024 191609 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_12870 193207 194082 gene locus_tag LOCUS_12880 193207 194082 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_12880 195258 194077 gene locus_tag LOCUS_12890 195258 194077 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_12890 196373 195270 gene locus_tag LOCUS_12900 gene aroC 196373 195270 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS7 protein_id gnl|my_center|LOCUS_12900 197341 196403 gene locus_tag LOCUS_12910 gene prmB 197341 196403 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECQ4 protein_id gnl|my_center|LOCUS_12910 197597 198094 gene locus_tag LOCUS_12920 197597 198094 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_12920 198307 199590 gene locus_tag LOCUS_12930 gene gltP 198307 199590 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_12930 199910 199692 gene locus_tag LOCUS_12940 199910 199692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 200063 200863 gene locus_tag LOCUS_12950 200063 200863 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 protein_id gnl|my_center|LOCUS_12950 202793 201000 gene locus_tag LOCUS_12960 202793 201000 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103343.1 protein_id gnl|my_center|LOCUS_12960 203400 202891 gene locus_tag LOCUS_12970 203400 202891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 204522 203419 gene locus_tag LOCUS_12980 204522 203419 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942315.1 protein_id gnl|my_center|LOCUS_12980 205503 204562 gene locus_tag LOCUS_12990 205503 204562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 205590 206777 gene locus_tag LOCUS_13000 205590 206777 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_13000 206839 207165 gene locus_tag LOCUS_13010 206839 207165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 208994 207228 gene locus_tag LOCUS_13020 gene deaD 208994 207228 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_13020 209774 209313 gene locus_tag LOCUS_13030 209774 209313 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770111.1 protein_id gnl|my_center|LOCUS_13030 210700 209810 gene locus_tag LOCUS_13040 210700 209810 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_13040 211571 210693 gene locus_tag LOCUS_13050 211571 210693 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_13050 211822 211634 gene locus_tag LOCUS_13060 211822 211634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 211839 212651 gene locus_tag LOCUS_13070 211839 212651 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366172.1 protein_id gnl|my_center|LOCUS_13070 212664 213683 gene locus_tag LOCUS_13080 212664 213683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 protein_id gnl|my_center|LOCUS_13080 213802 214296 gene locus_tag LOCUS_13090 213802 214296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 214315 215565 gene locus_tag LOCUS_13100 214315 215565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 215694 216710 gene locus_tag LOCUS_13110 gene dusA 215694 216710 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_13110 216856 217800 gene locus_tag LOCUS_13120 gene tal 216856 217800 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV64 protein_id gnl|my_center|LOCUS_13120 217871 218314 gene locus_tag LOCUS_13130 217871 218314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 218950 218414 gene locus_tag LOCUS_13140 218950 218414 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895798.1 protein_id gnl|my_center|LOCUS_13140 219052 219651 gene locus_tag LOCUS_13150 219052 219651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 219663 220460 gene locus_tag LOCUS_13160 gene hetN 219663 220460 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_13160 221095 220523 gene locus_tag LOCUS_13170 221095 220523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 222445 221513 gene locus_tag LOCUS_13180 222445 221513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 223305 222634 gene locus_tag LOCUS_13190 223305 222634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 protein_id gnl|my_center|LOCUS_13190 224099 223302 gene locus_tag LOCUS_13200 224099 223302 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_13200 224991 224092 gene locus_tag LOCUS_13210 224991 224092 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYW0 protein_id gnl|my_center|LOCUS_13210 225381 225037 gene locus_tag LOCUS_13220 225381 225037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 226799 225642 gene locus_tag LOCUS_13230 226799 225642 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104870.1 protein_id gnl|my_center|LOCUS_13230 230948 226974 gene locus_tag LOCUS_13240 gene hrpA 230948 226974 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 protein_id gnl|my_center|LOCUS_13240 232791 230938 gene locus_tag LOCUS_13250 232791 230938 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 protein_id gnl|my_center|LOCUS_13250 233154 234083 gene locus_tag LOCUS_13260 233154 234083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_13260 235338 234160 gene locus_tag LOCUS_13270 235338 234160 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245801.1 protein_id gnl|my_center|LOCUS_13270 236220 235378 gene locus_tag LOCUS_13280 236220 235378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_13280 236542 237276 gene locus_tag LOCUS_13290 236542 237276 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_13290 238242 237373 gene locus_tag LOCUS_13300 gene rluB 238242 237373 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_13300 239368 238211 gene locus_tag LOCUS_13310 239368 238211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 240437 239361 gene locus_tag LOCUS_13320 240437 239361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 241673 240459 gene locus_tag LOCUS_13330 gene trpS 241673 240459 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_13330 242353 241730 gene locus_tag LOCUS_13340 242353 241730 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_13340 243376 242507 gene locus_tag LOCUS_13350 243376 242507 CDS product 5'-3' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44176 protein_id gnl|my_center|LOCUS_13350 243488 244096 gene locus_tag LOCUS_13360 243488 244096 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJ81 protein_id gnl|my_center|LOCUS_13360 244096 244392 gene locus_tag LOCUS_13370 gene yciL 244096 244392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_13370 244490 245149 gene locus_tag LOCUS_13380 244490 245149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 246442 245261 gene locus_tag LOCUS_13390 246442 245261 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_13390 246582 247469 gene locus_tag LOCUS_13400 246582 247469 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_13400 247412 248422 gene locus_tag LOCUS_13410 247412 248422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 248559 251351 gene locus_tag LOCUS_13420 248559 251351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 251348 251818 gene locus_tag LOCUS_13430 251348 251818 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence05 203 1552 gene locus_tag LOCUS_13440 gene mpl 203 1552 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_13440 1647 2108 gene locus_tag LOCUS_13450 1647 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 protein_id gnl|my_center|LOCUS_13450 2111 2734 gene locus_tag LOCUS_13460 gene ubiX 2111 2734 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_13460 2871 3116 gene locus_tag LOCUS_13470 2871 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3572 3177 gene locus_tag LOCUS_13480 3572 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114197.1 protein_id gnl|my_center|LOCUS_13480 3922 3635 gene locus_tag LOCUS_13490 3922 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4696 4337 gene locus_tag LOCUS_13500 4696 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_13500 5131 4745 gene locus_tag LOCUS_13510 5131 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5639 5121 gene locus_tag LOCUS_13520 5639 5121 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_13520 6560 5643 gene locus_tag LOCUS_13530 6560 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7813 6938 gene locus_tag LOCUS_13540 7813 6938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_13540 8720 8022 gene locus_tag LOCUS_13550 8720 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10249 8783 gene locus_tag LOCUS_13560 10249 8783 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_13560 11797 10361 gene locus_tag LOCUS_13570 11797 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 12349 11984 gene locus_tag LOCUS_13580 12349 11984 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972866.1 protein_id gnl|my_center|LOCUS_13580 13468 12440 gene locus_tag LOCUS_13590 gene lipA 13468 12440 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_13590 14189 13473 gene locus_tag LOCUS_13600 14189 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 14585 14319 gene locus_tag LOCUS_13610 14585 14319 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8I2 protein_id gnl|my_center|LOCUS_13610 15448 14582 gene locus_tag LOCUS_13620 15448 14582 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064726.1 protein_id gnl|my_center|LOCUS_13620 16603 15527 gene locus_tag LOCUS_13630 gene dacC 16603 15527 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_13630 17857 16991 gene locus_tag LOCUS_13640 gene rlpA 17857 16991 CDS product septal ring lipoprotein RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_13640 18957 17854 gene locus_tag LOCUS_13650 18957 17854 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_13650 20262 19117 gene locus_tag LOCUS_13660 20262 19117 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_13660 22262 20367 gene locus_tag LOCUS_13670 gene pbpA 22262 20367 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_13670 23013 22543 gene locus_tag LOCUS_13680 gene rlmH 23013 22543 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWE4 protein_id gnl|my_center|LOCUS_13680 23370 23017 gene locus_tag LOCUS_13690 gene rsfS 23370 23017 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB4 protein_id gnl|my_center|LOCUS_13690 24143 23367 gene locus_tag LOCUS_13700 gene nadD 24143 23367 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDG1 protein_id gnl|my_center|LOCUS_13700 25392 24136 gene locus_tag LOCUS_13710 gene proA 25392 24136 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_13710 25712 27001 gene locus_tag LOCUS_13720 25712 27001 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208332.1 protein_id gnl|my_center|LOCUS_13720 28067 27159 gene locus_tag LOCUS_13730 28067 27159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_13730 29152 28247 gene locus_tag LOCUS_13740 29152 28247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 30367 29366 gene locus_tag LOCUS_13750 gene holA 30367 29366 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_13750 30945 30367 gene locus_tag LOCUS_13760 30945 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 33488 31035 gene locus_tag LOCUS_13770 gene leuS 33488 31035 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVU2 protein_id gnl|my_center|LOCUS_13770 33800 34417 gene locus_tag LOCUS_13780 33800 34417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 35056 34628 gene locus_tag LOCUS_13790 35056 34628 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_13790 36569 35049 gene locus_tag LOCUS_13800 gene lnt 36569 35049 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_13800 36881 38119 gene locus_tag LOCUS_13810 36881 38119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 39602 38136 gene locus_tag LOCUS_13820 39602 38136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 40536 39658 gene locus_tag LOCUS_13830 40536 39658 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_13830 41054 40521 gene locus_tag LOCUS_13840 gene ybeY 41054 40521 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLV7 protein_id gnl|my_center|LOCUS_13840 42069 41068 gene locus_tag LOCUS_13850 42069 41068 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_13850 43518 42208 gene locus_tag LOCUS_13860 gene miaB 43518 42208 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57163 protein_id gnl|my_center|LOCUS_13860 43656 44252 gene locus_tag LOCUS_13870 43656 44252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 44233 44730 gene locus_tag LOCUS_13880 44233 44730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263638.1 protein_id gnl|my_center|LOCUS_13880 44730 45827 gene locus_tag LOCUS_13890 44730 45827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 46698 45961 gene locus_tag LOCUS_13900 46698 45961 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_13900 47436 46930 gene locus_tag LOCUS_13910 47436 46930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 48649 47582 gene locus_tag LOCUS_13920 48649 47582 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_13920 48901 49581 gene locus_tag LOCUS_13930 48901 49581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 49796 51271 gene locus_tag LOCUS_13940 49796 51271 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376021.1 protein_id gnl|my_center|LOCUS_13940 51448 52110 gene locus_tag LOCUS_13950 51448 52110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 52734 52420 gene locus_tag LOCUS_13960 gene glpE 52734 52420 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U8 protein_id gnl|my_center|LOCUS_13960 53951 52731 gene locus_tag LOCUS_13970 gene rhlB 53951 52731 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_13970 54686 54081 gene locus_tag LOCUS_13980 54686 54081 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_13980 55561 54716 gene locus_tag LOCUS_13990 55561 54716 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_13990 57517 55787 gene locus_tag LOCUS_14000 57517 55787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 57781 59085 gene locus_tag LOCUS_14010 57781 59085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268479.1 protein_id gnl|my_center|LOCUS_14010 59082 59693 gene locus_tag LOCUS_14020 59082 59693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 61246 59690 gene locus_tag LOCUS_14030 61246 59690 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_14030 62017 61403 gene locus_tag LOCUS_14040 62017 61403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 62200 63270 gene locus_tag LOCUS_14050 62200 63270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 protein_id gnl|my_center|LOCUS_14050 63638 63267 gene locus_tag LOCUS_14060 63638 63267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 65761 63794 gene locus_tag LOCUS_14070 65761 63794 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_14070 66376 65789 gene locus_tag LOCUS_14080 66376 65789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_14080 67474 66575 gene locus_tag LOCUS_14090 gene cyoE1 67474 66575 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_14090 68502 67471 gene locus_tag LOCUS_14100 68502 67471 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 protein_id gnl|my_center|LOCUS_14100 69136 68510 gene locus_tag LOCUS_14110 69136 68510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 69884 69150 gene locus_tag LOCUS_14120 69884 69150 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_14120 69936 70103 gene locus_tag LOCUS_14130 69936 70103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 70090 70362 gene locus_tag LOCUS_14140 70090 70362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 70805 70461 gene locus_tag LOCUS_14150 70805 70461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376591.1 protein_id gnl|my_center|LOCUS_14150 71522 72724 gene locus_tag LOCUS_14160 71522 72724 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IS0 protein_id gnl|my_center|LOCUS_14160 72736 74349 gene locus_tag LOCUS_14170 gene coxA 72736 74349 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_14170 74381 74965 gene locus_tag LOCUS_14180 74381 74965 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_14180 74981 75880 gene locus_tag LOCUS_14190 gene coxC 74981 75880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_14190 76188 75958 gene locus_tag LOCUS_14200 76188 75958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 76694 78160 gene locus_tag LOCUS_14210 76694 78160 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_14210 78230 79246 gene locus_tag LOCUS_14220 78230 79246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 79249 80226 gene locus_tag LOCUS_14230 79249 80226 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_14230 80266 81435 gene locus_tag LOCUS_14240 80266 81435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 81536 82636 gene locus_tag LOCUS_14250 81536 82636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 84660 82726 gene locus_tag LOCUS_14260 gene htpG 84660 82726 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_14260 84914 85282 gene locus_tag LOCUS_14270 84914 85282 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_14270 85279 86598 gene locus_tag LOCUS_14280 85279 86598 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_14280 87282 86608 gene locus_tag LOCUS_14290 87282 86608 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_14290 87453 88901 gene locus_tag LOCUS_14300 gene pykA 87453 88901 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ME94 protein_id gnl|my_center|LOCUS_14300 92532 89596 gene locus_tag LOCUS_14310 gene hepA 92532 89596 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT66 protein_id gnl|my_center|LOCUS_14310 92668 92847 gene locus_tag LOCUS_14320 92668 92847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 93038 93769 gene locus_tag LOCUS_14330 93038 93769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 94154 95158 gene locus_tag LOCUS_14340 94154 95158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 95170 96903 gene locus_tag LOCUS_14350 95170 96903 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_14350 97131 97925 gene locus_tag LOCUS_14360 97131 97925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 97932 100151 gene locus_tag LOCUS_14370 97932 100151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 100460 101728 gene locus_tag LOCUS_14380 100460 101728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 101852 102568 gene locus_tag LOCUS_14390 101852 102568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_14390 102635 103111 gene locus_tag LOCUS_14400 102635 103111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_14400 104004 103153 gene locus_tag LOCUS_14410 104004 103153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 104788 104417 gene locus_tag LOCUS_14420 104788 104417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 107008 104915 gene locus_tag LOCUS_14430 107008 104915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 107225 109381 gene locus_tag LOCUS_14440 107225 109381 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_14440 109504 110187 gene locus_tag LOCUS_14450 109504 110187 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63L05 protein_id gnl|my_center|LOCUS_14450 110489 110256 gene locus_tag LOCUS_14460 110489 110256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 110488 111321 gene locus_tag LOCUS_14470 110488 111321 CDS product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 protein_id gnl|my_center|LOCUS_14470 111332 111763 gene locus_tag LOCUS_14480 gene exbD 111332 111763 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970692.1 protein_id gnl|my_center|LOCUS_14480 111764 112459 gene locus_tag LOCUS_14490 111764 112459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 112595 113920 gene locus_tag LOCUS_14500 112595 113920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 113921 115093 gene locus_tag LOCUS_14510 gene pvdR 113921 115093 CDS product pyoverdine biosynthesis protein PvdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114507.1 protein_id gnl|my_center|LOCUS_14510 115093 117084 gene locus_tag LOCUS_14520 gene macB 115093 117084 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NU9 protein_id gnl|my_center|LOCUS_14520 117292 118587 gene locus_tag LOCUS_14530 gene opmQ 117292 118587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_14530 118798 119688 gene locus_tag LOCUS_14540 118798 119688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_14540 120697 120621 gene locus_tag LOCUS_t00200 120697 120621 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 121167 121487 gene locus_tag LOCUS_14550 121167 121487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 122647 121556 gene locus_tag LOCUS_14560 122647 121556 CDS product GTP-dependent nucleic acid-binding protein EngD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231816.2 protein_id gnl|my_center|LOCUS_14560 122993 123631 gene locus_tag LOCUS_14570 gene rplY 122993 123631 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_14570 123748 124341 gene locus_tag LOCUS_14580 gene pth 123748 124341 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C8 protein_id gnl|my_center|LOCUS_14580 125494 124535 gene locus_tag LOCUS_14590 gene prs 125494 124535 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_14590 125819 125744 gene locus_tag LOCUS_t00210 125819 125744 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 126762 125857 gene locus_tag LOCUS_14600 gene ispE 126762 125857 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z699 protein_id gnl|my_center|LOCUS_14600 127337 126759 gene locus_tag LOCUS_14610 gene lolB 127337 126759 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 protein_id gnl|my_center|LOCUS_14610 129122 127368 gene locus_tag LOCUS_14620 129122 127368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266732.1 protein_id gnl|my_center|LOCUS_14620 129465 130841 gene locus_tag LOCUS_14630 gene hemA 129465 130841 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_14630 130838 131926 gene locus_tag LOCUS_14640 gene prfA 130838 131926 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C1 protein_id gnl|my_center|LOCUS_14640 131944 132780 gene locus_tag LOCUS_14650 gene prmC 131944 132780 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW6 protein_id gnl|my_center|LOCUS_14650 132770 133513 gene locus_tag LOCUS_14660 gene moeB 132770 133513 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_14660 134489 134010 gene locus_tag LOCUS_14670 134489 134010 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_14670 136610 134745 gene locus_tag LOCUS_14680 136610 134745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 136655 136813 gene locus_tag LOCUS_14690 136655 136813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 137731 149478 gene locus_tag LOCUS_14700 137731 149478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 149475 150008 gene locus_tag LOCUS_14710 149475 150008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 150342 150905 gene locus_tag LOCUS_14720 150342 150905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 151117 151281 gene locus_tag LOCUS_14730 151117 151281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 151683 152264 gene locus_tag LOCUS_14740 151683 152264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 152699 152613 gene locus_tag LOCUS_t00220 152699 152613 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 152943 153992 gene locus_tag LOCUS_14750 gene queA 152943 153992 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH8 protein_id gnl|my_center|LOCUS_14750 154087 155208 gene locus_tag LOCUS_14760 gene tgt 154087 155208 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_14760 155233 155571 gene locus_tag LOCUS_14770 gene yajC 155233 155571 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_14770 155688 157595 gene locus_tag LOCUS_14780 gene secD 155688 157595 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_14780 157606 158526 gene locus_tag LOCUS_14790 gene secF 157606 158526 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_14790 158581 159120 gene locus_tag LOCUS_14800 158581 159120 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL0 protein_id gnl|my_center|LOCUS_14800 159994 159173 gene locus_tag LOCUS_14810 gene suhB 159994 159173 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 protein_id gnl|my_center|LOCUS_14810 160368 161135 gene locus_tag LOCUS_14820 gene trmJ 160368 161135 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQD6 protein_id gnl|my_center|LOCUS_14820 161175 161957 gene locus_tag LOCUS_14830 gene cysE 161175 161957 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_14830 162204 162674 gene locus_tag LOCUS_14840 gene iscR 162204 162674 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_14840 162671 163816 gene locus_tag LOCUS_14850 gene iscS 162671 163816 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6B7 protein_id gnl|my_center|LOCUS_14850 164347 165747 gene locus_tag LOCUS_14860 164347 165747 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_14860 166596 165727 gene locus_tag LOCUS_14870 166596 165727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 166616 167230 gene locus_tag LOCUS_14880 166616 167230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 167240 168790 gene locus_tag LOCUS_14890 gene sypO 167240 168790 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_14890 168802 169608 gene locus_tag LOCUS_14900 168802 169608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 169620 170936 gene locus_tag LOCUS_14910 169620 170936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 170936 172864 gene locus_tag LOCUS_14920 170936 172864 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061273.1 protein_id gnl|my_center|LOCUS_14920 172874 173131 gene locus_tag LOCUS_14930 172874 173131 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533122.1 protein_id gnl|my_center|LOCUS_14930 173128 174672 gene locus_tag LOCUS_14940 173128 174672 CDS product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061275.1 protein_id gnl|my_center|LOCUS_14940 174669 175670 gene locus_tag LOCUS_14950 gene nadE 174669 175670 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TY6 protein_id gnl|my_center|LOCUS_14950 175670 176473 gene locus_tag LOCUS_14960 175670 176473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 176470 177498 gene locus_tag LOCUS_14970 176470 177498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 177498 178670 gene locus_tag LOCUS_14980 177498 178670 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533209.1 protein_id gnl|my_center|LOCUS_14980 178660 179583 gene locus_tag LOCUS_14990 178660 179583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 179583 180722 gene locus_tag LOCUS_15000 179583 180722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 180719 181432 gene locus_tag LOCUS_15010 180719 181432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 181404 182918 gene locus_tag LOCUS_15020 181404 182918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 182911 184041 gene locus_tag LOCUS_15030 182911 184041 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_15030 184066 184920 gene locus_tag LOCUS_15040 184066 184920 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_15040 184917 186044 gene locus_tag LOCUS_15050 184917 186044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 186025 187287 gene locus_tag LOCUS_15060 186025 187287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 187288 188073 gene locus_tag LOCUS_15070 187288 188073 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813215.1 protein_id gnl|my_center|LOCUS_15070 189592 188174 gene locus_tag LOCUS_15080 189592 188174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 190312 189845 gene locus_tag LOCUS_15090 190312 189845 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_15090 190854 190312 gene locus_tag LOCUS_15100 190854 190312 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_15100 191213 190854 gene locus_tag LOCUS_15110 gene iscA 191213 190854 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU7 protein_id gnl|my_center|LOCUS_15110 192440 191226 gene locus_tag LOCUS_15120 192440 191226 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 protein_id gnl|my_center|LOCUS_15120 193699 192449 gene locus_tag LOCUS_15130 gene sufD 193699 192449 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_15130 194445 193696 gene locus_tag LOCUS_15140 194445 193696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_15140 195943 194501 gene locus_tag LOCUS_15150 195943 194501 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021047.1 protein_id gnl|my_center|LOCUS_15150 196253 196684 gene locus_tag LOCUS_15160 gene ndk 196253 196684 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_15160 197040 198167 gene locus_tag LOCUS_15170 gene rlmN 197040 198167 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_15170 198170 198934 gene locus_tag LOCUS_15180 gene pilF 198170 198934 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_15180 198931 199737 gene locus_tag LOCUS_15190 198931 199737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 199748 200866 gene locus_tag LOCUS_15200 gene ispG 199748 200866 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_15200 200925 202220 gene locus_tag LOCUS_15210 gene hisS 200925 202220 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E771 protein_id gnl|my_center|LOCUS_15210 202213 202872 gene locus_tag LOCUS_15220 202213 202872 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 protein_id gnl|my_center|LOCUS_15220 202869 204020 gene locus_tag LOCUS_15230 gene bamB 202869 204020 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 protein_id gnl|my_center|LOCUS_15230 204075 205460 gene locus_tag LOCUS_15240 gene engA 204075 205460 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_15240 205537 207768 gene locus_tag LOCUS_15250 205537 207768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_15250 207879 208703 gene locus_tag LOCUS_15260 207879 208703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 208703 210625 gene locus_tag LOCUS_15270 208703 210625 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3B1 protein_id gnl|my_center|LOCUS_15270 212014 210644 gene locus_tag LOCUS_15280 gene xseA 212014 210644 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S09 protein_id gnl|my_center|LOCUS_15280 212154 213623 gene locus_tag LOCUS_15290 gene guaB 212154 213623 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB3 protein_id gnl|my_center|LOCUS_15290 213734 215305 gene locus_tag LOCUS_15300 gene guaA 213734 215305 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX09 protein_id gnl|my_center|LOCUS_15300 215554 216231 gene locus_tag LOCUS_15310 215554 216231 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_15310 216224 217492 gene locus_tag LOCUS_15320 gene colS 216224 217492 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036321.1 protein_id gnl|my_center|LOCUS_15320 217839 219920 gene locus_tag LOCUS_15330 217839 219920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 220082 220486 gene locus_tag LOCUS_15340 220082 220486 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_15340 221067 220672 gene locus_tag LOCUS_15350 221067 220672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 222345 221125 gene locus_tag LOCUS_15360 gene purT 222345 221125 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V7 protein_id gnl|my_center|LOCUS_15360 222417 222551 gene locus_tag LOCUS_15370 222417 222551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 225131 222561 gene locus_tag LOCUS_15380 225131 222561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 225427 225885 gene locus_tag LOCUS_15390 225427 225885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 227335 225932 gene locus_tag LOCUS_15400 gene mltF 227335 225932 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN1 protein_id gnl|my_center|LOCUS_15400 227752 231663 gene locus_tag LOCUS_15410 gene purL 227752 231663 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX02 protein_id gnl|my_center|LOCUS_15410 231919 231638 gene locus_tag LOCUS_15420 231919 231638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 232210 232887 gene locus_tag LOCUS_15430 232210 232887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 232899 233222 gene locus_tag LOCUS_15440 232899 233222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_15440 233319 233930 gene locus_tag LOCUS_15450 233319 233930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768758.1 protein_id gnl|my_center|LOCUS_15450 234501 233944 gene locus_tag LOCUS_15460 234501 233944 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_15460 234750 235319 gene locus_tag LOCUS_15470 234750 235319 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_15470 235329 235862 gene locus_tag LOCUS_15480 235329 235862 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_15480 235846 236067 gene locus_tag LOCUS_15490 235846 236067 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266929.1 protein_id gnl|my_center|LOCUS_15490 236174 237130 gene locus_tag LOCUS_15500 236174 237130 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_15500 239270 237981 gene locus_tag LOCUS_15510 239270 237981 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_15510 240134 239334 gene locus_tag LOCUS_15520 240134 239334 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_15520 240422 241795 gene locus_tag LOCUS_15530 gene ffh 240422 241795 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG22 protein_id gnl|my_center|LOCUS_15530 242120 242668 gene locus_tag LOCUS_15540 gene cobP 242120 242668 CDS product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 protein_id gnl|my_center|LOCUS_15540 242830 243465 gene locus_tag LOCUS_15550 242830 243465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 244563 243721 gene locus_tag LOCUS_15560 244563 243721 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103243.1 protein_id gnl|my_center|LOCUS_15560 244844 245545 gene locus_tag LOCUS_15570 244844 245545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence06 2637 271 gene locus_tag LOCUS_15580 2637 271 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_15580 2937 3497 gene locus_tag LOCUS_15590 2937 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_15590 5084 3735 gene locus_tag LOCUS_15600 5084 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_15600 5367 7583 gene locus_tag LOCUS_15610 gene plpD 5367 7583 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_15610 7675 8037 gene locus_tag LOCUS_15620 7675 8037 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_15620 9494 8283 gene locus_tag LOCUS_15630 9494 8283 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_15630 11508 9625 gene locus_tag LOCUS_15640 gene uup 11508 9625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_15640 15128 11823 gene locus_tag LOCUS_15650 gene aefA 15128 11823 CDS product potassium efflux protein KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348034.1 protein_id gnl|my_center|LOCUS_15650 15913 15218 gene locus_tag LOCUS_15660 gene trmJ 15913 15218 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGU4 protein_id gnl|my_center|LOCUS_15660 16272 17339 gene locus_tag LOCUS_15670 gene plcB 16272 17339 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_15670 17537 18889 gene locus_tag LOCUS_15680 17537 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114640.1 protein_id gnl|my_center|LOCUS_15680 18870 19532 gene locus_tag LOCUS_15690 18870 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 19715 19954 gene locus_tag LOCUS_15700 19715 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 19955 20698 gene locus_tag LOCUS_15710 19955 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 20792 21133 gene locus_tag LOCUS_15720 20792 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 23487 21274 gene locus_tag LOCUS_15730 23487 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 24510 23650 gene locus_tag LOCUS_15740 24510 23650 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_15740 26001 24520 gene locus_tag LOCUS_15750 gene phnC 26001 24520 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125173.1 protein_id gnl|my_center|LOCUS_15750 26660 25998 gene locus_tag LOCUS_15760 gene phnC1 26660 25998 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 protein_id gnl|my_center|LOCUS_15760 27529 26666 gene locus_tag LOCUS_15770 gene phnD 27529 26666 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_15770 28906 27812 gene locus_tag LOCUS_15780 gene selU 28906 27812 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F6 protein_id gnl|my_center|LOCUS_15780 29656 28967 gene locus_tag LOCUS_15790 29656 28967 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727865.1 protein_id gnl|my_center|LOCUS_15790 29970 31058 gene locus_tag LOCUS_15800 29970 31058 CDS product stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727980.1 protein_id gnl|my_center|LOCUS_15800 31174 32304 gene locus_tag LOCUS_15810 31174 32304 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_15810 32317 32565 gene locus_tag LOCUS_15820 32317 32565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 33012 34181 gene locus_tag LOCUS_15830 33012 34181 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223974.1 protein_id gnl|my_center|LOCUS_15830 35202 34333 gene locus_tag LOCUS_15840 35202 34333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_15840 35415 36458 gene locus_tag LOCUS_15850 gene rr07 35415 36458 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_15850 36592 39024 gene locus_tag LOCUS_15860 gene ladS 36592 39024 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_15860 40516 39098 gene locus_tag LOCUS_15870 40516 39098 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_15870 40931 42217 gene locus_tag LOCUS_15880 40931 42217 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_15880 42923 42312 gene locus_tag LOCUS_15890 42923 42312 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_15890 43093 45141 gene locus_tag LOCUS_15900 gene fadH 43093 45141 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 protein_id gnl|my_center|LOCUS_15900 46496 45261 gene locus_tag LOCUS_15910 46496 45261 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_15910 46729 47028 gene locus_tag LOCUS_15920 46729 47028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 47402 47067 gene locus_tag LOCUS_15930 47402 47067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 48071 48598 gene locus_tag LOCUS_15940 48071 48598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 48660 50942 gene locus_tag LOCUS_15950 48660 50942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 53500 51119 gene locus_tag LOCUS_15960 53500 51119 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_15960 54514 53576 gene locus_tag LOCUS_15970 54514 53576 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389870.1 protein_id gnl|my_center|LOCUS_15970 54991 54524 gene locus_tag LOCUS_15980 54991 54524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 55173 55865 gene locus_tag LOCUS_15990 55173 55865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 57196 55991 gene locus_tag LOCUS_16000 gene acadM 57196 55991 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206631.1 protein_id gnl|my_center|LOCUS_16000 58521 57214 gene locus_tag LOCUS_16010 58521 57214 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_16010 60003 58858 gene locus_tag LOCUS_16020 60003 58858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 61319 60120 gene locus_tag LOCUS_16030 61319 60120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_16030 62664 61636 gene locus_tag LOCUS_16040 62664 61636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 63260 62661 gene locus_tag LOCUS_16050 63260 62661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 63736 64590 gene locus_tag LOCUS_16060 63736 64590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_16060 64591 65448 gene locus_tag LOCUS_16070 64591 65448 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268813.1 protein_id gnl|my_center|LOCUS_16070 65585 66151 gene locus_tag LOCUS_16080 65585 66151 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGK7 protein_id gnl|my_center|LOCUS_16080 66129 67289 gene locus_tag LOCUS_16090 66129 67289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_16090 67428 68264 gene locus_tag LOCUS_16100 67428 68264 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_16100 68352 69242 gene locus_tag LOCUS_16110 68352 69242 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_16110 69282 70286 gene locus_tag LOCUS_16120 69282 70286 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_16120 70286 70780 gene locus_tag LOCUS_16130 70286 70780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 70777 72069 gene locus_tag LOCUS_16140 70777 72069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 73079 72315 gene locus_tag LOCUS_16150 73079 72315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 73599 73225 gene locus_tag LOCUS_16160 73599 73225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 73712 74116 gene locus_tag LOCUS_16170 73712 74116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 76927 74168 gene locus_tag LOCUS_16180 gene acnA 76927 74168 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F5 protein_id gnl|my_center|LOCUS_16180 77776 77177 gene locus_tag LOCUS_16190 77776 77177 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208136.1 protein_id gnl|my_center|LOCUS_16190 77909 79273 gene locus_tag LOCUS_16200 77909 79273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208135.1 protein_id gnl|my_center|LOCUS_16200 80108 79458 gene locus_tag LOCUS_16210 80108 79458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 81159 80218 gene locus_tag LOCUS_16220 81159 80218 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_16220 81255 82268 gene locus_tag LOCUS_16230 81255 82268 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_16230 82321 82791 gene locus_tag LOCUS_16240 82321 82791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 84121 82940 gene locus_tag LOCUS_16250 gene thlA 84121 82940 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_16250 84381 84971 gene locus_tag LOCUS_16260 gene sodB 84381 84971 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53641 protein_id gnl|my_center|LOCUS_16260 85085 85588 gene locus_tag LOCUS_16270 85085 85588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 85650 86486 gene locus_tag LOCUS_16280 85650 86486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 86592 87326 gene locus_tag LOCUS_16290 86592 87326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 87372 87456 gene locus_tag LOCUS_t00230 87372 87456 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88146 87583 gene locus_tag LOCUS_16300 88146 87583 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_16300 88258 88884 gene locus_tag LOCUS_16310 88258 88884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101143.1 protein_id gnl|my_center|LOCUS_16310 89502 88981 gene locus_tag LOCUS_16320 89502 88981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 89742 90512 gene locus_tag LOCUS_16330 89742 90512 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_16330 90779 91036 gene locus_tag LOCUS_16340 90779 91036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 92110 91013 gene locus_tag LOCUS_16350 gene dinB 92110 91013 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I534 protein_id gnl|my_center|LOCUS_16350 92559 92179 gene locus_tag LOCUS_16360 92559 92179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 92638 94287 gene locus_tag LOCUS_16370 92638 94287 CDS product oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727704.1 protein_id gnl|my_center|LOCUS_16370 95248 94298 gene locus_tag LOCUS_16380 95248 94298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 95572 98262 gene locus_tag LOCUS_16390 gene ppc 95572 98262 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 protein_id gnl|my_center|LOCUS_16390 98975 98346 gene locus_tag LOCUS_16400 98975 98346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 99421 99245 gene locus_tag LOCUS_16410 99421 99245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 99372 99743 gene locus_tag LOCUS_16420 99372 99743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 99757 100557 gene locus_tag LOCUS_16430 99757 100557 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_16430 100634 101659 gene locus_tag LOCUS_16440 100634 101659 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_16440 101659 102948 gene locus_tag LOCUS_16450 gene colS 101659 102948 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_16450 103766 103065 gene locus_tag LOCUS_16460 gene cusR 103766 103065 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207170.1 protein_id gnl|my_center|LOCUS_16460 106232 103905 gene locus_tag LOCUS_16470 gene cti 106232 103905 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762564.1 protein_id gnl|my_center|LOCUS_16470 107271 106255 gene locus_tag LOCUS_16480 107271 106255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 108391 107432 gene locus_tag LOCUS_16490 108391 107432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_16490 108463 109236 gene locus_tag LOCUS_16500 gene fnr-1 108463 109236 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616041.1 protein_id gnl|my_center|LOCUS_16500 109510 109935 gene locus_tag LOCUS_16510 109510 109935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 110122 111915 gene locus_tag LOCUS_16520 110122 111915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 112995 111973 gene locus_tag LOCUS_16530 112995 111973 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 protein_id gnl|my_center|LOCUS_16530 114121 113186 gene locus_tag LOCUS_16540 gene dhmA1 114121 113186 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_16540 116117 114312 gene locus_tag LOCUS_16550 116117 114312 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_16550 116705 118201 gene locus_tag LOCUS_16560 116705 118201 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705199.1 protein_id gnl|my_center|LOCUS_16560 120051 118462 gene locus_tag LOCUS_16570 120051 118462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 120681 120202 gene locus_tag LOCUS_16580 120681 120202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 120968 121447 gene locus_tag LOCUS_16590 120968 121447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 122280 121492 gene locus_tag LOCUS_16600 122280 121492 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_16600 122502 124613 gene locus_tag LOCUS_16610 122502 124613 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141971.1 protein_id gnl|my_center|LOCUS_16610 124886 125284 gene locus_tag LOCUS_16620 124886 125284 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_16620 125776 125348 gene locus_tag LOCUS_16630 125776 125348 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196898.1 protein_id gnl|my_center|LOCUS_16630 125927 126421 gene locus_tag LOCUS_16640 125927 126421 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL22 protein_id gnl|my_center|LOCUS_16640 127485 126457 gene locus_tag LOCUS_16650 127485 126457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 128317 127487 gene locus_tag LOCUS_16660 128317 127487 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_16660 129060 128314 gene locus_tag LOCUS_16670 129060 128314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 129343 129783 gene locus_tag LOCUS_16680 129343 129783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 130753 129992 gene locus_tag LOCUS_16690 130753 129992 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0W7 protein_id gnl|my_center|LOCUS_16690 131676 130750 gene locus_tag LOCUS_16700 131676 130750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_16700 132889 131888 gene locus_tag LOCUS_16710 132889 131888 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169023.1 protein_id gnl|my_center|LOCUS_16710 134360 132882 gene locus_tag LOCUS_16720 134360 132882 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188183.1 protein_id gnl|my_center|LOCUS_16720 134786 135688 gene locus_tag LOCUS_16730 gene bioH 134786 135688 CDS product O-methylpimelyl-ACP methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_16730 137598 136429 gene locus_tag LOCUS_16740 137598 136429 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_16740 137764 138789 gene locus_tag LOCUS_16750 137764 138789 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_16750 138968 138786 gene locus_tag LOCUS_16760 138968 138786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 139035 140636 gene locus_tag LOCUS_16770 139035 140636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 142186 140765 gene locus_tag LOCUS_16780 142186 140765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 142443 143822 gene locus_tag LOCUS_16790 142443 143822 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266456.1 protein_id gnl|my_center|LOCUS_16790 144738 143923 gene locus_tag LOCUS_16800 144738 143923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 146063 145098 gene locus_tag LOCUS_16810 gene lipA 146063 145098 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_16810 146624 147292 gene locus_tag LOCUS_16820 146624 147292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 148254 147436 gene locus_tag LOCUS_16830 148254 147436 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529196.1 protein_id gnl|my_center|LOCUS_16830 149738 148281 gene locus_tag LOCUS_16840 149738 148281 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_16840 150655 149837 gene locus_tag LOCUS_16850 150655 149837 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702129.1 protein_id gnl|my_center|LOCUS_16850 152005 150953 gene locus_tag LOCUS_16860 152005 150953 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_16860 152324 152878 gene locus_tag LOCUS_16870 152324 152878 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_16870 152875 155106 gene locus_tag LOCUS_16880 152875 155106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 155194 155907 gene locus_tag LOCUS_16890 155194 155907 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_16890 156299 156051 gene locus_tag LOCUS_16900 156299 156051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 156410 156952 gene locus_tag LOCUS_16910 gene yaiL 156410 156952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51024 protein_id gnl|my_center|LOCUS_16910 157023 157754 gene locus_tag LOCUS_16920 157023 157754 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 protein_id gnl|my_center|LOCUS_16920 157893 158183 gene locus_tag LOCUS_16930 157893 158183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 158515 158282 gene locus_tag LOCUS_16940 158515 158282 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_16940 159170 158661 gene locus_tag LOCUS_16950 159170 158661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 protein_id gnl|my_center|LOCUS_16950 159770 159297 gene locus_tag LOCUS_16960 159770 159297 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 protein_id gnl|my_center|LOCUS_16960 161491 159986 gene locus_tag LOCUS_16970 161491 159986 CDS product putative amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702916.1 protein_id gnl|my_center|LOCUS_16970 162045 161698 gene locus_tag LOCUS_16980 162045 161698 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226697.1 protein_id gnl|my_center|LOCUS_16980 162166 162606 gene locus_tag LOCUS_16990 162166 162606 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531063.1 protein_id gnl|my_center|LOCUS_16990 162674 163486 gene locus_tag LOCUS_17000 162674 163486 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 protein_id gnl|my_center|LOCUS_17000 163536 163934 gene locus_tag LOCUS_17010 163536 163934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 165270 164026 gene locus_tag LOCUS_17020 165270 164026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 165890 167008 gene locus_tag LOCUS_17030 165890 167008 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNE9 protein_id gnl|my_center|LOCUS_17030 167019 168197 gene locus_tag LOCUS_17040 167019 168197 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_17040 168516 170702 gene locus_tag LOCUS_17050 168516 170702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_17050 170804 171547 gene locus_tag LOCUS_17060 170804 171547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 172453 171584 gene locus_tag LOCUS_17070 172453 171584 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_17070 172756 173022 gene locus_tag LOCUS_17080 172756 173022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_17080 173134 174264 gene locus_tag LOCUS_17090 gene frmA 173134 174264 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E800 protein_id gnl|my_center|LOCUS_17090 174346 175194 gene locus_tag LOCUS_17100 gene frmB 174346 175194 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_17100 175518 175264 gene locus_tag LOCUS_17110 175518 175264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 176250 175699 gene locus_tag LOCUS_17120 176250 175699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 176575 177972 gene locus_tag LOCUS_17130 176575 177972 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970749.1 protein_id gnl|my_center|LOCUS_17130 178130 178420 gene locus_tag LOCUS_17140 178130 178420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003858627.1 protein_id gnl|my_center|LOCUS_17140 179063 180478 gene locus_tag LOCUS_17150 179063 180478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 180605 181297 gene locus_tag LOCUS_17160 gene narL 180605 181297 CDS product putative transcriptional regulatory protein NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGM5 protein_id gnl|my_center|LOCUS_17160 183052 181277 gene locus_tag LOCUS_17170 183052 181277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 183140 184864 gene locus_tag LOCUS_17180 gene fhaC 183140 184864 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036965.1 protein_id gnl|my_center|LOCUS_17180 185076 194810 gene locus_tag LOCUS_17190 185076 194810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 196015 194984 gene locus_tag LOCUS_17200 196015 194984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702108.1 protein_id gnl|my_center|LOCUS_17200 196175 197200 gene locus_tag LOCUS_17210 196175 197200 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192764.1 protein_id gnl|my_center|LOCUS_17210 198362 197334 gene locus_tag LOCUS_17220 198362 197334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114360.1 protein_id gnl|my_center|LOCUS_17220 198606 200345 gene locus_tag LOCUS_17230 198606 200345 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229202.1 protein_id gnl|my_center|LOCUS_17230 200526 201527 gene locus_tag LOCUS_17240 200526 201527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 201726 202538 gene locus_tag LOCUS_17250 201726 202538 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615949.1 protein_id gnl|my_center|LOCUS_17250 202781 204541 gene locus_tag LOCUS_17260 202781 204541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 205803 204751 gene locus_tag LOCUS_17270 205803 204751 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_17270 206013 206969 gene locus_tag LOCUS_17280 gene lip 206013 206969 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_17280 207323 208003 gene locus_tag LOCUS_17290 207323 208003 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 protein_id gnl|my_center|LOCUS_17290 207993 210326 gene locus_tag LOCUS_17300 207993 210326 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637884.2 protein_id gnl|my_center|LOCUS_17300 210323 211237 gene locus_tag LOCUS_17310 210323 211237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 protein_id gnl|my_center|LOCUS_17310 211237 211653 gene locus_tag LOCUS_17320 211237 211653 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_17320 213266 211824 gene locus_tag LOCUS_17330 213266 211824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 214667 213435 gene locus_tag LOCUS_17340 214667 213435 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_17340 214716 215279 gene locus_tag LOCUS_17350 214716 215279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_17350 215276 215971 gene locus_tag LOCUS_17360 215276 215971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_17360 216768 215998 gene locus_tag LOCUS_17370 216768 215998 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_17370 216984 218264 gene locus_tag LOCUS_17380 216984 218264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 218492 221857 gene locus_tag LOCUS_17390 218492 221857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 222306 223217 gene locus_tag LOCUS_17400 222306 223217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 223845 224186 gene locus_tag LOCUS_17410 223845 224186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 224183 225454 gene locus_tag LOCUS_17420 224183 225454 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_17420 226761 225589 gene locus_tag LOCUS_17430 gene fadA 226761 225589 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_17430 229070 226923 gene locus_tag LOCUS_17440 gene fadB 229070 226923 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS1 protein_id gnl|my_center|LOCUS_17440 231513 229780 gene locus_tag LOCUS_17450 gene recJ 231513 229780 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_17450 232086 232370 gene locus_tag LOCUS_17460 232086 232370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 232717 233643 gene locus_tag LOCUS_17470 gene prfB 232717 233643 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A290 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17470 234035 235516 gene locus_tag LOCUS_17480 gene lysS 234035 235516 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_17480 235615 236271 gene locus_tag LOCUS_17490 235615 236271 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 protein_id gnl|my_center|LOCUS_17490 236275 237006 gene locus_tag LOCUS_17500 gene ung 236275 237006 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 protein_id gnl|my_center|LOCUS_17500 237841 236942 gene locus_tag LOCUS_17510 gene mmsR 237841 236942 CDS product MmsAB operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28809 protein_id gnl|my_center|LOCUS_17510 237941 239446 gene locus_tag LOCUS_17520 237941 239446 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477189.1 protein_id gnl|my_center|LOCUS_17520 240062 241231 gene locus_tag LOCUS_17530 240062 241231 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705947.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence07 248 1360 gene locus_tag LOCUS_17540 248 1360 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 protein_id gnl|my_center|LOCUS_17540 1357 2247 gene locus_tag LOCUS_17550 gene mmsB 1357 2247 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIP5 protein_id gnl|my_center|LOCUS_17550 4836 2437 gene locus_tag LOCUS_17560 4836 2437 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947391.1 protein_id gnl|my_center|LOCUS_17560 10792 4838 gene locus_tag LOCUS_17570 10792 4838 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947392.1 protein_id gnl|my_center|LOCUS_17570 12044 10995 gene locus_tag LOCUS_17580 12044 10995 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_17580 12230 12487 gene locus_tag LOCUS_17590 12230 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 13051 14394 gene locus_tag LOCUS_17600 13051 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 14649 14422 gene locus_tag LOCUS_17610 14649 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 15152 14805 gene locus_tag LOCUS_17620 15152 14805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 15376 15221 gene locus_tag LOCUS_17630 15376 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 16158 15547 gene locus_tag LOCUS_17640 16158 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 16527 16219 gene locus_tag LOCUS_17650 16527 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 17074 16685 gene locus_tag LOCUS_17660 17074 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 18715 17354 gene locus_tag LOCUS_17670 18715 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 20459 18834 gene locus_tag LOCUS_17680 gene nadB 20459 18834 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_17680 20714 21289 gene locus_tag LOCUS_17690 20714 21289 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_17690 21412 22077 gene locus_tag LOCUS_17700 21412 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 22078 23145 gene locus_tag LOCUS_17710 gene mucB 22078 23145 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764762.1 protein_id gnl|my_center|LOCUS_17710 23142 23564 gene locus_tag LOCUS_17720 gene mucC 23142 23564 CDS product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_17720 23681 25006 gene locus_tag LOCUS_17730 gene mucD 23681 25006 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_17730 25100 26902 gene locus_tag LOCUS_17740 gene lepA 25100 26902 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF8 protein_id gnl|my_center|LOCUS_17740 26902 27735 gene locus_tag LOCUS_17750 gene lepB 26902 27735 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_17750 27732 28115 gene locus_tag LOCUS_17760 27732 28115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 28115 28846 gene locus_tag LOCUS_17770 gene rnc 28115 28846 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH81 protein_id gnl|my_center|LOCUS_17770 28839 29825 gene locus_tag LOCUS_17780 gene era 28839 29825 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG2 protein_id gnl|my_center|LOCUS_17780 29812 30513 gene locus_tag LOCUS_17790 gene recO 29812 30513 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE3 protein_id gnl|my_center|LOCUS_17790 30510 31247 gene locus_tag LOCUS_17800 gene pdxJ 30510 31247 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCP4 protein_id gnl|my_center|LOCUS_17800 31244 31675 gene locus_tag LOCUS_17810 gene acpS 31244 31675 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB6 protein_id gnl|my_center|LOCUS_17810 34356 31639 gene locus_tag LOCUS_17820 34356 31639 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ42 protein_id gnl|my_center|LOCUS_17820 34503 35435 gene locus_tag LOCUS_17830 gene cysM 34503 35435 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_17830 35432 36202 gene locus_tag LOCUS_17840 35432 36202 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_17840 36221 37561 gene locus_tag LOCUS_17850 gene rlmD 36221 37561 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX1 protein_id gnl|my_center|LOCUS_17850 37577 39838 gene locus_tag LOCUS_17860 gene relA 37577 39838 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_17860 39962 40807 gene locus_tag LOCUS_17870 gene mazG 39962 40807 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_17870 41076 42119 gene locus_tag LOCUS_17880 41076 42119 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 protein_id gnl|my_center|LOCUS_17880 42365 43429 gene locus_tag LOCUS_17890 gene porB 42365 43429 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_17890 44746 43532 gene locus_tag LOCUS_17900 gene fabB 44746 43532 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_17900 45286 44762 gene locus_tag LOCUS_17910 gene fabA 45286 44762 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_17910 45508 47532 gene locus_tag LOCUS_17920 gene ccmF 45508 47532 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_17920 47535 48095 gene locus_tag LOCUS_17930 gene ccmG 47535 48095 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 protein_id gnl|my_center|LOCUS_17930 48092 48517 gene locus_tag LOCUS_17940 48092 48517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 48514 49536 gene locus_tag LOCUS_17950 48514 49536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 49662 50318 gene locus_tag LOCUS_17960 gene adk 49662 50318 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL6 protein_id gnl|my_center|LOCUS_17960 50522 51484 gene locus_tag LOCUS_17970 gene hemH 50522 51484 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_17970 51874 52698 gene locus_tag LOCUS_17980 51874 52698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 53436 52864 gene locus_tag LOCUS_17990 gene mobA 53436 52864 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMS8 protein_id gnl|my_center|LOCUS_17990 53647 55596 gene locus_tag LOCUS_18000 gene yoaA 53647 55596 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_18000 55628 56398 gene locus_tag LOCUS_18010 55628 56398 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111661.1 protein_id gnl|my_center|LOCUS_18010 56395 56853 gene locus_tag LOCUS_18020 56395 56853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_18020 56850 57647 gene locus_tag LOCUS_18030 gene uppP1 56850 57647 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_18030 57713 58396 gene locus_tag LOCUS_18040 57713 58396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 58777 58520 gene locus_tag LOCUS_18050 58777 58520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 61428 58930 gene locus_tag LOCUS_18060 gene plsB 61428 58930 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW7 protein_id gnl|my_center|LOCUS_18060 61665 62531 gene locus_tag LOCUS_18070 61665 62531 CDS product deferrochelatase/peroxidase YfeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208519.1 protein_id gnl|my_center|LOCUS_18070 62999 64237 gene locus_tag LOCUS_18080 62999 64237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 64378 64707 gene locus_tag LOCUS_18090 64378 64707 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_18090 65179 64895 gene locus_tag LOCUS_18100 65179 64895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 65520 65341 gene locus_tag LOCUS_18110 65520 65341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 65783 67606 gene locus_tag LOCUS_18120 gene oatA 65783 67606 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208060.1 protein_id gnl|my_center|LOCUS_18120 68615 67851 gene locus_tag LOCUS_18130 68615 67851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_18130 69223 68843 gene locus_tag LOCUS_18140 69223 68843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 71358 69382 gene locus_tag LOCUS_18150 gene slt 71358 69382 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 protein_id gnl|my_center|LOCUS_18150 71637 71374 gene locus_tag LOCUS_18160 71637 71374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 73031 71664 gene locus_tag LOCUS_18170 73031 71664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 73623 72964 gene locus_tag LOCUS_18180 73623 72964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 74263 73583 gene locus_tag LOCUS_18190 74263 73583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 74377 75366 gene locus_tag LOCUS_18200 gene rsmC 74377 75366 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPP9 protein_id gnl|my_center|LOCUS_18200 76379 75396 gene locus_tag LOCUS_18210 gene dfrA 76379 75396 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_18210 76716 76643 gene locus_tag LOCUS_t00240 76716 76643 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 77412 76930 gene locus_tag LOCUS_18220 gene slyD 77412 76930 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7M9 protein_id gnl|my_center|LOCUS_18220 77622 78092 gene locus_tag LOCUS_18230 77622 78092 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_18230 80619 78304 gene locus_tag LOCUS_18240 80619 78304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 82381 80912 gene locus_tag LOCUS_18250 82381 80912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_18250 83609 82569 gene locus_tag LOCUS_18260 83609 82569 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_18260 84506 83790 gene locus_tag LOCUS_18270 84506 83790 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883307.1 protein_id gnl|my_center|LOCUS_18270 84716 85798 gene locus_tag LOCUS_18280 84716 85798 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN1 protein_id gnl|my_center|LOCUS_18280 85959 86525 gene locus_tag LOCUS_18290 gene dcd 85959 86525 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN2 protein_id gnl|my_center|LOCUS_18290 87473 86646 gene locus_tag LOCUS_18300 87473 86646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 88398 87607 gene locus_tag LOCUS_18310 88398 87607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 88999 88349 gene locus_tag LOCUS_18320 gene purN 88999 88349 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_18320 90045 88996 gene locus_tag LOCUS_18330 gene purM 90045 88996 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDI8 protein_id gnl|my_center|LOCUS_18330 90281 91453 gene locus_tag LOCUS_18340 90281 91453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 91450 92148 gene locus_tag LOCUS_18350 91450 92148 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_18350 92481 96539 gene locus_tag LOCUS_18360 92481 96539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 96765 98162 gene locus_tag LOCUS_18370 gene sthA 96765 98162 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884I6 protein_id gnl|my_center|LOCUS_18370 98159 99211 gene locus_tag LOCUS_18380 98159 99211 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_18380 99845 99252 gene locus_tag LOCUS_18390 99845 99252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_18390 99980 100327 gene locus_tag LOCUS_18400 99980 100327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 100448 101884 gene locus_tag LOCUS_18410 gene cls 100448 101884 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_18410 102197 102877 gene locus_tag LOCUS_18420 102197 102877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_18420 103079 103003 gene locus_tag LOCUS_t00250 103079 103003 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 103291 104256 gene locus_tag LOCUS_18430 103291 104256 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_18430 104256 104999 gene locus_tag LOCUS_18440 104256 104999 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_18440 105074 105784 gene locus_tag LOCUS_18450 105074 105784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_18450 105788 106138 gene locus_tag LOCUS_18460 105788 106138 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766990.1 protein_id gnl|my_center|LOCUS_18460 107414 107085 gene locus_tag LOCUS_18470 gene fdxA 107414 107085 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_18470 110171 107574 gene locus_tag LOCUS_18480 gene mutS 110171 107574 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 protein_id gnl|my_center|LOCUS_18480 111956 110703 gene locus_tag LOCUS_18490 111956 110703 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_18490 113490 112108 gene locus_tag LOCUS_18500 113490 112108 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702784.1 protein_id gnl|my_center|LOCUS_18500 113867 113547 gene locus_tag LOCUS_18510 gene fdxB 113867 113547 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37098 protein_id gnl|my_center|LOCUS_18510 114105 115160 gene locus_tag LOCUS_18520 gene oruR 114105 115160 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_18520 115320 116189 gene locus_tag LOCUS_18530 115320 116189 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_18530 116189 117199 gene locus_tag LOCUS_18540 116189 117199 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_18540 117235 117726 gene locus_tag LOCUS_18550 117235 117726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 117723 118169 gene locus_tag LOCUS_18560 117723 118169 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815599.1 protein_id gnl|my_center|LOCUS_18560 118244 119794 gene locus_tag LOCUS_18570 118244 119794 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_18570 119840 121000 gene locus_tag LOCUS_18580 119840 121000 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_18580 121010 122107 gene locus_tag LOCUS_18590 121010 122107 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_18590 122110 123717 gene locus_tag LOCUS_18600 122110 123717 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 protein_id gnl|my_center|LOCUS_18600 124979 124095 gene locus_tag LOCUS_18610 124979 124095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_18610 125864 125013 gene locus_tag LOCUS_18620 gene ephD 125864 125013 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_18620 127387 125861 gene locus_tag LOCUS_18630 127387 125861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_18630 130685 127605 gene locus_tag LOCUS_18640 130685 127605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 132084 130735 gene locus_tag LOCUS_18650 132084 130735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 133373 132432 gene locus_tag LOCUS_18660 133373 132432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_18660 133552 134166 gene locus_tag LOCUS_18670 133552 134166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 134422 134973 gene locus_tag LOCUS_18680 134422 134973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 135053 136090 gene locus_tag LOCUS_18690 135053 136090 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532914.1 protein_id gnl|my_center|LOCUS_18690 136093 139170 gene locus_tag LOCUS_18700 136093 139170 CDS product drug-resistance cell envelope-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531375.1 protein_id gnl|my_center|LOCUS_18700 139441 139584 gene locus_tag LOCUS_18710 139441 139584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 140598 140993 gene locus_tag LOCUS_18720 140598 140993 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_18720 141511 143160 gene locus_tag LOCUS_18730 141511 143160 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533314.1 protein_id gnl|my_center|LOCUS_18730 143153 143425 gene locus_tag LOCUS_18740 143153 143425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 143462 144826 gene locus_tag LOCUS_18750 gene pvdA 143462 144826 CDS product L-ornithine N(5)-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51548 protein_id gnl|my_center|LOCUS_18750 144860 146257 gene locus_tag LOCUS_18760 gene rhbA 144860 146257 CDS product diaminobutyrate--2-oxoglutarate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R2 protein_id gnl|my_center|LOCUS_18760 146268 146660 gene locus_tag LOCUS_18770 146268 146660 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400967.1 protein_id gnl|my_center|LOCUS_18770 146653 148146 gene locus_tag LOCUS_18780 146653 148146 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267938.1 protein_id gnl|my_center|LOCUS_18780 148146 149261 gene locus_tag LOCUS_18790 148146 149261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 149254 150174 gene locus_tag LOCUS_18800 149254 150174 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104300.1 protein_id gnl|my_center|LOCUS_18800 150164 150622 gene locus_tag LOCUS_18810 gene yhfO 150164 150622 CDS product putative N-acetyltransferase YhfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07614 protein_id gnl|my_center|LOCUS_18810 150649 151689 gene locus_tag LOCUS_18820 150649 151689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 151686 153644 gene locus_tag LOCUS_18830 151686 153644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 153641 154009 gene locus_tag LOCUS_18840 153641 154009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 154006 154476 gene locus_tag LOCUS_18850 154006 154476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531514.1 protein_id gnl|my_center|LOCUS_18850 154469 154921 gene locus_tag LOCUS_18860 154469 154921 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246884.1 protein_id gnl|my_center|LOCUS_18860 154933 156183 gene locus_tag LOCUS_18870 154933 156183 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_18870 156236 158320 gene locus_tag LOCUS_18880 156236 158320 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141946.1 protein_id gnl|my_center|LOCUS_18880 158533 159414 gene locus_tag LOCUS_18890 158533 159414 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815494.1 protein_id gnl|my_center|LOCUS_18890 159438 162512 gene locus_tag LOCUS_18900 159438 162512 CDS product drug-resistance cell envelope-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531375.1 protein_id gnl|my_center|LOCUS_18900 162856 163239 gene locus_tag LOCUS_18910 162856 163239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 163257 164777 gene locus_tag LOCUS_18920 163257 164777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123836.1 protein_id gnl|my_center|LOCUS_18920 164774 165412 gene locus_tag LOCUS_18930 164774 165412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057874.1 protein_id gnl|my_center|LOCUS_18930 165499 165978 gene locus_tag LOCUS_18940 165499 165978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 165975 167078 gene locus_tag LOCUS_18950 165975 167078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 167162 167707 gene locus_tag LOCUS_18960 167162 167707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 169441 167924 gene locus_tag LOCUS_18970 gene hapE 169441 167924 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_18970 170286 169438 gene locus_tag LOCUS_18980 gene ephD 170286 169438 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_18980 171276 170347 gene locus_tag LOCUS_18990 171276 170347 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_18990 171988 171608 gene locus_tag LOCUS_19000 gene rnk 171988 171608 CDS product regulator of nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ43 protein_id gnl|my_center|LOCUS_19000 172720 172301 gene locus_tag LOCUS_19010 172720 172301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 173363 211225 gene locus_tag LOCUS_19020 173363 211225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 174412 174507 gene locus_tag LOCUS_t00260 174412 174507 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 211222 212049 gene locus_tag LOCUS_19030 211222 212049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 212037 212885 gene locus_tag LOCUS_19040 212037 212885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 212903 218410 gene locus_tag LOCUS_19050 212903 218410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 218473 224964 gene locus_tag LOCUS_19060 218473 224964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 224968 226494 gene locus_tag LOCUS_19070 224968 226494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 226826 226653 gene locus_tag LOCUS_19080 226826 226653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 227010 227306 gene locus_tag LOCUS_19090 227010 227306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 227316 227924 gene locus_tag LOCUS_19100 227316 227924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 227990 228838 gene locus_tag LOCUS_19110 227990 228838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 229125 230168 gene locus_tag LOCUS_19120 229125 230168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence08 578 1099 gene locus_tag LOCUS_19130 578 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1621 3177 gene locus_tag LOCUS_19140 1621 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4198 3356 gene locus_tag LOCUS_19150 4198 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_19150 4370 5098 gene locus_tag LOCUS_19160 4370 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5293 5610 gene locus_tag LOCUS_19170 5293 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6295 5708 gene locus_tag LOCUS_19180 6295 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 8770 6452 gene locus_tag LOCUS_19190 8770 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 9262 10344 gene locus_tag LOCUS_19200 9262 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 10698 12503 gene locus_tag LOCUS_19210 10698 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 12598 13314 gene locus_tag LOCUS_19220 12598 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 14419 13388 gene locus_tag LOCUS_19230 14419 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702108.1 protein_id gnl|my_center|LOCUS_19230 15875 14727 gene locus_tag LOCUS_19240 15875 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 18807 16033 gene locus_tag LOCUS_19250 18807 16033 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_19250 19004 19624 gene locus_tag LOCUS_19260 gene plsC2 19004 19624 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_19260 19750 20229 gene locus_tag LOCUS_19270 19750 20229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 22147 20930 gene locus_tag LOCUS_19280 gene desA 22147 20930 CDS product delta-9 fatty acid desaturase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104496.1 protein_id gnl|my_center|LOCUS_19280 24313 22325 gene locus_tag LOCUS_19290 24313 22325 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385793.1 protein_id gnl|my_center|LOCUS_19290 24497 25306 gene locus_tag LOCUS_19300 gene mutM 24497 25306 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN2 protein_id gnl|my_center|LOCUS_19300 25439 25819 gene locus_tag LOCUS_19310 25439 25819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 27589 25886 gene locus_tag LOCUS_19320 27589 25886 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_19320 28377 27880 gene locus_tag LOCUS_19330 gene coaD 28377 27880 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_19330 30198 28549 gene locus_tag LOCUS_19340 30198 28549 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_19340 30734 30198 gene locus_tag LOCUS_19350 30734 30198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 protein_id gnl|my_center|LOCUS_19350 32181 30739 gene locus_tag LOCUS_19360 gene calB 32181 30739 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C8 protein_id gnl|my_center|LOCUS_19360 32364 33071 gene locus_tag LOCUS_19370 32364 33071 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_19370 33469 34122 gene locus_tag LOCUS_19380 33469 34122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 34186 34629 gene locus_tag LOCUS_19390 34186 34629 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261186.1 protein_id gnl|my_center|LOCUS_19390 35702 34737 gene locus_tag LOCUS_19400 35702 34737 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103138.1 protein_id gnl|my_center|LOCUS_19400 36527 35952 gene locus_tag LOCUS_19410 36527 35952 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF77 protein_id gnl|my_center|LOCUS_19410 38082 36538 gene locus_tag LOCUS_19420 38082 36538 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_19420 39455 38082 gene locus_tag LOCUS_19430 39455 38082 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_19430 39768 40766 gene locus_tag LOCUS_19440 39768 40766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 40763 41443 gene locus_tag LOCUS_19450 gene ftsE 40763 41443 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_19450 41436 42476 gene locus_tag LOCUS_19460 gene ftsX 41436 42476 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B9 protein_id gnl|my_center|LOCUS_19460 44382 42814 gene locus_tag LOCUS_19470 gene hapE 44382 42814 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_19470 45161 44490 gene locus_tag LOCUS_19480 45161 44490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 46561 45620 gene locus_tag LOCUS_19490 46561 45620 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_19490 46941 47225 gene locus_tag LOCUS_19500 46941 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 48484 47357 gene locus_tag LOCUS_19510 48484 47357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 48813 48589 gene locus_tag LOCUS_19520 48813 48589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 50200 49046 gene locus_tag LOCUS_19530 gene acadL 50200 49046 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_19530 51312 50431 gene locus_tag LOCUS_19540 51312 50431 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_19540 51509 52498 gene locus_tag LOCUS_19550 gene hmgL 51509 52498 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_19550 53090 52539 gene locus_tag LOCUS_19560 53090 52539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 53557 53186 gene locus_tag LOCUS_19570 53557 53186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 55562 53685 gene locus_tag LOCUS_19580 55562 53685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407259.1 protein_id gnl|my_center|LOCUS_19580 56220 55618 gene locus_tag LOCUS_19590 56220 55618 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 protein_id gnl|my_center|LOCUS_19590 56604 57332 gene locus_tag LOCUS_19600 56604 57332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_19600 57994 57404 gene locus_tag LOCUS_19610 gene tag 57994 57404 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_19610 58109 59119 gene locus_tag LOCUS_19620 gene glyQ 58109 59119 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_19620 59116 61185 gene locus_tag LOCUS_19630 gene glyS 59116 61185 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Y5 protein_id gnl|my_center|LOCUS_19630 61314 61865 gene locus_tag LOCUS_19640 61314 61865 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X71 protein_id gnl|my_center|LOCUS_19640 61862 62644 gene locus_tag LOCUS_19650 gene lptA 61862 62644 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_19650 65202 62788 gene locus_tag LOCUS_19660 gene gyrB 65202 62788 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 protein_id gnl|my_center|LOCUS_19660 66289 65252 gene locus_tag LOCUS_19670 gene recF 66289 65252 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C3 protein_id gnl|my_center|LOCUS_19670 67507 66407 gene locus_tag LOCUS_19680 gene dnaN 67507 66407 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_19680 68916 67531 gene locus_tag LOCUS_19690 gene dnaA 68916 67531 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK3 protein_id gnl|my_center|LOCUS_19690 69568 69936 gene locus_tag LOCUS_19700 gene rnpA 69568 69936 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_19700 69881 71740 gene locus_tag LOCUS_19710 gene yidC 69881 71740 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_19710 71939 73336 gene locus_tag LOCUS_19720 gene mnmE 71939 73336 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS2 protein_id gnl|my_center|LOCUS_19720 73452 74834 gene locus_tag LOCUS_19730 gene fumC-2 73452 74834 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WT2 protein_id gnl|my_center|LOCUS_19730 74886 76526 gene locus_tag LOCUS_19740 74886 76526 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_19740 76778 77884 gene locus_tag LOCUS_19750 76778 77884 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_19750 77899 80994 gene locus_tag LOCUS_19760 77899 80994 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389847.1 protein_id gnl|my_center|LOCUS_19760 81029 81715 gene locus_tag LOCUS_19770 81029 81715 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_19770 82179 81835 gene locus_tag LOCUS_19780 82179 81835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_19780 82577 82182 gene locus_tag LOCUS_19790 82577 82182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 82918 82715 gene locus_tag LOCUS_19800 gene cspG 82918 82715 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_19800 84598 83231 gene locus_tag LOCUS_19810 84598 83231 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_19810 85529 84717 gene locus_tag LOCUS_19820 85529 84717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 85714 88074 gene locus_tag LOCUS_19830 85714 88074 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 protein_id gnl|my_center|LOCUS_19830 90002 88188 gene locus_tag LOCUS_19840 90002 88188 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086792.1 protein_id gnl|my_center|LOCUS_19840 90333 92213 gene locus_tag LOCUS_19850 90333 92213 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103008.1 protein_id gnl|my_center|LOCUS_19850 93632 92517 gene locus_tag LOCUS_19860 93632 92517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 94664 93651 gene locus_tag LOCUS_19870 94664 93651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 95308 95084 gene locus_tag LOCUS_19880 95308 95084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 97163 95466 gene locus_tag LOCUS_19890 gene nhaP2 97163 95466 CDS product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KV8 protein_id gnl|my_center|LOCUS_19890 97443 99329 gene locus_tag LOCUS_19900 gene mnmG 97443 99329 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F5X1 protein_id gnl|my_center|LOCUS_19900 99329 99949 gene locus_tag LOCUS_19910 gene rsmG 99329 99949 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3N0 protein_id gnl|my_center|LOCUS_19910 99953 100747 gene locus_tag LOCUS_19920 gene soj 99953 100747 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_19920 100770 101681 gene locus_tag LOCUS_19930 100770 101681 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_19930 102198 102566 gene locus_tag LOCUS_19940 102198 102566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 102588 103505 gene locus_tag LOCUS_19950 gene atpB 102588 103505 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_19950 103549 103770 gene locus_tag LOCUS_19960 103549 103770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 103820 104290 gene locus_tag LOCUS_19970 gene atpF 103820 104290 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL20 protein_id gnl|my_center|LOCUS_19970 104306 104848 gene locus_tag LOCUS_19980 gene atpH 104306 104848 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL21 protein_id gnl|my_center|LOCUS_19980 104860 106404 gene locus_tag LOCUS_19990 gene atpA 104860 106404 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_19990 106436 107299 gene locus_tag LOCUS_20000 gene atpG 106436 107299 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_20000 107333 108739 gene locus_tag LOCUS_20010 gene atpD 107333 108739 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_20010 108760 109188 gene locus_tag LOCUS_20020 gene atpC 108760 109188 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_20020 109337 110710 gene locus_tag LOCUS_20030 gene glmU 109337 110710 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT22 protein_id gnl|my_center|LOCUS_20030 110714 112543 gene locus_tag LOCUS_20040 gene glmS 110714 112543 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 protein_id gnl|my_center|LOCUS_20040 112713 113399 gene locus_tag LOCUS_20050 112713 113399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 113605 114405 gene locus_tag LOCUS_20060 113605 114405 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_20060 114402 115643 gene locus_tag LOCUS_20070 114402 115643 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_20070 115765 116211 gene locus_tag LOCUS_20080 115765 116211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 116236 117069 gene locus_tag LOCUS_20090 116236 117069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 117076 117456 gene locus_tag LOCUS_20100 117076 117456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_20100 117527 117919 gene locus_tag LOCUS_20110 117527 117919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_20110 120991 118130 gene locus_tag LOCUS_20120 120991 118130 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096868.1 protein_id gnl|my_center|LOCUS_20120 121243 123456 gene locus_tag LOCUS_20130 gene uvrD 121243 123456 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U01 protein_id gnl|my_center|LOCUS_20130 123523 124644 gene locus_tag LOCUS_20140 123523 124644 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_20140 126465 124747 gene locus_tag LOCUS_20150 126465 124747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 126673 127212 gene locus_tag LOCUS_20160 126673 127212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 127532 128599 gene locus_tag LOCUS_20170 gene ldh 127532 128599 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_20170 128586 129683 gene locus_tag LOCUS_20180 128586 129683 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483380.1 protein_id gnl|my_center|LOCUS_20180 129670 130728 gene locus_tag LOCUS_20190 129670 130728 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 protein_id gnl|my_center|LOCUS_20190 130809 131930 gene locus_tag LOCUS_20200 130809 131930 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYJ0 protein_id gnl|my_center|LOCUS_20200 132259 132092 gene locus_tag LOCUS_20210 132259 132092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 132258 132683 gene locus_tag LOCUS_20220 132258 132683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 133397 132747 gene locus_tag LOCUS_20230 133397 132747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 133484 134692 gene locus_tag LOCUS_20240 133484 134692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 134692 135675 gene locus_tag LOCUS_20250 134692 135675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_20250 135669 136127 gene locus_tag LOCUS_20260 135669 136127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 136258 136527 gene locus_tag LOCUS_20270 136258 136527 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DG3 protein_id gnl|my_center|LOCUS_20270 136524 136817 gene locus_tag LOCUS_20280 136524 136817 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_20280 137091 137747 gene locus_tag LOCUS_20290 137091 137747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 138717 137773 gene locus_tag LOCUS_20300 138717 137773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_20300 139137 138730 gene locus_tag LOCUS_20310 139137 138730 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116010.1 protein_id gnl|my_center|LOCUS_20310 140570 139170 gene locus_tag LOCUS_20320 140570 139170 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_20320 141127 140567 gene locus_tag LOCUS_20330 141127 140567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 141464 142534 gene locus_tag LOCUS_20340 141464 142534 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_20340 142869 144257 gene locus_tag LOCUS_20350 142869 144257 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_20350 144250 145521 gene locus_tag LOCUS_20360 144250 145521 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_20360 145535 146458 gene locus_tag LOCUS_20370 gene pstB 145535 146458 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_20370 146563 147282 gene locus_tag LOCUS_20380 gene phoU 146563 147282 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_20380 147517 147834 gene locus_tag LOCUS_20390 147517 147834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267061.1 protein_id gnl|my_center|LOCUS_20390 147867 148385 gene locus_tag LOCUS_20400 147867 148385 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_20400 148439 149506 gene locus_tag LOCUS_20410 148439 149506 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_20410 149551 150297 gene locus_tag LOCUS_20420 149551 150297 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_20420 150860 150294 gene locus_tag LOCUS_20430 150860 150294 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_20430 151106 151312 gene locus_tag LOCUS_20440 gene slyX 151106 151312 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SJ8 protein_id gnl|my_center|LOCUS_20440 152639 151329 gene locus_tag LOCUS_20450 gene phoR 152639 151329 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_20450 153433 152729 gene locus_tag LOCUS_20460 gene phoB 153433 152729 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_20460 154446 153568 gene locus_tag LOCUS_20470 gene ubiA 154446 153568 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB4 protein_id gnl|my_center|LOCUS_20470 155105 154569 gene locus_tag LOCUS_20480 gene ubiC 155105 154569 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F94 protein_id gnl|my_center|LOCUS_20480 155360 155524 gene locus_tag LOCUS_20490 gene rubA2 155360 155524 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_20490 155831 156976 gene locus_tag LOCUS_20500 gene alkT 155831 156976 CDS product Rubredoxin-NAD(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK9 protein_id gnl|my_center|LOCUS_20500 157061 157438 gene locus_tag LOCUS_20510 157061 157438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 157457 158860 gene locus_tag LOCUS_20520 157457 158860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 159839 159042 gene locus_tag LOCUS_20530 gene znuB 159839 159042 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_20530 160665 159832 gene locus_tag LOCUS_20540 gene znuC 160665 159832 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT73 protein_id gnl|my_center|LOCUS_20540 160811 161767 gene locus_tag LOCUS_20550 gene znuA 160811 161767 CDS product high-affinity zinc uptake system protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39172 protein_id gnl|my_center|LOCUS_20550 162182 161820 gene locus_tag LOCUS_20560 162182 161820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 162290 163405 gene locus_tag LOCUS_20570 162290 163405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 164563 163598 gene locus_tag LOCUS_20580 gene thrB 164563 163598 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29364 protein_id gnl|my_center|LOCUS_20580 164732 165385 gene locus_tag LOCUS_20590 164732 165385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 165641 168415 gene locus_tag LOCUS_20600 gene polA 165641 168415 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_20600 168415 169176 gene locus_tag LOCUS_20610 168415 169176 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_20610 169170 170363 gene locus_tag LOCUS_20620 gene nhaA 169170 170363 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH93 protein_id gnl|my_center|LOCUS_20620 >Feature sequence09 443 1357 gene locus_tag LOCUS_20630 443 1357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_20630 1543 1468 gene locus_tag LOCUS_t00270 1543 1468 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1759 1601 gene locus_tag LOCUS_20640 1759 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2067 1789 gene locus_tag LOCUS_20650 2067 1789 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_20650 3286 2174 gene locus_tag LOCUS_20660 gene mutY 3286 2174 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_20660 5508 3283 gene locus_tag LOCUS_20670 5508 3283 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105433.1 protein_id gnl|my_center|LOCUS_20670 5653 7584 gene locus_tag LOCUS_20680 gene ladS 5653 7584 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_20680 7951 7607 gene locus_tag LOCUS_20690 7951 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8067 8672 gene locus_tag LOCUS_20700 gene hisB 8067 8672 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_20700 8680 9318 gene locus_tag LOCUS_20710 gene hisH1 8680 9318 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_20710 9394 10146 gene locus_tag LOCUS_20720 gene hisA 9394 10146 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG3 protein_id gnl|my_center|LOCUS_20720 10149 10922 gene locus_tag LOCUS_20730 gene hisF 10149 10922 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG4 protein_id gnl|my_center|LOCUS_20730 11042 11920 gene locus_tag LOCUS_20740 11042 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 11932 12819 gene locus_tag LOCUS_20750 11932 12819 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_20750 13623 12847 gene locus_tag LOCUS_20760 gene yibQ 13623 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_20760 14969 13620 gene locus_tag LOCUS_20770 14969 13620 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_20770 16172 15012 gene locus_tag LOCUS_20780 16172 15012 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_20780 16282 16698 gene locus_tag LOCUS_20790 16282 16698 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 protein_id gnl|my_center|LOCUS_20790 16698 16958 gene locus_tag LOCUS_20800 gene grxC 16698 16958 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_20800 16958 17425 gene locus_tag LOCUS_20810 gene secB 16958 17425 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL70 protein_id gnl|my_center|LOCUS_20810 17959 17495 gene locus_tag LOCUS_20820 gene trmL 17959 17495 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8X2 protein_id gnl|my_center|LOCUS_20820 18171 18620 gene locus_tag LOCUS_20830 18171 18620 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTM1 protein_id gnl|my_center|LOCUS_20830 18643 19080 gene locus_tag LOCUS_20840 18643 19080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 19194 19355 gene locus_tag LOCUS_20850 19194 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 19579 20976 gene locus_tag LOCUS_20860 gene czcC 19579 20976 CDS product outer membrane protein CzcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_20860 20973 22202 gene locus_tag LOCUS_20870 20973 22202 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_20870 22227 25331 gene locus_tag LOCUS_20880 22227 25331 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_20880 25622 26752 gene locus_tag LOCUS_20890 25622 26752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 27088 26837 gene locus_tag LOCUS_20900 27088 26837 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_20900 28177 27212 gene locus_tag LOCUS_20910 28177 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 30344 28536 gene locus_tag LOCUS_20920 gene typA 30344 28536 CDS product GTP-binding protein TypA/BipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3B4 protein_id gnl|my_center|LOCUS_20920 31049 31516 gene locus_tag LOCUS_20930 31049 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 31520 33058 gene locus_tag LOCUS_20940 31520 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 protein_id gnl|my_center|LOCUS_20940 33058 34035 gene locus_tag LOCUS_20950 33058 34035 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_20950 34225 36069 gene locus_tag LOCUS_20960 34225 36069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_20960 36305 37330 gene locus_tag LOCUS_20970 36305 37330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_20970 37327 37560 gene locus_tag LOCUS_20980 37327 37560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 protein_id gnl|my_center|LOCUS_20980 37928 39334 gene locus_tag LOCUS_20990 37928 39334 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_20990 39462 40088 gene locus_tag LOCUS_21000 39462 40088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 40242 41351 gene locus_tag LOCUS_21010 gene ntrB 40242 41351 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_21010 41354 42784 gene locus_tag LOCUS_21020 gene ntrC 41354 42784 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_21020 43322 42831 gene locus_tag LOCUS_21030 43322 42831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 43449 44393 gene locus_tag LOCUS_21040 gene pip 43449 44393 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC98 protein_id gnl|my_center|LOCUS_21040 44390 44830 gene locus_tag LOCUS_21050 gene dtd 44390 44830 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNV3 protein_id gnl|my_center|LOCUS_21050 45003 45482 gene locus_tag LOCUS_21060 45003 45482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105069.1 protein_id gnl|my_center|LOCUS_21060 45558 47444 gene locus_tag LOCUS_21070 45558 47444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_21070 47593 48501 gene locus_tag LOCUS_21080 47593 48501 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_21080 49326 48562 gene locus_tag LOCUS_21090 gene tatC 49326 48562 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_21090 49754 49326 gene locus_tag LOCUS_21100 gene tatB 49754 49326 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG9 protein_id gnl|my_center|LOCUS_21100 50051 49806 gene locus_tag LOCUS_21110 gene tatA 50051 49806 CDS product sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR62 protein_id gnl|my_center|LOCUS_21110 50389 50054 gene locus_tag LOCUS_21120 gene hisE 50389 50054 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_21120 52143 50521 gene locus_tag LOCUS_21130 gene ubiB 52143 50521 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V3 protein_id gnl|my_center|LOCUS_21130 52793 52143 gene locus_tag LOCUS_21140 52793 52143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 53542 52790 gene locus_tag LOCUS_21150 gene ubiE 53542 52790 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V5 protein_id gnl|my_center|LOCUS_21150 54248 53544 gene locus_tag LOCUS_21160 54248 53544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 55769 54444 gene locus_tag LOCUS_21170 gene hslU 55769 54444 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_21170 56330 55806 gene locus_tag LOCUS_21180 gene hslV 56330 55806 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_21180 56402 56617 gene locus_tag LOCUS_21190 56402 56617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 56664 58790 gene locus_tag LOCUS_21200 56664 58790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 59485 58883 gene locus_tag LOCUS_21210 59485 58883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_21210 61317 59575 gene locus_tag LOCUS_21220 gene argS 61317 59575 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V03 protein_id gnl|my_center|LOCUS_21220 63582 61381 gene locus_tag LOCUS_21230 gene priA 63582 61381 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 protein_id gnl|my_center|LOCUS_21230 63908 64129 gene locus_tag LOCUS_21240 gene rpmE 63908 64129 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_21240 64266 65546 gene locus_tag LOCUS_21250 64266 65546 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266374.1 protein_id gnl|my_center|LOCUS_21250 68107 65672 gene locus_tag LOCUS_21260 gene mrcA 68107 65672 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_21260 68426 69460 gene locus_tag LOCUS_21270 68426 69460 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_21270 69457 70032 gene locus_tag LOCUS_21280 gene pilN 69457 70032 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_21280 70029 70673 gene locus_tag LOCUS_21290 gene pilO 70029 70673 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_21290 70676 71203 gene locus_tag LOCUS_21300 gene pilP 70676 71203 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_21300 71207 73324 gene locus_tag LOCUS_21310 gene pilQ 71207 73324 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_21310 73335 73865 gene locus_tag LOCUS_21320 gene aroK 73335 73865 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG11 protein_id gnl|my_center|LOCUS_21320 73887 74972 gene locus_tag LOCUS_21330 gene aroB 73887 74972 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_21330 74974 76257 gene locus_tag LOCUS_21340 74974 76257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 76393 80856 gene locus_tag LOCUS_21350 gene gltB 76393 80856 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_21350 80870 82291 gene locus_tag LOCUS_21360 gene gltD 80870 82291 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_21360 82476 83525 gene locus_tag LOCUS_21370 gene hemE 82476 83525 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZD8 protein_id gnl|my_center|LOCUS_21370 83529 84329 gene locus_tag LOCUS_21380 83529 84329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 84841 84365 gene locus_tag LOCUS_21390 84841 84365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_21390 84904 85956 gene locus_tag LOCUS_21400 84904 85956 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_21400 86924 86019 gene locus_tag LOCUS_21410 gene rdgC 86924 86019 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGP3 protein_id gnl|my_center|LOCUS_21410 87777 87112 gene locus_tag LOCUS_21420 gene bax 87777 87112 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_21420 88320 87982 gene locus_tag LOCUS_21430 88320 87982 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_21430 89082 88345 gene locus_tag LOCUS_21440 89082 88345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 89576 89181 gene locus_tag LOCUS_21450 89576 89181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 90404 89580 gene locus_tag LOCUS_21460 90404 89580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 91296 90589 gene locus_tag LOCUS_21470 gene comB 91296 90589 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06738 protein_id gnl|my_center|LOCUS_21470 91853 91314 gene locus_tag LOCUS_21480 91853 91314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 92832 93980 gene locus_tag LOCUS_21490 gene bioB 92832 93980 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA8 protein_id gnl|my_center|LOCUS_21490 94056 95246 gene locus_tag LOCUS_21500 gene bioF 94056 95246 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_21500 95243 96052 gene locus_tag LOCUS_21510 gene bioH 95243 96052 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF11 protein_id gnl|my_center|LOCUS_21510 96052 96951 gene locus_tag LOCUS_21520 gene bioC 96052 96951 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I615 protein_id gnl|my_center|LOCUS_21520 97032 97658 gene locus_tag LOCUS_21530 gene bioD 97032 97658 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A94 protein_id gnl|my_center|LOCUS_21530 98274 97807 gene locus_tag LOCUS_21540 98274 97807 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_21540 98249 98419 gene locus_tag LOCUS_21550 98249 98419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 99647 98412 gene locus_tag LOCUS_21560 gene phaC1 99647 98412 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_21560 99903 101708 gene locus_tag LOCUS_21570 99903 101708 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_21570 102893 101757 gene locus_tag LOCUS_21580 102893 101757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521899.1 protein_id gnl|my_center|LOCUS_21580 103017 104027 gene locus_tag LOCUS_21590 103017 104027 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_21590 104539 104045 gene locus_tag LOCUS_21600 104539 104045 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_21600 104909 106600 gene locus_tag LOCUS_21610 gene leuA-2 104909 106600 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_21610 106780 107499 gene locus_tag LOCUS_21620 106780 107499 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_21620 107647 108435 gene locus_tag LOCUS_21630 107647 108435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266523.1 protein_id gnl|my_center|LOCUS_21630 109259 108561 gene locus_tag LOCUS_21640 109259 108561 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_21640 110149 109331 gene locus_tag LOCUS_21650 110149 109331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 110936 110214 gene locus_tag LOCUS_21660 gene mtgA 110936 110214 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP9 protein_id gnl|my_center|LOCUS_21660 111964 111083 gene locus_tag LOCUS_21670 111964 111083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 113578 112520 gene locus_tag LOCUS_21680 gene purK 113578 112520 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBG3 protein_id gnl|my_center|LOCUS_21680 114066 113575 gene locus_tag LOCUS_21690 gene purE 114066 113575 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBG4 protein_id gnl|my_center|LOCUS_21690 114777 114271 gene locus_tag LOCUS_21700 114777 114271 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_21700 115264 116157 gene locus_tag LOCUS_21710 115264 116157 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206939.1 protein_id gnl|my_center|LOCUS_21710 116234 116668 gene locus_tag LOCUS_21720 116234 116668 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_21720 118548 116794 gene locus_tag LOCUS_21730 118548 116794 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_21730 118970 119842 gene locus_tag LOCUS_21740 118970 119842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 120723 122165 gene locus_tag LOCUS_21750 120723 122165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975770.1 protein_id gnl|my_center|LOCUS_21750 122245 122997 gene locus_tag LOCUS_21760 122245 122997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 123010 124857 gene locus_tag LOCUS_21770 123010 124857 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970769.1 protein_id gnl|my_center|LOCUS_21770 124841 125593 gene locus_tag LOCUS_21780 124841 125593 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142828.1 protein_id gnl|my_center|LOCUS_21780 125615 126544 gene locus_tag LOCUS_21790 125615 126544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 126658 127602 gene locus_tag LOCUS_21800 gene lppC 126658 127602 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 protein_id gnl|my_center|LOCUS_21800 129647 128580 gene locus_tag LOCUS_21810 129647 128580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 129947 130876 gene locus_tag LOCUS_21820 129947 130876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 131175 133745 gene locus_tag LOCUS_21830 131175 133745 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_21830 133738 135078 gene locus_tag LOCUS_21840 133738 135078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087774.1 protein_id gnl|my_center|LOCUS_21840 135177 135749 gene locus_tag LOCUS_21850 135177 135749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 135746 136390 gene locus_tag LOCUS_21860 135746 136390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_21860 136400 137479 gene locus_tag LOCUS_21870 136400 137479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_21870 137483 140749 gene locus_tag LOCUS_21880 137483 140749 CDS product type I restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_21880 140746 141453 gene locus_tag LOCUS_21890 140746 141453 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_21890 142260 141568 gene locus_tag LOCUS_21900 142260 141568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 protein_id gnl|my_center|LOCUS_21900 143176 142556 gene locus_tag LOCUS_21910 143176 142556 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084729.1 protein_id gnl|my_center|LOCUS_21910 143554 144132 gene locus_tag LOCUS_21920 143554 144132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 144165 144581 gene locus_tag LOCUS_21930 144165 144581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 144647 144913 gene locus_tag LOCUS_21940 144647 144913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 145370 145016 gene locus_tag LOCUS_tm00010 145370 145016 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 145716 145988 gene locus_tag LOCUS_21950 145716 145988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 146827 146348 gene locus_tag LOCUS_21960 gene smpB 146827 146348 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_21960 147117 148505 gene locus_tag LOCUS_21970 147117 148505 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_21970 148512 148820 gene locus_tag LOCUS_21980 148512 148820 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 protein_id gnl|my_center|LOCUS_21980 149474 148968 gene locus_tag LOCUS_21990 149474 148968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 149574 149978 gene locus_tag LOCUS_22000 gene fur 149574 149978 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_22000 151894 150227 gene locus_tag LOCUS_22010 151894 150227 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP5 protein_id gnl|my_center|LOCUS_22010 152018 153088 gene locus_tag LOCUS_22020 gene hrcA 152018 153088 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_22020 153437 153219 gene locus_tag LOCUS_22030 153437 153219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 153426 154052 gene locus_tag LOCUS_22040 gene grpE 153426 154052 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 protein_id gnl|my_center|LOCUS_22040 154218 156143 gene locus_tag LOCUS_22050 gene dnaK 154218 156143 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP7 protein_id gnl|my_center|LOCUS_22050 156267 157388 gene locus_tag LOCUS_22060 gene dnaJ 156267 157388 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_22060 157626 158783 gene locus_tag LOCUS_22070 157626 158783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112749.1 protein_id gnl|my_center|LOCUS_22070 158984 159784 gene locus_tag LOCUS_22080 gene dapB 158984 159784 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_22080 159954 161099 gene locus_tag LOCUS_22090 gene carA 159954 161099 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 protein_id gnl|my_center|LOCUS_22090 161106 164336 gene locus_tag LOCUS_22100 gene carB 161106 164336 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_22100 164336 164812 gene locus_tag LOCUS_22110 gene greA 164336 164812 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW2 protein_id gnl|my_center|LOCUS_22110 165250 164939 gene locus_tag LOCUS_22120 165250 164939 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_22120 >Feature sequence10 520 828 gene locus_tag LOCUS_22130 520 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 941 1771 gene locus_tag LOCUS_22140 941 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1855 2619 gene locus_tag LOCUS_22150 1855 2619 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_22150 3188 4048 gene locus_tag LOCUS_22160 3188 4048 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 protein_id gnl|my_center|LOCUS_22160 4267 4929 gene locus_tag LOCUS_22170 4267 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5044 5487 gene locus_tag LOCUS_22180 5044 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 6498 5548 gene locus_tag LOCUS_22190 6498 5548 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118756.1 protein_id gnl|my_center|LOCUS_22190 6810 7541 gene locus_tag LOCUS_22200 6810 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 7480 7644 gene locus_tag LOCUS_22210 7480 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 8868 7843 gene locus_tag LOCUS_22220 gene tnpA 8868 7843 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073686.1 protein_id gnl|my_center|LOCUS_22220 9213 9443 gene locus_tag LOCUS_22230 9213 9443 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_22230 9443 9844 gene locus_tag LOCUS_22240 gene vapC 9443 9844 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888H9 protein_id gnl|my_center|LOCUS_22240 10110 10394 gene locus_tag LOCUS_22250 10110 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 11194 10490 gene locus_tag LOCUS_22260 11194 10490 CDS product isomerase/hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 protein_id gnl|my_center|LOCUS_22260 12630 11191 gene locus_tag LOCUS_22270 12630 11191 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_22270 12816 14045 gene locus_tag LOCUS_22280 gene serA 12816 14045 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_22280 14217 15572 gene locus_tag LOCUS_22290 14217 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071315.1 protein_id gnl|my_center|LOCUS_22290 15569 15967 gene locus_tag LOCUS_22300 15569 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 15998 16591 gene locus_tag LOCUS_22310 15998 16591 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071314.1 protein_id gnl|my_center|LOCUS_22310 16628 17905 gene locus_tag LOCUS_22320 16628 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 18549 18082 gene locus_tag LOCUS_22330 18549 18082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 19600 18647 gene locus_tag LOCUS_22340 19600 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_22340 19777 20754 gene locus_tag LOCUS_22350 19777 20754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_22350 20751 24140 gene locus_tag LOCUS_22360 20751 24140 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_22360 24563 25858 gene locus_tag LOCUS_22370 24563 25858 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_22370 25851 26837 gene locus_tag LOCUS_22380 25851 26837 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_22380 26862 27893 gene locus_tag LOCUS_22390 26862 27893 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_22390 27897 28460 gene locus_tag LOCUS_22400 27897 28460 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_22400 28591 31798 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcgctgccgcacaggcagcttagaaa 32053 32838 gene locus_tag LOCUS_22410 32053 32838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 33694 32849 gene locus_tag LOCUS_22420 33694 32849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 34782 33700 gene locus_tag LOCUS_22430 34782 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973112.1 protein_id gnl|my_center|LOCUS_22430 36128 35064 gene locus_tag LOCUS_22440 36128 35064 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_22440 37401 36235 gene locus_tag LOCUS_22450 gene pgk 37401 36235 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK3 protein_id gnl|my_center|LOCUS_22450 38502 37432 gene locus_tag LOCUS_22460 gene epD 38502 37432 CDS product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_22460 40509 38503 gene locus_tag LOCUS_22470 gene tktA 40509 38503 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_22470 40777 41799 gene locus_tag LOCUS_22480 40777 41799 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_22480 42004 43164 gene locus_tag LOCUS_22490 gene metK 42004 43164 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_22490 43318 44700 gene locus_tag LOCUS_22500 gene ahcY 43318 44700 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_22500 44925 45764 gene locus_tag LOCUS_22510 44925 45764 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ93 protein_id gnl|my_center|LOCUS_22510 46139 45894 gene locus_tag LOCUS_22520 46139 45894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_22520 46310 47278 gene locus_tag LOCUS_22530 gene cysK 46310 47278 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF5 protein_id gnl|my_center|LOCUS_22530 50491 47354 gene locus_tag LOCUS_22540 50491 47354 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_22540 51633 50500 gene locus_tag LOCUS_22550 51633 50500 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_22550 52402 51665 gene locus_tag LOCUS_22560 52402 51665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 53937 52771 gene locus_tag LOCUS_22570 53937 52771 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_22570 54636 53983 gene locus_tag LOCUS_22580 54636 53983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 55463 54849 gene locus_tag LOCUS_22590 gene rdgB 55463 54849 CDS product dITP/XTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83JS0 protein_id gnl|my_center|LOCUS_22590 56053 55460 gene locus_tag LOCUS_22600 56053 55460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_22600 57251 56040 gene locus_tag LOCUS_22610 gene metX 57251 56040 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_22610 57645 57352 gene locus_tag LOCUS_22620 57645 57352 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ3 protein_id gnl|my_center|LOCUS_22620 58203 57661 gene locus_tag LOCUS_22630 gene yggT 58203 57661 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_22630 59275 58466 gene locus_tag LOCUS_22640 gene proC 59275 58466 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_22640 60135 59425 gene locus_tag LOCUS_22650 60135 59425 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_22650 60302 61336 gene locus_tag LOCUS_22660 gene pilT 60302 61336 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_22660 61423 62544 gene locus_tag LOCUS_22670 gene pilU 61423 62544 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_22670 63806 62679 gene locus_tag LOCUS_22680 gene modC 63806 62679 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_22680 64500 63799 gene locus_tag LOCUS_22690 gene modC 64500 63799 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064503.1 protein_id gnl|my_center|LOCUS_22690 65321 64497 gene locus_tag LOCUS_22700 gene modA 65321 64497 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_22700 66277 65429 gene locus_tag LOCUS_22710 66277 65429 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ00 protein_id gnl|my_center|LOCUS_22710 67327 66338 gene locus_tag LOCUS_22720 67327 66338 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708857.1 protein_id gnl|my_center|LOCUS_22720 67998 67378 gene locus_tag LOCUS_22730 gene azoR 67998 67378 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG7 protein_id gnl|my_center|LOCUS_22730 68156 69079 gene locus_tag LOCUS_22740 68156 69079 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_22740 69133 70062 gene locus_tag LOCUS_22750 69133 70062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 70115 70624 gene locus_tag LOCUS_22760 70115 70624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 71682 70702 gene locus_tag LOCUS_22770 71682 70702 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974978.1 protein_id gnl|my_center|LOCUS_22770 71810 72301 gene locus_tag LOCUS_22780 71810 72301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 72703 77100 gene locus_tag LOCUS_22790 72703 77100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 78492 77206 gene locus_tag LOCUS_22800 gene pyrC' 78492 77206 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_22800 79475 78489 gene locus_tag LOCUS_22810 gene pyrB 79475 78489 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_22810 79986 79477 gene locus_tag LOCUS_22820 gene pyrR 79986 79477 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6W6 protein_id gnl|my_center|LOCUS_22820 80518 80081 gene locus_tag LOCUS_22830 gene yqgF 80518 80081 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NI12 protein_id gnl|my_center|LOCUS_22830 81091 80528 gene locus_tag LOCUS_22840 gene algH 81091 80528 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_22840 82027 81149 gene locus_tag LOCUS_22850 gene tonB3 82027 81149 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_22850 83163 82210 gene locus_tag LOCUS_22860 gene gshB 83163 82210 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_22860 83468 83851 gene locus_tag LOCUS_22870 gene pilG 83468 83851 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_22870 83878 84246 gene locus_tag LOCUS_22880 gene pilH 83878 84246 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_22880 84260 84805 gene locus_tag LOCUS_22890 gene pilI 84260 84805 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_22890 84957 86975 gene locus_tag LOCUS_22900 gene pilJ 84957 86975 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_22900 86983 87891 gene locus_tag LOCUS_22910 gene pilK 86983 87891 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_22910 87904 94833 gene locus_tag LOCUS_22920 87904 94833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 94856 95881 gene locus_tag LOCUS_22930 gene chpB 94856 95881 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_22930 95890 96342 gene locus_tag LOCUS_22940 gene chpC 95890 96342 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_22940 96339 97334 gene locus_tag LOCUS_22950 96339 97334 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_22950 97343 98320 gene locus_tag LOCUS_22960 gene lpxL 97343 98320 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_22960 99053 98334 gene locus_tag LOCUS_22970 99053 98334 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_22970 100428 99055 gene locus_tag LOCUS_22980 gene bioA 100428 99055 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ98 protein_id gnl|my_center|LOCUS_22980 100801 101697 gene locus_tag LOCUS_22990 100801 101697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 101987 102325 gene locus_tag LOCUS_23000 gene glnK 101987 102325 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_23000 102379 103707 gene locus_tag LOCUS_23010 gene amtB 102379 103707 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTR7 protein_id gnl|my_center|LOCUS_23010 104627 103908 gene locus_tag LOCUS_23020 gene trmB 104627 103908 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_23020 104907 105269 gene locus_tag LOCUS_23030 104907 105269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468055.1 protein_id gnl|my_center|LOCUS_23030 105309 105980 gene locus_tag LOCUS_23040 105309 105980 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 protein_id gnl|my_center|LOCUS_23040 106022 106333 gene locus_tag LOCUS_23050 106022 106333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 107108 106326 gene locus_tag LOCUS_23060 gene thiG 107108 106326 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 protein_id gnl|my_center|LOCUS_23060 107364 107167 gene locus_tag LOCUS_23070 107364 107167 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_23070 107811 107437 gene locus_tag LOCUS_23080 107811 107437 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688312.1 protein_id gnl|my_center|LOCUS_23080 108203 107820 gene locus_tag LOCUS_23090 108203 107820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 protein_id gnl|my_center|LOCUS_23090 109519 108200 gene locus_tag LOCUS_23100 109519 108200 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_23100 111492 109642 gene locus_tag LOCUS_23110 gene ilvD 111492 109642 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_23110 112829 111501 gene locus_tag LOCUS_23120 gene argA 112829 111501 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR2 protein_id gnl|my_center|LOCUS_23120 113065 113379 gene locus_tag LOCUS_23130 113065 113379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 113592 114722 gene locus_tag LOCUS_23140 113592 114722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 115508 114888 gene locus_tag LOCUS_23150 115508 114888 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 protein_id gnl|my_center|LOCUS_23150 115673 116599 gene locus_tag LOCUS_23160 115673 116599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704779.1 protein_id gnl|my_center|LOCUS_23160 116650 118155 gene locus_tag LOCUS_23170 116650 118155 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705199.1 protein_id gnl|my_center|LOCUS_23170 118521 119678 gene locus_tag LOCUS_23180 118521 119678 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703503.1 protein_id gnl|my_center|LOCUS_23180 120826 119762 gene locus_tag LOCUS_23190 120826 119762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 120990 121358 gene locus_tag LOCUS_23200 gene merR-2 120990 121358 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640387.1 protein_id gnl|my_center|LOCUS_23200 121454 122779 gene locus_tag LOCUS_23210 121454 122779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 122974 123906 gene locus_tag LOCUS_23220 122974 123906 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039910.1 protein_id gnl|my_center|LOCUS_23220 124277 123951 gene locus_tag LOCUS_23230 124277 123951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212124.1 protein_id gnl|my_center|LOCUS_23230 124974 124261 gene locus_tag LOCUS_23240 124974 124261 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_23240 125519 124971 gene locus_tag LOCUS_23250 125519 124971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 125794 126222 gene locus_tag LOCUS_23260 125794 126222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_23260 127080 126346 gene locus_tag LOCUS_23270 127080 126346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 127510 127169 gene locus_tag LOCUS_23280 127510 127169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706975.1 protein_id gnl|my_center|LOCUS_23280 128579 127938 gene locus_tag LOCUS_23290 128579 127938 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_23290 128844 129368 gene locus_tag LOCUS_23300 gene moaB2 128844 129368 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_23300 129365 130570 gene locus_tag LOCUS_23310 gene moeA1 129365 130570 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence11 464 1945 gene locus_tag LOCUS_23320 464 1945 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_23320 1972 2811 gene locus_tag LOCUS_23330 1972 2811 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_23330 3558 2929 gene locus_tag LOCUS_23340 3558 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957993.1 protein_id gnl|my_center|LOCUS_23340 4237 3572 gene locus_tag LOCUS_23350 4237 3572 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267416.1 protein_id gnl|my_center|LOCUS_23350 4236 4910 gene locus_tag LOCUS_23360 4236 4910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_23360 4903 7485 gene locus_tag LOCUS_23370 4903 7485 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765750.1 protein_id gnl|my_center|LOCUS_23370 8193 10262 gene locus_tag LOCUS_23380 8193 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 10389 11051 gene locus_tag LOCUS_23390 10389 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 11178 11789 gene locus_tag LOCUS_23400 gene msrA 11178 11789 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJL3 protein_id gnl|my_center|LOCUS_23400 11849 12277 gene locus_tag LOCUS_23410 gene msrB 11849 12277 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q6 protein_id gnl|my_center|LOCUS_23410 12409 12484 gene locus_tag LOCUS_t00280 12409 12484 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12735 14279 gene locus_tag LOCUS_23420 12735 14279 CDS product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 protein_id gnl|my_center|LOCUS_23420 14412 16106 gene locus_tag LOCUS_23430 14412 16106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 16475 17638 gene locus_tag LOCUS_23440 16475 17638 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947550.1 protein_id gnl|my_center|LOCUS_23440 17895 18563 gene locus_tag LOCUS_23450 17895 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 18705 21605 gene locus_tag LOCUS_23460 18705 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 21598 22416 gene locus_tag LOCUS_23470 21598 22416 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_23470 24390 22447 gene locus_tag LOCUS_23480 gene wbfY 24390 22447 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_23480 26382 24682 gene locus_tag LOCUS_23490 gene pgi 26382 24682 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS2 protein_id gnl|my_center|LOCUS_23490 27683 26385 gene locus_tag LOCUS_23500 gene udg 27683 26385 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_23500 28601 27696 gene locus_tag LOCUS_23510 gene galU 28601 27696 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNX2 protein_id gnl|my_center|LOCUS_23510 29285 28707 gene locus_tag LOCUS_23520 29285 28707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 30304 29282 gene locus_tag LOCUS_23530 gene wbpL 30304 29282 CDS product glycosyltransferase WbpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 protein_id gnl|my_center|LOCUS_23530 31322 30348 gene locus_tag LOCUS_23540 31322 30348 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_23540 32455 31328 gene locus_tag LOCUS_23550 32455 31328 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_23550 33458 32448 gene locus_tag LOCUS_23560 gene wbjB 33458 32448 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 protein_id gnl|my_center|LOCUS_23560 34400 33543 gene locus_tag LOCUS_23570 34400 33543 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597457.1 protein_id gnl|my_center|LOCUS_23570 35635 34397 gene locus_tag LOCUS_23580 35635 34397 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_23580 36721 35711 gene locus_tag LOCUS_23590 gene galE-1 36721 35711 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_23590 37883 36816 gene locus_tag LOCUS_23600 37883 36816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 39194 37995 gene locus_tag LOCUS_23610 39194 37995 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362618.1 protein_id gnl|my_center|LOCUS_23610 40465 39215 gene locus_tag LOCUS_23620 40465 39215 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_23620 42007 40505 gene locus_tag LOCUS_23630 42007 40505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 43129 42107 gene locus_tag LOCUS_23640 43129 42107 CDS product UDP-N-acetylglucosamine C4 epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 protein_id gnl|my_center|LOCUS_23640 44628 43417 gene locus_tag LOCUS_23650 44628 43417 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_23650 45303 44680 gene locus_tag LOCUS_23660 45303 44680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23660 45905 45300 gene locus_tag LOCUS_23670 45905 45300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23670 46612 45902 gene locus_tag LOCUS_23680 46612 45902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 48827 47685 gene locus_tag LOCUS_23690 48827 47685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 51823 51215 gene locus_tag LOCUS_23700 51823 51215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 53294 52023 gene locus_tag LOCUS_23710 gene wbpO 53294 52023 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039034.1 protein_id gnl|my_center|LOCUS_23710 54006 53356 gene locus_tag LOCUS_23720 gene cysC 54006 53356 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP21 protein_id gnl|my_center|LOCUS_23720 56234 54009 gene locus_tag LOCUS_23730 gene wzc 56234 54009 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 protein_id gnl|my_center|LOCUS_23730 56746 56312 gene locus_tag LOCUS_23740 56746 56312 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458338.1 protein_id gnl|my_center|LOCUS_23740 57879 56746 gene locus_tag LOCUS_23750 gene gfcE 57879 56746 CDS product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_23750 59032 58007 gene locus_tag LOCUS_23760 59032 58007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 59057 59290 gene locus_tag LOCUS_23770 59057 59290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 60185 59883 gene locus_tag LOCUS_23780 60185 59883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 60999 60274 gene locus_tag LOCUS_23790 gene pyrF 60999 60274 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EGH6 protein_id gnl|my_center|LOCUS_23790 62165 60999 gene locus_tag LOCUS_23800 gene lapB 62165 60999 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_23800 62515 62276 gene locus_tag LOCUS_23810 62515 62276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 62862 62521 gene locus_tag LOCUS_23820 gene ihfB 62862 62521 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_23820 64604 62934 gene locus_tag LOCUS_23830 gene rpsA 64604 62934 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_23830 65452 64778 gene locus_tag LOCUS_23840 gene cmk 65452 64778 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_23840 67707 65449 gene locus_tag LOCUS_23850 gene aroA 67707 65449 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_23850 68804 67704 gene locus_tag LOCUS_23860 gene hisC2 68804 67704 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_23860 70080 68980 gene locus_tag LOCUS_23870 70080 68980 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_23870 71152 70073 gene locus_tag LOCUS_23880 gene serC 71152 70073 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_23880 73853 71169 gene locus_tag LOCUS_23890 gene gyrA 73853 71169 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLA2 protein_id gnl|my_center|LOCUS_23890 74149 75627 gene locus_tag LOCUS_23900 74149 75627 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_23900 75624 76358 gene locus_tag LOCUS_23910 gene ubiG 75624 76358 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 protein_id gnl|my_center|LOCUS_23910 76351 77016 gene locus_tag LOCUS_23920 gene gph-2 76351 77016 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103692.1 protein_id gnl|my_center|LOCUS_23920 77097 77867 gene locus_tag LOCUS_23930 77097 77867 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_23930 78249 79454 gene locus_tag LOCUS_23940 78249 79454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_23940 79472 80680 gene locus_tag LOCUS_23950 79472 80680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_23950 82222 80843 gene locus_tag LOCUS_23960 82222 80843 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_23960 82487 83422 gene locus_tag LOCUS_23970 82487 83422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_23970 83481 84494 gene locus_tag LOCUS_23980 83481 84494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_23980 84740 87058 gene locus_tag LOCUS_23990 84740 87058 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_23990 87386 87733 gene locus_tag LOCUS_24000 87386 87733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 88265 87780 gene locus_tag LOCUS_24010 88265 87780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 88621 88265 gene locus_tag LOCUS_24020 88621 88265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 89081 88626 gene locus_tag LOCUS_24030 89081 88626 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_24030 89385 89074 gene locus_tag LOCUS_24040 gene ycgL 89385 89074 CDS product protein YcgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32H41 protein_id gnl|my_center|LOCUS_24040 90479 89382 gene locus_tag LOCUS_24050 gene rnd 90479 89382 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_24050 90641 91387 gene locus_tag LOCUS_24060 gene gpmA 90641 91387 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFC8 protein_id gnl|my_center|LOCUS_24060 92600 91533 gene locus_tag LOCUS_24070 gene lifO 92600 91533 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_24070 93195 94145 gene locus_tag LOCUS_24080 gene lipA 93195 94145 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 protein_id gnl|my_center|LOCUS_24080 94375 95376 gene locus_tag LOCUS_24090 94375 95376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_24090 96648 95494 gene locus_tag LOCUS_24100 96648 95494 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_24100 97412 96804 gene locus_tag LOCUS_24110 gene recR 97412 96804 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NIF8 protein_id gnl|my_center|LOCUS_24110 97795 97478 gene locus_tag LOCUS_24120 97795 97478 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_24120 99641 97860 gene locus_tag LOCUS_24130 gene dnaX 99641 97860 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_24130 102472 100058 gene locus_tag LOCUS_24140 102472 100058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 102755 103759 gene locus_tag LOCUS_24150 gene gap 102755 103759 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU5 protein_id gnl|my_center|LOCUS_24150 104428 103904 gene locus_tag LOCUS_24160 104428 103904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 104835 104759 gene locus_tag LOCUS_t00290 104835 104759 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 105501 105025 gene locus_tag LOCUS_24170 105501 105025 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 protein_id gnl|my_center|LOCUS_24170 106003 105779 gene locus_tag LOCUS_24180 106003 105779 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396478.1 protein_id gnl|my_center|LOCUS_24180 106329 107480 gene locus_tag LOCUS_24190 106329 107480 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_24190 107480 107929 gene locus_tag LOCUS_24200 107480 107929 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_24200 108249 108160 gene locus_tag LOCUS_t00300 108249 108160 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 108645 108457 gene locus_tag LOCUS_24210 gene csrA 108645 108457 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUH3 protein_id gnl|my_center|LOCUS_24210 110140 108917 gene locus_tag LOCUS_24220 gene lysC 110140 108917 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_24220 113010 110383 gene locus_tag LOCUS_24230 gene alaS 113010 110383 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885J0 protein_id gnl|my_center|LOCUS_24230 114001 113234 gene locus_tag LOCUS_24240 114001 113234 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_24240 115173 114493 gene locus_tag LOCUS_24250 115173 114493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 116212 115166 gene locus_tag LOCUS_24260 gene recA 116212 115166 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_24260 116913 116407 gene locus_tag LOCUS_24270 116913 116407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 protein_id gnl|my_center|LOCUS_24270 117926 117039 gene locus_tag LOCUS_24280 117926 117039 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 protein_id gnl|my_center|LOCUS_24280 119061 118075 gene locus_tag LOCUS_24290 gene corA 119061 118075 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLT7 protein_id gnl|my_center|LOCUS_24290 119661 119990 gene locus_tag LOCUS_24300 119661 119990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 120449 120060 gene locus_tag LOCUS_24310 120449 120060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 121432 120446 gene locus_tag LOCUS_24320 121432 120446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 124023 121429 gene locus_tag LOCUS_24330 124023 121429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence12 326 637 gene locus_tag LOCUS_24340 gene rpsJ 326 637 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 protein_id gnl|my_center|LOCUS_24340 682 1317 gene locus_tag LOCUS_24350 gene rplC 682 1317 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD5 protein_id gnl|my_center|LOCUS_24350 1332 1934 gene locus_tag LOCUS_24360 gene rplD 1332 1934 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 protein_id gnl|my_center|LOCUS_24360 1931 2230 gene locus_tag LOCUS_24370 gene rplW 1931 2230 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_24370 2243 3067 gene locus_tag LOCUS_24380 gene rplB 2243 3067 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD8 protein_id gnl|my_center|LOCUS_24380 3086 3361 gene locus_tag LOCUS_24390 gene rpsS 3086 3361 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W7 protein_id gnl|my_center|LOCUS_24390 3373 3714 gene locus_tag LOCUS_24400 gene rplV 3373 3714 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_24400 3719 4417 gene locus_tag LOCUS_24410 gene rpsC 3719 4417 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF87 protein_id gnl|my_center|LOCUS_24410 4433 4846 gene locus_tag LOCUS_24420 gene rplP 4433 4846 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_24420 4850 5041 gene locus_tag LOCUS_24430 gene rpmC 4850 5041 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMA1 protein_id gnl|my_center|LOCUS_24430 5043 5312 gene locus_tag LOCUS_24440 gene rpsQ 5043 5312 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_24440 5360 5728 gene locus_tag LOCUS_24450 gene rplN 5360 5728 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ22 protein_id gnl|my_center|LOCUS_24450 5743 6057 gene locus_tag LOCUS_24460 gene rplX 5743 6057 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_24460 6070 6609 gene locus_tag LOCUS_24470 gene rplE 6070 6609 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ20 protein_id gnl|my_center|LOCUS_24470 6615 6920 gene locus_tag LOCUS_24480 gene rpsN 6615 6920 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ7 protein_id gnl|my_center|LOCUS_24480 6953 7339 gene locus_tag LOCUS_24490 gene rpsH 6953 7339 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_24490 7359 7892 gene locus_tag LOCUS_24500 gene rplF 7359 7892 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_24500 7910 8260 gene locus_tag LOCUS_24510 gene rplR 7910 8260 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_24510 8272 8769 gene locus_tag LOCUS_24520 gene rpsE 8272 8769 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ15 protein_id gnl|my_center|LOCUS_24520 8795 8980 gene locus_tag LOCUS_24530 gene rpmD 8795 8980 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF3 protein_id gnl|my_center|LOCUS_24530 8984 9418 gene locus_tag LOCUS_24540 gene rplO 8984 9418 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E895 protein_id gnl|my_center|LOCUS_24540 9427 10809 gene locus_tag LOCUS_24550 gene secY 9427 10809 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR4 protein_id gnl|my_center|LOCUS_24550 11065 11421 gene locus_tag LOCUS_24560 gene rpsM 11065 11421 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_24560 11448 11840 gene locus_tag LOCUS_24570 gene rpsK 11448 11840 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_24570 11856 12482 gene locus_tag LOCUS_24580 gene rpsD 11856 12482 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_24580 12503 13510 gene locus_tag LOCUS_24590 gene rpoA 12503 13510 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 protein_id gnl|my_center|LOCUS_24590 13563 13949 gene locus_tag LOCUS_24600 gene rplQ 13563 13949 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_24600 16892 14073 gene locus_tag LOCUS_24610 gene uvrA 16892 14073 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_24610 17715 17053 gene locus_tag LOCUS_24620 17715 17053 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462983.1 protein_id gnl|my_center|LOCUS_24620 18003 19304 gene locus_tag LOCUS_24630 18003 19304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000935.1 protein_id gnl|my_center|LOCUS_24630 19353 19841 gene locus_tag LOCUS_24640 gene ssb 19353 19841 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40947 protein_id gnl|my_center|LOCUS_24640 19850 20560 gene locus_tag LOCUS_24650 19850 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 20597 21469 gene locus_tag LOCUS_24660 20597 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 21482 23539 gene locus_tag LOCUS_24670 gene xcpQ 21482 23539 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_24670 23692 24603 gene locus_tag LOCUS_24680 23692 24603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 25712 24681 gene locus_tag LOCUS_24690 25712 24681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 27287 25788 gene locus_tag LOCUS_24700 27287 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 28599 27640 gene locus_tag LOCUS_24710 28599 27640 CDS product fatty acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_24710 30811 28802 gene locus_tag LOCUS_24720 30811 28802 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 protein_id gnl|my_center|LOCUS_24720 31114 31773 gene locus_tag LOCUS_24730 31114 31773 CDS product DNA-binding transcriptional regulator FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838364.1 protein_id gnl|my_center|LOCUS_24730 31906 32247 gene locus_tag LOCUS_24740 31906 32247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 32519 32286 gene locus_tag LOCUS_24750 32519 32286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 32609 33295 gene locus_tag LOCUS_24760 32609 33295 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_24760 33321 33737 gene locus_tag LOCUS_24770 33321 33737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 36204 33751 gene locus_tag LOCUS_24780 gene ladS 36204 33751 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_24780 36466 38712 gene locus_tag LOCUS_24790 36466 38712 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_24790 40085 38757 gene locus_tag LOCUS_24800 gene adcK4 40085 38757 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_24800 40714 40286 gene locus_tag LOCUS_24810 40714 40286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 40971 41351 gene locus_tag LOCUS_24820 40971 41351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 41656 41459 gene locus_tag LOCUS_24830 41656 41459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 42024 43043 gene locus_tag LOCUS_24840 gene oruR 42024 43043 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_24840 43065 43895 gene locus_tag LOCUS_24850 43065 43895 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886761.1 protein_id gnl|my_center|LOCUS_24850 43888 44301 gene locus_tag LOCUS_24860 43888 44301 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390651.1 protein_id gnl|my_center|LOCUS_24860 44294 44476 gene locus_tag LOCUS_24870 44294 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719780.1 protein_id gnl|my_center|LOCUS_24870 44509 45285 gene locus_tag LOCUS_24880 44509 45285 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_24880 45974 45354 gene locus_tag LOCUS_24890 45974 45354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 46261 47124 gene locus_tag LOCUS_24900 46261 47124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 47867 47286 gene locus_tag LOCUS_24910 47867 47286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094953.1 protein_id gnl|my_center|LOCUS_24910 48904 47930 gene locus_tag LOCUS_24920 48904 47930 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230088.2 protein_id gnl|my_center|LOCUS_24920 49246 49557 gene locus_tag LOCUS_24930 gene rplU 49246 49557 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F3 protein_id gnl|my_center|LOCUS_24930 49585 49845 gene locus_tag LOCUS_24940 gene rpmA 49585 49845 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7M0 protein_id gnl|my_center|LOCUS_24940 49988 51205 gene locus_tag LOCUS_24950 gene obg 49988 51205 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK1 protein_id gnl|my_center|LOCUS_24950 51264 52376 gene locus_tag LOCUS_24960 gene proB 51264 52376 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_24960 53830 52409 gene locus_tag LOCUS_24970 53830 52409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 54418 54215 gene locus_tag LOCUS_24980 54418 54215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 54899 56536 gene locus_tag LOCUS_24990 gene mviN 54899 56536 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_24990 56676 57611 gene locus_tag LOCUS_25000 gene ribF 56676 57611 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJE0 protein_id gnl|my_center|LOCUS_25000 57621 60437 gene locus_tag LOCUS_25010 gene ileS 57621 60437 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_25010 60430 60951 gene locus_tag LOCUS_25020 gene lspA 60430 60951 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_25020 60944 61456 gene locus_tag LOCUS_25030 60944 61456 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_25030 61524 62456 gene locus_tag LOCUS_25040 gene ispH 61524 62456 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_25040 62838 63287 gene locus_tag LOCUS_25050 62838 63287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 63289 63798 gene locus_tag LOCUS_25060 63289 63798 CDS product pilus assembly protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980865.1 protein_id gnl|my_center|LOCUS_25060 63795 64577 gene locus_tag LOCUS_25070 63795 64577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 64577 65170 gene locus_tag LOCUS_25080 64577 65170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 65250 69509 gene locus_tag LOCUS_25090 65250 69509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 69568 70005 gene locus_tag LOCUS_25100 gene pilE 69568 70005 CDS product pilus assembly protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_25100 70583 70026 gene locus_tag LOCUS_25110 70583 70026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 70684 71784 gene locus_tag LOCUS_25120 70684 71784 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_25120 73112 71736 gene locus_tag LOCUS_25130 gene pilR 73112 71736 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_25130 74698 73112 gene locus_tag LOCUS_25140 gene pilS 74698 73112 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_25140 74961 74695 gene locus_tag LOCUS_25150 74961 74695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 75037 76671 gene locus_tag LOCUS_25160 gene nadE 75037 76671 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_25160 77791 77048 gene locus_tag LOCUS_25170 77791 77048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 77930 78910 gene locus_tag LOCUS_25180 gene rluD 77930 78910 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI4 protein_id gnl|my_center|LOCUS_25180 78907 79701 gene locus_tag LOCUS_25190 78907 79701 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_25190 >Feature sequence13 <1 6819 gene locus_tag LOCUS_25200 <1 6819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:sulfurtransferase 7132 7764 gene locus_tag LOCUS_25210 7132 7764 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_25210 7989 8690 gene locus_tag LOCUS_25220 7989 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 9751 8627 gene locus_tag LOCUS_25230 9751 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 11021 9741 gene locus_tag LOCUS_25240 11021 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_25240 12426 11023 gene locus_tag LOCUS_25250 12426 11023 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_25250 13476 12550 gene locus_tag LOCUS_25260 13476 12550 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_25260 15047 13563 gene locus_tag LOCUS_25270 gene ubiD 15047 13563 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 protein_id gnl|my_center|LOCUS_25270 16623 15385 gene locus_tag LOCUS_25280 16623 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 16931 17869 gene locus_tag LOCUS_25290 16931 17869 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088676.1 protein_id gnl|my_center|LOCUS_25290 18001 19959 gene locus_tag LOCUS_25300 18001 19959 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948486.1 protein_id gnl|my_center|LOCUS_25300 20363 20058 gene locus_tag LOCUS_25310 20363 20058 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_25310 21760 20501 gene locus_tag LOCUS_25320 gene rho 21760 20501 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_25320 22400 22074 gene locus_tag LOCUS_25330 gene trxA 22400 22074 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_25330 22919 24499 gene locus_tag LOCUS_25340 gene ppx 22919 24499 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 protein_id gnl|my_center|LOCUS_25340 26646 24571 gene locus_tag LOCUS_25350 gene ppk 26646 24571 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_25350 27007 27453 gene locus_tag LOCUS_25360 gene greB 27007 27453 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43882 protein_id gnl|my_center|LOCUS_25360 27551 28240 gene locus_tag LOCUS_25370 27551 28240 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_25370 28652 28323 gene locus_tag LOCUS_25380 28652 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 28895 28698 gene locus_tag LOCUS_25390 28895 28698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 30888 28990 gene locus_tag LOCUS_25400 30888 28990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 protein_id gnl|my_center|LOCUS_25400 31022 31492 gene locus_tag LOCUS_25410 31022 31492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 33862 31517 gene locus_tag LOCUS_25420 33862 31517 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637884.2 protein_id gnl|my_center|LOCUS_25420 34862 34095 gene locus_tag LOCUS_25430 34862 34095 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_25430 35006 35368 gene locus_tag LOCUS_25440 35006 35368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 35407 36120 gene locus_tag LOCUS_25450 35407 36120 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WG9 protein_id gnl|my_center|LOCUS_25450 36714 36232 gene locus_tag LOCUS_25460 36714 36232 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245202.1 protein_id gnl|my_center|LOCUS_25460 37841 37143 gene locus_tag LOCUS_25470 37841 37143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_25470 38182 37838 gene locus_tag LOCUS_25480 38182 37838 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 protein_id gnl|my_center|LOCUS_25480 38714 38184 gene locus_tag LOCUS_25490 gene dsbB 38714 38184 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_25490 40450 38888 gene locus_tag LOCUS_25500 gene gshA 40450 38888 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_25500 42943 40586 gene locus_tag LOCUS_25510 42943 40586 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_25510 43499 43137 gene locus_tag LOCUS_25520 gene pilH 43499 43137 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_25520 43833 44594 gene locus_tag LOCUS_25530 gene ompR 43833 44594 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_25530 44601 45917 gene locus_tag LOCUS_25540 gene envZ 44601 45917 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_25540 45966 46364 gene locus_tag LOCUS_25550 45966 46364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008769922.1 protein_id gnl|my_center|LOCUS_25550 47745 46450 gene locus_tag LOCUS_25560 47745 46450 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887899.1 protein_id gnl|my_center|LOCUS_25560 48054 48803 gene locus_tag LOCUS_25570 48054 48803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 49416 49009 gene locus_tag LOCUS_25580 49416 49009 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_25580 50369 49542 gene locus_tag LOCUS_25590 50369 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 50954 50418 gene locus_tag LOCUS_25600 50954 50418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 51429 52037 gene locus_tag LOCUS_25610 gene gsT 51429 52037 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103353.1 protein_id gnl|my_center|LOCUS_25610 52111 52752 gene locus_tag LOCUS_25620 52111 52752 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_25620 53652 52774 gene locus_tag LOCUS_25630 53652 52774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_25630 53842 54237 gene locus_tag LOCUS_25640 53842 54237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 protein_id gnl|my_center|LOCUS_25640 54339 54545 gene locus_tag LOCUS_25650 54339 54545 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 protein_id gnl|my_center|LOCUS_25650 55318 54923 gene locus_tag LOCUS_25660 55318 54923 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_25660 56647 55955 gene locus_tag LOCUS_25670 56647 55955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 protein_id gnl|my_center|LOCUS_25670 57189 56644 gene locus_tag LOCUS_25680 57189 56644 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_25680 57370 58884 gene locus_tag LOCUS_25690 57370 58884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_25690 58897 59130 gene locus_tag LOCUS_25700 58897 59130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 59127 60296 gene locus_tag LOCUS_25710 59127 60296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142974.1 protein_id gnl|my_center|LOCUS_25710 60293 61417 gene locus_tag LOCUS_25720 60293 61417 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_25720 61918 61478 gene locus_tag LOCUS_25730 61918 61478 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_25730 62533 62195 gene locus_tag LOCUS_25740 62533 62195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 63018 63164 gene locus_tag LOCUS_25750 63018 63164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 63609 63289 gene locus_tag LOCUS_25760 63609 63289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 63952 63707 gene locus_tag LOCUS_25770 63952 63707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 64456 64082 gene locus_tag LOCUS_25780 64456 64082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 65441 64776 gene locus_tag LOCUS_25790 65441 64776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 65982 65500 gene locus_tag LOCUS_25800 65982 65500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 66480 66094 gene locus_tag LOCUS_25810 66480 66094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 67237 67049 gene locus_tag LOCUS_25820 67237 67049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 69185 67641 gene locus_tag LOCUS_25830 gene pckA 69185 67641 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_25830 69965 70159 gene locus_tag LOCUS_25840 69965 70159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 71033 70146 gene locus_tag LOCUS_25850 gene hslO 71033 70146 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_25850 71650 71249 gene locus_tag LOCUS_25860 71650 71249 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EMQ5 protein_id gnl|my_center|LOCUS_25860 72302 71643 gene locus_tag LOCUS_25870 72302 71643 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_25870 72492 73040 gene locus_tag LOCUS_25880 72492 73040 CDS product ADP-ribose diphosphatase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_25880 73078 73947 gene locus_tag LOCUS_25890 73078 73947 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence14 877 209 gene locus_tag LOCUS_25900 877 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1428 973 gene locus_tag LOCUS_25910 1428 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1714 1520 gene locus_tag LOCUS_25920 1714 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2228 1908 gene locus_tag LOCUS_25930 2228 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 2598 2326 gene locus_tag LOCUS_25940 2598 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3141 2611 gene locus_tag LOCUS_25950 3141 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3528 4529 gene locus_tag LOCUS_25960 3528 4529 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263500.1 protein_id gnl|my_center|LOCUS_25960 4999 4712 gene locus_tag LOCUS_25970 4999 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 5293 5087 gene locus_tag LOCUS_25980 gene cspG 5293 5087 CDS product cold shock-like protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A980 protein_id gnl|my_center|LOCUS_25980 6021 5773 gene locus_tag LOCUS_25990 gene rbpD 6021 5773 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_25990 6622 6224 gene locus_tag LOCUS_26000 6622 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 6999 8594 gene locus_tag LOCUS_26010 6999 8594 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_26010 8867 10537 gene locus_tag LOCUS_26020 8867 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 12076 10691 gene locus_tag LOCUS_26030 gene degQ 12076 10691 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886707.1 protein_id gnl|my_center|LOCUS_26030 12983 14917 gene locus_tag LOCUS_26040 12983 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 15161 16363 gene locus_tag LOCUS_26050 15161 16363 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_26050 16422 16721 gene locus_tag LOCUS_26060 16422 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 17095 16778 gene locus_tag LOCUS_26070 17095 16778 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393857.1 protein_id gnl|my_center|LOCUS_26070 17358 18620 gene locus_tag LOCUS_26080 gene yfeW 17358 18620 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_26080 18969 18721 gene locus_tag LOCUS_26090 18969 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 19378 19013 gene locus_tag LOCUS_26100 19378 19013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 19783 21099 gene locus_tag LOCUS_26110 19783 21099 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_26110 21102 22115 gene locus_tag LOCUS_26120 21102 22115 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_26120 23180 22623 gene locus_tag LOCUS_26130 23180 22623 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933067.1 protein_id gnl|my_center|LOCUS_26130 23709 23284 gene locus_tag LOCUS_26140 23709 23284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_26140 23937 24809 gene locus_tag LOCUS_26150 23937 24809 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_26150 26299 25217 gene locus_tag LOCUS_26160 gene thrC 26299 25217 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_26160 27764 26454 gene locus_tag LOCUS_26170 27764 26454 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY1 protein_id gnl|my_center|LOCUS_26170 28975 27761 gene locus_tag LOCUS_26180 28975 27761 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813076.1 protein_id gnl|my_center|LOCUS_26180 29870 29136 gene locus_tag LOCUS_26190 gene dsbC 29870 29136 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_26190 30975 29980 gene locus_tag LOCUS_26200 gene xerD 30975 29980 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_26200 31171 32148 gene locus_tag LOCUS_26210 31171 32148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 32822 32457 gene locus_tag LOCUS_26220 gene rplS 32822 32457 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_26220 33672 32863 gene locus_tag LOCUS_26230 gene trmD 33672 32863 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V0 protein_id gnl|my_center|LOCUS_26230 34268 33738 gene locus_tag LOCUS_26240 gene rimM 34268 33738 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6J4 protein_id gnl|my_center|LOCUS_26240 34519 34268 gene locus_tag LOCUS_26250 gene rpsP 34519 34268 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK22 protein_id gnl|my_center|LOCUS_26250 36252 34771 gene locus_tag LOCUS_26260 gene cobQ 36252 34771 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I467 protein_id gnl|my_center|LOCUS_26260 37249 36611 gene locus_tag LOCUS_26270 gene cobO 37249 36611 CDS product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766671.1 protein_id gnl|my_center|LOCUS_26270 38145 37327 gene locus_tag LOCUS_26280 38145 37327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203863.1 protein_id gnl|my_center|LOCUS_26280 39205 38153 gene locus_tag LOCUS_26290 39205 38153 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_26290 40067 39192 gene locus_tag LOCUS_26300 gene btuF 40067 39192 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_26300 42011 40176 gene locus_tag LOCUS_26310 gene btuB 42011 40176 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038182.1 protein_id gnl|my_center|LOCUS_26310 43601 42441 gene locus_tag LOCUS_26320 gene cobC 43601 42441 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_26320 44674 43637 gene locus_tag LOCUS_26330 gene cobD 44674 43637 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6A8 protein_id gnl|my_center|LOCUS_26330 44957 46048 gene locus_tag LOCUS_26340 gene cobT 44957 46048 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6B1 protein_id gnl|my_center|LOCUS_26340 46038 46679 gene locus_tag LOCUS_26350 46038 46679 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766688.1 protein_id gnl|my_center|LOCUS_26350 46759 47577 gene locus_tag LOCUS_26360 gene cobS 46759 47577 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885W4 protein_id gnl|my_center|LOCUS_26360 48075 47527 gene locus_tag LOCUS_26370 48075 47527 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_26370 48298 48636 gene locus_tag LOCUS_26380 48298 48636 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889189.1 protein_id gnl|my_center|LOCUS_26380 49295 49480 gene locus_tag LOCUS_26390 49295 49480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 50416 49511 gene locus_tag LOCUS_26400 50416 49511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_26400 51452 50457 gene locus_tag LOCUS_26410 51452 50457 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_26410 53012 52074 gene locus_tag LOCUS_26420 53012 52074 CDS product transposase for insertion sequence element IS1111A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45968 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26420 53296 53463 gene locus_tag LOCUS_26430 53296 53463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 53552 54727 gene locus_tag LOCUS_26440 53552 54727 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_26440 54781 55917 gene locus_tag LOCUS_26450 54781 55917 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_26450 55910 57523 gene locus_tag LOCUS_26460 55910 57523 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 protein_id gnl|my_center|LOCUS_26460 57520 58329 gene locus_tag LOCUS_26470 57520 58329 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 protein_id gnl|my_center|LOCUS_26470 58353 59225 gene locus_tag LOCUS_26480 58353 59225 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_26480 60011 59403 gene locus_tag LOCUS_26490 60011 59403 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_26490 60204 61142 gene locus_tag LOCUS_26500 60204 61142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919221.1 protein_id gnl|my_center|LOCUS_26500 61157 61984 gene locus_tag LOCUS_26510 gene ephD 61157 61984 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_26510 62144 63001 gene locus_tag LOCUS_26520 62144 63001 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_26520 63020 64681 gene locus_tag LOCUS_26530 63020 64681 CDS product monoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 protein_id gnl|my_center|LOCUS_26530 67878 64759 gene locus_tag LOCUS_26540 67878 64759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 69284 67893 gene locus_tag LOCUS_26550 69284 67893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 69501 70394 gene locus_tag LOCUS_26560 69501 70394 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_26560 70640 70951 gene locus_tag LOCUS_26570 70640 70951 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625915.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence15 478 1344 gene locus_tag LOCUS_26580 478 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1412 3172 gene locus_tag LOCUS_26590 1412 3172 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113145.1 protein_id gnl|my_center|LOCUS_26590 3383 4258 gene locus_tag LOCUS_26600 3383 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_26600 5644 4388 gene locus_tag LOCUS_26610 5644 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_26610 6517 5672 gene locus_tag LOCUS_26620 6517 5672 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_26620 7543 6530 gene locus_tag LOCUS_26630 7543 6530 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_26630 8950 7574 gene locus_tag LOCUS_26640 8950 7574 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_26640 10461 9286 gene locus_tag LOCUS_26650 10461 9286 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_26650 11106 10462 gene locus_tag LOCUS_26660 11106 10462 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_26660 12312 11455 gene locus_tag LOCUS_26670 12312 11455 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267778.1 protein_id gnl|my_center|LOCUS_26670 12534 12459 gene locus_tag LOCUS_t00310 12534 12459 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12640 12565 gene locus_tag LOCUS_t00320 12640 12565 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14300 12807 gene locus_tag LOCUS_26680 gene gltX 14300 12807 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV02 protein_id gnl|my_center|LOCUS_26680 15714 14446 gene locus_tag LOCUS_26690 15714 14446 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_26690 16360 15893 gene locus_tag LOCUS_26700 16360 15893 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_26700 17445 16357 gene locus_tag LOCUS_26710 gene gpsA 17445 16357 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_26710 18463 17564 gene locus_tag LOCUS_26720 18463 17564 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_26720 20140 18464 gene locus_tag LOCUS_26730 20140 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 20243 21139 gene locus_tag LOCUS_26740 20243 21139 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957705.1 protein_id gnl|my_center|LOCUS_26740 21326 21607 gene locus_tag LOCUS_26750 21326 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 21943 21734 gene locus_tag LOCUS_26760 21943 21734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 23117 22242 gene locus_tag LOCUS_26770 gene sucD 23117 22242 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY38 protein_id gnl|my_center|LOCUS_26770 24283 23114 gene locus_tag LOCUS_26780 gene sucC 24283 23114 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_26780 25861 24419 gene locus_tag LOCUS_26790 gene lpdG 25861 24419 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_26790 27143 25893 gene locus_tag LOCUS_26800 gene sucB 27143 25893 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_26800 30008 27174 gene locus_tag LOCUS_26810 gene sucA 30008 27174 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_26810 30669 31886 gene locus_tag LOCUS_26820 30669 31886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 32898 32182 gene locus_tag LOCUS_26830 gene sdhB 32898 32182 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 protein_id gnl|my_center|LOCUS_26830 34686 32914 gene locus_tag LOCUS_26840 34686 32914 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX2 protein_id gnl|my_center|LOCUS_26840 35061 34690 gene locus_tag LOCUS_26850 gene sdhD 35061 34690 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XF75 protein_id gnl|my_center|LOCUS_26850 35438 35058 gene locus_tag LOCUS_26860 gene sdhC 35438 35058 CDS product succinate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_26860 35863 37149 gene locus_tag LOCUS_26870 gene gltA 35863 37149 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_26870 37408 38508 gene locus_tag LOCUS_26880 37408 38508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_26880 38501 39382 gene locus_tag LOCUS_26890 38501 39382 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_26890 39510 39791 gene locus_tag LOCUS_26900 39510 39791 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_26900 40696 40247 gene locus_tag LOCUS_26910 gene ibpA 40696 40247 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_26910 43169 40878 gene locus_tag LOCUS_26920 43169 40878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 43804 43148 gene locus_tag LOCUS_26930 43804 43148 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706239.1 protein_id gnl|my_center|LOCUS_26930 44127 44810 gene locus_tag LOCUS_26940 44127 44810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 45482 44853 gene locus_tag LOCUS_26950 45482 44853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 45619 46173 gene locus_tag LOCUS_26960 45619 46173 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_26960 46233 47039 gene locus_tag LOCUS_26970 46233 47039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 protein_id gnl|my_center|LOCUS_26970 47005 48039 gene locus_tag LOCUS_26980 47005 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_26980 48033 48608 gene locus_tag LOCUS_26990 48033 48608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 48877 50214 gene locus_tag LOCUS_27000 48877 50214 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ58 protein_id gnl|my_center|LOCUS_27000 52469 50238 gene locus_tag LOCUS_27010 52469 50238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 55791 52615 gene locus_tag LOCUS_27020 55791 52615 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_27020 56975 55788 gene locus_tag LOCUS_27030 56975 55788 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_27030 58120 57029 gene locus_tag LOCUS_27040 58120 57029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 59757 58117 gene locus_tag LOCUS_27050 59757 58117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 protein_id gnl|my_center|LOCUS_27050 60602 59754 gene locus_tag LOCUS_27060 60602 59754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_27060 60892 61899 gene locus_tag LOCUS_27070 60892 61899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence16 1396 197 gene locus_tag LOCUS_27080 gene tyrS2 1396 197 CDS product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q3 protein_id gnl|my_center|LOCUS_27080 1551 2861 gene locus_tag LOCUS_27090 1551 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_27090 2848 3945 gene locus_tag LOCUS_27100 gene anmK 2848 3945 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 protein_id gnl|my_center|LOCUS_27100 4889 4014 gene locus_tag LOCUS_27110 4889 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 5481 4978 gene locus_tag LOCUS_27120 5481 4978 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704824.1 protein_id gnl|my_center|LOCUS_27120 7115 5628 gene locus_tag LOCUS_27130 7115 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 8370 7195 gene locus_tag LOCUS_27140 8370 7195 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_27140 8958 8572 gene locus_tag LOCUS_27150 gene erpA 8958 8572 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_27150 9495 9034 gene locus_tag LOCUS_27160 9495 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 10237 9479 gene locus_tag LOCUS_27170 10237 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 11333 10278 gene locus_tag LOCUS_27180 gene argC 11333 10278 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_27180 12832 11438 gene locus_tag LOCUS_27190 12832 11438 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528814.1 protein_id gnl|my_center|LOCUS_27190 13056 13484 gene locus_tag LOCUS_27200 13056 13484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_27200 13484 14302 gene locus_tag LOCUS_27210 gene thiD 13484 14302 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_27210 14310 14945 gene locus_tag LOCUS_27220 gene thiE 14310 14945 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_27220 14945 16231 gene locus_tag LOCUS_27230 gene hemL 14945 16231 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_27230 16645 16277 gene locus_tag LOCUS_27240 16645 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 17153 16686 gene locus_tag LOCUS_27250 17153 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 19456 17129 gene locus_tag LOCUS_27260 gene mrcB 19456 17129 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_27260 19623 20648 gene locus_tag LOCUS_27270 19623 20648 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_27270 20655 20987 gene locus_tag LOCUS_27280 20655 20987 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246097.1 protein_id gnl|my_center|LOCUS_27280 21375 21995 gene locus_tag LOCUS_27290 21375 21995 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402307.1 protein_id gnl|my_center|LOCUS_27290 23164 22421 gene locus_tag LOCUS_27300 gene sfsA 23164 22421 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUC5 protein_id gnl|my_center|LOCUS_27300 24384 23161 gene locus_tag LOCUS_27310 24384 23161 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_27310 24543 25703 gene locus_tag LOCUS_27320 24543 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 25882 26781 gene locus_tag LOCUS_27330 gene gluQ 25882 26781 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P9 protein_id gnl|my_center|LOCUS_27330 26696 26992 gene locus_tag LOCUS_27340 26696 26992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 26982 29924 gene locus_tag LOCUS_27350 26982 29924 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246100.1 protein_id gnl|my_center|LOCUS_27350 29927 31279 gene locus_tag LOCUS_27360 gene cbrB 29927 31279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_27360 31852 33258 gene locus_tag LOCUS_27370 gene pcnB 31852 33258 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_27370 33263 33769 gene locus_tag LOCUS_27380 gene folK 33263 33769 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420858.1 protein_id gnl|my_center|LOCUS_27380 33766 34440 gene locus_tag LOCUS_27390 33766 34440 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_27390 34546 35334 gene locus_tag LOCUS_27400 gene panB 34546 35334 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY86 protein_id gnl|my_center|LOCUS_27400 35544 35305 gene locus_tag LOCUS_27410 35544 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 35428 36276 gene locus_tag LOCUS_27420 gene panC 35428 36276 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 protein_id gnl|my_center|LOCUS_27420 36382 36762 gene locus_tag LOCUS_27430 gene panD 36382 36762 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 protein_id gnl|my_center|LOCUS_27430 36977 38914 gene locus_tag LOCUS_27440 gene acsA2 36977 38914 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_27440 39008 39319 gene locus_tag LOCUS_27450 39008 39319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 41549 39426 gene locus_tag LOCUS_27460 gene pnp 41549 39426 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_27460 41928 41659 gene locus_tag LOCUS_27470 gene rpsO 41928 41659 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMU7 protein_id gnl|my_center|LOCUS_27470 43063 42134 gene locus_tag LOCUS_27480 gene truB 43063 42134 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M04 protein_id gnl|my_center|LOCUS_27480 43523 43080 gene locus_tag LOCUS_27490 gene rbfA 43523 43080 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_27490 46271 43551 gene locus_tag LOCUS_27500 gene infB 46271 43551 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L5 protein_id gnl|my_center|LOCUS_27500 47833 46328 gene locus_tag LOCUS_27510 gene nusA 47833 46328 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_27510 48334 47879 gene locus_tag LOCUS_27520 gene rimP 48334 47879 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_27520 48566 48490 gene locus_tag LOCUS_t00330 48566 48490 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49072 48987 gene locus_tag LOCUS_t00340 49072 48987 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49516 49106 gene locus_tag LOCUS_27530 gene secG 49516 49106 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_27530 50286 49525 gene locus_tag LOCUS_27540 gene tpiA 50286 49525 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_27540 51707 50361 gene locus_tag LOCUS_27550 gene glmM 51707 50361 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ0 protein_id gnl|my_center|LOCUS_27550 52690 51797 gene locus_tag LOCUS_27560 gene folP 52690 51797 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_27560 54649 52694 gene locus_tag LOCUS_27570 gene ftsH 54649 52694 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_27570 55380 54757 gene locus_tag LOCUS_27580 gene rlmE 55380 54757 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_27580 >Feature sequence17 1821 400 gene locus_tag LOCUS_27590 1821 400 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 protein_id gnl|my_center|LOCUS_27590 2201 1845 gene locus_tag LOCUS_27600 2201 1845 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104253.1 protein_id gnl|my_center|LOCUS_27600 2503 2198 gene locus_tag LOCUS_27610 2503 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2613 3137 gene locus_tag LOCUS_27620 2613 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 6044 3693 gene locus_tag LOCUS_27630 6044 3693 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 protein_id gnl|my_center|LOCUS_27630 7046 6051 gene locus_tag LOCUS_27640 7046 6051 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_27640 7259 7086 gene locus_tag LOCUS_27650 7259 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 7913 7554 gene locus_tag LOCUS_27660 7913 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27660 8263 7964 gene locus_tag LOCUS_27670 8263 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27670 8511 8846 gene locus_tag LOCUS_27680 8511 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 8912 9406 gene locus_tag LOCUS_27690 8912 9406 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR57 protein_id gnl|my_center|LOCUS_27690 9509 10468 gene locus_tag LOCUS_27700 9509 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_27700 10549 11058 gene locus_tag LOCUS_27710 10549 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 11055 12056 gene locus_tag LOCUS_27720 11055 12056 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_27720 12126 13019 gene locus_tag LOCUS_27730 12126 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705013.1 protein_id gnl|my_center|LOCUS_27730 13345 13016 gene locus_tag LOCUS_27740 13345 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 13738 13923 gene locus_tag LOCUS_27750 13738 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 13993 14556 gene locus_tag LOCUS_27760 13993 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 14574 14894 gene locus_tag LOCUS_27770 14574 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 14987 16207 gene locus_tag LOCUS_27780 14987 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 16475 16323 gene locus_tag LOCUS_27790 16475 16323 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 protein_id gnl|my_center|LOCUS_27790 17242 16568 gene locus_tag LOCUS_27800 gene yagK 17242 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263371.1 protein_id gnl|my_center|LOCUS_27800 18481 17648 gene locus_tag LOCUS_27810 18481 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 19285 19995 gene locus_tag LOCUS_27820 19285 19995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 20235 20867 gene locus_tag LOCUS_27830 gene gmk 20235 20867 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_27830 20898 21164 gene locus_tag LOCUS_27840 gene rpoZ 20898 21164 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY9 protein_id gnl|my_center|LOCUS_27840 21517 23622 gene locus_tag LOCUS_27850 gene spoT 21517 23622 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_27850 23715 24101 gene locus_tag LOCUS_27860 23715 24101 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_27860 25083 24193 gene locus_tag LOCUS_27870 25083 24193 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_27870 25230 26132 gene locus_tag LOCUS_27880 25230 26132 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 protein_id gnl|my_center|LOCUS_27880 26129 28201 gene locus_tag LOCUS_27890 gene recG 26129 28201 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_27890 28386 28832 gene locus_tag LOCUS_27900 28386 28832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 29354 28905 gene locus_tag LOCUS_27910 gene ytoQ 29354 28905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_27910 29599 29369 gene locus_tag LOCUS_27920 29599 29369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 31689 29596 gene locus_tag LOCUS_27930 gene prlC 31689 29596 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114658.1 protein_id gnl|my_center|LOCUS_27930 31803 32366 gene locus_tag LOCUS_27940 31803 32366 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_27940 33358 32363 gene locus_tag LOCUS_27950 33358 32363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 34180 33362 gene locus_tag LOCUS_27960 gene aroE 34180 33362 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S3 protein_id gnl|my_center|LOCUS_27960 35166 34249 gene locus_tag LOCUS_27970 gene hemF 35166 34249 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ2 protein_id gnl|my_center|LOCUS_27970 35785 35234 gene locus_tag LOCUS_27980 gene tsaC 35785 35234 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX6 protein_id gnl|my_center|LOCUS_27980 37066 35945 gene locus_tag LOCUS_27990 37066 35945 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461424.1 protein_id gnl|my_center|LOCUS_27990 38291 37218 gene locus_tag LOCUS_28000 38291 37218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_28000 38436 38942 gene locus_tag LOCUS_28010 gene def 38436 38942 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_28010 39113 40072 gene locus_tag LOCUS_28020 gene fmt 39113 40072 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85732 protein_id gnl|my_center|LOCUS_28020 40059 41363 gene locus_tag LOCUS_28030 gene rsmB 40059 41363 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_28030 41382 42755 gene locus_tag LOCUS_28040 gene trkA 41382 42755 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_28040 42767 44212 gene locus_tag LOCUS_28050 gene trkH 42767 44212 CDS product trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3C8 protein_id gnl|my_center|LOCUS_28050 45602 44454 gene locus_tag LOCUS_28060 gene alkB2 45602 44454 CDS product alkane 1-monooxygenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6H941 protein_id gnl|my_center|LOCUS_28060 45816 46532 gene locus_tag LOCUS_28070 45816 46532 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_28070 46651 47514 gene locus_tag LOCUS_28080 gene rpoH 46651 47514 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_28080 49050 50243 gene locus_tag LOCUS_28090 49050 50243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence18 911 369 gene locus_tag LOCUS_28100 gene slyD 911 369 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_28100 978 1973 gene locus_tag LOCUS_28110 gene moaA 978 1973 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 protein_id gnl|my_center|LOCUS_28110 2099 3613 gene locus_tag LOCUS_28120 gene ilvA1 2099 3613 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_28120 3661 4059 gene locus_tag LOCUS_28130 3661 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 4388 4564 gene locus_tag LOCUS_28140 4388 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 5245 4586 gene locus_tag LOCUS_28150 5245 4586 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_28150 5913 5599 gene locus_tag LOCUS_28160 5913 5599 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZN2 protein_id gnl|my_center|LOCUS_28160 6122 5910 gene locus_tag LOCUS_28170 6122 5910 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551573.1 protein_id gnl|my_center|LOCUS_28170 6146 6325 gene locus_tag LOCUS_28180 6146 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6448 7047 gene locus_tag LOCUS_28190 6448 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266317.1 protein_id gnl|my_center|LOCUS_28190 7140 8558 gene locus_tag LOCUS_28200 gene pepP 7140 8558 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_28200 8555 9742 gene locus_tag LOCUS_28210 gene ubiH 8555 9742 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_28210 9735 11012 gene locus_tag LOCUS_28220 9735 11012 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_28220 11199 11047 gene locus_tag LOCUS_28230 11199 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 11430 12704 gene locus_tag LOCUS_28240 11430 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 12715 15909 gene locus_tag LOCUS_28250 12715 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 16387 17721 gene locus_tag LOCUS_28260 16387 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 17733 20885 gene locus_tag LOCUS_28270 17733 20885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 21135 22211 gene locus_tag LOCUS_28280 gene gcvT 21135 22211 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_28280 22309 22698 gene locus_tag LOCUS_28290 gene gcvH 22309 22698 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_28290 22837 24204 gene locus_tag LOCUS_28300 gene gcvPA 22837 24204 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ95 protein_id gnl|my_center|LOCUS_28300 24201 25664 gene locus_tag LOCUS_28310 gene gcvPB 24201 25664 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ97 protein_id gnl|my_center|LOCUS_28310 26013 26726 gene locus_tag LOCUS_28320 26013 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 27814 26819 gene locus_tag LOCUS_28330 27814 26819 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266307.1 protein_id gnl|my_center|LOCUS_28330 28524 27871 gene locus_tag LOCUS_28340 gene rpiA 28524 27871 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHR7 protein_id gnl|my_center|LOCUS_28340 29076 28684 gene locus_tag LOCUS_28350 29076 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_457621.1 protein_id gnl|my_center|LOCUS_28350 30165 29479 gene locus_tag LOCUS_28360 30165 29479 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence19 1791 538 gene locus_tag LOCUS_28370 gene intA 1791 538 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 protein_id gnl|my_center|LOCUS_28370 2938 2084 gene locus_tag LOCUS_28380 2938 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246513.1 protein_id gnl|my_center|LOCUS_28380 3165 3881 gene locus_tag LOCUS_28390 gene rph 3165 3881 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_28390 3933 4592 gene locus_tag LOCUS_28400 gene pyrE 3933 4592 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_28400 4592 5230 gene locus_tag LOCUS_28410 4592 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 5822 5220 gene locus_tag LOCUS_28420 gene slmA 5822 5220 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_28420 6732 5833 gene locus_tag LOCUS_28430 gene argB 6732 5833 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_28430 9217 6743 gene locus_tag LOCUS_28440 9217 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 9688 9236 gene locus_tag LOCUS_28450 gene dut 9688 9236 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN3 protein_id gnl|my_center|LOCUS_28450 10929 9730 gene locus_tag LOCUS_28460 gene coaC 10929 9730 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_28460 11064 11738 gene locus_tag LOCUS_28470 11064 11738 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P456 protein_id gnl|my_center|LOCUS_28470 11873 12109 gene locus_tag LOCUS_28480 gene rpmB 11873 12109 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM34 protein_id gnl|my_center|LOCUS_28480 12120 12290 gene locus_tag LOCUS_28490 gene rpmG 12120 12290 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44369 protein_id gnl|my_center|LOCUS_28490 13645 12455 gene locus_tag LOCUS_28500 13645 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 13844 15541 gene locus_tag LOCUS_28510 13844 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115686.1 protein_id gnl|my_center|LOCUS_28510 15516 22313 gene locus_tag LOCUS_28520 15516 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 22316 22972 gene locus_tag LOCUS_28530 22316 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence20 1314 646 gene locus_tag LOCUS_28540 gene engB 1314 646 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT0 protein_id gnl|my_center|LOCUS_28540 1497 1781 gene locus_tag LOCUS_28550 gene scyA 1497 1781 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_28550 1791 2438 gene locus_tag LOCUS_28560 gene cc4 1791 2438 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_28560 2719 3381 gene locus_tag LOCUS_28570 gene dsbA 2719 3381 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_28570 3400 4311 gene locus_tag LOCUS_28580 3400 4311 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_28580 4311 7652 gene locus_tag LOCUS_28590 gene recC 4311 7652 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74RY3 protein_id gnl|my_center|LOCUS_28590 7645 11196 gene locus_tag LOCUS_28600 gene recB 7645 11196 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI1 protein_id gnl|my_center|LOCUS_28600 11193 13184 gene locus_tag LOCUS_28610 gene recD 11193 13184 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04993 protein_id gnl|my_center|LOCUS_28610 13418 13636 gene locus_tag LOCUS_28620 13418 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 14247 15023 gene locus_tag LOCUS_28630 14247 15023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 15029 16849 gene locus_tag LOCUS_28640 15029 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 16849 17475 gene locus_tag LOCUS_28650 16849 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence21 205 2781 gene locus_tag LOCUS_28660 gene clpB 205 2781 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_28660 3404 2892 gene locus_tag LOCUS_28670 3404 2892 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246093.1 protein_id gnl|my_center|LOCUS_28670 3858 5579 gene locus_tag LOCUS_28680 gene ilvI 3858 5579 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_28680 5582 6070 gene locus_tag LOCUS_28690 gene ilvH 5582 6070 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 protein_id gnl|my_center|LOCUS_28690 6167 7183 gene locus_tag LOCUS_28700 gene ilvC 6167 7183 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 protein_id gnl|my_center|LOCUS_28700 7367 8164 gene locus_tag LOCUS_28710 gene pssA 7367 8164 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_28710 8295 9338 gene locus_tag LOCUS_28720 gene msrP 8295 9338 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_28720 9425 9934 gene locus_tag LOCUS_28730 gene msrQ 9425 9934 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 protein_id gnl|my_center|LOCUS_28730