COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1027772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(654..1517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1727..2815) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2819..3568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(3591..4640) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene holA CDS complement(4621..5136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5149..7611) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DY1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene leuS CDS 7871..8182 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene rplU CDS 8198..8455 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS9 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rpmA CDS 8618..9829 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene obg CDS 9863..10984 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene proB CDS 11247..11501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11498..12250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 12391..13359 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13398..14261 product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76329 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene yedP CDS 14261..15478 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(15653..17641) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(17800..19551) product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(19610..20161) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3J2 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene idnK CDS 20295..21335 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(21332..23692) product cellobionic acid phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3J4 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(23765..25399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(25664..25951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(26127..26393) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rpsT CDS complement(26493..28682) product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(28685..29380) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 29458..31221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 31218..32666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(32671..33021) product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(33041..33310) product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(33295..33810) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(33803..35341) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(35338..35679) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(35679..38516) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(38912..39451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(39500..40528) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(40606..41559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 42113..43363 product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 43363..46524 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 46615..47184 product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D4 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(47188..48105) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(48092..51475) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 51869..53137 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 53249..54175 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 54188..55348 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083790.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 55345..56094 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 56105..56794 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 56860..57903 product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P11436 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene amiE CDS 57965..59035 product ATP-dependent protease ATP-binding subunit-like protein AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51416 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene amiB CDS 59300..60532 product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene fmdA CDS 60536..60904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 61113..62354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(62398..63093) product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 63267..64889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 64957..65790 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980161.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 65863..67281 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(67290..67637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 67702..68739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120893.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 68780..69253 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene fxsA CDS complement(69243..69446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 69497..69787 product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X13 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene groS CDS 69838..71487 product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene groL CDS 71715..72296 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 72505..73293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 73639..75159 product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 75250..75588 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 75677..76813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(76810..77535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(77583..78212) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 78317..79795 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG2 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene sbcB CDS 79937..81829 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 81922..83247 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene argG CDS 83478..84926 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene ccoN1 CDS 84939..85550 product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene ccoO1 CDS 85550..85723 product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 85762..86667 product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene ccoP1 CDS 86778..88199 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 88267..88800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene ccoH CDS 88819..91191 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 91213..91455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 91448..92185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 92455..94173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 94373..95314 product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 95338..96645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 96756..97229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(97379..98710) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene cpxA CDS complement(98707..99408) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene cpxR CDS complement(99486..100331) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene mscS CDS complement(100531..101247) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(101247..101912) product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(101912..102964) product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(103016..105328) product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB8 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(105328..105966) product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX3 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(105985..106560) product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rnfA CDS complement(106762..108780) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN0 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene metG CDS 109024..110115 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 110735..111625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 111805..113211 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 113573..114142 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W86 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene dcd CDS 114460..115320 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(115395..116678) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH8 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene aroA CDS complement(116788..117780) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 117867..118421 product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 118712..119776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 119815..121809 product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 121838..122548 product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene gufA CDS 122582..123322 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 123350..124252 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(124311..124703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(124745..125953) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene gltS CDS complement(126063..128147) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 128321..129337 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 129462..131360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 132181..132735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 132959..133948 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIR3 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(133949..134569) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rlmE CDS 134775..136439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764923.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 136436..137164 product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 137356..137868 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene yjdF CDS 137958..138938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 139187..139657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 139672..140532 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(140639..141445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(141436..141822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(141822..144338) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene qoxA CDS complement(144335..145342) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 145334..145789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(145854..146288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 146901..147980 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887856.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 148143..149174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(149391..150488) product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene gfo CDS 150917..152773 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 153239..153844 product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene cobO CDS 154333..155871 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885W8 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene cobQ CDS 155868..156890 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 156887..157723 product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene hmuV CDS 157720..158247 product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene cobP CDS 158252..159301 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6B1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene cobT CDS 159291..159878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 159882..160694 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I463 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene cobS CDS 160688..161626 product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ62 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene cobD CDS 161619..162674 product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene cobC CDS 162678..163610 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene btuF CDS 163717..164574 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 164603..164953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 164970..165155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(165266..168634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 168973..171741 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene cirA CDS complement(171993..172475) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene slyD CDS complement(172535..173281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(173297..173947) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene purN CDS complement(173956..175008) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM24 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene purM CDS 175252..176358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 176368..177078 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 177276..179075 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene egl2 CDS complement(179143..179832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(179843..180649) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA9 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(180663..181199) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(181232..181537) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 181703..182746 product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 182761..184257 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene gltX tRNA 184777..184852 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 185182..187191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 187188..188606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 188606..189394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(189413..191071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(191247..191399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(191796..192266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(192430..193320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(193339..194490) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 195170..195358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(195790..196113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 196027..197073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(197474..197773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 197968..198207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 198360..199562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(199727..200089) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 200357..200764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(201125..202138) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(202595..202978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(202975..203622) product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 203855..204502 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 204639..205538 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 205744..206829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(207021..207392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(207724..208620) product putative lipid kinase YegS-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IB3 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 208898..209737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(209758..209928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 210111..213455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 213452..214432 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(215056..216330) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene metY CDS complement(216391..216780) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 217229..218071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 218637..222491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 223609..226641 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 226822..227541 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 227655..229088 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene prnA CDS 229142..230161 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 230227..231261 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 231518..234094 product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene celD CDS 234689..237709 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(238032..238682) product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(238663..240396) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene proS CDS 240647..241123 product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(241184..241591) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(241789..242604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(242625..243125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(243156..243638) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(243635..244822) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(244870..246234) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(246397..247032) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene hflD CDS complement(247074..248186) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene mnmA CDS complement(248235..248684) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(248681..249316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(249431..249655) product cold shock domain protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene cspD CDS 250226..250615 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS0 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene clpS CDS 250745..253018 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene clpA CDS complement(253274..253492) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene infA CDS complement(253631..254338) product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene ate CDS complement(254432..255151) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS4 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene aat CDS complement(255301..256236) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene trxB1 CDS 256483..258825 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M3 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene ftsK CDS 258843..259478 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene lolA CDS 259489..260844 product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 260856..261233 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U893 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene crcB CDS 261258..262586 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL5 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene serS CDS 262590..263984 product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene cysG CDS 264057..264296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 264381..265730 product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene gor CDS 265902..266351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 266878..268065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(268127..268729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(268838..270112) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene gltA CDS 270899..271273 product succinate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene sdhC CDS 271267..271635 product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D6 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene sdhD CDS 271639..273411 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene sdhA CDS 273426..274130 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene sdhB CDS 274405..277236 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene sucA CDS 277283..278527 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene sucB CDS 278625..280079 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene lpdG CDS 280290..281456 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene sucC CDS 281457..282329 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene sucD CDS 282559..284475 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F01 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene speA CDS 284501..285703 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene lys1 CDS 285774..286943 product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A53 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene nspC CDS complement(286950..287477) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 288282..291272 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene iroN CDS 291351..292829 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(292984..293151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 293209..294564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 294723..295235 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 295261..296604 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528682.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 296601..297602 product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 297694..298350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 298621..299079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(299060..300946) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQK4 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(301004..301441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(301438..302043) product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(302051..302398) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 302605..302970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 303047..304303 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene avtA CDS complement(304656..305006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(305043..306377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 306581..306898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 306941..310444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 310441..311478 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 311605..311901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 311947..313737 product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene aspS CDS 313821..314567 product transcriptional regulatory protein PmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51423 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene pmpR CDS 314652..315158 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QV1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene ruvC CDS 315192..315803 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF2 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene ruvA CDS 315813..316835 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene ruvB CDS 316832..317263 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 317349..318050 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene tolQ CDS 318117..318509 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene tolR CDS 318526..319329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 319326..320612 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y40 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene tolB CDS 320658..321170 product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z4 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene pal CDS 321181..322035 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 322207..322464 product Trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A882 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene trpR CDS 322474..323871 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 323868..324530 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene pabA CDS complement(324588..325568) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(325695..326768) product hyaluronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 327110..328753 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM2 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene pgi CDS 329002..330834 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene edd CDS 330878..332353 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene zwf CDS 332365..333072 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene pgl CDS 333105..333737 product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 333865..334875 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK56 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene gap CDS 334888..336324 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW72 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene pykA CDS 336446..337288 product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 337382..337579 product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 337645..340239 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene alaS CDS 340372..341607 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene lysC CDS 341841..342032 product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene csrA tRNA 342252..342341 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 343121..345397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(345556..345945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(346250..349105) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI0 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene valS CDS 349304..352372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(352473..353507) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene dapD CDS complement(353552..353902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(353949..354641) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene nth CDS complement(354644..355840) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(355924..358626) product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene glnD CDS complement(358630..359400) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene map CDS 359831..360574 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rpsB CDS 360681..361220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 note possible pseudo, frameshifted CDS 361168..361548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 note possible pseudo, frameshifted CDS 361655..362398 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene pyrH CDS 362388..362945 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene frr CDS 363026..363787 product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene uppS CDS 363780..364640 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene cdsA-1 CDS 364633..365838 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene dxr CDS 365855..367210 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 367305..369977 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene opr86 CDS 370065..370586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 370604..371632 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene lpxD CDS 371712..372149 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene fabZ CDS 372168..372944 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene lpxA CDS 372953..374146 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene lpxB CDS 374158..374763 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rnhB CDS 374874..378275 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR3 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(378467..379060) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 379275..379772 product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene ectA CDS 379857..381131 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene ectB CDS 381201..381599 product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC3 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene ectC CDS 381702..383138 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 383126..384049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 384418..386052 product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BU4 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene opgG CDS 386081..387955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(387959..389671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(389696..391693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(391690..392739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(392732..393241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(393238..394212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(394222..395181) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 395552..400411 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 400692..400985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 401257..401991 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQT7 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene pyrF CDS 401981..402655 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene cmk CDS 402895..404256 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 404311..405204 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD9 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene galU CDS 405480..407168 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene rpsA CDS 407397..407687 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NM62 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene ihfB CDS 407733..408032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 408037..409224 product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVL7 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene lapB CDS 409351..410754 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 410847..412271 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 412261..413238 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 413235..414272 product glycosyltransferase WbpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene wbpL CDS complement(414357..416276) product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene wbfY tRNA 416520..416596 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 416778..418682 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene htpG CDS complement(418756..419220) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene mgsA CDS complement(419232..420068) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(420145..422763) product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP8 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 423040..424017 product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 424115..424573 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 424587..425192 product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(425273..425776) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(425760..427424) product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cysI CDS 427576..427713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 428143..428607 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(428631..428858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 428942..429616 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene rluA CDS 429657..430487 product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene kch CDS 430625..431212 product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene nfuA CDS 431287..432495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(432590..433690) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(433821..437321) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(437318..440032) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 440230..443235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(443254..444090) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPN8 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene murI CDS complement(444083..444685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 444791..446365 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene rmuC CDS 446358..446825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(446853..447944) product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KN8 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene trmA CDS complement(447969..448760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(448871..450400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 450350..450610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 tRNA 450706..450781 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 450812..450888 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(451197..451343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 451490..452842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 452844..453800 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 453805..454944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(454905..455963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 456025..456924 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene nadK CDS 456921..457886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 457942..458817 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 458875..459153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 459162..460016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 460061..462766 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene pepN CDS 462872..463801 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 463934..464908 product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene cysB CDS 464953..465924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406942.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 466052..467410 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene phr CDS complement(467617..467976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(468187..468489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(468514..469995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 470201..470851 product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE58 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene ccmA CDS 470844..471542 product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene ccmB CDS 471660..472340 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765259.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene ccmC CDS 472337..472549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 472562..473026 product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene ccmE CDS 473016..474995 product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene ccmF CDS 474995..475528 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene dsbE tRNA complement(476582..476658) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(476689..476764) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 476935..477417 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ccmH CDS 477410..478702 product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene cycH CDS 478971..482480 product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene smc CDS 482545..483495 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVF7 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene zipA CDS 483541..485583 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN5 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene ligA CDS 485647..486072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 486109..487089 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGH0 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene hemB CDS 487082..487378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 487384..488835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 488832..489509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 489512..493120 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 493155..494027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 494051..494908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(495071..496900) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 497076..497453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 497600..498157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(498268..499122) product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ00 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(499159..499764) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DD3 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene azoR CDS 499909..500823 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 500866..501303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(501317..502714) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene fumC CDS 502813..504813 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV05 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene uvrB CDS complement(504827..507367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(507375..508229) product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(508462..511392) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene preP2 CDS complement(511423..511689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(512001..512279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 512367..513182 product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV2 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene cmoM CDS complement(513185..513673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(513867..514208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 514192..515679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 515688..516239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 516300..517379 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene aguA CDS 517381..518259 product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 518278..518979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 519054..519524 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene bcp CDS 519835..520272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 520393..520725 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262438.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene yajC CDS 520795..521784 product putative 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY68 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 521868..523223 product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(523299..523634) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(523636..523944) product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene dsrH CDS complement(523944..524303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(524312..524704) product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene tusD CDS complement(524751..525446) product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene yccA tRNA complement(525687..525777) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(525925..529089) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene rne CDS 529813..530829 product ribosomal large subunit pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM9 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rluC CDS 530888..531526 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(531555..532145) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG5 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene maf-2 CDS 532397..532939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 533009..533191 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFT9 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rpmF CDS 533250..534212 product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX9 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene plsX CDS 534249..535190 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLP3 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 535212..535955 product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene fabG CDS 536146..536382 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFT4 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene acpP CDS 536555..537763 product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH5 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene fabF CDS 537809..538690 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene pabC CDS 538687..539748 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 539837..541537 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YQ1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene glnS CDS 541586..542980 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene cysS CDS 543011..543391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 543391..543636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(543658..544932) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(545023..545820) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 546166..547563 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LS7 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene ffh CDS complement(547623..547835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 547867..548193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 548239..549924 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTY5 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene maeA CDS 549956..550525 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 550585..552756 product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene fadB CDS 552768..553967 product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ3 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene fadA CDS 554090..555439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 tRNA 555591..555675 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 555773..557086 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene tig CDS 557257..557892 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM7 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene clpP CDS 558001..559302 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM6 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene clpX CDS 559462..561876 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene lon CDS 562165..562437 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACF7 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene hupB CDS 562583..564445 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU5 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene ppiD CDS complement(564558..565526) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(565544..566164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 566507..568351 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 568376..569461 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 569474..570496 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 570468..572117 product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(572101..573690) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene mltD CDS complement(573798..574577) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EK5 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene gloB CDS 574664..575512 product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 575599..575964 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YT0 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rnhA CDS 576008..576784 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene dnaQ CDS 576979..578694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene fimL CDS 578711..579526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 579554..580207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 580289..581335 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 581451..582446 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 582488..583123 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene msrA CDS complement(583120..583380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(583397..584173) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene cysH CDS 584607..585224 product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene thrH CDS 585531..587768 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 587943..591101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(591098..591382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 591381..592055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 592306..592512 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 592716..594098 product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene dbpA CDS complement(594162..595526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 595686..596222 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD3 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene apt CDS 596225..596455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 596540..597445 product aspartyl/asparaginyl beta-hydroxylase AspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(597466..598854) product aminodeoxychorismate synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854994.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(598938..602051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(602386..602664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 603035..604555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 604568..606274 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene hscC CDS complement(606333..607067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(607134..608018) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 608124..608618 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(608768..610039) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(610273..612546) product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(612555..613010) product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(612985..613656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(613646..614641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(614628..615263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(615381..616280) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(616410..618647) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(618650..619699) product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(619696..620358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 620897..622039 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764112.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 622174..622455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 622460..624097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 624094..624357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(624434..626407) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene fyuA CDS complement(626605..626943) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(626930..627412) product GemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988475.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(627415..627810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(627813..628430) product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(628440..628745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(628723..628944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(628944..629273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(629266..629499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(629499..630524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(630672..632447) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(632444..633331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(633413..633727) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(633724..633900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(633893..634327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(634592..635005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(635016..635255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 635376..635735 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 635813..636142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 636767..636946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 636992..637345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 637347..637808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(637800..638192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 638341..638721 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(638789..638983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 638955..639473 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938427.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 639470..639880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 639967..640170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 640158..640487 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 640484..640798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 640802..641338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 641338..642996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057672.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 642990..644552 product Mu-like prophage FluMu protein gp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44225 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 644552..645781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 645882..646439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 646693..647820 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 647917..648327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 648394..649287 product head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 649380..649862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 649885..650403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 650400..650840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 650843..650995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 651032..651973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 652046..652519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 652567..652827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 652838..658096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 658096..659529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 659520..660374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 660377..661819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 661819..662391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 662388..663095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 663095..663445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 663644..664159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 664295..664480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 664563..665231 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(665282..665671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 665884..668049 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene putA CDS 668165..668458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 668455..670113 product iron uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 670110..670469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(670628..672025) product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 672467..673792 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 673943..674380 product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene trxC CDS 674878..677712 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene cirA CDS complement(677828..678550) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(678965..680572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 680680..680940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 681389..682834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 683162..684070 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 684352..684879 product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 684884..685660 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(686025..686852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 note possible pseudo, frameshifted CDS complement(686846..687112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 note possible pseudo, frameshifted CDS complement(687911..690466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(690613..696249) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I5 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(696477..697505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(697671..698021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(698061..699641) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(699642..701378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(701381..702634) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene glgC CDS 703137..705368 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB8 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene glgB CDS 705451..706974 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS50 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene glgA CDS complement(706922..707854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(707851..708333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 708563..710638 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene nicT CDS complement(711364..711639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(711660..713873) product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene rlmL CDS 714630..714836 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008439237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(715050..716084) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene pyrD CDS complement(716132..716377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(716393..717877) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene gabD CDS complement(718284..719705) product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SX9 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene cysN CDS complement(719797..720717) product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E831 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene cysD CDS complement(720845..723103) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene aroA CDS complement(723106..724209) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(724216..726804) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRA9 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene gyrA CDS 727057..728394 product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 728409..729158 product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene ubiG CDS 729179..729886 product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene gph2 CDS 729883..730650 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(730757..731146) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(731175..731660) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(731859..732719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(732716..733570) product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(733671..734543) product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene motD CDS complement(734555..735295) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene motC CDS complement(735295..736377) product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene cheB1 CDS complement(736442..738706) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(738718..739512) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(739550..739933) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(740073..740792) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884V7 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene fliA CDS complement(740820..741647) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV2 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(741744..743120) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3P8 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene flhF CDS complement(743141..745366) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene flhA CDS complement(745445..746581) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene flhB CDS complement(746581..747366) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene fliR CDS complement(747368..747637) product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(747647..748507) product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene fliP CDS complement(748497..749042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(749044..749484) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQU4 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(749474..750481) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene fliM CDS complement(750494..751030) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(751253..752773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(752992..753333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(753422..755131) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(755144..755449) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(755576..756022) product flagellar protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene fliJ CDS complement(756015..757415) product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene fliI CDS complement(757408..758352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(758367..759386) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene fliG CDS complement(759393..761084) product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51463 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene fliF CDS complement(761109..761480) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51462 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene fliE CDS complement(761674..763092) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene fleR CDS complement(763160..764386) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene fleS CDS complement(764652..766088) product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene fleQ CDS complement(766345..766617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(766614..767027) product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene fliS CDS 767242..769311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(769331..770479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(770480..771610) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene neuC CDS complement(771607..772662) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene neuB CDS complement(772662..773363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(773423..775453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(775588..775995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(776053..777798) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EK43 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(778154..778510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(778562..779785) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene flgL CDS complement(779821..781776) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene flgK CDS complement(781776..782774) product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene flgJ CDS complement(782774..783886) product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene flgI CDS complement(783896..784579) product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene flgH CDS complement(784604..785389) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene flgG CDS complement(785420..786163) product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Z7 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene flgF CDS complement(786366..787616) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P9 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene flgE CDS complement(787668..788381) product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene flgD CDS complement(788392..788835) product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene flgC CDS complement(788885..789301) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQQ9 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(789619..790479) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(790591..791544) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 791812..792534 product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYP6 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 792713..793027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 793157..793633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 tRNA 793709..793785 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 793803..794516 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(794530..796875) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(797060..798163) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene ald CDS complement(798279..799193) product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene ttcA CDS 799504..800295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 800347..801915 product aerotaxis receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene aer CDS 801985..803271 product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC5 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene bioA CDS complement(803331..804338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(804402..805523) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(805520..806842) product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW15 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene apeB CDS complement(806918..807616) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(807784..808548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(809094..809747) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene adk CDS 810203..810532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(810639..811169) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(811208..812854) product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(812936..814564) product K(+)/H(+) antiporter NhaP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGS6 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene nhaP2 CDS 814788..816785 product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZED8 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rnb CDS 816793..817269 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(817353..819923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 820315..820902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 821014..821844 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(822128..822754) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(822756..824333) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene guaA CDS complement(824420..825895) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene guaB CDS 826100..827434 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX12 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene xseA CDS 827646..828794 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 828791..829015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 829018..829827 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV73 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene thiG CDS complement(829824..830726) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(830766..832154) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene der CDS complement(832214..833356) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Y7 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene bamB CDS complement(833353..834030) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(834090..835343) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC33 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene hisS CDS complement(835406..836521) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z0 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene ispG CDS complement(836521..837489) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(837498..838313) product type 4 fimbrial biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene pilF CDS complement(838382..839542) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene rlmN CDS complement(839567..839986) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene ndk CDS complement(840151..840573) product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(840616..841155) product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(841179..841541) product Fe-S cluster assembly protein SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene sufA CDS complement(841567..842790) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(842777..844099) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene sufD CDS complement(844099..844848) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(844927..846363) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(846483..847646) product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY6 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene iscS CDS complement(847674..848141) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene iscR CDS complement(848319..849107) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene trmJ CDS 849311..850114 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene suhB CDS complement(850204..852258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(852381..853559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(853559..855460) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene secD CDS complement(855608..856783) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene tgt CDS complement(856798..857865) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L6W9 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene queA tRNA 858010..858096 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 858318..859598 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 859624..860628 product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 860618..861385 product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477222.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 861492..862406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 862482..862970 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(863042..864100) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(864087..865178) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 865490..866974 product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene pepA CDS 866980..867420 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene holC CDS 867432..867941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(867958..869172) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene setA CDS complement(869500..869898) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 870170..870862 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(871354..873264) product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEX3 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene aceF CDS complement(873373..876024) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene aceE CDS complement(876329..879328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(879328..880431) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(880457..880720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 880925..882361 product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y51 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(882375..882599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(882635..883804) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(883833..884177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 884288..884611 product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 884699..885235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(885315..886262) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene accA CDS complement(886608..887417) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(887464..887931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(887971..888642) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(888737..889060) product competence protein TfoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(889076..889279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(889390..889617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 889741..890925 product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 890961..891398 product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene nsrR CDS 891395..891760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(891822..892577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(892584..892964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 tRNA complement(893396..893484) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(893589..893662) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(893774..894331) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(894491..896335) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X7 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene uvrC CDS complement(896396..897046) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene gacA CDS complement(897192..897806) product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(897832..898893) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF8 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene murB CDS complement(898896..899381) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene ptpA CDS complement(899381..900148) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGA4 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene kdsB CDS complement(900156..901175) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene lpxK CDS complement(901177..901599) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(901613..902242) product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(902397..904562) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113988.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 904972..905472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(905504..906739) product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(906732..907448) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene lolD CDS complement(907441..908679) product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene lolE CDS 908796..909368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 909408..909710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(909813..911147) product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene sthA CDS complement(911275..911529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(911562..912557) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MB1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(912625..913845) product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene nqrF CDS complement(913861..914469) product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene nqrE CDS complement(914472..915134) product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene nqrD CDS complement(915139..915921) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene nqrC CDS complement(915914..917119) product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene nqrB CDS complement(917122..918444) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene nqrA CDS complement(918754..918933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 918950..922414 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene mfd CDS 922499..923359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(923406..923618) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(923823..924380) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(924377..925507) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 925745..926347 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7C2 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene lexA CDS 926340..926750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(926899..927159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(927407..927892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(927917..930541) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene topA CDS complement(931014..931487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 931567..932010 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZA9 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(932055..934004) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 934429..936348 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 936528..937760 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene yuxH CDS complement(937798..938043) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(938076..938942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(939005..940756) product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 940969..941703 product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EK02 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene cmoA CDS 941700..942671 product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEE6 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene cmoB CDS complement(942706..943239) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44562 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene fldA CDS 943550..944275 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene cpxR CDS 944272..945681 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene cpxA CDS 945931..946908 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(946905..947846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(947876..948823) product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L8 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(948823..949779) product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF6 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(949838..950464) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(950559..951416) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 951594..952373 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 952402..952701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene yciL CDS 952771..953508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 953567..954205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 954202..954960 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene pdxJ CDS 955099..955515 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 955593..956357 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene yjfH CDS complement(956421..957728) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene amt-1 CDS complement(958058..960055) product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene tgpA CDS complement(960052..961050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(961093..961965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(962081..963010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(963023..964231) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene metZ CDS complement(964257..965696) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene purF CDS 965586..965819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(965829..966323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(966394..967035) product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(967032..968363) product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene folC CDS complement(968378..969244) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene accD CDS complement(969312..970127) product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0D4 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene trpA CDS complement(970147..971373) product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene trpB CDS complement(971413..972030) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene trpF CDS complement(972106..973005) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI5 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene truA CDS complement(973121..976243) product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene fimV CDS complement(976585..977697) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884B9 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene asd-1 CDS complement(977806..978888) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene leuB CDS complement(978926..979237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(979272..979922) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8T3 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene leuD CDS complement(979935..981362) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C2 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene leuC CDS 981534..982412 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 982496..983203 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(983282..984619) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(984625..985314) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene rstA CDS complement(985314..985739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(985717..986682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(986851..987630) product rhamnogalacturonan acetylesterase RhgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31523 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene rhgT CDS complement(987682..988464) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(988553..989653) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3U6 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene aroC CDS complement(989745..990692) product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene prmB CDS 990855..991394 product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene folE2 CDS complement(991434..992084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(992071..992916) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(992986..993444) product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene sixA CDS complement(993488..993898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(994446..995462) product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV7 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene gpsA CDS complement(996008..996529) product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 tRNA 996801..996877 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 996914..996990 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 997087..997162 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 997450..998301 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene folD CDS 998339..998668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 998681..999472 product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene truC CDS 999459..1000211 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLN5 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene rsuA CDS 1000208..1001302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(1001299..1002024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(1002011..1002610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 tRNA 1002835..1002910 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1003282..1003563 product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(1003568..1005022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(1005142..1005822) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 1006303..1006908 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073041.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1006927..1007841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1007844..1009463) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene gspA CDS complement(1009563..1010801) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y8 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene rlmD CDS complement(1010936..1011847) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene cysM CDS 1011990..1014764 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD98 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene gacS CDS complement(1014775..1015470) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGF4 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene recO CDS complement(1015475..1016377) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE2 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene era CDS complement(1016380..1017057) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPB0 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene rnc CDS complement(1017062..1017463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1017510..1018406) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene lepB CDS complement(1018424..1020226) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene lepA CDS 1020382..1021524 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene dapE CDS complement(1021529..1022455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1022622..1023836 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 1023902..1024660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1024657..1025394 product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1026367..1027701 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 sequence02 source 1..428615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(228..839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(2182..4938) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rpfA CDS complement(5326..6819) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(6870..9836) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene fhuA CDS complement(10080..12461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(12659..13321) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene senC CDS complement(13331..14242) product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene cyoE1 CDS complement(14312..15358) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(15371..15994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(16013..16705) product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 16953..17180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(17201..18112) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene coIII CDS complement(18155..18733) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene ctaG CDS complement(18758..20308) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene coxA CDS complement(20319..21464) product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene coxB CDS 21956..23221 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 23322..24017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 24122..25966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(25939..26694) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939681.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(26740..26994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(26991..29081) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene prlC CDS 29187..29780 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 29773..30447 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(30458..32863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(32970..33845) product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(33937..34713) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(34856..35599) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(35714..36136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 36312..36650 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene raiA CDS 36820..38724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 38805..40427 product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(40499..41143) product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 41817..42953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(43006..43842) product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S3 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene aroE CDS complement(43917..44837) product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EM02 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene hemF CDS complement(44903..45472) product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene tsaC CDS complement(45477..45983) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene purE-2 CDS complement(46135..47256) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene smf CDS complement(47327..48370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 48539..49045 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene def CDS 49100..50071 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85732 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene fmt CDS 50068..51372 product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene rsmB CDS 51454..52839 product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene trkA CDS 52897..54342 product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene trkH CDS 54567..55133 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 55219..56814 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 57055..57792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 57803..58363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 58476..58829 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 58826..59251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 59357..60481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(60501..61457) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(61457..62980) product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(62977..63723) product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(63802..64650) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 64950..65897 product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene glyQ CDS 65899..67977 product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene glyS CDS 67983..68558 product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B34 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 68558..69346 product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene lptA CDS complement(69318..70439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(70529..71809) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(72005..73699) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPL1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene leuA CDS 73968..74447 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 74481..75416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(75426..78050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 78338..80920 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 81255..82607 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(82604..83326) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(83482..83775) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 83875..85128 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene cusC CDS 85121..86797 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706760.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 86798..89911 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene cusA CDS 90224..91312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(91473..91931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(92040..93374) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 94019..94438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 94441..94761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 note possible pseudo, internal stop codon CDS 94777..97101 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 97115..97468 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 97561..97908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 98715..99929 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 99895..100074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 100188..100709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 100711..101442 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(101546..102040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(102192..102485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(102558..103391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(103388..105241) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene copA CDS 105423..106115 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene cusR CDS 106093..107505 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene cusS CDS complement(107825..108838) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(108838..110358) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(110355..111389) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(111390..112208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(112814..113704) product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(114139..114489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(114534..115385) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(115534..118635) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(118650..119873) product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(119897..121207) product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(121974..122240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 122427..123305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(123432..125003) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(125118..125981) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(126048..127493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(127739..129697) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGH1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene topA CDS 129772..130023 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884T6 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 130023..130439 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(130853..132454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(132451..132819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(132819..134171) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(134192..135220) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(135210..135698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(135691..135849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(135842..136270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(136658..136855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(136881..139706) product conjugative transfer ATPase, PFL_4706 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(139703..140119) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(140085..141497) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(141487..142272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(142269..142883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(142880..143248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(143258..143518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(143655..143885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(143891..144247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(144244..144729) product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(144726..145256) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(145253..145978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(145975..146736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(146745..147425) product integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989289.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(147422..148987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 149394..149579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 149776..150186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 150183..150908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 note possible pseudo, internal stop codon CDS 151020..152120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 note possible pseudo, internal stop codon CDS 152235..153167 product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 153926..154204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(154359..154868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 155100..157244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(157744..158835) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene ychF CDS complement(158891..159862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(159956..160537) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C8 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene pth CDS complement(160568..161206) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rplY CDS complement(161313..162257) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX2 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene prs tRNA complement(162451..162525) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(162534..163391) product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C5 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene ispE CDS complement(163438..164100) product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX0 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene lolB CDS complement(164081..165814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 166005..167339 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene hemA CDS 167339..168421 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene prfA CDS 168421..169263 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene prmC CDS 169260..170018 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene moeB CDS 170076..171464 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 171476..172603 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(172931..173929) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 174095..176440 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene mrcB CDS 176500..177030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 177888..179645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(179835..181100) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CUC3 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene fabF CDS 181192..181851 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(181896..182294) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene vapC CDS complement(182291..182485) product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 182960..184114 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 184220..184597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 184722..186095 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene cusB CDS 186092..189232 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene cusA CDS 190230..194342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 194417..196261 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene xlnC CDS complement(196406..197446) product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 197581..198504 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(198532..199161) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 199388..200431 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035487.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(200448..201923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(202162..204144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(204141..204788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(204843..205433) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 205804..207138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 207155..207664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 207675..209678 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970769.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 209924..212101 product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(212186..213781) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ybiT CDS 214293..214529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 214617..214901 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 215785..216483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(216933..220643) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene metH CDS complement(220797..221702) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 221909..224863 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRN7 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene rapA CDS 224986..225273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(225437..226228) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene cysQ-2 CDS complement(226283..226903) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP21 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene cysC CDS complement(227003..228406) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene cpsB CDS complement(228663..229442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(230631..232373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(232519..232980) product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EKK9 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene gmm CDS complement(232983..233942) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN61 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene wbcJ CDS complement(233968..234867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(234877..235992) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV56 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene gmd CDS complement(236039..238033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(238079..238957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(239013..241073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 241081..241245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(241334..242251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(242254..243192) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(243295..244455) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene wcaG CDS complement(244556..245500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(245519..246928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 note possible pseudo, internal stop codon CDS complement(246940..248307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(248467..249360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 250168..252315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 252627..253772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(253685..254851) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(254932..257421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(257418..257780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(257777..258493) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(259022..260221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(260224..260481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 261059..264190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 264197..266488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 266872..271377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 271507..273096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 274154..274846 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 275089..275856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 276028..277572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 277560..278282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(278392..279306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(279686..280651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(280703..281302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 282334..283011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(283129..284241) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(284452..286368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 286731..287267 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 287254..288744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 288770..289159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(289204..290925) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene deaD-1 CDS 291718..292563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 292576..292965 product hypothetical HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(293590..294150) product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(294552..295082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(295075..296637) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene glsF CDS 296821..297186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 297238..298005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(298117..298512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 298654..298932 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M2 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene ftsB CDS 298940..299653 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPU8 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene ispD CDS 299650..300141 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ3 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene ispF CDS 300134..301126 product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene truD CDS 301209..301883 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP9 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene pcm CDS 301883..302833 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 303125..303856 product lipoprotein NlpD/LppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45682 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 304010..305008 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDD3 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene rpoS CDS complement(305189..306940) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene egl2 CDS 306987..307259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(307626..307949) product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene fdxA CDS complement(308032..310608) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene mutS CDS 310765..311268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 311423..312466 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene recA CDS 312557..313033 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56647 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene recX CDS 313078..313581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(313723..314322) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 314570..315688 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 315771..316943 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 317020..317331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 317324..317899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 317979..319580 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene fadD1 CDS 319750..320913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(320970..321692) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V0 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene lpxH CDS complement(321695..322189) product peptidyl-prolyl cis-trans isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44499 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene ppiB CDS complement(322583..323275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(324059..324358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(324400..325758) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(325755..326414) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958089.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene qseB CDS complement(326432..327070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(327067..327897) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(327902..328591) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(328597..330090) product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(330083..330796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 331068..331712 product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX2 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene tmk CDS complement(331754..332941) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(333097..333747) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSW3 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene rluA CDS 333834..334886 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene holB CDS 334989..336056 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene mltB CDS 336056..336718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 336834..337184 product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene pilZ CDS 337257..338048 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 338109..338738 product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene dut CDS 339204..339809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 340536..342158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 342538..343518 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene mdh CDS complement(343602..344723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 344819..345622 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 345752..346201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 346398..347213 product 2,5-diketo-D-gluconate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene dkgB CDS complement(347207..347464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 347824..348357 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene rpoE CDS 348354..349085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 349362..350951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 350962..351489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 351553..352785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 352788..353909 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 354050..354385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 354491..355738 product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 355735..356667 product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 356688..359777 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 359869..360747 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene cheV CDS complement(360790..362052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 362251..364317 product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(364359..364841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 364747..364998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(365371..365862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 366584..366811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 366888..367733 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 367870..369027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 369168..369479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 369479..370690 product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 370976..372019 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 372383..373060 product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(374083..374640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(374765..375550) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SV9 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene map2 CDS complement(375543..375746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 375994..376914 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968421.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 376915..377649 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF02 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene cutC CDS 378132..379823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 380311..380559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 380522..380809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(381073..381264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(381342..384251) product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ05 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene gcvP CDS 384656..387250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 387401..388168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(388247..388726) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L47 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(388911..389120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 389486..390088 product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene tsaA CDS 390388..391569 product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene speC CDS 391646..392329 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D7 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene ung CDS 392492..393394 product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 393409..393984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 394193..395149 product DUF4862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113941.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(395277..396113) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(396181..397233) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(397384..398319) product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene argF CDS complement(398342..399502) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene argD CDS 399769..401325 product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene hyuB CDS 401325..403766 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074767.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 403833..405890 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 406327..406668 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(406761..407111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 407298..408242 product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene lpxL CDS 408300..409253 product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPT4 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene corA CDS 409455..410558 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSR6 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene purC CDS complement(410588..410914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 410991..411641 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene queE CDS 411713..412399 product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y44 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene queC tRNA 412576..412651 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 412891..412966 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 413139..414197 product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W9 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene nadA CDS 414322..415197 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene dapA CDS 415217..416383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 416399..417217 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 417339..417605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(417621..418145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 418294..418941 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 419017..419838 product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886R2 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene rsmJ CDS complement(419835..420101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 420209..420874 product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 420966..422414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 422414..423370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 423469..424416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104652.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(424448..425194) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 425368..426975 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 427032..427208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(427513..427782) product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(427763..428035) product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65068 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene yefM sequence03 source 1..305181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1710..2192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 2348..2590 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 2842..3903 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene bioB CDS 3921..5084 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I617 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene bioF CDS 5086..6666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 6663..7340 product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I614 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene bioD CDS 7503..7754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 7761..8537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 8633..8812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(8957..9379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 tRNA 9725..9801 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 9999..10211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 10281..10736 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene rimP CDS 10779..12260 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene nusA CDS 12315..15005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 15126..15509 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene rbfA CDS 15509..16456 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72154 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene truB CDS 16560..16925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 17022..19172 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR6 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene pnp CDS 19475..20821 product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene nagP CDS 21120..23105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(23150..24175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 24500..25666 product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 25730..27004 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 27001..28296 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 28304..29665 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 29768..31210 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 31323..32813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 33008..33355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 33436..34632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(34616..35698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(35695..36357) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 36552..37049 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene rppH CDS 37106..39379 product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene ptsP CDS 39502..40338 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene lgt CDS 40335..41174 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MA28 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene thyA CDS 41206..41715 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB86 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene folA CDS 41996..42778 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 42775..44160 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene ttpC CDS 44171..44698 product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene exbB CDS 44738..45142 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 45149..45769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 45781..47181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(47322..49163) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene ilvD CDS complement(49299..50618) product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene argA CDS complement(50615..51805) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene argE CDS complement(51914..53188) product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(53244..53924) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 54089..55852 product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 55875..58823 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene glnE CDS 58884..59813 product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene ilvE CDS 59888..60877 product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene waaF CDS 61075..62397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44067 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 62357..63181 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 63195..64967 product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene msbA CDS 65000..66433 product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG9 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene hldE CDS complement(66812..67501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(67642..68022) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(68047..69363) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene hslU CDS complement(69382..69921) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene hslV CDS complement(70045..70629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(70721..72916) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene priA CDS 73190..73408 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene rpmE CDS complement(73521..75959) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene mrcA CDS 76157..77182 product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene pilM CDS 77182..77766 product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 77766..78380 product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene pilO CDS 78373..78912 product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene pilP CDS 78919..81063 product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene pilQ CDS 81068..81574 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L67 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene aroK CDS 81683..82765 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene aroB CDS 82784..84313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(84607..86649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 87196..91650 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene gltB CDS 91685..93103 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene gltD CDS 93251..94315 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene hemE CDS 94464..95837 product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(95842..96702) product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYM4 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene psd CDS 96854..97504 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 97497..98219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 98223..98585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(98608..98964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 99178..99681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 99712..101970 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene parC CDS 101991..102257 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 102270..103475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 103507..104595 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 104577..105125 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(105122..105982) product glycoside hydrolase family 73 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(106010..106678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(106590..107714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(107812..110139) product 9-hexadecenoic acid cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 110280..111884 product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene yhcX CDS 111990..113243 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 113363..114367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(114359..115279) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(115283..116089) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rhdA CDS complement(116171..117196) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rsgA CDS 117253..117807 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene orn CDS complement(117980..118987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(119201..120655) product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P10 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(120864..121991) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene queG CDS 122147..123640 product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene nnr CDS 123633..124109 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene yjeE CDS 124145..125521 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene amiB CDS 125544..127415 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene mutL CDS 127418..128395 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59197 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene miaA CDS 128500..128769 product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene hfq CDS 128790..130115 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene hflX CDS 130263..131420 product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene hflK CDS 131420..132295 product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 132519..133694 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene hisZ CDS 133751..135046 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene purA CDS 135406..138036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(138033..139343) product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(139360..139719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 140067..141578 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(141626..142258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 142410..143870 product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU8 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene clsA CDS complement(143878..144441) product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(144518..145144) product putative sugar epimerase YhfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07609 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene yhfK CDS 145256..145921 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene fabG CDS 145915..146442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 146498..147367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(147413..148135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 148306..149385 product bifunctional transcriptional activator/DNA repair enzyme Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06134 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene ada CDS complement(149716..151539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 152223..152840 product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 152840..153592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 153651..154268 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 tRNA complement(154386..154472) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 154775..155722 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 155815..157314 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 157328..158332 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 158332..159282 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 159472..160368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 160606..161205 product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene yqaB CDS complement(161248..161730) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 162065..163732 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7K1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene araB CDS 163729..164424 product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQQ9 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene sgaE CDS 164460..165962 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FK3 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene araA CDS 166270..167646 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 167697..168644 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 168719..171106 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(171135..171584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 171679..172455 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 172585..173085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(173167..174207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 174621..175478 product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 175578..175829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 175896..177053 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 177218..177949 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 178045..178416 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XAG6 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(178423..179640) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(179630..180322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(180412..181113) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(181110..182498) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267098.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(183054..183782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(184757..185557) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene uppP CDS complement(185825..186874) product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene abnA CDS 187172..188146 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 188184..189254 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene galM CDS 189323..190267 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 190307..192241 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 192291..194135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 194265..195797 product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919298.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene abfA CDS 195958..196476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(196597..198456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 199144..199419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(199432..200700) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 200839..202632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(202701..206300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(206460..210104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(210716..212020) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(212207..213544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(213532..214365) product 3-dehydroshikimate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(214362..215636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(215633..216946) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(216957..218837) product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(218830..220659) product petrobactin biosynthesis protein AsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(220769..222127) product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(222124..222414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(222469..223230) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene cpxR CDS 223562..225538 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 225760..226386 product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene hlY-III CDS complement(226383..227450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(227471..228952) product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene glpK1 CDS 229077..229331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 229404..229706 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 229706..230023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(230050..231681) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 232174..234987 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene cirA CDS 235425..236144 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 236276..238834 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene rnr CDS 238907..239650 product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rlmB CDS 239724..240200 product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene nrdR CDS 240244..241392 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ribD CDS 241403..242059 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene ribC CDS 242056..243177 product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene ribB CDS 243208..243675 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene ribH CDS 243675..244136 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene nusB CDS 244159..245157 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EFU4 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene thiL CDS 245159..245656 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG4 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 245698..246339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 246375..246980 product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q3 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene ribA CDS 246999..247805 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene dapB CDS 248886..249293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(249372..251555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 251730..252704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 252959..254104 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS6 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene carA CDS 254139..257360 product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene carB CDS 257357..257833 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64282 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene greA CDS complement(257890..258192) product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(258385..258597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 258852..260786 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene ftsH CDS 261000..261809 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene folP CDS 261815..263152 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene glmM CDS 263181..264029 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL9 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene tpiA CDS 264051..264467 product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene secG tRNA 264491..264575 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(264822..265700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(265829..266458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(266565..266996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 267037..267330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 267432..268178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 268168..268950 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 268943..269200 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 269212..269460 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6K4 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene acpP CDS 269460..270017 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 270014..271387 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 271387..271734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 271731..272498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 note possible pseudo, frameshifted CDS 272491..273441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 note possible pseudo, internal stop codon, frameshifted CDS 273431..274990 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 274980..275429 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 275422..276087 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RB0 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 276093..278423 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 278434..279684 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 279685..280194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 280197..281375 product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 281372..281878 product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 281875..282600 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene fabG CDS 282600..283826 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene fabF CDS 283823..285052 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene fabF CDS 285210..286469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 286506..287576 product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y2N4 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene glsA CDS 287634..288401 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFE0 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 288404..288733 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 288875..291115 product siderophore receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 291128..292480 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 292690..294663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(294731..297103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(297850..298572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(298556..299965) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(300020..301129) product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(301117..302262) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene aroB CDS complement(302280..303176) product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(303173..304084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 304271..305068 product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene djlA sequence04 source 1..290187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 156..434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 434..727 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1253..1657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 1873..2757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 2913..3602 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(3681..3890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 4111..4536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 4555..4779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 4874..5401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene blc CDS 5632..6159 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(6129..7139) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 7284..8210 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDS1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene lpxC CDS complement(8220..11264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 11436..12806 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460902.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 12892..14721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(14708..15868) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE75 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene lldD CDS 16062..17357 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene fucP CDS 17362..18192 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 18373..19161 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene kdgR CDS 19304..20335 product pyridoxal 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 20377..20715 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 20708..21928 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 21964..22689 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene ucpA1 CDS 22728..23573 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene hpcE CDS 23607..24872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(25422..26063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(26081..26977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 27468..28817 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(28907..29908) product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 29868..30194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 30500..30925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(31004..31981) product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene fbp CDS complement(31974..33056) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAS0 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene fba CDS complement(33073..33849) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27876 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene tpiA CDS 34222..35628 product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0M5 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene uxaC CDS 35625..37100 product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(37148..37843) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 38127..38999 product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene kdgK CDS 39022..39990 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 39990..40466 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 40477..41772 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 42335..45706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(45791..46078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(46071..47570) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 47903..49648 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 49872..52613 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene malA CDS 52695..54857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 54956..56935 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(56954..57529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 57679..58368 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 58355..59692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(59828..61030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(61327..64323) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(64543..65373) product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832G5 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene kduI2 CDS complement(65385..66590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 66761..68011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 68021..68797 product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene kduD CDS 68846..71260 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 71408..72589 product mannonate dehydratase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UA46 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene uxuA2 CDS complement(72833..74083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(74071..75375) product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(75426..77102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 77296..80196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638981.2 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(80445..80648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(81100..84660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(84925..87129) product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3G9 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene aguA CDS complement(87350..88213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(88467..89234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(89227..89856) product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene pnuT CDS complement(89853..90116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene ykoF CDS complement(90171..92291) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 92657..93802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 94008..94454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(94618..95322) product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(95325..95870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(95928..96254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 96711..97061 product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 97188..98027 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(98152..99033) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 99119..100105 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 100574..100771 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(100866..101318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 note possible pseudo, internal stop codon CDS complement(101331..101822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 note possible pseudo, internal stop codon CDS complement(102131..102841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(103005..104462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(104738..105613) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(105761..106546) product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(106539..107306) product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene znuC CDS complement(107299..107796) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 107865..108782 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene znuA CDS complement(109040..109312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 109594..112419 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene polA CDS complement(112905..113591) product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TG0 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene engB CDS 113803..114483 product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene cc4 CDS 114632..115276 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene dsbA CDS 115422..117140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 117144..117779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 117792..120149 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 120127..120999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 120999..121427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 121536..124037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(124118..125125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 125269..126069 product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 126178..128583 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene fadE CDS 128671..129591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(129588..129770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 129975..131090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 131104..131925 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 132191..136510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(136691..137497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(137499..137834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 137972..138703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(138727..139779) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 139955..140839 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(140836..142347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089541.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 142406..142723 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AB0 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene acyP CDS 142730..143239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 143226..143831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(143828..144754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(144758..145525) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(145582..145863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 146140..146631 product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(146655..147440) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(147500..148276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(148273..148833) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(148837..150108) product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene cfaS CDS complement(150115..150957) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(150950..152248) product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(152245..153051) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(153065..153523) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 153713..154294 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 154296..155018 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(155074..155712) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(155941..156783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 157021..158787 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(158896..159621) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene chd1 tRNA complement(160003..160079) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 160586..161017 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(161120..163129) product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA4 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rep CDS 163411..165138 product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(165135..166643) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(166696..166956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 167396..167734 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 167786..169054 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 169271..169609 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene glnK CDS complement(169743..170066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 170464..170742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(171055..171651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(171648..171851) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(172104..173198) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 173341..174795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 tRNA 174539..174611 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 174889..175920 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene malR CDS complement(175974..177479) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene malT CDS complement(177539..179944) product glucan 14-alpha-glucosidase Cga inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene cga CDS complement(179974..180216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 180215..181846 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene algA CDS 182452..188871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 188889..190277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(190462..191400) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51566 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene xerC CDS complement(191445..192137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(192139..192969) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene dapF CDS complement(193047..194294) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene lysA CDS 194663..195364 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 195345..196301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 196298..197470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 197467..198690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 198687..199925 product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 200154..200903 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 200950..201747 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771267.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 201755..202669 product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 202701..203144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 203246..203953 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 204560..205417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(205500..205670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 205787..207088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 207607..208173 product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 208296..209516 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 210718..211131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(211200..212366) product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene xsa CDS complement(212441..213670) product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene rspA CDS complement(213775..214701) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(214750..215154) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(215247..216773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(216965..217390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(217558..220434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(220834..221562) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 221833..223320 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 223327..224253 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene yihR CDS 224337..225668 product xylose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene xylA2 CDS 225835..228291 product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 228974..232312 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 232446..233996 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 233996..235441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 235487..236995 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(236982..239117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(239385..240773) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene argH CDS 240953..242041 product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene algZ CDS 242055..242780 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene algR CDS 242911..243855 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene hemC CDS 243866..244657 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704441.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene hemD CDS 244759..246003 product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 246000..247292 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene hemY CDS 247297..247656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(247739..248332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(248403..248843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 248884..250941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(251817..251990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 251998..253272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(253349..253642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(253903..254739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(254959..255585) product thiazole biosynthesis protein ThiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(255629..256189) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(256191..256583) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 256830..257219 product RplA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706218.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 257304..257450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(257402..258169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(258392..259858) product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEH3 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene ubiD CDS complement(259963..261222) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene rho CDS complement(261617..261946) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ3 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene trx-2 CDS complement(262168..264576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(264662..265828) product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(265919..267079) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 267158..267622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 267693..268097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 268174..268842 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN28 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene azoR CDS complement(268895..269509) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(269512..270021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(270042..270629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(270632..271777) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene metX CDS complement(271855..273843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(274001..274591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(274688..275509) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene proC CDS complement(275526..276209) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 276319..277353 product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene pilT CDS 277436..278581 product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene pilU CDS complement(278651..279097) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHG2 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene yqgF CDS complement(279090..279686) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA2 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(279748..280653) product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene tonB3 CDS complement(280656..281618) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene gshB CDS 281936..282331 product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene pilG CDS 282390..282752 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 282836..283381 product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene pilI CDS 283547..285778 product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene pilJ CDS 285815..286678 product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene pilK sequence05 source 1..282692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..601) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(644..1315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1793..2935 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 3170..3331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 3542..3784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 3791..4330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 4263..4496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(4697..4891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 5134..6444 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063841.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene zraR CDS 6511..6750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 6747..8243 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 8250..8693 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 8700..10661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 10984..11190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 11333..12904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(12992..14566) product fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 14731..16569 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 16613..18043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 18563..21577 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene iroN CDS 21739..22809 product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(22973..24067) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(24079..24759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(25275..25862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(25880..26314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 tRNA complement(26440..26516) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(26791..28602) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene rpoD CDS complement(28750..30843) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene dnaG CDS complement(30893..31330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(31409..31624) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V8 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene rpsU CDS 31854..32927 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene tsaD CDS 32948..33307 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene folB CDS 33304..33819 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(33854..34894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(35017..35982) product putative metal ion transporter YfjQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31543 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene yfjQ CDS complement(36013..36753) product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene ptr1 CDS complement(36750..37991) product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPN1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene cca CDS 38365..39246 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene pagO CDS 39513..40196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 40379..41410 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(41426..42802) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(42804..43496) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene phoP CDS complement(43522..43776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 44170..45435 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene proA CDS 45472..46122 product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPW3 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene nadD CDS 46180..46521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 46531..47001 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene rlmH CDS 47043..48905 product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 48908..50053 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene rodA CDS 50108..51130 product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene sltB1 CDS 51123..51935 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF4 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rlpA CDS 52017..53165 product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene dacC CDS 53264..53530 product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 53527..54177 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene lipB CDS 54256..55269 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene lipA CDS 55270..55788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(55757..56467) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 56585..57097 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(57306..58499) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene aspC CDS complement(58776..59054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 59209..60813 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene murJ CDS 60866..61846 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene ribF CDS 61863..64664 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene ileS CDS 64676..65197 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene lspA CDS 65181..65639 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 65708..66640 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene ispH CDS complement(66632..67162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 67362..67934 product pre-pilin like leader sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene fimT CDS 67927..68307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 68318..69373 product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 69383..69910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 70083..74198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(74655..76040) product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene pilR CDS complement(76037..77641) product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene pilS CDS 77625..77777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 77929..79557 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene nadE CDS complement(79641..80543) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene bamD CDS 80814..81767 product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene rluD CDS 81760..82536 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33663 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 82606..83673 product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAL5 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene hisC CDS 83928..86198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(86217..87287) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(87294..88199) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ2 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene rimK CDS complement(88259..88711) product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene rimK2 CDS 88977..89162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 89513..90820 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(90828..91637) product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene apaH CDS complement(91678..92082) product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A47 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene apaG CDS complement(92075..92911) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene rsmA CDS complement(92908..93912) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7S7 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene pdxA CDS complement(93912..95258) product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene surA CDS complement(95275..97863) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG8 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene lptD CDS 98158..99222 product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 99219..99920 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(99877..100572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(100583..102094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(102199..102942) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(102936..103727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(104320..104841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(104878..105831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 106022..106702 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene rpe CDS 107155..108666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 108963..110204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 110282..111181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 111200..112912 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31742 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene xpsE CDS 113056..114255 product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417566.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 114277..114702 product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene gspG CDS 114712..115173 product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31736 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene xpsH CDS 115170..115559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 115549..116145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 116142..116945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 116926..117942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 117939..118496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 118509..119048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 119120..121228 product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29041 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene xpsD CDS 121254..121643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 121671..122993 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 123000..123800 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 123841..128568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 128588..129370 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(129351..130106) product alpha-L-Rha alpha-1,3-L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(130107..130988) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene rfbD CDS complement(130981..131571) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(131568..132452) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene rfbA CDS complement(132455..133516) product dTDP-D-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_273142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene rfbB-2 CDS 133733..134764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 134883..135494 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 135507..136538 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene trpD CDS 136562..137371 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene trpC CDS complement(137467..139092) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 139475..142078 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 142545..145199 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 145273..146796 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 146835..147536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 148042..151140 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 151338..152840 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(152853..154403) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(154469..155029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(155101..156033) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNV0 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene rdgC CDS 156245..157069 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 157649..158557 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene nagK CDS 158612..159688 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(159759..160790) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene nagR CDS complement(160973..161938) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 162064..162636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 162887..163453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 163623..164213 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 164376..165536 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene acrA CDS 165542..168670 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene vmeB CDS complement(168732..172376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(172520..173200) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(173333..176896) product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(177068..177829) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWM8 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(177826..178752) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(178800..179282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 179579..180613 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(180883..183408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 183398..183637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(184291..184701) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(184773..185120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(185161..186444) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 186597..187601 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene msrP CDS 187648..188274 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFD8 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene yedZ CDS 188643..189626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 190021..195021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 195287..196432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 196669..199452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 200076..200309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(200199..202307) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 202443..203498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 203595..204056 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 204073..204924 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene qmcA CDS 204957..207008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(206980..207747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(207868..208434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(208542..209006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(209028..209576) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SB6 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 209712..211862 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(211919..214060) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071497.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(214280..215065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(215125..216519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 216909..217217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 217192..217854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 217921..218274 product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(218367..221480) product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3Z6 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 221751..221951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 221961..222482 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N03 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene dsbB CDS complement(222526..223338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 223734..224651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(224723..226999) product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XJ9 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene metE CDS 227120..228022 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene metR CDS 228106..229122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 229130..229501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 229744..230406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(230490..230933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 231198..232184 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097940.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 232224..235730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(235766..236734) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 237135..237896 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU0 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene tpiA CDS 237981..238952 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene fbp CDS 239303..240388 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 240381..241985 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 241982..243109 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 243140..244189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 244194..244622 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(244646..245200) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(245306..245983) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(245998..247149) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(247553..247957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 248023..248958 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 248958..249731 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene yadH CDS 249748..250593 product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV71 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene queF CDS complement(250610..251992) product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene cyaB CDS 252235..252792 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 tRNA 252908..252995 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 253509..253585 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 253773..254957 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 254954..255760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 255870..256082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 256262..256888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 256878..257546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 257539..257733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(257758..258834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(258831..259682) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene srtN CDS complement(259759..261000) product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(261009..263636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(263657..266338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(266398..268398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(268416..273110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(273147..275969) product ATP-dependent helicase HepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(275966..281185) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 281934..282077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 sequence06 source 1..241717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(1070..1660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(1663..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(3263..6451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 6680..7651 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 7641..8600 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 8597..9700 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IW8 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 9715..10791 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(10880..11644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(12175..14454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(14951..17656) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene fecA CDS complement(17870..19564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038526.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(19931..20941) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(20951..21658) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(21655..22134) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene arsC2 CDS complement(22216..22551) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267061.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 22795..23178 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 23347..25140 product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(25208..25837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 26075..28402 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 28456..29166 product putative S-adenosylmethionine-dependent methyltransferase RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT0 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene rcsF CDS 29307..30536 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene serA CDS complement(30577..32406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(32477..33730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 33908..35914 product thio:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 35936..36550 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 36696..37295 product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 37326..37751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 37898..41473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 41569..42759 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 42904..43911 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 43980..45179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 45315..46094 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(46125..47420) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 47674..48432 product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene ppk2 CDS complement(48468..50669) product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene fdhF CDS complement(50770..51669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 51852..52934 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 53031..53771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 53876..54076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 54118..55149 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(55189..56034) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene frmB CDS complement(56045..57163) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene frmA CDS 57288..58181 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(58220..59017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(59134..59823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 60132..61286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(61927..63069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(63086..63259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 63435..64973 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(65133..65891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(65891..66595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(66642..67349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(67353..68882) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039038.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene prnA CDS complement(68882..69559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(69917..70636) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(70875..73781) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene iroN CDS 74556..75845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(75855..77969) product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene spoT CDS complement(78010..78270) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZY9 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene rpoZ CDS complement(78457..79074) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene gmk CDS 79528..80658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 80974..81183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 81432..82334 product LPS biosynthetic protein LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene lpxO1 CDS 82693..85647 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene iroN CDS 85818..87362 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 87365..88045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 88262..90280 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072426.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene susB CDS 90584..91597 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(91609..92478) product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(92648..94984) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(95104..96360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 96660..97526 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 97589..99070 product N-acyl-D-amino-acid deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 99060..99449 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 99531..100976 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 101064..101489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 101548..101973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 102155..103102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 103560..103739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 104637..105740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 106011..106463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(106472..107338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 107501..108220 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene rph CDS complement(108293..109063) product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene crc CDS 109272..109913 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHW8 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene pyrE CDS 109941..110567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(110594..111208) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene slmA CDS complement(111408..112316) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene argB CDS complement(112319..114850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(114898..116091) product coenzyme A biosynthesis bifunctional protein CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T89 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene coaBC CDS 116261..116935 product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 117255..117491 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2A6 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rpmB CDS 117507..117662 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN0 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene rpmG CDS complement(117786..118460) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene rpiA CDS 118602..120116 product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene ilvA1 CDS complement(120562..121227) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(121469..121768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(121806..122012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 122208..122792 product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 122856..124190 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene pepP CDS 124192..125418 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ubiH CDS 125411..126625 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene ubiF CDS 126658..126999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 127155..127367 product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene cspA CDS 127484..127801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 127899..128492 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene hisB CDS 128502..129146 product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene hisH1 CDS 129167..129901 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene hisA CDS 129905..130678 product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene hisF1 CDS complement(130761..131726) product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(131730..133283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(133341..134072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(134069..135211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(135208..136812) product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(137251..137475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(137600..138517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(138535..139959) product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(140013..141209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(141233..142762) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene gpmI CDS 143002..143409 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 143420..143677 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687379.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 143711..144214 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGG5 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene secB CDS 144354..145877 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZN70 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene ppx CDS complement(146022..148076) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UP6 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene ppk CDS complement(148209..148520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(148609..149451) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene metF CDS complement(149513..150913) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene ahcY CDS complement(150963..151319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(151382..152536) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene metK CDS complement(152567..153652) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 153848..155848 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene tkt CDS 155967..157142 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPR0 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene pgk CDS 157254..158123 product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 158218..158559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(158464..158655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(158693..159868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 159936..160190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(160455..160583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 160705..161571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 161809..163899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(163956..164636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039537.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene mmyP CDS complement(164665..165459) product A-factor biosynthesis protein AfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 165870..166511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 166520..168082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 168048..168473 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(168535..170829) product cellobionic acid phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3J4 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(171163..173742) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(173853..176513) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 176683..177072 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(177094..177942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 177994..178929 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 178932..181022 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene recG CDS 181176..182576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(182586..183839) product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 184121..184597 product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene ubiC CDS 184590..185459 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U39 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene ubiA CDS 185647..186345 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene phoB CDS 186383..187669 product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene phoR CDS 187758..188741 product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 188769..189047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 189069..189503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 189512..191314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 191375..191818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 191926..192870 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071093.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 192933..193385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(193418..194065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(194150..195001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(194998..195873) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene hslO CDS complement(195939..196352) product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ4 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(196345..197007) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(197082..198155) product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(198193..199452) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(199475..200713) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(200716..201417) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 201806..202354 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene nudE CDS 202347..203189 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 203390..203629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(203646..204866) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(204866..205369) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene moaB2 CDS complement(205414..206535) product GTP 3',8-cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD6 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene moaA1 CDS 206955..207794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 207828..210368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 210385..210738 product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene nirD-2 CDS complement(210834..211070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(211268..212782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(212832..213068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 213174..213326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 213389..213910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 213939..215510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 215570..216112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 216138..216377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 216417..217085 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 217295..217858 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 217983..218141 product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 218632..219129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 219169..219930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(220213..220668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(220869..221681) product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene mutM CDS 221882..223858 product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(223871..224860) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 225022..225750 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 225778..226212 product magnesium transporter MgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(226209..227489) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(227490..228410) product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(228499..228810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(228822..229226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(229239..229427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(229420..230223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 230463..232796 product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 233015..233947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 233944..235440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(235443..235892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(235889..236284) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(236395..237615) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(237817..240219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(240701..241132) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene yqaA CDS complement(241200..241538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267529.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 sequence07 source 1..202569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(1040..2110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114162.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2263..4683) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U4 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene gyrB CDS complement(4746..5834) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene recF CDS complement(5871..6977) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene dnaN CDS complement(7080..8483) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK3 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene dnaA CDS 9169..9558 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY2 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene rnpA CDS 9555..9806 product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I270 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 9808..11472 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene yidC CDS 11475..12833 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY5 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene mnmE CDS 12899..13351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(13418..14047) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(14201..15055) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 15671..17566 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F5X1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene mnmG CDS 17566..18204 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL14 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene rsmG CDS 18292..19104 product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene soj CDS 19136..20035 product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene spoOJ CDS 20867..21811 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene atpB CDS 21858..22094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 22145..22615 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene atpF CDS 22628..23164 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL21 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene atpH CDS 23181..24725 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene atpA CDS 24778..25641 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene atpG CDS 25717..27096 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene atpD CDS 27142..27567 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene atpC CDS 27681..29051 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1N9 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene glmU CDS 29077..29901 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene uppP CDS 29919..32735 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 32885..33658 product GlmR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114653.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene glmR CDS 33674..35503 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX0 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene glmS CDS 35537..36832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 36850..37608 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 37633..38223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 38326..44178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 44278..45948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 46304..47839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 47906..48196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 48414..49871 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene katA CDS complement(49947..50363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(50414..50878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 50841..51032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(51056..51832) product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(51887..52096) product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263045.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(52294..52713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(53183..54709) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(54795..55880) product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 55997..56662 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969624.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 57140..58444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 58545..59669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(59811..60023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(60259..60450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(60447..61595) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(61611..63788) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920765.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(64087..64290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(64507..65490) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(65694..68474) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(68959..70002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(70189..70638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 71118..72095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 72085..72891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 72891..73826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(73841..74923) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(74910..75179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(75573..75920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(76456..78039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(78056..80548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(80550..81767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 82045..84729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 84729..85511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 85523..86134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 86144..86665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 86662..86886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 86873..88021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(88186..89295) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 89773..91185 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene xylE CDS 91311..91688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 91696..92250 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A642 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 92237..92557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 92752..93495 product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113362.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene ybhP CDS 93508..94836 product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59715 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene clsB CDS 94836..95888 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097488.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 95885..96496 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 96577..97002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(97010..97531) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(97516..98196) product PKHD-type hydroxylase PiuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVQ7 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene piuC CDS complement(98297..100462) product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 100639..101415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 101412..102764 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263089.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 102761..103144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 103141..103548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 103548..104183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 104180..105568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 105649..105870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 105940..106284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 note possible pseudo, internal stop codon CDS 106429..108402 product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(108399..108866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(109046..110650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(110931..111209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(111477..113102) product methyl-accepting chemotaxis protein CtpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA3 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene ctpH CDS 113339..115528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(115594..117501) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 117552..118040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(118037..118978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 119308..120075 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene fklB CDS complement(120141..121115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(121176..121736) product transcriptional regulatory protein AlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15275 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene algQ CDS complement(122082..122474) product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ectC CDS 123087..123521 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(123496..125118) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene gshA CDS complement(125274..125684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(125777..126328) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 126463..128658 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene uvrD CDS 128781..129923 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 129975..130274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 note possible pseudo, frameshifted CDS 130222..130695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 note possible pseudo, internal stop codon, frameshifted CDS 131018..132220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 132523..133896 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 134191..134673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(134760..136037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(136034..136663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(136937..137539) product protein YceI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A8X2 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene yceI CDS complement(137569..138132) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(138312..138713) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1A2 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene yciA CDS complement(138931..140322) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(140312..140914) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(141000..142283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 142381..142857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 142900..143673 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN3 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 143723..144547 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096657.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 144566..145054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(145122..145271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 145474..146727 product spindolin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 146922..148106 product macrolide-specific efflux protein MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708505.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene macA CDS 148093..150042 product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPB4 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene macB CDS 150047..151423 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706710.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 151593..151964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 151992..152924 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769641.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 153226..154692 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene crnA CDS 154984..155502 product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87G06 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(155634..156356) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(156497..157336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(157340..158497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(158547..159287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 159740..160786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 160799..162856 product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene xcpQ CDS 162860..164416 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene xcpR CDS 164431..165669 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene xcpS CDS 165834..166277 product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene xcpT CDS 166283..166837 product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704543.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene gspH CDS 166834..167208 product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene gspI CDS 167201..167899 product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45776 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene epsJ CDS 167883..168974 product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene xcpX CDS 168967..170208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 170211..170696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 170708..171913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 171922..172677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(172712..173797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 174023..175717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 175724..177907 product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 178032..178241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 178213..178938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 179197..187611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 187614..189125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 189303..191678 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 191763..192791 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 192906..193433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 193421..195355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 195352..198324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 198311..199033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 199030..199344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 199515..200180 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 200190..200759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 200756..201307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 201309..202280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 202287..202556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 sequence08 source 1..185929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(1553..2842) product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene eno CDS complement(2947..3813) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRS8 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene kdsA CDS complement(3870..5492) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene pyrG CDS complement(6321..7664) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene tilS CDS 7777..9729 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 9732..10238 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene greB CDS complement(10229..10465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 10513..11421 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(11444..11884) product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885A6 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene cynS CDS complement(12131..14005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(14336..15865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 16711..19668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 19673..20767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(20796..21569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(21570..22376) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(22448..24718) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(24944..27406) product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene celD CDS 27703..28683 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64254 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene glk CDS complement(28785..29624) product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CG06 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene rlmJ CDS complement(29966..31363) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314231.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(31412..32719) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene hom CDS complement(32845..33621) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(33696..34610) product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene xerD CDS complement(34729..35082) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886U9 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene rplS CDS complement(35122..35847) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG25 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene trmD CDS complement(35928..36419) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene rimM CDS complement(36479..36718) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene rpsP CDS complement(36895..38793) product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene fabY CDS 38914..39936 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(39940..40293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 40302..40487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(40718..41206) product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(41354..42268) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038965.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene sulA CDS 42433..42858 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(42928..43671) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 tRNA complement(43927..44003) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(44146..44505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(44486..44794) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H6 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene ihfA CDS complement(44805..47183) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene pheT CDS complement(47256..48293) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene pheS CDS complement(48442..48801) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A2 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene rplT CDS complement(48834..49031) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene rpmI CDS complement(49097..49534) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene infC CDS complement(49654..51594) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H9 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene thrS CDS 51790..52425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 52444..53208 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 53202..53453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 53599..55767 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene prc CDS 55847..56659 product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene xthA CDS complement(56666..58912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(58997..59209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 59501..59899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(59995..60480) product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene moaE CDS complement(60480..60728) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E943 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene moaD CDS complement(60725..61204) product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MY2 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene moaC CDS 61264..61959 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974611.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(62027..62800) product salt-induced outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(63032..63469) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 63606..64562 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263936.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 64686..64901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 64898..65065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(65162..65875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 66266..66964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(67356..67958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(67961..68425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(68836..69444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(69485..70246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(70243..71307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(71315..71650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(71650..74724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(74724..78848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(78848..79087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(79165..79548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(79560..80036) product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072860.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene V CDS complement(80163..80546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(80733..81248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072862.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(81230..81475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(81468..81788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(81781..82143) product phage head-tail adapter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072864.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(82146..82466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(82457..83047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(83047..83661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(83646..84239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(84227..84631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(84685..85074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(85157..86569) product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(86580..87452) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4R5 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(87449..88729) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene B CDS complement(88726..90483) product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(90480..90944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(91377..91577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(91638..92147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(92144..92617) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9C0 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene ybcS CDS complement(92610..92900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(93096..93443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(93443..93928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(93945..94280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(94316..94555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(94898..95086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262504.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 95176..95817 product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856967.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 95848..96027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(96031..96483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 96650..96847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 96844..97257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 97254..97988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 97985..98383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 98392..98664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 98661..99179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 99189..99671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 99685..100104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 100117..100371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 100389..100823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 100835..101059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 101047..102081 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TQ6 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 102091..102504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 102504..102899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 102892..103101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 103119..103727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 103730..104239 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109521.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 104232..104645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 104635..104820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(104806..105891) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 106129..107031 product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX9 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene dusA CDS 107214..108173 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH2 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene tal CDS 108166..108630 product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(108707..109198) product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(109201..110424) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 110615..110920 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104055.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(110940..111632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(111798..112163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(112246..113154) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene porB CDS complement(113312..114085) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(114082..114948) product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYW0 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(114948..115343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(115553..119464) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(119577..120047) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(120184..120999) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160484.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(121012..121476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(121476..123620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(123738..124103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(124142..124585) product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I445 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(124585..124875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(124872..126017) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW61 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene rnd CDS complement(126065..126658) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL54 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene recR CDS complement(126676..126996) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(127018..129066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(129382..130875) product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 131030..131524 product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene tpx CDS 131615..132469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene queD CDS 132631..133674 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089772.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 133746..135002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(135011..135931) product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene lpxL CDS complement(135938..136840) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(136852..138036) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene fabV CDS 138201..138611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(138917..139933) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 140220..141536 product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225587.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene gluP CDS complement(141625..142581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117899.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(142910..143758) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(143787..144323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene yaeQ CDS complement(144327..145817) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886S6 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene lysS CDS complement(145849..146751) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene prfB CDS complement(147027..148118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(148111..148539) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 148861..149049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(149096..149362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 149571..149987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 149992..150957 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 151098..152522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(152543..153922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(153982..160398) product GlyGly-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(160771..161352) product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(162359..163933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(164564..167038) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(167032..167727) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(167760..169070) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 169204..169845 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(169856..171589) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene recJ CDS 171777..172457 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453940.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 172475..173872 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 173884..176952 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N39 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene dnaE2 CDS 177079..177645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(177648..178253) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 178379..178936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 179125..179988 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 180091..181044 product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene rlmF CDS complement(181031..182197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 182715..184472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 184671..185246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 misc_feature complement(185255..>185929) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021076.1:IS5/IS1182 family transposase locus_tag LOCUS_25960 sequence09 source 1..175246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 79..1179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(1195..3546) product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2L1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene polB CDS complement(3565..4671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268997.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(4707..5072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(5272..5976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 6287..8041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 8331..8771 product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene aroQ1 CDS 8815..9273 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 9337..10680 product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene accC CDS 10727..11608 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN40 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene prmA CDS 11703..13316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 13493..14482 product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene dusB CDS 14479..14796 product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 14908..16479 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KT0 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene purH CDS 16557..17900 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene purD CDS complement(18018..19583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(19611..20165) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(20312..21052) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene phoU CDS complement(21104..22012) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene pstB CDS complement(22029..23696) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLA6 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(23712..25997) product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(26162..27130) product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene pstS CDS complement(27333..27950) product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(28094..28492) product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene sspB CDS complement(28589..29224) product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707594.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene sspA CDS complement(29291..31342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(31344..31937) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(32234..32626) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene rpsI CDS complement(32641..33069) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene rplM CDS complement(33217..34335) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene zapE CDS complement(34328..34993) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 35146..35637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 35670..36827 product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(36874..38181) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene hisD CDS complement(38191..38832) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene hisG CDS complement(38841..40103) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene murA CDS complement(40116..40358) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376481.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(40491..41105) product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 41375..42337 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene yrbG CDS 42385..43356 product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene kdsD CDS 43400..43936 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 43977..44513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 44503..45051 product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LE4 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene lptA CDS 45053..45778 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 45922..47451 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene rpoN CDS 47582..47872 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 47902..48360 product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene ptsN CDS 48371..49249 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 49250..49522 product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene ptsO CDS 49595..50113 product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(50138..54148) product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(54198..55718) product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene cafA CDS complement(55723..56352) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSG5 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(56371..56868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(56875..57645) product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene mreC CDS complement(57798..58832) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 58831..59106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 59277..59564 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS8 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene gatC CDS 59644..61098 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene gatA CDS 61111..62559 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene gatB CDS 62556..62852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406914.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 62862..63608 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF4 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene cysZ CDS complement(63631..64113) product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP05 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(64123..65028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(65042..65614) product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene ampD CDS complement(65721..68069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 68341..69201 product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene nadC CDS 69367..70686 product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD94 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene wbpA CDS 70739..71821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 71824..72945 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene vioA CDS 73825..74361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 74374..75153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(75360..76202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(77669..78523) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(78520..80052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 80071..80235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(80535..80891) product type IV pilin protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070777.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene pilA CDS 81213..82919 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266636.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 82923..84182 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 84197..85051 product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22610 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene pilD CDS 85064..85684 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF11 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene coaE CDS complement(85944..86873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268840.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(86877..88097) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW04 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene argJ CDS complement(88113..90833) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene secA CDS complement(90938..91870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(92177..93088) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene lpxC CDS complement(93418..94572) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene ftsZ CDS complement(94625..95860) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene ftsA CDS complement(95899..96717) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA7 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene ftsQ CDS complement(96717..97649) product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene ddlB CDS complement(97666..99093) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene murC CDS complement(99086..100156) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCK0 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene murG CDS complement(100153..101358) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene ftsW CDS complement(101355..102698) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY8 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene murD CDS complement(102715..103797) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene mraY CDS complement(103798..105174) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY6 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene murF CDS complement(105171..106703) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY5 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene murE CDS complement(106700..108448) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene ftsI CDS complement(108449..108751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(108757..109689) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene rsmH CDS complement(109698..110138) product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene mraZ CDS complement(110892..111674) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ3 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene rsmI CDS 111813..113807 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 113804..114193 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FK61 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 114194..114805 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene gmhA CDS 114805..115383 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 115404..116000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 116027..117952 product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 118054..119334 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(119687..120115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(120314..121390) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWM4 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene dinB CDS 121709..122479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(122572..123246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(123416..124099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(124262..124972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 125454..126674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(126816..128399) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU03 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene prfC CDS complement(128667..129284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(129498..130847) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 131105..132388 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene roxS CDS 132381..132914 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(133094..133594) product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene rimI CDS complement(133587..134423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(134436..135983) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene leuA CDS complement(136285..137694) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W45 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene otsA CDS complement(137691..139487) product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(139450..140220) product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ73 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene otsB CDS complement(140344..140964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(140946..144266) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(144519..145805) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039003.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(145833..147167) product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808316.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(147183..147608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(147750..148571) product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(148568..150121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 150380..152860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 152951..153286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 153299..154306 product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982092.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 154352..154876 product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 154906..156399 product type VI secretion system protein ImpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 156505..157053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502640.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene hcp CDS 157137..157952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 157958..158479 product type VI secretion system protein ImpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene impF CDS 158476..160350 product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190509.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 160347..161414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064508.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 161431..162267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 162301..165132 product protein ClpV1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I742 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene clpV1 CDS 165144..167399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 167415..168761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123798.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 168758..170074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 170173..170886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 170976..172718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 172715..173380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 174211..174525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 note possible pseudo, internal stop codon CDS 174911..175132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 sequence10 source 1..130504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(978..1904) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(2056..2847) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K487 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene nagB CDS complement(2844..4007) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5D1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene nagA CDS 4311..4949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035410.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(5046..5864) product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZE81 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene uspE CDS 6038..6511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(6508..7164) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene rnt CDS complement(7245..8285) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB40 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene pyrC CDS 8435..9400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 9582..10979 product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene mucD CDS 11126..11383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 11421..11825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(11803..13434) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene nadB CDS 13770..14363 product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene algU CDS 14567..15274 product sigma factor AlgU negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38107 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene mucA CDS 15278..16396 product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764762.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene mucB CDS 16399..16857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(16926..18011) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(18008..18544) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 18637..19008 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene dgkA CDS 19071..20300 product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 20321..23461 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 23620..24759 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976164.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 24752..27835 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 27945..28259 product global transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene bolA CDS 28394..29341 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FT1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 29458..29820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(29835..30368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(30528..31124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 31401..31607 product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene cspA CDS complement(31669..32598) product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 32616..33254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(33220..35292) product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886E0 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene mnmC CDS complement(35289..35840) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ60 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(35837..36283) product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707919.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(36364..36819) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU7 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene trmL CDS 36982..37899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 37899..38507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 38494..39162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 39155..39562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 39559..41295 product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene mshL CDS 41324..42232 product MSHA biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene mshM CDS 42232..43608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 43617..45404 product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 45391..46611 product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene mshG CDS 46614..47126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 47360..47797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 47803..48228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 48281..48706 product MSHA biogenesis protein MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene mshD CDS 48706..49494 product MSHA biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene mshO CDS 49484..49936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 49939..54063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 54343..55611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 55617..58301 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 58342..59112 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(59149..59790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 59789..60013 product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNW8 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 60017..60655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 60652..61710 product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQY7 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene rlmM CDS complement(61707..61988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(62068..62499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 62687..62926 product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene tusA CDS complement(62943..63644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 64089..64589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 65599..66477 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969897.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(66937..68247) product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene exuT CDS complement(68308..69087) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 69692..71902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 71903..74065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 74123..74485 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 74628..75380 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 75465..76373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 76408..77481 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene fbaA CDS 77518..79173 product fructose-1,6-bisphosphatase class 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IR8 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene fbp CDS 79212..80303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(80671..81009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 81096..82904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 83385..86312 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640062.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(86520..86660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 86632..87942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(88452..91499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 92197..93090 product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene exo CDS 93108..94244 product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R9 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene pdxB CDS 94349..95494 product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 95491..96453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(96462..96926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(96940..98154) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 98309..98701 product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EM9 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene msrB CDS complement(98761..99522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 tRNA 99758..99833 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 99835..99909 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 99955..100030 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 100034..100108 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 100295..101683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 102176..103861 product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18956 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene ggt CDS complement(103858..104844) product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ95 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene dusC CDS 105141..105389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 105490..107268 product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 107286..108593 product putative oxaloacetate decarboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTU5 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene oadB CDS 108810..110090 product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 110083..110850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093244.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 111203..112012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 112467..114308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 114384..116534 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 116534..117952 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 117952..118539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 118720..128631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 sequence11 source 1..107355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..1354) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene dnaJ CDS complement(1450..3372) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene dnaK CDS complement(3559..4116) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene grpE CDS 4272..5951 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene recN CDS complement(5948..6358) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene fur CDS 6485..6853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(6917..8575) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(8609..8998) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(9056..12355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(12520..12843) product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI82 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(12891..13325) product ribosome association toxin RatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGL6 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene ratA CDS complement(13328..14932) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 15125..15604 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene smpB CDS 15844..18171 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 18404..20116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 20236..21585 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(21652..22725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 22958..23566 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 23633..24220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 24372..24959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 25389..27191 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 27456..28754 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888240.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 28875..30506 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 30594..31718 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 31715..32539 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 32647..33342 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(33388..34611) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 35114..36292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(36334..37515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(37653..39626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(39775..41337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 41999..44260 product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(44785..47352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(47543..50041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(50198..52603) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene fyuA CDS 53083..54300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(54574..54813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 54914..57190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 57235..59502 product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(59598..60521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 60959..64096 product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 64204..65148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 65399..66220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(66281..66640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(66670..67110) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 67223..69055 product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 69161..70147 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(70265..71359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(71491..73140) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969438.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(73137..74123) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(74120..74599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(74602..75549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969435.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(75583..76563) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(76586..78817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 79199..80773 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122328.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene arsA CDS complement(81084..81950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 82139..83530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(83505..84848) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463736.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 84951..85679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 85800..86066 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 86070..87773 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 87892..88050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 88059..89189 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070717.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 89186..89782 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070716.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(89799..91940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(92216..93076) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULZ7 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene purU CDS complement(93193..94107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 94270..95100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 96013..98928 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene nrdA CDS 99004..100248 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPL5 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene nrdB CDS 100267..100506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 100749..101351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 101391..103301 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263953.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(103318..103647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 sequence12 source 1..104727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(1340..4087) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072179.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene yfiQ CDS complement(4228..5046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(5164..5760) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(6027..6452) product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene osmC CDS complement(6556..7344) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 7490..7660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(7699..8748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 8984..9844 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 10491..10913 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(10937..11200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(11131..11826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 12133..14196 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene fpvA1 CDS 14257..15516 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 15996..16802 product group 1 glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(17770..18639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707494.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(18787..19134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(19195..19620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(19696..22629) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene fyuA CDS 22887..23459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 23456..24439 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920554.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(24650..27277) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene fyuA CDS complement(27528..31403) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene purL CDS 31810..33315 product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene mltF CDS 33475..33900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(33906..34667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(34829..36322) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(36366..37382) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(37407..38861) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918856.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(39044..42292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(42729..43934) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(43998..44972) product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(44995..45657) product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FE9 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene pdxH CDS complement(45802..47250) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY4 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene katB CDS 47535..48158 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene mobA CDS 48467..49951 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 49983..50837 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 50837..51196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(51345..52124) product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(52117..52851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708148.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(53020..53832) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(53844..54626) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 54742..56535 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQC6 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene argS CDS complement(56746..57891) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8B0 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene galK CDS complement(57909..58967) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NA00 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene galT CDS complement(58989..60545) product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene sglT CDS complement(60594..61646) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F7D4 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene galE CDS 62034..64766 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036452.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene btuB CDS 64868..66070 product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene galA CDS 66084..68456 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658410.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(68507..70012) product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(70114..72954) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265674.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(73119..74624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(74950..76089) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene galM CDS complement(76255..77448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 77465..77638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(78238..79266) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267755.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 79295..80725 product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(80735..81091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(81157..81837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(81961..82281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(82293..84428) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene dinG CDS complement(84434..85597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 85788..86192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 86337..87608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(87618..88634) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene pyrB CDS 88884..89780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(89799..91283) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN93 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene lnt CDS complement(91334..92194) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(92191..92715) product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene ybeY CDS complement(92720..93817) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(93921..95279) product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene miaB CDS 95470..95796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 95980..97149 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene glpD CDS 97358..98851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 98851..99411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 99511..101346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 101601..103691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(103782..104183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099687.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 sequence13 source 1..97546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..1125) product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene pssA CDS complement(1239..2255) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene ilvC CDS 2412..3287 product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene ilvY CDS complement(3321..5966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(6037..9171) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene iroN CDS complement(9574..10065) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene ilvH CDS complement(10240..11973) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene ilvI CDS 12419..12850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(12917..15565) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene clpB CDS 15873..16559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 16819..17727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 17720..20113 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(20133..22145) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(22138..24027) product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(24108..26897) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 27261..28178 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 28183..29196 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 29297..30286 product deoxyfructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene socC CDS 30391..31683 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816134.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene ndh CDS 31774..32736 product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene ispB CDS 32901..33425 product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene fabA CDS complement(33405..33575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 33544..34761 product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene fabB CDS complement(34843..35703) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103231.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 35887..37068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(37099..38115) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(38115..39635) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(39632..40669) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228817.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(40670..41488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(41714..42268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(42371..43735) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 43909..46764 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene uvrA CDS 47026..49254 product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(49135..49362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 49469..50443 product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(50534..50929) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK46 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene rplQ CDS complement(51005..51994) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U6 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene rpoA CDS complement(52021..52641) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene rpsD CDS complement(52654..53049) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59375 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene rpsK CDS complement(53107..53463) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene rpsM CDS complement(53868..55205) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF5 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene secY CDS complement(55215..55649) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS08 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene rplO CDS complement(55651..55836) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK52 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene rpmD CDS complement(55874..56425) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene rpsE CDS complement(56394..56744) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene rplR CDS complement(56755..57288) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene rplF CDS complement(57300..57692) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ8 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene rpsH CDS complement(57723..58028) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHV5 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene rpsN CDS complement(58039..58578) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V9 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene rplE CDS complement(58584..58898) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene rplX CDS complement(58935..59303) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE5 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene rplN CDS complement(59341..59607) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ3 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene rpsQ CDS complement(59610..59801) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMA1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene rpmC CDS complement(59801..60214) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene rplP CDS complement(60227..60904) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene rpsC CDS complement(60918..61250) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE0 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene rplV CDS complement(61278..61556) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene rpsS CDS complement(61590..62417) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD8 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene rplB CDS complement(62431..62727) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene rplW CDS complement(62724..63338) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD6 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene rplD CDS complement(63359..64003) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD5 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene rplC CDS complement(64105..64416) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X2 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene rpsJ CDS complement(64827..66230) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene pntB CDS complement(66240..66524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(66537..67706) product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene pntAA CDS complement(67800..69401) product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 69541..70308 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 70432..71865 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 72178..74856 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene iroN CDS 75215..77716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 77743..78582 product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene kduI CDS 78597..79394 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(79437..79802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(79813..80163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(80190..80765) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(80779..81630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 81937..83634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(83776..86559) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene fyuA CDS complement(86733..87788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(87781..88329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 88764..89120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(89217..95093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 96220..96921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 96996..97319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 sequence14 source 1..96263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(376..651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 note possible pseudo, frameshifted CDS complement(884..1438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(1441..1710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 2214..2399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(2609..5212) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(5341..5568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710062.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 5820..6650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 6749..7279 product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene ppa CDS complement(7406..8113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 8425..8646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(8647..9486) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene cysE CDS complement(9530..10225) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066575.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(10266..11666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(11675..12352) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262398.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 12618..12896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 13122..13904 product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene cbpA CDS 14304..15197 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q3 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene htpX CDS 15190..16275 product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene degP CDS 16281..16622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(16609..17340) product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG4 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene sfsA CDS 17618..18061 product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene dksA CDS 18159..19058 product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP04 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene gluQ CDS 19074..19244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 19241..22276 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246100.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 22284..23681 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103371.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 24479..25816 product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene pcnB CDS 25821..26324 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 26356..27042 product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 27053..27874 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene panB CDS complement(27871..29277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 tRNA complement(29325..29401) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 30386..34627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 34728..37769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(37890..39050) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 39407..42550 product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 gene oar CDS complement(42625..43629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 43622..43768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 44065..44289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(44658..48269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(49266..49778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 49732..54462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 54982..56268 product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene pfp CDS 56330..57379 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 57680..60652 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 60727..62892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 62981..64135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 64735..65307 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483028.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(65404..65892) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(65991..66929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 67290..68474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 68675..69592 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene cysK CDS 69729..70742 product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(70811..72751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 72938..74095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(74137..74358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(74419..75036) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS0 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene ureG CDS complement(75053..75721) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene ureF CDS complement(75721..76239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(76250..77953) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP0 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene ureC CDS complement(77955..78260) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UG2 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene ureB CDS complement(78269..78571) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309349.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene ureA CDS complement(78635..79567) product urease accessory protein UreD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP5 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene ureD2 CDS 79999..81429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(82217..82876) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(82908..84251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(84428..85216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(85262..85669) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967057.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 86014..87408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(87574..88503) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 88722..89792 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 89982..90251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(90269..90583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(90936..93272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(93438..93785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(93862..94275) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266566.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(94327..94695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(95161..95400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(95508..96020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 sequence15 source 1..80997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(247..3387) product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(3401..4498) product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(4643..5950) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene tyrS CDS 6222..7697 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 7701..8843 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMW8 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene anmK CDS complement(8875..9228) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM4 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene erpA CDS complement(9317..9727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(9841..10581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(10612..11658) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene argC CDS 11828..12250 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 12328..13167 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 13232..13918 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene thiE CDS 13915..15195 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene hemL CDS complement(15261..15629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(15633..18080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 18647..19690 product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 19739..20560 product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 20557..21375 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 21372..22094 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 22106..22747 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 22848..26477 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(26583..28892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 29245..30135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 tRNA complement(30247..30322) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(30414..30692) product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(30733..31794) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148958.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(31791..34085) product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 34337..35428 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene gcvT CDS 35490..35882 product glycine cleavage system H protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX6 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene gcvH2 CDS 35879..36169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 36264..37067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 37101..38294 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(38314..38751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035594.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(39432..39875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(39933..40586) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109877.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(41097..42950) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 43182..44846 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 45010..47244 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262603.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 47411..48460 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104980.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 48511..48924 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene yaeJ CDS 48925..49395 product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFQ0 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(49404..49826) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088942.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 50274..51587 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 51602..53710 product fatty-acid oxidation protein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085215.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 53710..55572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(55536..58049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974940.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(58229..59482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(59703..60176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 60475..61914 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene nhaD CDS complement(61982..62890) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_308472.2 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 63003..63356 product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB4 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(63427..63573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 63878..64666 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(64759..64938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 65422..66645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 66692..68704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(68750..69073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(69319..70692) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene radA CDS complement(70733..71875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 72174..72968 product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04957 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene bglS CDS complement(72985..73341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 73328..74671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(74748..76223) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(76220..76993) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene drrA CDS complement(77143..77910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(77921..78622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(78803..79090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 79241..79705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(79767..80417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 sequence16 source 1..75742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(342..1358) product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene hemH2 CDS complement(1464..2600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(2638..3231) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 3525..4496 product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 4499..4939 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX9 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene dtd CDS 5029..5898 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(5972..8083) product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene fimX CDS complement(8358..10151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(10267..11274) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120173.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 11315..11887 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQL2 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene efp CDS 11907..12872 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAB4 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene lysS CDS 13230..15845 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFU8 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene ppc CDS complement(15995..16651) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 16858..17421 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267916.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(17418..17900) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPI9 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 18209..20272 product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 20259..20921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(20916..21890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 22166..23923 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073382.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(23940..24878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048859.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(24875..25216) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 25361..25729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(25875..26879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(27416..27652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(27660..28628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(29644..29844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(29844..30938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(31292..32266) product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59738 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene modC CDS complement(32253..32915) product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(32912..33616) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 33875..35011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 35237..36175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 36159..36557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 36554..37513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338208.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(37564..38697) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(38762..39082) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 39494..40771 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene amt CDS 40768..41424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(41445..42935) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(43302..43508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(43555..45417) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene feoB CDS complement(45414..45731) product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265601.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(45832..47721) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene dxs CDS complement(47790..48674) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene ispA CDS complement(48674..48922) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene xseB CDS 49183..49950 product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 49956..50942 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460634.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene motB CDS 51482..52888 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(52943..54307) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4R0 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(54388..55656) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene ectB CDS 56204..56818 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 57137..57697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 57825..58724 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(58757..59644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(59717..60076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 60348..63851 product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene gdhP CDS complement(63951..64805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(64934..65734) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene cysE CDS complement(65784..66782) product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AA8 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene srkA CDS complement(67045..67449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 67923..68945 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 69216..70187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 70211..71155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 71660..75463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 75487..75627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 sequence17 source 1..69282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2945 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein locus_tag LOCUS_33040 CDS 2950..3933 product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene chpB CDS 3930..4415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 4520..5128 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(5088..5819) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ99 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 5948..6490 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 6504..6635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(6711..7253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(7292..7600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(7612..7980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(7989..8300) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072008.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene sugE CDS 8490..10040 product potassium transporter KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228222.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(10099..10938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(11304..12152) product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(12182..12889) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene trmB CDS complement(12886..13305) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(13387..14247) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene rpoH CDS complement(14444..15457) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AG1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene ftsX CDS complement(15454..16122) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene ftsE CDS complement(16119..17297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 17412..17981 product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKW9 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 18033..18515 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene coaD CDS complement(18490..19431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 19613..20788 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088709.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(20838..21836) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 22165..24042 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 24171..25352 product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 25349..26599 product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 26889..28055 product mannanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918686.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 28181..29416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(29503..31005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(31465..33225) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(33294..34769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 35102..36832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 36853..37215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 37443..39038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 39199..40344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(40632..41159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(41425..41910) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(41970..42323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(42586..42825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 42858..43004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(43034..44899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(45003..45518) product DNA topology modulation protein FlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016073.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(45851..46822) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 47134..49374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 49397..50716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 51107..52891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 52965..53459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 53468..54454 product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338207.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 54616..55878 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH4 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene glyA CDS 56189..56650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 56654..56881 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene rpsR CDS 56893..57738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 57776..58222 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 transl_table 11 codon_start 1 locus_tag LOCUS_33580 gene rplI CDS 58368..59768 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene dnaB CDS 60726..61292 product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 61423..62274 product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene panC CDS 62361..62741 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV68 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene panD CDS complement(62763..65249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 65410..65868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 66080..68014 product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene acsA2 CDS 68123..68695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene ydaL CDS 68710..68922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 sequence18 source 1..44529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..2038) product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ08 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene thiC CDS complement(2031..2873) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene thiD CDS complement(2843..3010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 3418..4803 product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(4886..6160) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene kdtA CDS complement(6279..6857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(6925..7278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(7412..8491) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(8567..8737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(9098..10804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 10974..12209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 12202..13038 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 13035..13433 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene hisI CDS 13477..13812 product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene hisE CDS 13839..14081 product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene tatA CDS 14096..14509 product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG9 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene tatB CDS 14506..15291 product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH0 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene tatC CDS complement(15313..15522) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 15782..17404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 17434..18663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105922.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 18678..19082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(19139..22765) product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815440.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(22813..24543) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(24677..25522) product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 25677..26147 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 26268..27017 product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene ubiE CDS 27017..27643 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115043.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 27643..29292 product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene ubiB CDS 29341..30978 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 30990..31400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(31485..32702) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105245.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 32804..34045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 34166..35881 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 36195..37556 product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M0 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene mpl CDS 37575..38180 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene ubiX CDS 38180..39106 product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene liuE CDS 39103..39408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(39516..40247) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 40493..41545 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene tas repeat_region 41625..>44529 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcttagctgcctgtgcggcagcgaac sequence19 source 1..37710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(1266..1793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(2365..2718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(2956..3552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(4178..5875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 7242..9011 product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 9161..10009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 note possible pseudo, internal stop codon CDS 10016..10582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 note possible pseudo, internal stop codon CDS complement(10617..11150) product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(11282..11692) product DabB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(11807..12073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036386.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 12199..13125 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974802.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(13137..13541) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066939.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 13724..15385 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705267.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 15647..16978 product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(17027..17503) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(17500..17745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(17882..19243) product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(19362..20786) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene ntrC CDS complement(20773..21876) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene ntrB CDS complement(22151..22699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(22829..24232) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(24225..24539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 24581..26062 product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene thiI CDS 26065..26526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 26688..28511 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene typA CDS 28785..30128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(30155..30340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(30363..30818) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG90 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(30872..31675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 31946..34093 product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 34117..35403 product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 35424..36509 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480736.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 36838..37158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 sequence20 source 1..31792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..1440 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 1763..4714 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 4837..5559 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 5734..5988 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 6092..8158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 8155..9159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 9530..9823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 9825..10886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 10966..13467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 13493..14788 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199472.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 14797..16473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 16470..17342 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812713.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 17355..18236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 18646..19077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 19064..19891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 20284..21261 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 21277..21771 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 21832..23136 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene ygiK CDS 23147..23536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 23581..24864 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887310.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(24932..25885) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(25973..26191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 26289..27704 product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0M5 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene uxaC CDS 27715..29187 product mannitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969872.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 29187..30380 product pectinesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJ76 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 30535..30771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 30929..31546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 sequence21 source 1..31339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(1156..2115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(2348..4441) product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene fusA2 CDS 4793..5086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(5091..6815) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(6885..7694) product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085585.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(8136..8927) product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 9064..9774 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 9847..10398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 10476..11462 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 11803..14244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105080.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 14369..14752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 14885..15844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 15940..16884 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086958.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 16928..17242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098676.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 17317..18495 product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 18642..19112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(19336..20559) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene araJ CDS complement(20815..21072) product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene minE CDS complement(21072..21881) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC7 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene minD CDS complement(21910..22626) product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW11 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene minC CDS complement(22784..23923) product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene xynA CDS complement(23931..24479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(24753..26726) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203543.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(26927..27268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(27270..28064) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(28180..28863) product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU12 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene trmH CDS 28927..29175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 29200..30006 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727S2 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(30356..31165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 sequence22 source 1..29677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 452..1195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 1192..1389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(1616..3241) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123644.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 3484..4083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 4162..5391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089771.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 5881..6438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 6638..8485 product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 8475..9839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039058.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 9840..10550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 10591..11067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(11080..11802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(11802..12914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 13139..14107 product abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525237.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 14744..18004 product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene hsdR CDS complement(18199..18480) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK5 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene ppiC2 tmRNA complement(18769..19159) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(19292..19879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 20205..22994 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene malA CDS 23117..24610 product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(24669..26951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 27251..28129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 28276..29127 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 29256..29582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 sequence23 source 1..8068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(484..675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 1252..1719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(1723..2340) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709989.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 2633..3709 product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462329.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 3719..6787 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(7034..7222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 7260..7622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 7610..7975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 sequence24 source 1..7179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(616..969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 1315..2277 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene intI CDS complement(2497..4386) product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene parE CDS complement(4459..5049) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(5090..5914) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ6 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene cpdA CDS complement(6138..6602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 misc_feature complement(6599..>7179) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707476.1:ADP-ribose pyrophosphatase locus_tag LOCUS_35350 sequence25 source 1..4549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(434..976) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene maa CDS complement(1013..2005) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094813.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(2032..3174) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(3267..4499) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262922.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 sequence26 source 1..4186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1189..2862) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 transl_table 11 codon_start 1 locus_tag LOCUS_35410 gene ilvD CDS complement(2981..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887695.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(3772..4068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430