>Feature sequence001 1040 117 gene locus_tag LOCUS_00010 1040 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2176 1370 gene locus_tag LOCUS_00020 gene yfeN 2176 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261438.1 protein_id gnl|my_center|LOCUS_00020 2804 2583 gene locus_tag LOCUS_00030 2804 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3641 2901 gene locus_tag LOCUS_00040 3641 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3871 5244 gene locus_tag LOCUS_00050 gene glmU 3871 5244 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C2 protein_id gnl|my_center|LOCUS_00050 5262 7094 gene locus_tag LOCUS_00060 gene glmS 5262 7094 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQX0 protein_id gnl|my_center|LOCUS_00060 7240 8088 gene locus_tag LOCUS_00070 7240 8088 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090707.1 protein_id gnl|my_center|LOCUS_00070 8085 10205 gene locus_tag LOCUS_00080 8085 10205 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351437.1 protein_id gnl|my_center|LOCUS_00080 10202 11815 gene locus_tag LOCUS_00090 10202 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13108 13365 gene locus_tag LOCUS_00100 13108 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13406 14959 gene locus_tag LOCUS_00110 13406 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15537 15037 gene locus_tag LOCUS_00120 15537 15037 CDS product copper-containing oxidoreductase signal peptide protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_384693.1 protein_id gnl|my_center|LOCUS_00120 15712 15500 gene locus_tag LOCUS_00130 15712 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15763 16143 gene locus_tag LOCUS_00140 15763 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16260 17537 gene locus_tag LOCUS_00150 gene cusC 16260 17537 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263307.1 protein_id gnl|my_center|LOCUS_00150 17537 19315 gene locus_tag LOCUS_00160 17537 19315 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_00160 19327 19719 gene locus_tag LOCUS_00170 19327 19719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00170 19731 22856 gene locus_tag LOCUS_00180 gene cusA 19731 22856 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_00180 22921 23367 gene locus_tag LOCUS_00190 gene copG 22921 23367 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_00190 23662 23880 gene locus_tag LOCUS_00200 23662 23880 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305998.1 protein_id gnl|my_center|LOCUS_00200 23877 24659 gene locus_tag LOCUS_00210 23877 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_00210 24652 25200 gene locus_tag LOCUS_00220 24652 25200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_00220 25249 28731 gene locus_tag LOCUS_00230 25249 28731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_00230 28744 32031 gene locus_tag LOCUS_00240 28744 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32487 33581 gene locus_tag LOCUS_00250 32487 33581 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 protein_id gnl|my_center|LOCUS_00250 33578 34237 gene locus_tag LOCUS_00260 33578 34237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_00260 34250 36568 gene locus_tag LOCUS_00270 34250 36568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_00270 36571 38616 gene locus_tag LOCUS_00280 36571 38616 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393721.1 protein_id gnl|my_center|LOCUS_00280 39259 38816 gene locus_tag LOCUS_00290 39259 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00290 40090 39290 gene locus_tag LOCUS_00300 40090 39290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00300 40773 40093 gene locus_tag LOCUS_00310 40773 40093 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457963.1 protein_id gnl|my_center|LOCUS_00310 40919 41119 gene locus_tag LOCUS_00320 40919 41119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 41153 41683 gene locus_tag LOCUS_00330 41153 41683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00330 41680 43461 gene locus_tag LOCUS_00340 41680 43461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence002 1138 161 gene locus_tag LOCUS_00350 1138 161 CDS product thiamine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263204.1 protein_id gnl|my_center|LOCUS_00350 2055 1294 gene locus_tag LOCUS_00360 gene tauC 2055 1294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263203.1 protein_id gnl|my_center|LOCUS_00360 2840 2052 gene locus_tag LOCUS_00370 2840 2052 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389334.1 protein_id gnl|my_center|LOCUS_00370 3725 2844 gene locus_tag LOCUS_00380 gene thiD 3725 2844 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 protein_id gnl|my_center|LOCUS_00380 6072 4030 gene locus_tag LOCUS_00390 6072 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 6370 6588 gene locus_tag LOCUS_00400 6370 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 6867 7838 gene locus_tag LOCUS_00410 6867 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 9999 8539 gene locus_tag LOCUS_00420 gene gabD 9999 8539 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_00420 10365 12497 gene locus_tag LOCUS_00430 10365 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 15575 12741 gene locus_tag LOCUS_00440 gene uvrA 15575 12741 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_00440 16541 15594 gene locus_tag LOCUS_00450 16541 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 16991 16542 gene locus_tag LOCUS_00460 16991 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 17816 17139 gene locus_tag LOCUS_00470 gene bioD 17816 17139 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB2 protein_id gnl|my_center|LOCUS_00470 18656 17820 gene locus_tag LOCUS_00480 gene bioC 18656 17820 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB1 protein_id gnl|my_center|LOCUS_00480 19381 18641 gene locus_tag LOCUS_00490 19381 18641 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402140.1 protein_id gnl|my_center|LOCUS_00490 20574 19378 gene locus_tag LOCUS_00500 gene bioF 20574 19378 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_00500 21654 20578 gene locus_tag LOCUS_00510 gene bioB 21654 20578 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA8 protein_id gnl|my_center|LOCUS_00510 21739 22485 gene locus_tag LOCUS_00520 21739 22485 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_00520 22586 23581 gene locus_tag LOCUS_00530 gene srkA 22586 23581 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_00530 23674 24756 gene locus_tag LOCUS_00540 23674 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 25149 26162 gene locus_tag LOCUS_00550 25149 26162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 27590 26187 gene locus_tag LOCUS_00560 27590 26187 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW7 protein_id gnl|my_center|LOCUS_00560 29132 28686 gene locus_tag LOCUS_00570 gene rplI 29132 28686 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 protein_id gnl|my_center|LOCUS_00570 30244 29375 gene locus_tag LOCUS_00580 30244 29375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_00580 30541 30317 gene locus_tag LOCUS_00590 gene rpsR 30541 30317 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_00590 31018 30596 gene locus_tag LOCUS_00600 31018 30596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 31352 33133 gene locus_tag LOCUS_00610 31352 33133 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705450.1 protein_id gnl|my_center|LOCUS_00610 33130 36822 gene locus_tag LOCUS_00620 33130 36822 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_00620 39399 36841 gene locus_tag LOCUS_00630 39399 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence003 949 560 gene locus_tag LOCUS_00640 949 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 1916 942 gene locus_tag LOCUS_00650 1916 942 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674809.1 protein_id gnl|my_center|LOCUS_00650 4887 2005 gene locus_tag LOCUS_00660 4887 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5708 5202 gene locus_tag LOCUS_00670 gene folA 5708 5202 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AF3 protein_id gnl|my_center|LOCUS_00670 7227 5767 gene locus_tag LOCUS_00680 gene thiI 7227 5767 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32JI1 protein_id gnl|my_center|LOCUS_00680 7648 9051 gene locus_tag LOCUS_00690 gene glnA 7648 9051 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_00690 9160 9753 gene locus_tag LOCUS_00700 9160 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114474.1 protein_id gnl|my_center|LOCUS_00700 9835 10380 gene locus_tag LOCUS_00710 9835 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 10528 11241 gene locus_tag LOCUS_00720 gene cooB 10528 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074074.1 protein_id gnl|my_center|LOCUS_00720 11349 12212 gene locus_tag LOCUS_00730 11349 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12989 12507 gene locus_tag LOCUS_00740 12989 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_00740 14190 13225 gene locus_tag LOCUS_00750 14190 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 16910 14331 gene locus_tag LOCUS_00760 gene tsaC 16910 14331 CDS product fimbrial outer membrane usher protein TcfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092510.1 protein_id gnl|my_center|LOCUS_00760 17784 17206 gene locus_tag LOCUS_00770 17784 17206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 18715 18134 gene locus_tag LOCUS_00780 18715 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 19562 18966 gene locus_tag LOCUS_00790 19562 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19630 20682 gene locus_tag LOCUS_00800 gene ntrB 19630 20682 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_00800 20693 22129 gene locus_tag LOCUS_00810 gene ntrC 20693 22129 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555721.1 protein_id gnl|my_center|LOCUS_00810 22957 22181 gene locus_tag LOCUS_00820 22957 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 25555 23084 gene locus_tag LOCUS_00830 25555 23084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26626 25691 gene locus_tag LOCUS_00840 26626 25691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 27331 26738 gene locus_tag LOCUS_00850 27331 26738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 27566 28030 gene locus_tag LOCUS_00860 gene trmL 27566 28030 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDX5 protein_id gnl|my_center|LOCUS_00860 28664 28197 gene locus_tag LOCUS_00870 gene secB 28664 28197 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_00870 29099 28839 gene locus_tag LOCUS_00880 gene grx 29099 28839 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU55 protein_id gnl|my_center|LOCUS_00880 29548 29132 gene locus_tag LOCUS_00890 29548 29132 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 protein_id gnl|my_center|LOCUS_00890 29792 31321 gene locus_tag LOCUS_00900 gene gpmI 29792 31321 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_00900 31978 31361 gene locus_tag LOCUS_00910 gene fklB 31978 31361 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_00910 32865 32224 gene locus_tag LOCUS_00920 32865 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 >Feature sequence004 67 636 gene locus_tag LOCUS_00930 67 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2227 827 gene locus_tag LOCUS_00940 gene pmpM 2227 827 CDS product multidrug resistance protein PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Y3 protein_id gnl|my_center|LOCUS_00940 2411 3226 gene locus_tag LOCUS_00950 gene mutM 2411 3226 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_00950 3227 3862 gene locus_tag LOCUS_00960 3227 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_00960 4317 5324 gene locus_tag LOCUS_00970 gene dctP 4317 5324 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_00970 5327 5821 gene locus_tag LOCUS_00980 gene dctQ 5327 5821 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_00980 5821 7212 gene locus_tag LOCUS_00990 gene dctM 5821 7212 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_00990 8869 7220 gene locus_tag LOCUS_01000 8869 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 9665 9225 gene locus_tag LOCUS_01010 9665 9225 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q8 protein_id gnl|my_center|LOCUS_01010 10066 9677 gene locus_tag LOCUS_01020 10066 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 10348 10070 gene locus_tag LOCUS_01030 10348 10070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_01030 11108 11686 gene locus_tag LOCUS_01040 11108 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 11702 12244 gene locus_tag LOCUS_01050 11702 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 12327 13097 gene locus_tag LOCUS_01060 12327 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 13141 13764 gene locus_tag LOCUS_01070 13141 13764 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946655.1 protein_id gnl|my_center|LOCUS_01070 15293 13845 gene locus_tag LOCUS_01080 15293 13845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15807 17399 gene locus_tag LOCUS_01090 15807 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 17396 18751 gene locus_tag LOCUS_01100 17396 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 18732 23846 gene locus_tag LOCUS_01110 18732 23846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 23891 24229 gene locus_tag LOCUS_01120 23891 24229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 24277 26115 gene locus_tag LOCUS_01130 24277 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701844.1 protein_id gnl|my_center|LOCUS_01130 26484 26134 gene locus_tag LOCUS_01140 26484 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 28501 26474 gene locus_tag LOCUS_01150 28501 26474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 protein_id gnl|my_center|LOCUS_01150 30027 28498 gene locus_tag LOCUS_01160 30027 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701838.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence005 <1 525 gene locus_tag LOCUS_01170 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P53593:succinate--CoA ligase [ADP-forming] subunit beta 525 1397 gene locus_tag LOCUS_01180 gene sucD 525 1397 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_01180 1579 2454 gene locus_tag LOCUS_01190 gene menA 1579 2454 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1L4 protein_id gnl|my_center|LOCUS_01190 4736 2664 gene locus_tag LOCUS_01200 gene xcpQ 4736 2664 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_01200 5420 4782 gene locus_tag LOCUS_01210 5420 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 5679 7202 gene locus_tag LOCUS_01220 gene xcpR 5679 7202 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_01220 7220 8443 gene locus_tag LOCUS_01230 gene xcpS 7220 8443 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_01230 8535 8963 gene locus_tag LOCUS_01240 gene xcpT 8535 8963 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 protein_id gnl|my_center|LOCUS_01240 8963 9460 gene locus_tag LOCUS_01250 8963 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 9540 10001 gene locus_tag LOCUS_01260 gene xcpV 9540 10001 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_01260 10005 10739 gene locus_tag LOCUS_01270 gene xcpW 10005 10739 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_01270 10736 11779 gene locus_tag LOCUS_01280 gene xcpX 10736 11779 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_01280 11786 13177 gene locus_tag LOCUS_01290 gene xcpY 11786 13177 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25060 protein_id gnl|my_center|LOCUS_01290 13182 13694 gene locus_tag LOCUS_01300 13182 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13972 13793 gene locus_tag LOCUS_01310 13972 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 14394 15371 gene locus_tag LOCUS_01320 gene prfB 14394 15371 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E1JGJ8 protein_id gnl|my_center|LOCUS_01320 15443 16939 gene locus_tag LOCUS_01330 gene lysS 15443 16939 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWW0 protein_id gnl|my_center|LOCUS_01330 17919 17218 gene locus_tag LOCUS_01340 17919 17218 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453980.1 protein_id gnl|my_center|LOCUS_01340 18356 18769 gene locus_tag LOCUS_01350 18356 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 20936 18828 gene locus_tag LOCUS_01360 gene prc 20936 18828 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_01360 22528 21218 gene locus_tag LOCUS_01370 gene apeB 22528 21218 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_01370 23133 22870 gene locus_tag LOCUS_01380 gene minE 23133 22870 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC6 protein_id gnl|my_center|LOCUS_01380 23945 23130 gene locus_tag LOCUS_01390 gene minD 23945 23130 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUR8 protein_id gnl|my_center|LOCUS_01390 24724 23996 gene locus_tag LOCUS_01400 gene minC 24724 23996 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ7 protein_id gnl|my_center|LOCUS_01400 24895 25836 gene locus_tag LOCUS_01410 gene lpxL 24895 25836 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 protein_id gnl|my_center|LOCUS_01410 26274 25852 gene locus_tag LOCUS_01420 26274 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 <28186 26735 gene locus_tag LOCUS_01430 <28186 26735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZPQ0:RNA polymerase-associated protein RapA >Feature sequence006 206 1567 gene locus_tag LOCUS_01440 gene ibeB 206 1567 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_01440 1564 2820 gene locus_tag LOCUS_01450 1564 2820 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_01450 2817 5903 gene locus_tag LOCUS_01460 gene czcA 2817 5903 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_01460 6941 5973 gene locus_tag LOCUS_01470 6941 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7588 7088 gene locus_tag LOCUS_01480 7588 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7908 7633 gene locus_tag LOCUS_01490 7908 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262217.1 protein_id gnl|my_center|LOCUS_01490 8492 7992 gene locus_tag LOCUS_01500 8492 7992 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_01500 8933 8517 gene locus_tag LOCUS_01510 8933 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9843 9013 gene locus_tag LOCUS_01520 9843 9013 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 protein_id gnl|my_center|LOCUS_01520 10995 10108 gene locus_tag LOCUS_01530 10995 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11711 10992 gene locus_tag LOCUS_01540 11711 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 12063 13697 gene locus_tag LOCUS_01550 12063 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 15390 13627 gene locus_tag LOCUS_01560 gene mdlB 15390 13627 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261611.1 protein_id gnl|my_center|LOCUS_01560 17226 15406 gene locus_tag LOCUS_01570 gene mdlA 17226 15406 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261610.1 protein_id gnl|my_center|LOCUS_01570 17619 18932 gene locus_tag LOCUS_01580 17619 18932 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_01580 18938 19753 gene locus_tag LOCUS_01590 18938 19753 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_01590 19740 20990 gene locus_tag LOCUS_01600 19740 20990 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_01600 20987 21568 gene locus_tag LOCUS_01610 20987 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 protein_id gnl|my_center|LOCUS_01610 21577 22350 gene locus_tag LOCUS_01620 21577 22350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_01620 22864 22424 gene locus_tag LOCUS_01630 22864 22424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 23076 23789 gene locus_tag LOCUS_01640 23076 23789 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_01640 23786 25234 gene locus_tag LOCUS_01650 23786 25234 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_01650 25439 27097 gene locus_tag LOCUS_01660 25439 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence007 2164 101 gene locus_tag LOCUS_01670 2164 101 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_01670 3588 2242 gene locus_tag LOCUS_01680 3588 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4676 3789 gene locus_tag LOCUS_01690 4676 3789 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814625.1 protein_id gnl|my_center|LOCUS_01690 4827 5507 gene locus_tag LOCUS_01700 4827 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_01700 5500 6168 gene locus_tag LOCUS_01710 5500 6168 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771485.1 protein_id gnl|my_center|LOCUS_01710 7024 6254 gene locus_tag LOCUS_01720 7024 6254 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_01720 8315 7071 gene locus_tag LOCUS_01730 gene amtB 8315 7071 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_01730 8739 8401 gene locus_tag LOCUS_01740 gene glnK 8739 8401 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_01740 8972 9226 gene locus_tag LOCUS_01750 8972 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198021.1 protein_id gnl|my_center|LOCUS_01750 10329 9328 gene locus_tag LOCUS_01760 10329 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11574 10477 gene locus_tag LOCUS_01770 11574 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082911.1 protein_id gnl|my_center|LOCUS_01770 12674 11601 gene locus_tag LOCUS_01780 12674 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950891.1 protein_id gnl|my_center|LOCUS_01780 14403 12766 gene locus_tag LOCUS_01790 14403 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 15155 14439 gene locus_tag LOCUS_01800 15155 14439 CDS product short-chain dehydrogenase/reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103227.1 protein_id gnl|my_center|LOCUS_01800 16572 15193 gene locus_tag LOCUS_01810 gene dbpA 16572 15193 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_01810 18900 16762 gene locus_tag LOCUS_01820 18900 16762 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_01820 18985 19986 gene locus_tag LOCUS_01830 gene hemB 18985 19986 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59643 protein_id gnl|my_center|LOCUS_01830 20207 22423 gene locus_tag LOCUS_01840 gene ppk 20207 22423 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 protein_id gnl|my_center|LOCUS_01840 23220 22420 gene locus_tag LOCUS_01850 23220 22420 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_01850 23532 24302 gene locus_tag LOCUS_01860 23532 24302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_01860 24343 24765 gene locus_tag LOCUS_01870 24343 24765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 25166 24786 gene locus_tag LOCUS_01880 25166 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 25588 25175 gene locus_tag LOCUS_01890 25588 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence008 930 274 gene locus_tag LOCUS_01900 930 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3440 1095 gene locus_tag LOCUS_01910 3440 1095 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266280.1 protein_id gnl|my_center|LOCUS_01910 5330 3714 gene locus_tag LOCUS_01920 gene pckA 5330 3714 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE1 protein_id gnl|my_center|LOCUS_01920 6567 5695 gene locus_tag LOCUS_01930 gene hslO 6567 5695 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_01930 6881 9106 gene locus_tag LOCUS_01940 6881 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9383 9087 gene locus_tag LOCUS_01950 gene frwB 9383 9087 CDS product fructose-like phosphotransferase enzyme IIB component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_01950 10963 9650 gene locus_tag LOCUS_01960 10963 9650 CDS product agglutination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951431.1 protein_id gnl|my_center|LOCUS_01960 11118 11483 gene locus_tag LOCUS_01970 gene pilH 11118 11483 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_01970 11558 12100 gene locus_tag LOCUS_01980 gene pilI 11558 12100 CDS product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 protein_id gnl|my_center|LOCUS_01980 12137 14176 gene locus_tag LOCUS_01990 gene pilJ 12137 14176 CDS product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 protein_id gnl|my_center|LOCUS_01990 14289 19385 gene locus_tag LOCUS_02000 14289 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 20700 19471 gene locus_tag LOCUS_02010 20700 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 21139 22131 gene locus_tag LOCUS_02020 21139 22131 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266459.1 protein_id gnl|my_center|LOCUS_02020 22128 23123 gene locus_tag LOCUS_02030 gene waaC 22128 23123 CDS product heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_02030 23227 23490 gene locus_tag LOCUS_02040 23227 23490 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_02040 23480 23710 gene locus_tag LOCUS_02050 23480 23710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_02050 24112 24549 gene locus_tag LOCUS_02060 24112 24549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 24612 24854 gene locus_tag LOCUS_02070 24612 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence009 1249 791 gene locus_tag LOCUS_02080 1249 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 1438 2799 gene locus_tag LOCUS_02090 1438 2799 CDS product chitin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262918.1 protein_id gnl|my_center|LOCUS_02090 3043 3648 gene locus_tag LOCUS_02100 3043 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261131.1 protein_id gnl|my_center|LOCUS_02100 3650 4366 gene locus_tag LOCUS_02110 3650 4366 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_02110 4363 5625 gene locus_tag LOCUS_02120 4363 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_02120 5781 6326 gene locus_tag LOCUS_02130 5781 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105266.1 protein_id gnl|my_center|LOCUS_02130 6373 9276 gene locus_tag LOCUS_02140 gene glnE 6373 9276 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VD5 protein_id gnl|my_center|LOCUS_02140 10756 9329 gene locus_tag LOCUS_02150 10756 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 11437 13647 gene locus_tag LOCUS_02160 gene hutA 11437 13647 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 protein_id gnl|my_center|LOCUS_02160 13940 14230 gene locus_tag LOCUS_02170 13940 14230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 14973 14257 gene locus_tag LOCUS_02180 14973 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 15519 16217 gene locus_tag LOCUS_02190 15519 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 16273 16998 gene locus_tag LOCUS_02200 gene exbB1 16273 16998 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261840.1 protein_id gnl|my_center|LOCUS_02200 16995 17426 gene locus_tag LOCUS_02210 gene exbD1 16995 17426 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 protein_id gnl|my_center|LOCUS_02210 17438 18322 gene locus_tag LOCUS_02220 17438 18322 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479207.1 protein_id gnl|my_center|LOCUS_02220 18312 19358 gene locus_tag LOCUS_02230 18312 19358 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_02230 19361 20149 gene locus_tag LOCUS_02240 gene hmuV 19361 20149 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_02240 20402 21295 gene locus_tag LOCUS_02250 20402 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_02250 21428 22915 gene locus_tag LOCUS_02260 21428 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 23850 23269 gene locus_tag LOCUS_02270 23850 23269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 24535 24257 gene locus_tag LOCUS_02280 24535 24257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence010 416 1621 gene locus_tag LOCUS_02290 416 1621 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_02290 2369 1704 gene locus_tag LOCUS_02300 2369 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2534 3283 gene locus_tag LOCUS_02310 2534 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3745 5241 gene locus_tag LOCUS_02320 3745 5241 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_02320 5583 5792 gene locus_tag LOCUS_02330 gene cspG 5583 5792 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_02330 6935 5862 gene locus_tag LOCUS_02340 gene modC 6935 5862 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS73 protein_id gnl|my_center|LOCUS_02340 7599 6928 gene locus_tag LOCUS_02350 gene modB 7599 6928 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705491.1 protein_id gnl|my_center|LOCUS_02350 8370 7600 gene locus_tag LOCUS_02360 8370 7600 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267943.1 protein_id gnl|my_center|LOCUS_02360 8968 8513 gene locus_tag LOCUS_02370 gene moaE 8968 8513 CDS product molybdopterin guanine dinucleotide biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418591.1 protein_id gnl|my_center|LOCUS_02370 9674 8946 gene locus_tag LOCUS_02380 9674 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10415 10164 gene locus_tag LOCUS_02390 gene moaD 10415 10164 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTX2 protein_id gnl|my_center|LOCUS_02390 10894 10412 gene locus_tag LOCUS_02400 gene moaC 10894 10412 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT79 protein_id gnl|my_center|LOCUS_02400 11437 10901 gene locus_tag LOCUS_02410 gene moaB2 11437 10901 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZH7 protein_id gnl|my_center|LOCUS_02410 12024 11440 gene locus_tag LOCUS_02420 gene mobA 12024 11440 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_02420 12127 12891 gene locus_tag LOCUS_02430 gene hpcH 12127 12891 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_02430 13369 12899 gene locus_tag LOCUS_02440 13369 12899 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL64 protein_id gnl|my_center|LOCUS_02440 14894 13431 gene locus_tag LOCUS_02450 14894 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 15609 14986 gene locus_tag LOCUS_02460 15609 14986 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GU2 protein_id gnl|my_center|LOCUS_02460 15835 15584 gene locus_tag LOCUS_02470 15835 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 15834 16376 gene locus_tag LOCUS_02480 15834 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 17423 16380 gene locus_tag LOCUS_02490 gene argC 17423 16380 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM3 protein_id gnl|my_center|LOCUS_02490 17822 17529 gene locus_tag LOCUS_02500 17822 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 18045 17806 gene locus_tag LOCUS_02510 18045 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 18332 18108 gene locus_tag LOCUS_02520 18332 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_02520 19062 18346 gene locus_tag LOCUS_02530 19062 18346 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 protein_id gnl|my_center|LOCUS_02530 19432 19055 gene locus_tag LOCUS_02540 19432 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 19533 21236 gene locus_tag LOCUS_02550 19533 21236 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_02550 21252 21671 gene locus_tag LOCUS_02560 21252 21671 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_02560 21730 22482 gene locus_tag LOCUS_02570 21730 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence011 1060 170 gene locus_tag LOCUS_02580 gene coIII 1060 170 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_02580 1497 1162 gene locus_tag LOCUS_02590 1497 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 2066 1494 gene locus_tag LOCUS_02600 2066 1494 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_02600 3680 2091 gene locus_tag LOCUS_02610 gene coxA 3680 2091 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_02610 4883 3693 gene locus_tag LOCUS_02620 gene coxB 4883 3693 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_02620 6111 5485 gene locus_tag LOCUS_02630 6111 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6319 6975 gene locus_tag LOCUS_02640 6319 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719730.1 protein_id gnl|my_center|LOCUS_02640 7578 7327 gene locus_tag LOCUS_02650 7578 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 9747 7681 gene locus_tag LOCUS_02660 gene prlC 9747 7681 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_02660 10090 10626 gene locus_tag LOCUS_02670 10090 10626 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889777.1 protein_id gnl|my_center|LOCUS_02670 10776 11063 gene locus_tag LOCUS_02680 10776 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 11162 11746 gene locus_tag LOCUS_02690 11162 11746 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF67 protein_id gnl|my_center|LOCUS_02690 12516 11818 gene locus_tag LOCUS_02700 12516 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14509 12617 gene locus_tag LOCUS_02710 gene mnmG 14509 12617 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_02710 15048 16097 gene locus_tag LOCUS_02720 15048 16097 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479089.1 protein_id gnl|my_center|LOCUS_02720 16196 17752 gene locus_tag LOCUS_02730 gene fbpB 16196 17752 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704617.1 protein_id gnl|my_center|LOCUS_02730 17749 18861 gene locus_tag LOCUS_02740 gene fbpC 17749 18861 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071049.1 protein_id gnl|my_center|LOCUS_02740 19388 18885 gene locus_tag LOCUS_02750 19388 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 20165 19539 gene locus_tag LOCUS_02760 20165 19539 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_02760 21582 20203 gene locus_tag LOCUS_02770 gene mnmE 21582 20203 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Z9 protein_id gnl|my_center|LOCUS_02770 22030 21878 gene locus_tag LOCUS_02780 22030 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence012 179 1387 gene locus_tag LOCUS_02790 179 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3244 1466 gene locus_tag LOCUS_02800 3244 1466 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_02800 3386 3637 gene locus_tag LOCUS_02810 gene rpoZ 3386 3637 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_02810 3707 5836 gene locus_tag LOCUS_02820 gene spoT 3707 5836 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_02820 5914 6300 gene locus_tag LOCUS_02830 5914 6300 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957491.1 protein_id gnl|my_center|LOCUS_02830 6380 7765 gene locus_tag LOCUS_02840 6380 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 9701 7824 gene locus_tag LOCUS_02850 9701 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 9960 9769 gene locus_tag LOCUS_02860 9960 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11979 10054 gene locus_tag LOCUS_02870 11979 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 12657 13562 gene locus_tag LOCUS_02880 gene oxyR 12657 13562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_02880 13566 15665 gene locus_tag LOCUS_02890 gene recG 13566 15665 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_02890 15908 15693 gene locus_tag LOCUS_02900 15908 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 17245 15983 gene locus_tag LOCUS_02910 gene ubiF 17245 15983 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210347.1 protein_id gnl|my_center|LOCUS_02910 17567 17301 gene locus_tag LOCUS_02920 17567 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 18509 17598 gene locus_tag LOCUS_02930 gene cdd 18509 17598 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44325 protein_id gnl|my_center|LOCUS_02930 18645 19004 gene locus_tag LOCUS_02940 gene dksA 18645 19004 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72A47 protein_id gnl|my_center|LOCUS_02940 19191 19907 gene locus_tag LOCUS_02950 gene murI 19191 19907 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5G3 protein_id gnl|my_center|LOCUS_02950 21009 19930 gene locus_tag LOCUS_02960 21009 19930 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_02960 21135 21290 gene locus_tag LOCUS_02970 21135 21290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 21319 21519 gene locus_tag LOCUS_02980 21319 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 21957 21592 gene locus_tag LOCUS_02990 21957 21592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence013 837 2126 gene locus_tag LOCUS_03000 837 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3120 2104 gene locus_tag LOCUS_03010 gene pdxA 3120 2104 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3X9 protein_id gnl|my_center|LOCUS_03010 4130 3369 gene locus_tag LOCUS_03020 4130 3369 CDS product DeoR family regulatory proteins inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254704.1 protein_id gnl|my_center|LOCUS_03020 4421 5044 gene locus_tag LOCUS_03030 4421 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03030 5056 5676 gene locus_tag LOCUS_03040 5056 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719782.1 protein_id gnl|my_center|LOCUS_03040 5669 7975 gene locus_tag LOCUS_03050 5669 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 protein_id gnl|my_center|LOCUS_03050 8108 9187 gene locus_tag LOCUS_03060 8108 9187 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYJ0 protein_id gnl|my_center|LOCUS_03060 9297 11219 gene locus_tag LOCUS_03070 9297 11219 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_03070 11256 12536 gene locus_tag LOCUS_03080 11256 12536 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG0 protein_id gnl|my_center|LOCUS_03080 12533 14077 gene locus_tag LOCUS_03090 12533 14077 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_03090 14166 15341 gene locus_tag LOCUS_03100 14166 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 16070 16528 gene locus_tag LOCUS_03110 16070 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 17777 16557 gene locus_tag LOCUS_03120 gene phoR 17777 16557 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_03120 18754 18065 gene locus_tag LOCUS_03130 gene phoB 18754 18065 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_03130 19878 18970 gene locus_tag LOCUS_03140 gene ubiA 19878 18970 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB4 protein_id gnl|my_center|LOCUS_03140 20530 19973 gene locus_tag LOCUS_03150 gene ubiC 20530 19973 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F94 protein_id gnl|my_center|LOCUS_03150 20690 20857 gene locus_tag LOCUS_03160 gene rubA 20690 20857 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U41 protein_id gnl|my_center|LOCUS_03160 21002 21277 gene locus_tag LOCUS_03170 gene hupA 21002 21277 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 protein_id gnl|my_center|LOCUS_03170 21472 21558 gene locus_tag LOCUS_t00010 21472 21558 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 584 135 gene locus_tag LOCUS_03180 584 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 1102 2166 gene locus_tag LOCUS_03190 gene mutY 1102 2166 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_03190 2222 3265 gene locus_tag LOCUS_03200 2222 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_03200 3333 3788 gene locus_tag LOCUS_03210 3333 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4435 3797 gene locus_tag LOCUS_03220 gene ynjD 4435 3797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262996.1 protein_id gnl|my_center|LOCUS_03220 6138 4432 gene locus_tag LOCUS_03230 6138 4432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067482.1 protein_id gnl|my_center|LOCUS_03230 6351 7100 gene locus_tag LOCUS_03240 6351 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 8368 7151 gene locus_tag LOCUS_03250 8368 7151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709896.1 protein_id gnl|my_center|LOCUS_03250 9510 8560 gene locus_tag LOCUS_03260 9510 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9780 11048 gene locus_tag LOCUS_03270 9780 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 14041 11045 gene locus_tag LOCUS_03280 14041 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 15409 14636 gene locus_tag LOCUS_03290 gene hisF1 15409 14636 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_03290 15798 15409 gene locus_tag LOCUS_03300 15798 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_03300 16519 15791 gene locus_tag LOCUS_03310 gene hisA 16519 15791 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_03310 17160 16516 gene locus_tag LOCUS_03320 gene hisH1 17160 16516 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_03320 17756 17163 gene locus_tag LOCUS_03330 gene hisB 17756 17163 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_03330 18465 17749 gene locus_tag LOCUS_03340 18465 17749 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 protein_id gnl|my_center|LOCUS_03340 18590 19066 gene locus_tag LOCUS_03350 18590 19066 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I017 protein_id gnl|my_center|LOCUS_03350 20962 19085 gene locus_tag LOCUS_03360 20962 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence015 2736 1054 gene locus_tag LOCUS_03370 gene yidC 2736 1054 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_03370 3886 3512 gene locus_tag LOCUS_03380 gene rnpA 3886 3512 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT4 protein_id gnl|my_center|LOCUS_03380 4035 3901 gene locus_tag LOCUS_03390 gene rpmH 4035 3901 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Z6 protein_id gnl|my_center|LOCUS_03390 4982 6667 gene locus_tag LOCUS_03400 gene dnaA 4982 6667 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C5 protein_id gnl|my_center|LOCUS_03400 6771 7874 gene locus_tag LOCUS_03410 6771 7874 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_03410 7963 9108 gene locus_tag LOCUS_03420 gene recF 7963 9108 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 protein_id gnl|my_center|LOCUS_03420 9101 11515 gene locus_tag LOCUS_03430 gene gyrB 9101 11515 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_03430 11747 12334 gene locus_tag LOCUS_03440 gene gmhA 11747 12334 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPY2 protein_id gnl|my_center|LOCUS_03440 13094 12372 gene locus_tag LOCUS_03450 gene lptA 13094 12372 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_03450 13669 13091 gene locus_tag LOCUS_03460 13669 13091 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA9 protein_id gnl|my_center|LOCUS_03460 16092 13996 gene locus_tag LOCUS_03470 gene glyS 16092 13996 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR8 protein_id gnl|my_center|LOCUS_03470 17057 16092 gene locus_tag LOCUS_03480 gene glyQ 17057 16092 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_03480 17187 20594 gene locus_tag LOCUS_03490 17187 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence016 1001 114 gene locus_tag LOCUS_03500 gene prmC 1001 114 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW6 protein_id gnl|my_center|LOCUS_03500 2089 1001 gene locus_tag LOCUS_03510 gene prfA 2089 1001 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C1 protein_id gnl|my_center|LOCUS_03510 3417 2119 gene locus_tag LOCUS_03520 gene hemA 3417 2119 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_03520 3704 5497 gene locus_tag LOCUS_03530 3704 5497 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_03530 5985 6596 gene locus_tag LOCUS_03540 gene lolB 5985 6596 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN00 protein_id gnl|my_center|LOCUS_03540 6633 7511 gene locus_tag LOCUS_03550 gene ispE 6633 7511 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX1 protein_id gnl|my_center|LOCUS_03550 7522 7596 gene locus_tag LOCUS_t00020 7522 7596 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7910 9085 gene locus_tag LOCUS_03560 7910 9085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_03560 10449 9082 gene locus_tag LOCUS_03570 gene norM 10449 9082 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783536.1 protein_id gnl|my_center|LOCUS_03570 10651 11583 gene locus_tag LOCUS_03580 gene prs 10651 11583 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C6 protein_id gnl|my_center|LOCUS_03580 11740 12393 gene locus_tag LOCUS_03590 gene rplY 11740 12393 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_03590 12406 13005 gene locus_tag LOCUS_03600 gene pth 12406 13005 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32H03 protein_id gnl|my_center|LOCUS_03600 14180 13044 gene locus_tag LOCUS_03610 14180 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 15767 14763 gene locus_tag LOCUS_03620 gene ddl 15767 14763 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A5 protein_id gnl|my_center|LOCUS_03620 15928 15743 gene locus_tag LOCUS_03630 15928 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 15956 16234 gene locus_tag LOCUS_03640 15956 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 16242 17507 gene locus_tag LOCUS_03650 gene mtr 16242 17507 CDS product high affinity tryptophan transporter Mtr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074198.1 protein_id gnl|my_center|LOCUS_03650 17613 18704 gene locus_tag LOCUS_03660 gene ychF 17613 18704 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_03660 19037 19549 gene locus_tag LOCUS_03670 19037 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 19614 19690 gene locus_tag LOCUS_t00030 19614 19690 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19785 19859 gene locus_tag LOCUS_t00040 19785 19859 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 1388 162 gene locus_tag LOCUS_03680 gene sstT 1388 162 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP8 protein_id gnl|my_center|LOCUS_03680 1976 3220 gene locus_tag LOCUS_03690 1976 3220 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 protein_id gnl|my_center|LOCUS_03690 3213 3905 gene locus_tag LOCUS_03700 gene lolD 3213 3905 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_03700 4295 3993 gene locus_tag LOCUS_03710 4295 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4843 4316 gene locus_tag LOCUS_03720 4843 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_03720 5309 7324 gene locus_tag LOCUS_03730 5309 7324 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104749.1 protein_id gnl|my_center|LOCUS_03730 7598 8998 gene locus_tag LOCUS_03740 gene uhpT 7598 8998 CDS product hexose phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479317.1 protein_id gnl|my_center|LOCUS_03740 9420 9046 gene locus_tag LOCUS_03750 9420 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9669 10283 gene locus_tag LOCUS_03760 gene uhpA 9669 10283 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421796.1 protein_id gnl|my_center|LOCUS_03760 10300 11772 gene locus_tag LOCUS_03770 gene uhpB 10300 11772 CDS product two-component system sensor histidine kinase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262945.1 protein_id gnl|my_center|LOCUS_03770 11795 13057 gene locus_tag LOCUS_03780 11795 13057 CDS product regulatory protein UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480243.1 protein_id gnl|my_center|LOCUS_03780 13993 13031 gene locus_tag LOCUS_03790 13993 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 14836 15432 gene locus_tag LOCUS_03800 14836 15432 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_03800 15429 15854 gene locus_tag LOCUS_03810 15429 15854 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_03810 15875 16897 gene locus_tag LOCUS_03820 gene lpxK 15875 16897 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY9 protein_id gnl|my_center|LOCUS_03820 16863 17144 gene locus_tag LOCUS_03830 16863 17144 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_03830 17144 17929 gene locus_tag LOCUS_03840 gene kdsB 17144 17929 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_03840 17929 18477 gene locus_tag LOCUS_03850 gene ptpA 17929 18477 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_03850 18477 19505 gene locus_tag LOCUS_03860 gene murB 18477 19505 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_03860 >Feature sequence018 127 1698 gene locus_tag LOCUS_03870 127 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 1709 2971 gene locus_tag LOCUS_03880 gene proA 1709 2971 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_03880 3331 3678 gene locus_tag LOCUS_03890 gene rsfS 3331 3678 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_03890 3678 4145 gene locus_tag LOCUS_03900 gene rlmH 3678 4145 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF1 protein_id gnl|my_center|LOCUS_03900 4320 6230 gene locus_tag LOCUS_03910 gene pbpA 4320 6230 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_03910 6223 7371 gene locus_tag LOCUS_03920 6223 7371 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268987.1 protein_id gnl|my_center|LOCUS_03920 7584 8633 gene locus_tag LOCUS_03930 7584 8633 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_03930 8739 9473 gene locus_tag LOCUS_03940 8739 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 9849 11036 gene locus_tag LOCUS_03950 gene dacC 9849 11036 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_03950 11288 11554 gene locus_tag LOCUS_03960 11288 11554 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_03960 11554 12225 gene locus_tag LOCUS_03970 gene lipB 11554 12225 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_03970 12479 13531 gene locus_tag LOCUS_03980 gene lipA 12479 13531 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_03980 14225 14001 gene locus_tag LOCUS_03990 14225 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 14519 16342 gene locus_tag LOCUS_04000 14519 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 16923 16468 gene locus_tag LOCUS_04010 16923 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 17466 17023 gene locus_tag LOCUS_04020 17466 17023 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_04020 17758 18273 gene locus_tag LOCUS_04030 17758 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 19214 18297 gene locus_tag LOCUS_04040 19214 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence019 437 123 gene locus_tag LOCUS_04050 437 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1521 943 gene locus_tag LOCUS_04060 gene sodB 1521 943 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED83 protein_id gnl|my_center|LOCUS_04060 1951 2625 gene locus_tag LOCUS_04070 1951 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3036 3404 gene locus_tag LOCUS_04080 3036 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3506 4123 gene locus_tag LOCUS_04090 3506 4123 CDS product IMPACT family member inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44842 protein_id gnl|my_center|LOCUS_04090 4123 5571 gene locus_tag LOCUS_04100 4123 5571 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSM2 protein_id gnl|my_center|LOCUS_04100 6227 5766 gene locus_tag LOCUS_04110 6227 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7285 6632 gene locus_tag LOCUS_04120 7285 6632 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_04120 9107 7686 gene locus_tag LOCUS_04130 gene aspA 9107 7686 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTD7 protein_id gnl|my_center|LOCUS_04130 9419 11344 gene locus_tag LOCUS_04140 gene sopB 9419 11344 CDS product inositol phosphate phosphatase SopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7R1 protein_id gnl|my_center|LOCUS_04140 12412 11351 gene locus_tag LOCUS_04150 gene yscU 12412 11351 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176440.1 protein_id gnl|my_center|LOCUS_04150 13197 12409 gene locus_tag LOCUS_04160 gene pscT 13197 12409 CDS product EscT/YscT/HrcT family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114621.1 protein_id gnl|my_center|LOCUS_04160 13464 13201 gene locus_tag LOCUS_04170 gene yscS 13464 13201 CDS product Yop proteins translocation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69982 protein_id gnl|my_center|LOCUS_04170 14125 13457 gene locus_tag LOCUS_04180 14125 13457 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_04180 15167 14172 gene locus_tag LOCUS_04190 15167 14172 CDS product type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105899.1 protein_id gnl|my_center|LOCUS_04190 15898 15167 gene locus_tag LOCUS_04200 15898 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 16370 15909 gene locus_tag LOCUS_04210 16370 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 17706 16375 gene locus_tag LOCUS_04220 gene bscN 17706 16375 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064189.1 protein_id gnl|my_center|LOCUS_04220 18306 17812 gene locus_tag LOCUS_04230 18306 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence020 282 695 gene locus_tag LOCUS_04240 282 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1818 721 gene locus_tag LOCUS_04250 1818 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3953 2463 gene locus_tag LOCUS_04260 3953 2463 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262043.1 protein_id gnl|my_center|LOCUS_04260 4199 5155 gene locus_tag LOCUS_04270 4199 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5241 6386 gene locus_tag LOCUS_04280 5241 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6876 6457 gene locus_tag LOCUS_04290 6876 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10236 7108 gene locus_tag LOCUS_04300 10236 7108 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479247.1 protein_id gnl|my_center|LOCUS_04300 11449 10238 gene locus_tag LOCUS_04310 11449 10238 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709358.1 protein_id gnl|my_center|LOCUS_04310 11880 12581 gene locus_tag LOCUS_04320 gene cpxR 11880 12581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_04320 12602 13975 gene locus_tag LOCUS_04330 gene cpxA 12602 13975 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704207.1 protein_id gnl|my_center|LOCUS_04330 14030 14707 gene locus_tag LOCUS_04340 14030 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 14759 16726 gene locus_tag LOCUS_04350 gene ladS 14759 16726 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_04350 17387 16728 gene locus_tag LOCUS_04360 gene rluE 17387 16728 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_04360 17712 17512 gene locus_tag LOCUS_04370 17712 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_04370 17838 18200 gene locus_tag LOCUS_04380 17838 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence021 618 376 gene locus_tag LOCUS_04390 618 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1489 707 gene locus_tag LOCUS_04400 gene cpdA 1489 707 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AEW4 protein_id gnl|my_center|LOCUS_04400 1976 1518 gene locus_tag LOCUS_04410 1976 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 protein_id gnl|my_center|LOCUS_04410 2175 3644 gene locus_tag LOCUS_04420 2175 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_04420 4965 3685 gene locus_tag LOCUS_04430 4965 3685 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369159.1 protein_id gnl|my_center|LOCUS_04430 5076 5660 gene locus_tag LOCUS_04440 5076 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112755.1 protein_id gnl|my_center|LOCUS_04440 6127 6987 gene locus_tag LOCUS_04450 gene btuF 6127 6987 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_04450 7012 8886 gene locus_tag LOCUS_04460 7012 8886 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_04460 8901 9443 gene locus_tag LOCUS_04470 8901 9443 CDS product adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263791.1 protein_id gnl|my_center|LOCUS_04470 9507 10487 gene locus_tag LOCUS_04480 9507 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 10561 11778 gene locus_tag LOCUS_04490 10561 11778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_04490 11771 12571 gene locus_tag LOCUS_04500 11771 12571 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_04500 13342 12620 gene locus_tag LOCUS_04510 13342 12620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44162 protein_id gnl|my_center|LOCUS_04510 15011 13569 gene locus_tag LOCUS_04520 gene hldE 15011 13569 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG9 protein_id gnl|my_center|LOCUS_04520 16825 15053 gene locus_tag LOCUS_04530 gene msbA 16825 15053 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_04530 >Feature sequence022 799 308 gene locus_tag LOCUS_04540 799 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5787 931 gene locus_tag LOCUS_04550 5787 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6592 5774 gene locus_tag LOCUS_04560 6592 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 6921 6589 gene locus_tag LOCUS_04570 6921 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8406 6970 gene locus_tag LOCUS_04580 8406 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 8568 9203 gene locus_tag LOCUS_04590 8568 9203 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766709.1 protein_id gnl|my_center|LOCUS_04590 9200 10681 gene locus_tag LOCUS_04600 9200 10681 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 protein_id gnl|my_center|LOCUS_04600 10793 11392 gene locus_tag LOCUS_04610 10793 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11385 12311 gene locus_tag LOCUS_04620 11385 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 12386 13381 gene locus_tag LOCUS_04630 12386 13381 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXF7 protein_id gnl|my_center|LOCUS_04630 13449 13919 gene locus_tag LOCUS_04640 13449 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13930 14235 gene locus_tag LOCUS_04650 13930 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 14873 14220 gene locus_tag LOCUS_04660 14873 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15406 16719 gene locus_tag LOCUS_04670 gene ndH 15406 16719 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614782.1 protein_id gnl|my_center|LOCUS_04670 16899 16824 gene locus_tag LOCUS_t00050 16899 16824 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17023 16948 gene locus_tag LOCUS_t00060 17023 16948 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 2523 253 gene locus_tag LOCUS_04680 gene ptsP 2523 253 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_04680 3210 2710 gene locus_tag LOCUS_04690 gene rppH 3210 2710 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_04690 3424 4080 gene locus_tag LOCUS_04700 3424 4080 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_04700 4941 4087 gene locus_tag LOCUS_04710 4941 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5239 5559 gene locus_tag LOCUS_04720 5239 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6234 5569 gene locus_tag LOCUS_04730 6234 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6324 6719 gene locus_tag LOCUS_04740 6324 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6761 7195 gene locus_tag LOCUS_04750 6761 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 7266 7946 gene locus_tag LOCUS_04760 7266 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8405 8007 gene locus_tag LOCUS_04770 8405 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 11464 8969 gene locus_tag LOCUS_04780 11464 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_04780 12207 11461 gene locus_tag LOCUS_04790 12207 11461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_04790 12164 12850 gene locus_tag LOCUS_04800 gene tesA 12164 12850 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 protein_id gnl|my_center|LOCUS_04800 13235 13840 gene locus_tag LOCUS_04810 13235 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 13952 14440 gene locus_tag LOCUS_04820 13952 14440 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB0 protein_id gnl|my_center|LOCUS_04820 14581 15966 gene locus_tag LOCUS_04830 14581 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 16834 16025 gene locus_tag LOCUS_04840 16834 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence024 <1 11640 gene locus_tag LOCUS_04850 <1 11640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:type I secretion C-terminal target domain-containing protein 12825 11644 gene locus_tag LOCUS_04860 12825 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 13957 12953 gene locus_tag LOCUS_04870 gene dsbG 13957 12953 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_04870 16358 14193 gene locus_tag LOCUS_04880 gene zntA 16358 14193 CDS product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704595.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence025 735 130 gene locus_tag LOCUS_04890 735 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1401 763 gene locus_tag LOCUS_04900 1401 763 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_04900 1526 1780 gene locus_tag LOCUS_04910 1526 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1773 2099 gene locus_tag LOCUS_04920 1773 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3128 2202 gene locus_tag LOCUS_04930 3128 2202 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_04930 4508 3165 gene locus_tag LOCUS_04940 4508 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04940 6323 4575 gene locus_tag LOCUS_04950 6323 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04950 8372 6996 gene locus_tag LOCUS_04960 8372 6996 CDS product anti-codon nuclease masking agent prrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548846.1 protein_id gnl|my_center|LOCUS_04960 9984 8362 gene locus_tag LOCUS_04970 gene hsdM-1 9984 8362 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_04970 10302 12428 gene locus_tag LOCUS_04980 gene recD2 10302 12428 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCL3 protein_id gnl|my_center|LOCUS_04980 12622 16167 gene locus_tag LOCUS_04990 12622 16167 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956668.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence026 108 557 gene locus_tag LOCUS_05000 108 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 602 1459 gene locus_tag LOCUS_05010 602 1459 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLZ4 protein_id gnl|my_center|LOCUS_05010 1629 2201 gene locus_tag LOCUS_05020 gene dsbB 1629 2201 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59346 protein_id gnl|my_center|LOCUS_05020 4030 2243 gene locus_tag LOCUS_05030 4030 2243 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_05030 4300 4034 gene locus_tag LOCUS_05040 4300 4034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_05040 4729 4433 gene locus_tag LOCUS_05050 4729 4433 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_05050 4962 6101 gene locus_tag LOCUS_05060 gene yjlD 4962 6101 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122519.1 protein_id gnl|my_center|LOCUS_05060 6356 6649 gene locus_tag LOCUS_05070 6356 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7051 7758 gene locus_tag LOCUS_05080 7051 7758 CDS product topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706629.1 protein_id gnl|my_center|LOCUS_05080 9953 7755 gene locus_tag LOCUS_05090 gene glgB 9953 7755 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP85 protein_id gnl|my_center|LOCUS_05090 11523 10015 gene locus_tag LOCUS_05100 gene glgA 11523 10015 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPQ1 protein_id gnl|my_center|LOCUS_05100 12718 11513 gene locus_tag LOCUS_05110 gene glgC1 12718 11513 CDS product glucose-1-phosphate adenylyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRB5 protein_id gnl|my_center|LOCUS_05110 14560 12917 gene locus_tag LOCUS_05120 gene pgm 14560 12917 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_05120 <16158 14881 gene locus_tag LOCUS_05130 <16158 14881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RXP5:glycogen operon protein GlgX homolog >Feature sequence027 358 1233 gene locus_tag LOCUS_05140 gene tonB3 358 1233 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_05140 1276 1848 gene locus_tag LOCUS_05150 1276 1848 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P765 protein_id gnl|my_center|LOCUS_05150 1872 2318 gene locus_tag LOCUS_05160 1872 2318 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_05160 3470 2436 gene locus_tag LOCUS_05170 gene pilT 3470 2436 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_05170 3540 4241 gene locus_tag LOCUS_05180 3540 4241 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_05180 4251 5072 gene locus_tag LOCUS_05190 gene proC 4251 5072 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_05190 5152 6066 gene locus_tag LOCUS_05200 5152 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263657.1 protein_id gnl|my_center|LOCUS_05200 6232 6702 gene locus_tag LOCUS_05210 6232 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7796 6954 gene locus_tag LOCUS_05220 gene nfo 7796 6954 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z593 protein_id gnl|my_center|LOCUS_05220 8749 7811 gene locus_tag LOCUS_05230 8749 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_05230 9366 8746 gene locus_tag LOCUS_05240 9366 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9634 12177 gene locus_tag LOCUS_05250 9634 12177 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369394.1 protein_id gnl|my_center|LOCUS_05250 12182 12511 gene locus_tag LOCUS_05260 12182 12511 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 protein_id gnl|my_center|LOCUS_05260 12749 13711 gene locus_tag LOCUS_05270 12749 13711 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_05270 14525 13833 gene locus_tag LOCUS_05280 14525 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 15056 14784 gene locus_tag LOCUS_05290 15056 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 15243 15452 gene locus_tag LOCUS_05300 15243 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence028 1533 220 gene locus_tag LOCUS_05310 1533 220 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142097.1 protein_id gnl|my_center|LOCUS_05310 1958 3457 gene locus_tag LOCUS_05320 gene mmsA-1 1958 3457 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_05320 3967 3479 gene locus_tag LOCUS_05330 3967 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4228 4470 gene locus_tag LOCUS_05340 4228 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4588 4839 gene locus_tag LOCUS_05350 4588 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5900 4866 gene locus_tag LOCUS_05360 gene selD 5900 4866 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKE7 protein_id gnl|my_center|LOCUS_05360 6083 6643 gene locus_tag LOCUS_05370 6083 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6797 7747 gene locus_tag LOCUS_05380 6797 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8323 7796 gene locus_tag LOCUS_05390 8323 7796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_05390 9567 8344 gene locus_tag LOCUS_05400 9567 8344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704849.1 protein_id gnl|my_center|LOCUS_05400 10754 9642 gene locus_tag LOCUS_05410 gene potF 10754 9642 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQL0 protein_id gnl|my_center|LOCUS_05410 10887 11837 gene locus_tag LOCUS_05420 10887 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12347 11895 gene locus_tag LOCUS_05430 12347 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 12341 12583 gene locus_tag LOCUS_05440 12341 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 12730 12806 gene locus_tag LOCUS_t00070 12730 12806 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14521 12884 gene locus_tag LOCUS_05450 14521 12884 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127897.1 protein_id gnl|my_center|LOCUS_05450 14727 14518 gene locus_tag LOCUS_05460 14727 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 15029 14724 gene locus_tag LOCUS_05470 15029 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence029 512 1162 gene locus_tag LOCUS_05480 512 1162 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929665.1 protein_id gnl|my_center|LOCUS_05480 1251 1925 gene locus_tag LOCUS_05490 gene yedJ 1251 1925 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298512.1 protein_id gnl|my_center|LOCUS_05490 3036 1984 gene locus_tag LOCUS_05500 gene hisC 3036 1984 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE04 protein_id gnl|my_center|LOCUS_05500 3198 3419 gene locus_tag LOCUS_05510 3198 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3581 4132 gene locus_tag LOCUS_05520 3581 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4198 5172 gene locus_tag LOCUS_05530 gene birA 4198 5172 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E226 protein_id gnl|my_center|LOCUS_05530 5181 5912 gene locus_tag LOCUS_05540 gene coaX 5181 5912 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_05540 5912 6640 gene locus_tag LOCUS_05550 5912 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_05550 6767 6850 gene locus_tag LOCUS_t00080 6767 6850 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6968 7041 gene locus_tag LOCUS_t00090 6968 7041 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7064 7139 gene locus_tag LOCUS_t00100 7064 7139 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7260 7335 gene locus_tag LOCUS_t00110 7260 7335 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7383 7754 gene locus_tag LOCUS_05560 gene secE 7383 7754 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMN1 protein_id gnl|my_center|LOCUS_05560 7768 8301 gene locus_tag LOCUS_05570 gene nusG 7768 8301 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC4 protein_id gnl|my_center|LOCUS_05570 8709 9143 gene locus_tag LOCUS_05580 gene rplK 8709 9143 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC5 protein_id gnl|my_center|LOCUS_05580 9143 9838 gene locus_tag LOCUS_05590 gene rplA 9143 9838 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC6 protein_id gnl|my_center|LOCUS_05590 10141 10671 gene locus_tag LOCUS_05600 gene rplJ 10141 10671 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID4 protein_id gnl|my_center|LOCUS_05600 10750 11124 gene locus_tag LOCUS_05610 gene rplL 10750 11124 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E236 protein_id gnl|my_center|LOCUS_05610 >Feature sequence030 1719 1471 gene locus_tag LOCUS_05620 1719 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2511 2155 gene locus_tag LOCUS_05630 gene rplT 2511 2155 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A159 protein_id gnl|my_center|LOCUS_05630 2757 2566 gene locus_tag LOCUS_05640 gene rpmI 2757 2566 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A1 protein_id gnl|my_center|LOCUS_05640 3175 2912 gene locus_tag LOCUS_05650 3175 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5525 3564 gene locus_tag LOCUS_05660 gene thrS 5525 3564 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG7 protein_id gnl|my_center|LOCUS_05660 13224 5731 gene locus_tag LOCUS_05670 13224 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13758 14813 gene locus_tag LOCUS_05680 gene selU 13758 14813 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_05680 >Feature sequence031 305 580 gene locus_tag LOCUS_05690 305 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_05690 1329 577 gene locus_tag LOCUS_05700 gene moeB 1329 577 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_05700 1951 1559 gene locus_tag LOCUS_05710 gene gcvH 1951 1559 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_05710 2275 2808 gene locus_tag LOCUS_05720 2275 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4571 2805 gene locus_tag LOCUS_05730 4571 2805 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_05730 5140 4688 gene locus_tag LOCUS_05740 5140 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5615 5172 gene locus_tag LOCUS_05750 5615 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_05750 6849 5674 gene locus_tag LOCUS_05760 6849 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_05760 7430 6810 gene locus_tag LOCUS_05770 7430 6810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013926.1 protein_id gnl|my_center|LOCUS_05770 7931 10051 gene locus_tag LOCUS_05780 7931 10051 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_05780 10070 10600 gene locus_tag LOCUS_05790 10070 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 10617 13439 gene locus_tag LOCUS_05800 10617 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13822 13436 gene locus_tag LOCUS_05810 gene cueR 13822 13436 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_05810 13916 14578 gene locus_tag LOCUS_05820 13916 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence032 308 1903 gene locus_tag LOCUS_05830 308 1903 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 protein_id gnl|my_center|LOCUS_05830 3639 1978 gene locus_tag LOCUS_05840 3639 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4998 3733 gene locus_tag LOCUS_05850 4998 3733 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870481.1 protein_id gnl|my_center|LOCUS_05850 5894 5286 gene locus_tag LOCUS_05860 5894 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6057 6905 gene locus_tag LOCUS_05870 6057 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269372.1 protein_id gnl|my_center|LOCUS_05870 7363 6971 gene locus_tag LOCUS_05880 7363 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7860 9134 gene locus_tag LOCUS_05890 7860 9134 CDS product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 protein_id gnl|my_center|LOCUS_05890 9225 9503 gene locus_tag LOCUS_05900 9225 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 9766 9690 gene locus_tag LOCUS_t00120 9766 9690 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9893 10573 gene locus_tag LOCUS_05910 9893 10573 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832895.1 protein_id gnl|my_center|LOCUS_05910 10570 12516 gene locus_tag LOCUS_05920 10570 12516 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_05920 12660 13730 gene locus_tag LOCUS_05930 12660 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_05930 13799 14389 gene locus_tag LOCUS_05940 13799 14389 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023618.1 protein_id gnl|my_center|LOCUS_05940 14394 14711 gene locus_tag LOCUS_05950 14394 14711 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence033 1380 478 gene locus_tag LOCUS_05960 1380 478 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 protein_id gnl|my_center|LOCUS_05960 2193 1384 gene locus_tag LOCUS_05970 gene soj 2193 1384 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_05970 2863 2210 gene locus_tag LOCUS_05980 gene rsmG 2863 2210 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_05980 3462 2920 gene locus_tag LOCUS_05990 3462 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3750 4433 gene locus_tag LOCUS_06000 3750 4433 CDS product murein peptide amidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705658.1 protein_id gnl|my_center|LOCUS_06000 5103 4438 gene locus_tag LOCUS_06010 5103 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038642.1 protein_id gnl|my_center|LOCUS_06010 5970 5131 gene locus_tag LOCUS_06020 gene aroE 5970 5131 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE4 protein_id gnl|my_center|LOCUS_06020 6900 5974 gene locus_tag LOCUS_06030 gene hemF 6900 5974 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_06030 7562 7005 gene locus_tag LOCUS_06040 gene tsaC 7562 7005 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_06040 8071 7565 gene locus_tag LOCUS_06050 gene purE-2 8071 7565 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 protein_id gnl|my_center|LOCUS_06050 8425 9810 gene locus_tag LOCUS_06060 8425 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10218 10340 gene locus_tag LOCUS_06070 10218 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 10331 10768 gene locus_tag LOCUS_06080 10331 10768 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257371.1 protein_id gnl|my_center|LOCUS_06080 11985 10915 gene locus_tag LOCUS_06090 11985 10915 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_06090 13080 12055 gene locus_tag LOCUS_06100 13080 12055 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266133.1 protein_id gnl|my_center|LOCUS_06100 13292 14470 gene locus_tag LOCUS_06110 13292 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence034 764 171 gene locus_tag LOCUS_06120 gene lexA1 764 171 CDS product LexA repressor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB9 protein_id gnl|my_center|LOCUS_06120 914 1552 gene locus_tag LOCUS_06130 gene psrA 914 1552 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_06130 1556 2044 gene locus_tag LOCUS_06140 1556 2044 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_06140 2063 3085 gene locus_tag LOCUS_06150 gene nagZ 2063 3085 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32EW7 protein_id gnl|my_center|LOCUS_06150 3148 4281 gene locus_tag LOCUS_06160 3148 4281 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_06160 4335 5375 gene locus_tag LOCUS_06170 4335 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5394 6566 gene locus_tag LOCUS_06180 5394 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463782.1 protein_id gnl|my_center|LOCUS_06180 6588 6920 gene locus_tag LOCUS_06190 6588 6920 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E2 protein_id gnl|my_center|LOCUS_06190 6923 7366 gene locus_tag LOCUS_06200 6923 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11047 7451 gene locus_tag LOCUS_06210 11047 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 11280 11672 gene locus_tag LOCUS_06220 gene ssb 11280 11672 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40947 protein_id gnl|my_center|LOCUS_06220 11898 11812 gene locus_tag LOCUS_t00130 11898 11812 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12148 12855 gene locus_tag LOCUS_06230 gene rsuA 12148 12855 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW18 protein_id gnl|my_center|LOCUS_06230 >Feature sequence035 225 599 gene locus_tag LOCUS_06240 225 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 1157 669 gene locus_tag LOCUS_06250 gene lrp 1157 669 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_06250 1617 2768 gene locus_tag LOCUS_06260 gene potG 1617 2768 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHF2 protein_id gnl|my_center|LOCUS_06260 2778 3710 gene locus_tag LOCUS_06270 gene potH 2778 3710 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707794.1 protein_id gnl|my_center|LOCUS_06270 3707 4552 gene locus_tag LOCUS_06280 gene potI 3707 4552 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 protein_id gnl|my_center|LOCUS_06280 4597 5466 gene locus_tag LOCUS_06290 4597 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5576 5869 gene locus_tag LOCUS_06300 5576 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7096 6083 gene locus_tag LOCUS_06310 gene add-1 7096 6083 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEY5 protein_id gnl|my_center|LOCUS_06310 7696 7313 gene locus_tag LOCUS_06320 7696 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9875 8223 gene locus_tag LOCUS_06330 gene pgi 9875 8223 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV67 protein_id gnl|my_center|LOCUS_06330 10844 9984 gene locus_tag LOCUS_06340 gene panC 10844 9984 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 protein_id gnl|my_center|LOCUS_06340 11655 10861 gene locus_tag LOCUS_06350 gene panB 11655 10861 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_06350 12109 11789 gene locus_tag LOCUS_06360 gene sugE 12109 11789 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932066.1 protein_id gnl|my_center|LOCUS_06360 12623 12123 gene locus_tag LOCUS_06370 12623 12123 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_06370 14182 12728 gene locus_tag LOCUS_06380 gene pcnB 14182 12728 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_06380 >Feature sequence036 128 982 gene locus_tag LOCUS_06390 128 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1254 1892 gene locus_tag LOCUS_06400 1254 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2500 1895 gene locus_tag LOCUS_06410 2500 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3230 4822 gene locus_tag LOCUS_06420 3230 4822 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_06420 4941 5867 gene locus_tag LOCUS_06430 4941 5867 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_06430 5878 6783 gene locus_tag LOCUS_06440 5878 6783 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_06440 6803 7777 gene locus_tag LOCUS_06450 6803 7777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388347.1 protein_id gnl|my_center|LOCUS_06450 7777 8769 gene locus_tag LOCUS_06460 7777 8769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_06460 11447 12913 gene locus_tag LOCUS_06470 gene pepA 11447 12913 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_06470 13495 13004 gene locus_tag LOCUS_06480 13495 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 14126 13536 gene locus_tag LOCUS_06490 14126 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence037 722 123 gene locus_tag LOCUS_06500 722 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2859 868 gene locus_tag LOCUS_06510 2859 868 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070844.1 protein_id gnl|my_center|LOCUS_06510 3375 2902 gene locus_tag LOCUS_06520 3375 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3652 3317 gene locus_tag LOCUS_06530 3652 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3879 4769 gene locus_tag LOCUS_06540 3879 4769 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_06540 4842 5765 gene locus_tag LOCUS_06550 4842 5765 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 protein_id gnl|my_center|LOCUS_06550 5775 6314 gene locus_tag LOCUS_06560 5775 6314 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 protein_id gnl|my_center|LOCUS_06560 8255 6372 gene locus_tag LOCUS_06570 8255 6372 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_06570 8451 9806 gene locus_tag LOCUS_06580 8451 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10869 9949 gene locus_tag LOCUS_06590 10869 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 protein_id gnl|my_center|LOCUS_06590 12006 11056 gene locus_tag LOCUS_06600 12006 11056 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193319.1 protein_id gnl|my_center|LOCUS_06600 12882 12061 gene locus_tag LOCUS_06610 12882 12061 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065132.1 protein_id gnl|my_center|LOCUS_06610 <14302 13304 gene locus_tag LOCUS_06620 <14302 13304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001880869.1:MFS transporter >Feature sequence038 1389 631 gene locus_tag LOCUS_06630 gene anr 1389 631 CDS product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 protein_id gnl|my_center|LOCUS_06630 3170 1782 gene locus_tag LOCUS_06640 gene hemN 3170 1782 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_06640 3879 3487 gene locus_tag LOCUS_06650 3879 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4700 4014 gene locus_tag LOCUS_06660 4700 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_06660 4916 6454 gene locus_tag LOCUS_06670 4916 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 6675 6490 gene locus_tag LOCUS_06680 6675 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9140 6678 gene locus_tag LOCUS_06690 9140 6678 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_06690 9712 9137 gene locus_tag LOCUS_06700 9712 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_06700 11114 9714 gene locus_tag LOCUS_06710 11114 9714 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_06710 12449 11553 gene locus_tag LOCUS_06720 gene ccoP1 12449 11553 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_06720 12658 12443 gene locus_tag LOCUS_06730 12658 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13272 12658 gene locus_tag LOCUS_06740 gene ccoO1 13272 12658 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_06740 <14273 13289 gene locus_tag LOCUS_06750 <14273 13289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087306.1:cbb3-type cytochrome c oxidase subunit I >Feature sequence039 1095 241 gene locus_tag LOCUS_06760 gene rpoH 1095 241 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_06760 2354 1317 gene locus_tag LOCUS_06770 gene ftsX 2354 1317 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B9 protein_id gnl|my_center|LOCUS_06770 3019 2351 gene locus_tag LOCUS_06780 gene ftsE 3019 2351 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 protein_id gnl|my_center|LOCUS_06780 4804 3209 gene locus_tag LOCUS_06790 gene ftsY 4804 3209 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM44 protein_id gnl|my_center|LOCUS_06790 5228 5043 gene locus_tag LOCUS_06800 5228 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 5145 6377 gene locus_tag LOCUS_06810 5145 6377 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_06810 6370 7806 gene locus_tag LOCUS_06820 6370 7806 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_06820 7927 8565 gene locus_tag LOCUS_06830 gene rsmD 7927 8565 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Z7 protein_id gnl|my_center|LOCUS_06830 8803 9897 gene locus_tag LOCUS_06840 gene mdh 8803 9897 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_06840 11378 10176 gene locus_tag LOCUS_06850 gene hmp 11378 10176 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WUM8 protein_id gnl|my_center|LOCUS_06850 11811 11506 gene locus_tag LOCUS_06860 11811 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 11966 12250 gene locus_tag LOCUS_06870 11966 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 12265 12588 gene locus_tag LOCUS_06880 12265 12588 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058054.1 protein_id gnl|my_center|LOCUS_06880 13245 12571 gene locus_tag LOCUS_06890 13245 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 <13767 13242 gene locus_tag LOCUS_06900 <13767 13242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E276:UPF0056 inner membrane protein >Feature sequence040 2685 259 gene locus_tag LOCUS_06910 2685 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4497 4117 gene locus_tag LOCUS_06920 4497 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521667.1 protein_id gnl|my_center|LOCUS_06920 5532 4564 gene locus_tag LOCUS_06930 5532 4564 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_06930 5778 7616 gene locus_tag LOCUS_06940 gene fabY 5778 7616 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_06940 8025 9188 gene locus_tag LOCUS_06950 8025 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 10110 9202 gene locus_tag LOCUS_06960 10110 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 11948 10296 gene locus_tag LOCUS_06970 11948 10296 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_06970 12181 12933 gene locus_tag LOCUS_06980 12181 12933 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267372.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence041 152 334 gene locus_tag LOCUS_06990 152 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 466 1164 gene locus_tag LOCUS_07000 466 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1280 2308 gene locus_tag LOCUS_07010 1280 2308 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247332.1 protein_id gnl|my_center|LOCUS_07010 2359 3345 gene locus_tag LOCUS_07020 gene thrB 2359 3345 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29364 protein_id gnl|my_center|LOCUS_07020 3445 3930 gene locus_tag LOCUS_07030 3445 3930 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_07030 3945 4703 gene locus_tag LOCUS_07040 gene znuC 3945 4703 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_07040 4703 5485 gene locus_tag LOCUS_07050 gene znuB 4703 5485 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 protein_id gnl|my_center|LOCUS_07050 6654 5524 gene locus_tag LOCUS_07060 6654 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 6882 7655 gene locus_tag LOCUS_07070 6882 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020345.1 protein_id gnl|my_center|LOCUS_07070 8375 7719 gene locus_tag LOCUS_07080 gene senC 8375 7719 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_07080 9309 8404 gene locus_tag LOCUS_07090 gene cyoE1 9309 8404 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_07090 10346 9306 gene locus_tag LOCUS_07100 10346 9306 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_07100 11798 11205 gene locus_tag LOCUS_07110 11798 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 protein_id gnl|my_center|LOCUS_07110 12959 12255 gene locus_tag LOCUS_07120 12959 12255 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 protein_id gnl|my_center|LOCUS_07120 13059 13268 gene locus_tag LOCUS_07130 13059 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence042 534 2618 gene locus_tag LOCUS_07140 gene bifA 534 2618 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_07140 2630 3715 gene locus_tag LOCUS_07150 gene sypH 2630 3715 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_07150 3718 5151 gene locus_tag LOCUS_07160 3718 5151 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_07160 5181 6689 gene locus_tag LOCUS_07170 gene sypL 5181 6689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_07170 6652 7386 gene locus_tag LOCUS_07180 gene sypM 6652 7386 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 protein_id gnl|my_center|LOCUS_07180 7379 8548 gene locus_tag LOCUS_07190 gene sypN 7379 8548 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 protein_id gnl|my_center|LOCUS_07190 8680 9159 gene locus_tag LOCUS_07200 8680 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 9162 10661 gene locus_tag LOCUS_07210 gene sypO 9162 10661 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_07210 10658 11749 gene locus_tag LOCUS_07220 gene sypP 10658 11749 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263844.1 protein_id gnl|my_center|LOCUS_07220 11746 12960 gene locus_tag LOCUS_07230 11746 12960 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105842.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence043 <1 1854 gene locus_tag LOCUS_07240 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095680.1:protein FimX 1921 3543 gene locus_tag LOCUS_07250 gene nadE 1921 3543 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_07250 4751 3726 gene locus_tag LOCUS_07260 4751 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5632 4751 gene locus_tag LOCUS_07270 5632 4751 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYB8 protein_id gnl|my_center|LOCUS_07270 6425 5943 gene locus_tag LOCUS_07280 6425 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483841.1 protein_id gnl|my_center|LOCUS_07280 7288 6524 gene locus_tag LOCUS_07290 7288 6524 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615308.1 protein_id gnl|my_center|LOCUS_07290 8248 7298 gene locus_tag LOCUS_07300 8248 7298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263644.1 protein_id gnl|my_center|LOCUS_07300 9203 8241 gene locus_tag LOCUS_07310 9203 8241 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735136.1 protein_id gnl|my_center|LOCUS_07310 10190 9273 gene locus_tag LOCUS_07320 gene vctP 10190 9273 CDS product enterochelin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263646.1 protein_id gnl|my_center|LOCUS_07320 12189 10261 gene locus_tag LOCUS_07330 12189 10261 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_07330 12374 13198 gene locus_tag LOCUS_07340 12374 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525277.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence044 1293 1973 gene locus_tag LOCUS_07350 1293 1973 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_07350 2793 2029 gene locus_tag LOCUS_07360 2793 2029 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 protein_id gnl|my_center|LOCUS_07360 3146 5272 gene locus_tag LOCUS_07370 3146 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5985 7433 gene locus_tag LOCUS_07380 5985 7433 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 protein_id gnl|my_center|LOCUS_07380 7655 8767 gene locus_tag LOCUS_07390 gene anmK 7655 8767 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM5 protein_id gnl|my_center|LOCUS_07390 8965 9705 gene locus_tag LOCUS_07400 8965 9705 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_07400 10132 9755 gene locus_tag LOCUS_07410 gene erpA 10132 9755 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_07410 10896 10429 gene locus_tag LOCUS_07420 10896 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11644 10886 gene locus_tag LOCUS_07430 11644 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707262.1 protein_id gnl|my_center|LOCUS_07430 11768 12400 gene locus_tag LOCUS_07440 11768 12400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887115.1 protein_id gnl|my_center|LOCUS_07440 12678 12397 gene locus_tag LOCUS_07450 12678 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence045 711 1499 gene locus_tag LOCUS_07460 711 1499 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917976.1 protein_id gnl|my_center|LOCUS_07460 1720 3327 gene locus_tag LOCUS_07470 1720 3327 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_07470 3841 3371 gene locus_tag LOCUS_07480 3841 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4019 4207 gene locus_tag LOCUS_07490 4019 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4430 5053 gene locus_tag LOCUS_07500 4430 5053 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_07500 5112 5924 gene locus_tag LOCUS_07510 gene pyrF 5112 5924 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR1 protein_id gnl|my_center|LOCUS_07510 6032 6691 gene locus_tag LOCUS_07520 gene yadF 6032 6691 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC9 protein_id gnl|my_center|LOCUS_07520 6763 7182 gene locus_tag LOCUS_07530 6763 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 7840 7205 gene locus_tag LOCUS_07540 7840 7205 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940507.1 protein_id gnl|my_center|LOCUS_07540 8206 8571 gene locus_tag LOCUS_07550 8206 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8702 9373 gene locus_tag LOCUS_07560 8702 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10542 9493 gene locus_tag LOCUS_07570 10542 9493 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_07570 11159 10704 gene locus_tag LOCUS_07580 11159 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 12008 11247 gene locus_tag LOCUS_07590 gene truC 12008 11247 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_07590 12324 12791 gene locus_tag LOCUS_07600 12324 12791 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458586.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence046 92 406 gene locus_tag LOCUS_07610 92 406 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071888.1 protein_id gnl|my_center|LOCUS_07610 941 435 gene locus_tag LOCUS_07620 941 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2778 1033 gene locus_tag LOCUS_07630 2778 1033 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_07630 3693 3073 gene locus_tag LOCUS_07640 3693 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3790 4581 gene locus_tag LOCUS_07650 3790 4581 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_07650 4600 5868 gene locus_tag LOCUS_07660 4600 5868 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_07660 5878 7032 gene locus_tag LOCUS_07670 5878 7032 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_07670 7033 8358 gene locus_tag LOCUS_07680 gene argA 7033 8358 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR2 protein_id gnl|my_center|LOCUS_07680 8727 10124 gene locus_tag LOCUS_07690 8727 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 12034 10397 gene locus_tag LOCUS_07700 gene ushA 12034 10397 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704618.1 protein_id gnl|my_center|LOCUS_07700 12643 12167 gene locus_tag LOCUS_07710 12643 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence047 2481 2966 gene locus_tag LOCUS_07720 2481 2966 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_07720 3074 4141 gene locus_tag LOCUS_07730 gene recA 3074 4141 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_07730 4144 4608 gene locus_tag LOCUS_07740 gene recX 4144 4608 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_07740 5414 4614 gene locus_tag LOCUS_07750 gene thiM 5414 4614 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGX6 protein_id gnl|my_center|LOCUS_07750 5801 6232 gene locus_tag LOCUS_07760 gene alaE 5801 6232 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WJC2 protein_id gnl|my_center|LOCUS_07760 6663 8402 gene locus_tag LOCUS_07770 6663 8402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 protein_id gnl|my_center|LOCUS_07770 8678 10234 gene locus_tag LOCUS_07780 gene dppA 8678 10234 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 protein_id gnl|my_center|LOCUS_07780 10457 11437 gene locus_tag LOCUS_07790 10457 11437 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895425.1 protein_id gnl|my_center|LOCUS_07790 11434 12393 gene locus_tag LOCUS_07800 gene dppC 11434 12393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262868.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence048 404 1888 gene locus_tag LOCUS_07810 404 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3143 2001 gene locus_tag LOCUS_07820 gene dnaJ 3143 2001 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_07820 5268 3337 gene locus_tag LOCUS_07830 gene dnaK 5268 3337 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_07830 5992 5393 gene locus_tag LOCUS_07840 gene grpE 5992 5393 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV42 protein_id gnl|my_center|LOCUS_07840 6155 7837 gene locus_tag LOCUS_07850 6155 7837 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP5 protein_id gnl|my_center|LOCUS_07850 8332 7919 gene locus_tag LOCUS_07860 gene fur 8332 7919 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_07860 8464 8901 gene locus_tag LOCUS_07870 8464 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9645 9232 gene locus_tag LOCUS_07880 gene fur 9645 9232 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_07880 9984 9655 gene locus_tag LOCUS_07890 9984 9655 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI82 protein_id gnl|my_center|LOCUS_07890 10427 9999 gene locus_tag LOCUS_07900 10427 9999 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 protein_id gnl|my_center|LOCUS_07900 11873 10512 gene locus_tag LOCUS_07910 11873 10512 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_07910 12622 12077 gene locus_tag LOCUS_07920 12622 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence049 1285 317 gene locus_tag LOCUS_07930 gene ebgR 1285 317 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263230.1 protein_id gnl|my_center|LOCUS_07930 3925 1442 gene locus_tag LOCUS_07940 3925 1442 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKZ5 protein_id gnl|my_center|LOCUS_07940 5327 5845 gene locus_tag LOCUS_07950 5327 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8014 5999 gene locus_tag LOCUS_07960 8014 5999 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHI0 protein_id gnl|my_center|LOCUS_07960 10095 8023 gene locus_tag LOCUS_07970 gene glgB 10095 8023 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP85 protein_id gnl|my_center|LOCUS_07970 10361 11335 gene locus_tag LOCUS_07980 gene lpxL 10361 11335 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ1 protein_id gnl|my_center|LOCUS_07980 12286 12654 gene locus_tag LOCUS_07990 12286 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence050 490 1521 gene locus_tag LOCUS_08000 490 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1823 2113 gene locus_tag LOCUS_08010 1823 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57134 protein_id gnl|my_center|LOCUS_08010 2224 2724 gene locus_tag LOCUS_08020 2224 2724 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 protein_id gnl|my_center|LOCUS_08020 4439 2871 gene locus_tag LOCUS_08030 4439 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6016 4436 gene locus_tag LOCUS_08040 6016 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 7221 6013 gene locus_tag LOCUS_08050 7221 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 9040 7214 gene locus_tag LOCUS_08060 9040 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_08060 12323 9033 gene locus_tag LOCUS_08070 12323 9033 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence051 3630 124 gene locus_tag LOCUS_08080 3630 124 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103907.1 protein_id gnl|my_center|LOCUS_08080 3869 4954 gene locus_tag LOCUS_08090 3869 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5097 6122 gene locus_tag LOCUS_08100 5097 6122 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707373.1 protein_id gnl|my_center|LOCUS_08100 6147 7046 gene locus_tag LOCUS_08110 6147 7046 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706548.1 protein_id gnl|my_center|LOCUS_08110 7036 8226 gene locus_tag LOCUS_08120 7036 8226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_08120 8971 8276 gene locus_tag LOCUS_08130 8971 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 9349 12567 gene locus_tag LOCUS_08140 9349 12567 CDS product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence052 366 1334 gene locus_tag LOCUS_08150 366 1334 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185786.1 protein_id gnl|my_center|LOCUS_08150 2680 1358 gene locus_tag LOCUS_08160 2680 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2859 4178 gene locus_tag LOCUS_08170 2859 4178 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_08170 4457 5470 gene locus_tag LOCUS_08180 4457 5470 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 protein_id gnl|my_center|LOCUS_08180 6237 5458 gene locus_tag LOCUS_08190 6237 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6464 7522 gene locus_tag LOCUS_08200 gene astA 6464 7522 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC67 protein_id gnl|my_center|LOCUS_08200 7539 9005 gene locus_tag LOCUS_08210 gene astD 7539 9005 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN18 protein_id gnl|my_center|LOCUS_08210 9039 10394 gene locus_tag LOCUS_08220 gene astB 9039 10394 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZ79 protein_id gnl|my_center|LOCUS_08220 10602 11756 gene locus_tag LOCUS_08230 10602 11756 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence053 80 820 gene locus_tag LOCUS_08240 gene pyrH 80 820 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_08240 820 1377 gene locus_tag LOCUS_08250 gene frr 820 1377 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_08250 1541 2320 gene locus_tag LOCUS_08260 gene uppS 1541 2320 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_08260 2314 3120 gene locus_tag LOCUS_08270 gene cdsA-1 2314 3120 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_08270 3125 4321 gene locus_tag LOCUS_08280 gene dxr 3125 4321 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_08280 4318 5697 gene locus_tag LOCUS_08290 4318 5697 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS1 protein_id gnl|my_center|LOCUS_08290 5802 8114 gene locus_tag LOCUS_08300 gene opr86 5802 8114 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_08300 8278 8778 gene locus_tag LOCUS_08310 8278 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8785 9807 gene locus_tag LOCUS_08320 gene lpxD 8785 9807 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_08320 9900 10343 gene locus_tag LOCUS_08330 gene fabZ 9900 10343 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_08330 10346 11167 gene locus_tag LOCUS_08340 gene lpxA 10346 11167 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR6 protein_id gnl|my_center|LOCUS_08340 11245 12417 gene locus_tag LOCUS_08350 gene lpxB 11245 12417 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR5 protein_id gnl|my_center|LOCUS_08350 >Feature sequence054 1202 249 gene locus_tag LOCUS_08360 gene yrbG 1202 249 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_08360 3526 1319 gene locus_tag LOCUS_08370 3526 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4090 4899 gene locus_tag LOCUS_08380 4090 4899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_08380 4896 5690 gene locus_tag LOCUS_08390 4896 5690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 protein_id gnl|my_center|LOCUS_08390 5693 6160 gene locus_tag LOCUS_08400 5693 6160 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_08400 6313 6879 gene locus_tag LOCUS_08410 gene ttg2D 6313 6879 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_08410 6896 7219 gene locus_tag LOCUS_08420 6896 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 7295 7528 gene locus_tag LOCUS_08430 7295 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094334.1 protein_id gnl|my_center|LOCUS_08430 7677 8939 gene locus_tag LOCUS_08440 gene murA 7677 8939 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_08440 10643 8994 gene locus_tag LOCUS_08450 10643 8994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706343.1 protein_id gnl|my_center|LOCUS_08450 11794 10655 gene locus_tag LOCUS_08460 11794 10655 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974057.1 protein_id gnl|my_center|LOCUS_08460 <12485 11791 gene locus_tag LOCUS_08470 <12485 11791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974056.1:peptide ABC transporter permease >Feature sequence055 291 596 gene locus_tag LOCUS_08480 291 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 2018 789 gene locus_tag LOCUS_08490 2018 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2517 2011 gene locus_tag LOCUS_08500 2517 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 8555 2568 gene locus_tag LOCUS_08510 8555 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 11448 8695 gene locus_tag LOCUS_08520 11448 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229124.1 protein_id gnl|my_center|LOCUS_08520 12081 11590 gene locus_tag LOCUS_08530 12081 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence056 2076 586 gene locus_tag LOCUS_08540 2076 586 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882045.1 protein_id gnl|my_center|LOCUS_08540 2493 2884 gene locus_tag LOCUS_tm00010 2493 2884 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3025 3873 gene locus_tag LOCUS_08550 3025 3873 CDS product RIO1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705970.1 protein_id gnl|my_center|LOCUS_08550 3870 4940 gene locus_tag LOCUS_08560 gene galM 3870 4940 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_08560 5317 6528 gene locus_tag LOCUS_08570 5317 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707106.1 protein_id gnl|my_center|LOCUS_08570 7087 6557 gene locus_tag LOCUS_08580 7087 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8205 7285 gene locus_tag LOCUS_08590 gene yedA 8205 7285 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260976.1 protein_id gnl|my_center|LOCUS_08590 8354 8806 gene locus_tag LOCUS_08600 gene ybaO 8354 8806 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262148.1 protein_id gnl|my_center|LOCUS_08600 9296 8838 gene locus_tag LOCUS_08610 9296 8838 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365892.1 protein_id gnl|my_center|LOCUS_08610 11644 9308 gene locus_tag LOCUS_08620 11644 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12258 11659 gene locus_tag LOCUS_08630 12258 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence057 875 2242 gene locus_tag LOCUS_08640 875 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4193 2352 gene locus_tag LOCUS_08650 4193 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5594 4200 gene locus_tag LOCUS_08660 5594 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082852.1 protein_id gnl|my_center|LOCUS_08660 7859 5811 gene locus_tag LOCUS_08670 7859 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 8086 8445 gene locus_tag LOCUS_08680 8086 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8535 9020 gene locus_tag LOCUS_08690 8535 9020 CDS product protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704802.1 protein_id gnl|my_center|LOCUS_08690 9315 9608 gene locus_tag LOCUS_08700 gene groS 9315 9608 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X13 protein_id gnl|my_center|LOCUS_08700 9661 11301 gene locus_tag LOCUS_08710 gene groL 9661 11301 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_08710 >Feature sequence058 1867 209 gene locus_tag LOCUS_08720 1867 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3784 1916 gene locus_tag LOCUS_08730 3784 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4867 3809 gene locus_tag LOCUS_08740 4867 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5095 6465 gene locus_tag LOCUS_08750 5095 6465 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707738.1 protein_id gnl|my_center|LOCUS_08750 7110 6466 gene locus_tag LOCUS_08760 7110 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 7911 7189 gene locus_tag LOCUS_08770 7911 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 9111 7969 gene locus_tag LOCUS_08780 gene cdfA 9111 7969 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 protein_id gnl|my_center|LOCUS_08780 9287 10741 gene locus_tag LOCUS_08790 gene yfmT 9287 10741 CDS product putative aldehyde dehydrogenase YfmT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06478 protein_id gnl|my_center|LOCUS_08790 10873 12015 gene locus_tag LOCUS_08800 gene pdxB 10873 12015 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R9 protein_id gnl|my_center|LOCUS_08800 >Feature sequence059 <1 1559 gene locus_tag LOCUS_08810 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091644.1:long-chain-fatty-acid--CoA ligase 2032 1628 gene locus_tag LOCUS_08820 2032 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2753 2175 gene locus_tag LOCUS_08830 2753 2175 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705053.1 protein_id gnl|my_center|LOCUS_08830 3270 3494 gene locus_tag LOCUS_08840 3270 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3533 4036 gene locus_tag LOCUS_08850 3533 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4924 4091 gene locus_tag LOCUS_08860 4924 4091 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707055.1 protein_id gnl|my_center|LOCUS_08860 5104 5028 gene locus_tag LOCUS_t00140 5104 5028 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5221 5145 gene locus_tag LOCUS_t00150 5221 5145 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7291 5342 gene locus_tag LOCUS_08870 gene acsA1 7291 5342 CDS product acetyl-coenzyme A synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I558 protein_id gnl|my_center|LOCUS_08870 7721 7449 gene locus_tag LOCUS_08880 7721 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8510 7866 gene locus_tag LOCUS_08890 8510 7866 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_08890 9150 8542 gene locus_tag LOCUS_08900 9150 8542 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_08900 9367 10476 gene locus_tag LOCUS_08910 gene dinB 9367 10476 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y22 protein_id gnl|my_center|LOCUS_08910 10512 10904 gene locus_tag LOCUS_08920 10512 10904 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_08920 11267 11010 gene locus_tag LOCUS_08930 11267 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence060 <1 2106 gene locus_tag LOCUS_08940 <1 2106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KNF0:4-alpha-glucanotransferase 3348 2320 gene locus_tag LOCUS_08950 3348 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3724 5028 gene locus_tag LOCUS_08960 gene lamB 3724 5028 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1T9 protein_id gnl|my_center|LOCUS_08960 5255 5755 gene locus_tag LOCUS_08970 5255 5755 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG04 protein_id gnl|my_center|LOCUS_08970 5970 7565 gene locus_tag LOCUS_08980 5970 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 7954 9438 gene locus_tag LOCUS_08990 7954 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 <12076 9479 gene locus_tag LOCUS_09000 <12076 9479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56307:beta-galactosidase >Feature sequence061 1660 404 gene locus_tag LOCUS_09010 gene avtA 1660 404 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260902.1 protein_id gnl|my_center|LOCUS_09010 2011 3813 gene locus_tag LOCUS_09020 2011 3813 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 protein_id gnl|my_center|LOCUS_09020 3906 4406 gene locus_tag LOCUS_09030 3906 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5821 4457 gene locus_tag LOCUS_09040 5821 4457 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_09040 6066 6584 gene locus_tag LOCUS_09050 6066 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6622 8853 gene locus_tag LOCUS_09060 6622 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 10084 8954 gene locus_tag LOCUS_09070 gene thiH 10084 8954 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_09070 10917 10084 gene locus_tag LOCUS_09080 gene thiG 10917 10084 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVS4 protein_id gnl|my_center|LOCUS_09080 11228 10914 gene locus_tag LOCUS_09090 11228 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence062 800 1921 gene locus_tag LOCUS_09100 gene ald 800 1921 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_09100 3217 2195 gene locus_tag LOCUS_09110 gene mccF 3217 2195 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_09110 3340 3816 gene locus_tag LOCUS_09120 3340 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 5382 3985 gene locus_tag LOCUS_09130 gene fumC 5382 3985 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_09130 5889 5647 gene locus_tag LOCUS_09140 5889 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5849 6052 gene locus_tag LOCUS_09150 5849 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7887 6367 gene locus_tag LOCUS_09160 gene lnt 7887 6367 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN93 protein_id gnl|my_center|LOCUS_09160 8726 7887 gene locus_tag LOCUS_09170 8726 7887 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_09170 9215 8757 gene locus_tag LOCUS_09180 gene ybeY 9215 8757 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHN9 protein_id gnl|my_center|LOCUS_09180 10220 9216 gene locus_tag LOCUS_09190 10220 9216 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_09190 10475 11512 gene locus_tag LOCUS_09200 10475 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 11627 11929 gene locus_tag LOCUS_09210 11627 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence063 1238 141 gene locus_tag LOCUS_09220 1238 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1378 2364 gene locus_tag LOCUS_09230 1378 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2871 4163 gene locus_tag LOCUS_09240 2871 4163 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_09240 4262 5347 gene locus_tag LOCUS_09250 gene trmA 4262 5347 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E215 protein_id gnl|my_center|LOCUS_09250 5449 6624 gene locus_tag LOCUS_09260 5449 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6702 7370 gene locus_tag LOCUS_09270 6702 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 8111 7401 gene locus_tag LOCUS_09280 8111 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 10806 8113 gene locus_tag LOCUS_09290 gene sypC 10806 8113 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263831.1 protein_id gnl|my_center|LOCUS_09290 11237 10803 gene locus_tag LOCUS_09300 11237 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 11658 11326 gene locus_tag LOCUS_09310 11658 11326 CDS product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454817.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence064 1650 202 gene locus_tag LOCUS_09320 1650 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1950 2903 gene locus_tag LOCUS_09330 1950 2903 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q99 protein_id gnl|my_center|LOCUS_09330 3558 3061 gene locus_tag LOCUS_09340 3558 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_09340 3699 4805 gene locus_tag LOCUS_09350 gene zapE 3699 4805 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_09350 4864 5649 gene locus_tag LOCUS_09360 4864 5649 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_09360 6170 6946 gene locus_tag LOCUS_09370 6170 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7374 7168 gene locus_tag LOCUS_09380 7374 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 8272 7445 gene locus_tag LOCUS_09390 gene djlA 8272 7445 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_09390 8948 8277 gene locus_tag LOCUS_09400 8948 8277 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_09400 9979 8945 gene locus_tag LOCUS_09410 9979 8945 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946057.1 protein_id gnl|my_center|LOCUS_09410 10918 10469 gene locus_tag LOCUS_09420 10918 10469 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705323.1 protein_id gnl|my_center|LOCUS_09420 11099 11605 gene locus_tag LOCUS_09430 11099 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence065 616 71 gene locus_tag LOCUS_09440 616 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 837 2321 gene locus_tag LOCUS_09450 837 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3318 3722 gene locus_tag LOCUS_09460 3318 3722 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_09460 4115 4039 gene locus_tag LOCUS_t00160 4115 4039 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4795 4235 gene locus_tag LOCUS_09470 4795 4235 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_09470 5232 4810 gene locus_tag LOCUS_09480 5232 4810 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460412.1 protein_id gnl|my_center|LOCUS_09480 5355 5807 gene locus_tag LOCUS_09490 5355 5807 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529976.1 protein_id gnl|my_center|LOCUS_09490 5976 7181 gene locus_tag LOCUS_09500 5976 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 8201 7230 gene locus_tag LOCUS_09510 8201 7230 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ7 protein_id gnl|my_center|LOCUS_09510 8559 9884 gene locus_tag LOCUS_09520 8559 9884 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_09520 10046 10825 gene locus_tag LOCUS_09530 10046 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence066 2838 196 gene locus_tag LOCUS_09540 2838 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3719 4441 gene locus_tag LOCUS_09550 3719 4441 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence067 2030 408 gene locus_tag LOCUS_09560 2030 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3691 2057 gene locus_tag LOCUS_09570 3691 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5303 3849 gene locus_tag LOCUS_09580 gene nagE2 5303 3849 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263302.1 protein_id gnl|my_center|LOCUS_09580 5615 6409 gene locus_tag LOCUS_09590 gene nagB 5615 6409 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A760 protein_id gnl|my_center|LOCUS_09590 6440 7615 gene locus_tag LOCUS_09600 gene nagA 6440 7615 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32445 protein_id gnl|my_center|LOCUS_09600 7629 8846 gene locus_tag LOCUS_09610 gene nagC 7629 8846 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418264.1 protein_id gnl|my_center|LOCUS_09610 9856 9089 gene locus_tag LOCUS_09620 9856 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 11016 10684 gene locus_tag LOCUS_09630 11016 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence068 2306 789 gene locus_tag LOCUS_09640 gene murE 2306 789 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_09640 4069 2312 gene locus_tag LOCUS_09650 gene ftsI 4069 2312 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_09650 4365 4066 gene locus_tag LOCUS_09660 gene ftsL 4365 4066 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX18 protein_id gnl|my_center|LOCUS_09660 5342 4365 gene locus_tag LOCUS_09670 gene rsmH 5342 4365 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY0 protein_id gnl|my_center|LOCUS_09670 5823 5368 gene locus_tag LOCUS_09680 gene mraZ 5823 5368 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_09680 7763 6921 gene locus_tag LOCUS_09690 gene rsmI 7763 6921 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45298 protein_id gnl|my_center|LOCUS_09690 7892 9823 gene locus_tag LOCUS_09700 7892 9823 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_09700 9795 10172 gene locus_tag LOCUS_09710 9795 10172 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY5 protein_id gnl|my_center|LOCUS_09710 10207 10791 gene locus_tag LOCUS_09720 gene gmhA 10207 10791 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_09720 10812 11384 gene locus_tag LOCUS_09730 10812 11384 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence069 450 1880 gene locus_tag LOCUS_09740 gene gltD 450 1880 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_09740 2835 1924 gene locus_tag LOCUS_09750 2835 1924 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262938.1 protein_id gnl|my_center|LOCUS_09750 2930 3625 gene locus_tag LOCUS_09760 2930 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 3671 4948 gene locus_tag LOCUS_09770 3671 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 5186 5941 gene locus_tag LOCUS_09780 5186 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263663.1 protein_id gnl|my_center|LOCUS_09780 6107 7174 gene locus_tag LOCUS_09790 gene hemE 6107 7174 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_09790 11151 7510 gene locus_tag LOCUS_09800 11151 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence070 1488 2135 gene locus_tag LOCUS_09810 1488 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2348 2130 gene locus_tag LOCUS_09820 2348 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2539 3627 gene locus_tag LOCUS_09830 gene queG 2539 3627 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_09830 5042 3618 gene locus_tag LOCUS_09840 5042 3618 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704162.1 protein_id gnl|my_center|LOCUS_09840 5823 5083 gene locus_tag LOCUS_09850 5823 5083 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704163.1 protein_id gnl|my_center|LOCUS_09850 6216 7469 gene locus_tag LOCUS_09860 6216 7469 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_09860 7523 8974 gene locus_tag LOCUS_09870 7523 8974 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097113.1 protein_id gnl|my_center|LOCUS_09870 9561 9019 gene locus_tag LOCUS_09880 gene orn 9561 9019 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45340 protein_id gnl|my_center|LOCUS_09880 9684 10703 gene locus_tag LOCUS_09890 gene rsgA 9684 10703 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 protein_id gnl|my_center|LOCUS_09890 11286 10783 gene locus_tag LOCUS_09900 11286 10783 CDS product HuvX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704903.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence071 4867 68 gene locus_tag LOCUS_09910 4867 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5422 4877 gene locus_tag LOCUS_09920 5422 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6496 5438 gene locus_tag LOCUS_09930 6496 5438 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_09930 6993 6493 gene locus_tag LOCUS_09940 6993 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7505 6984 gene locus_tag LOCUS_09950 gene fimT 7505 6984 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957587.1 protein_id gnl|my_center|LOCUS_09950 8609 7659 gene locus_tag LOCUS_09960 gene ispH 8609 7659 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_09960 9061 8621 gene locus_tag LOCUS_09970 9061 8621 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_09970 9579 9079 gene locus_tag LOCUS_09980 gene lspA 9579 9079 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 protein_id gnl|my_center|LOCUS_09980 11266 9743 gene locus_tag LOCUS_09990 11266 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence072 1392 2099 gene locus_tag LOCUS_10000 1392 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_10000 2096 2581 gene locus_tag LOCUS_10010 2096 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2739 3716 gene locus_tag LOCUS_10020 2739 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4803 3685 gene locus_tag LOCUS_10030 gene gnnB 4803 3685 CDS product UDP-2-acetamido-2-deoxy-alpha-D-ribo-hexopyranos-3-ulose 3-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_10030 5750 4800 gene locus_tag LOCUS_10040 gene gnnA 5750 4800 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_10040 6611 5856 gene locus_tag LOCUS_10050 gene sfsA 6611 5856 CDS product sugar fermentation stimulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NIA9 protein_id gnl|my_center|LOCUS_10050 6754 6936 gene locus_tag LOCUS_10060 6754 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6979 7422 gene locus_tag LOCUS_10070 gene dksA 6979 7422 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_10070 7482 8372 gene locus_tag LOCUS_10080 gene gluQ 7482 8372 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY80 protein_id gnl|my_center|LOCUS_10080 8450 9223 gene locus_tag LOCUS_10090 8450 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 10993 9251 gene locus_tag LOCUS_10100 10993 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence073 446 4924 gene locus_tag LOCUS_10110 446 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5058 5651 gene locus_tag LOCUS_10120 5058 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5677 6570 gene locus_tag LOCUS_10130 5677 6570 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_10130 6714 9335 gene locus_tag LOCUS_10140 gene alaS 6714 9335 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_10140 9971 9396 gene locus_tag LOCUS_10150 9971 9396 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036331.1 protein_id gnl|my_center|LOCUS_10150 10907 10011 gene locus_tag LOCUS_10160 10907 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence074 1729 4524 gene locus_tag LOCUS_10170 1729 4524 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_10170 4900 6096 gene locus_tag LOCUS_10180 4900 6096 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_10180 7275 6202 gene locus_tag LOCUS_10190 7275 6202 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674987.1 protein_id gnl|my_center|LOCUS_10190 8546 7347 gene locus_tag LOCUS_10200 8546 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10200 9258 8473 gene locus_tag LOCUS_10210 9258 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 9864 9271 gene locus_tag LOCUS_10220 9864 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_10220 10074 10859 gene locus_tag LOCUS_10230 10074 10859 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_10230 >Feature sequence075 1280 180 gene locus_tag LOCUS_10240 1280 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2206 1538 gene locus_tag LOCUS_10250 2206 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2469 4676 gene locus_tag LOCUS_10260 gene mrcB 2469 4676 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_10260 4701 5075 gene locus_tag LOCUS_10270 4701 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5079 5390 gene locus_tag LOCUS_10280 5079 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_10280 6261 5410 gene locus_tag LOCUS_10290 6261 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6461 8185 gene locus_tag LOCUS_10300 gene ilvI 6461 8185 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_10300 8185 8676 gene locus_tag LOCUS_10310 gene ilvH 8185 8676 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_10310 10676 8904 gene locus_tag LOCUS_10320 10676 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence076 >Feature sequence077 2718 1570 gene locus_tag LOCUS_10330 gene malE 2718 1570 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_10330 5027 2847 gene locus_tag LOCUS_10340 5027 2847 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF0 protein_id gnl|my_center|LOCUS_10340 6301 5117 gene locus_tag LOCUS_10350 6301 5117 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705560.1 protein_id gnl|my_center|LOCUS_10350 7242 6352 gene locus_tag LOCUS_10360 gene malG 7242 6352 CDS product maltose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423192.1 protein_id gnl|my_center|LOCUS_10360 8780 7245 gene locus_tag LOCUS_10370 gene malF 8780 7245 CDS product maltose transport system permease protein MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1U2 protein_id gnl|my_center|LOCUS_10370 10307 9096 gene locus_tag LOCUS_10380 gene malE 10307 9096 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence078 2611 635 gene locus_tag LOCUS_10390 2611 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_10390 3356 2622 gene locus_tag LOCUS_10400 3356 2622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_10400 4279 3356 gene locus_tag LOCUS_10410 4279 3356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_10410 5901 4522 gene locus_tag LOCUS_10420 gene dacB 5901 4522 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 protein_id gnl|my_center|LOCUS_10420 6247 8625 gene locus_tag LOCUS_10430 6247 8625 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_10430 10125 8737 gene locus_tag LOCUS_10440 10125 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence079 181 444 gene locus_tag LOCUS_10450 181 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 <10550 448 gene locus_tag LOCUS_10460 <10550 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331491.1:hemolysin-type calcium-binding protein >Feature sequence080 524 123 gene locus_tag LOCUS_10470 524 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 614 2074 gene locus_tag LOCUS_10480 614 2074 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ58 protein_id gnl|my_center|LOCUS_10480 2168 2440 gene locus_tag LOCUS_10490 2168 2440 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67616 protein_id gnl|my_center|LOCUS_10490 2503 3825 gene locus_tag LOCUS_10500 2503 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3902 3977 gene locus_tag LOCUS_t00170 3902 3977 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4014 4089 gene locus_tag LOCUS_t00180 4014 4089 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5029 4208 gene locus_tag LOCUS_10510 gene pssA 5029 4208 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_10510 5558 5181 gene locus_tag LOCUS_10520 5558 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 6756 5794 gene locus_tag LOCUS_10530 gene yjiE 6756 5794 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340740.1 protein_id gnl|my_center|LOCUS_10530 7441 6764 gene locus_tag LOCUS_10540 7441 6764 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_10540 7634 8263 gene locus_tag LOCUS_10550 7634 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 9381 8260 gene locus_tag LOCUS_10560 gene pilU 9381 8260 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_10560 9710 10171 gene locus_tag LOCUS_10570 9710 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence081 387 94 gene locus_tag LOCUS_10580 387 94 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I449 protein_id gnl|my_center|LOCUS_10580 1539 403 gene locus_tag LOCUS_10590 gene rnd 1539 403 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_10590 2516 1629 gene locus_tag LOCUS_10600 gene htpX 2516 1629 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 protein_id gnl|my_center|LOCUS_10600 3209 2745 gene locus_tag LOCUS_10610 3209 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4430 3216 gene locus_tag LOCUS_10620 4430 3216 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_10620 4670 5068 gene locus_tag LOCUS_10630 gene msrB 4670 5068 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC6 protein_id gnl|my_center|LOCUS_10630 5363 5073 gene locus_tag LOCUS_10640 5363 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 5563 5985 gene locus_tag LOCUS_10650 5563 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7885 6026 gene locus_tag LOCUS_10660 gene atpA 7885 6026 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73M28 protein_id gnl|my_center|LOCUS_10660 8583 7897 gene locus_tag LOCUS_10670 8583 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 9327 8644 gene locus_tag LOCUS_10680 9327 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 9837 9388 gene locus_tag LOCUS_10690 gene atpK 9837 9388 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence082 219 677 gene locus_tag LOCUS_10700 219 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1738 722 gene locus_tag LOCUS_10710 gene ilvC 1738 722 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 protein_id gnl|my_center|LOCUS_10710 1856 2797 gene locus_tag LOCUS_10720 gene ilvY 1856 2797 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_10720 2788 3291 gene locus_tag LOCUS_10730 2788 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4036 3326 gene locus_tag LOCUS_10740 4036 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4848 4087 gene locus_tag LOCUS_10750 4848 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5841 5134 gene locus_tag LOCUS_10760 5841 5134 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456648.1 protein_id gnl|my_center|LOCUS_10760 6329 7801 gene locus_tag LOCUS_10770 6329 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7911 9947 gene locus_tag LOCUS_10780 7911 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence083 751 2787 gene locus_tag LOCUS_10790 751 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2972 3385 gene locus_tag LOCUS_10800 2972 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4479 3529 gene locus_tag LOCUS_10810 4479 3529 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_10810 5237 4542 gene locus_tag LOCUS_10820 5237 4542 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_10820 5215 5403 gene locus_tag LOCUS_10830 5215 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5419 6201 gene locus_tag LOCUS_10840 5419 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6602 6255 gene locus_tag LOCUS_10850 gene frdD 6602 6255 CDS product fumarate reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS2 protein_id gnl|my_center|LOCUS_10850 7002 6616 gene locus_tag LOCUS_10860 gene frdC 7002 6616 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS3 protein_id gnl|my_center|LOCUS_10860 7751 7002 gene locus_tag LOCUS_10870 7751 7002 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN49 protein_id gnl|my_center|LOCUS_10870 9566 7764 gene locus_tag LOCUS_10880 gene frdA 9566 7764 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN48 protein_id gnl|my_center|LOCUS_10880 10079 9861 gene locus_tag LOCUS_10890 10079 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence084 2205 1501 gene locus_tag LOCUS_10900 gene sdhB 2205 1501 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_10900 3991 2219 gene locus_tag LOCUS_10910 gene sdhA 3991 2219 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_10910 4363 3995 gene locus_tag LOCUS_10920 4363 3995 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX3 protein_id gnl|my_center|LOCUS_10920 4614 4264 gene locus_tag LOCUS_10930 4614 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5318 6610 gene locus_tag LOCUS_10940 gene gltA 5318 6610 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A2 protein_id gnl|my_center|LOCUS_10940 6764 7480 gene locus_tag LOCUS_10950 6764 7480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933545.1 protein_id gnl|my_center|LOCUS_10950 7499 8125 gene locus_tag LOCUS_10960 7499 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8207 9220 gene locus_tag LOCUS_10970 8207 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 9293 9871 gene locus_tag LOCUS_10980 gene ddpX 9293 9871 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMT9 protein_id gnl|my_center|LOCUS_10980 >Feature sequence085 1291 407 gene locus_tag LOCUS_10990 1291 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872458.1 protein_id gnl|my_center|LOCUS_10990 1650 2534 gene locus_tag LOCUS_11000 1650 2534 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169452.1 protein_id gnl|my_center|LOCUS_11000 2796 3806 gene locus_tag LOCUS_11010 2796 3806 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_11010 3822 5093 gene locus_tag LOCUS_11020 gene dadA 3822 5093 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_11020 5133 6635 gene locus_tag LOCUS_11030 5133 6635 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101377.1 protein_id gnl|my_center|LOCUS_11030 6827 7639 gene locus_tag LOCUS_11040 6827 7639 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123287.1 protein_id gnl|my_center|LOCUS_11040 8878 7871 gene locus_tag LOCUS_11050 8878 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9183 9377 gene locus_tag LOCUS_11060 9183 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence086 1129 2415 gene locus_tag LOCUS_11070 1129 2415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_11070 2427 3425 gene locus_tag LOCUS_11080 2427 3425 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642789.1 protein_id gnl|my_center|LOCUS_11080 3435 4394 gene locus_tag LOCUS_11090 3435 4394 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011970.1 protein_id gnl|my_center|LOCUS_11090 4560 8579 gene locus_tag LOCUS_11100 4560 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 9612 9025 gene locus_tag LOCUS_11110 9612 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence087 1783 602 gene locus_tag LOCUS_11120 1783 602 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_11120 2105 2566 gene locus_tag LOCUS_11130 2105 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4710 2710 gene locus_tag LOCUS_11140 gene tktA 4710 2710 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_11140 6150 4786 gene locus_tag LOCUS_11150 6150 4786 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873532.1 protein_id gnl|my_center|LOCUS_11150 6409 7368 gene locus_tag LOCUS_11160 6409 7368 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_11160 7411 8574 gene locus_tag LOCUS_11170 gene metK 7411 8574 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX3 protein_id gnl|my_center|LOCUS_11170 9608 8643 gene locus_tag LOCUS_11180 9608 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence088 778 2043 gene locus_tag LOCUS_11190 778 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3045 2194 gene locus_tag LOCUS_11200 gene kdsA 3045 2194 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EI24 protein_id gnl|my_center|LOCUS_11200 4692 3064 gene locus_tag LOCUS_11210 gene pyrG 4692 3064 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_11210 6215 4824 gene locus_tag LOCUS_11220 gene tilS 6215 4824 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ3 protein_id gnl|my_center|LOCUS_11220 7162 6212 gene locus_tag LOCUS_11230 gene accA 7162 6212 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR2 protein_id gnl|my_center|LOCUS_11230 8030 7431 gene locus_tag LOCUS_11240 8030 7431 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S292 protein_id gnl|my_center|LOCUS_11240 9439 8030 gene locus_tag LOCUS_11250 gene menE 9439 8030 CDS product 2-succinylbenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704500.1 protein_id gnl|my_center|LOCUS_11250 9555 9755 gene locus_tag LOCUS_11260 9555 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence089 236 1042 gene locus_tag LOCUS_11270 236 1042 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_11270 1215 1883 gene locus_tag LOCUS_11280 1215 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11280 2073 2717 gene locus_tag LOCUS_11290 gene msrA 2073 2717 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM24 protein_id gnl|my_center|LOCUS_11290 4758 2761 gene locus_tag LOCUS_11300 gene mnmC 4758 2761 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_11300 4882 5829 gene locus_tag LOCUS_11310 gene dusC 4882 5829 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD1 protein_id gnl|my_center|LOCUS_11310 7690 5843 gene locus_tag LOCUS_11320 7690 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 8403 8678 gene locus_tag LOCUS_11330 8403 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence090 816 121 gene locus_tag LOCUS_11340 gene cmk 816 121 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_11340 3073 842 gene locus_tag LOCUS_11350 gene aroA 3073 842 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_11350 4260 3070 gene locus_tag LOCUS_11360 gene hisC2 4260 3070 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_11360 5465 4380 gene locus_tag LOCUS_11370 5465 4380 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_11370 7523 8434 gene locus_tag LOCUS_11380 7523 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9687 8458 gene locus_tag LOCUS_11390 gene serC 9687 8458 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6F2 protein_id gnl|my_center|LOCUS_11390 >Feature sequence091 745 975 gene locus_tag LOCUS_11400 745 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1792 3354 gene locus_tag LOCUS_11410 1792 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5436 3454 gene locus_tag LOCUS_11420 5436 3454 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705127.1 protein_id gnl|my_center|LOCUS_11420 5556 5792 gene locus_tag LOCUS_11430 5556 5792 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631987.1 protein_id gnl|my_center|LOCUS_11430 5919 6833 gene locus_tag LOCUS_11440 gene fieF 5919 6833 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 protein_id gnl|my_center|LOCUS_11440 7614 6805 gene locus_tag LOCUS_11450 7614 6805 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_11450 8306 7647 gene locus_tag LOCUS_11460 8306 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 8475 9272 gene locus_tag LOCUS_11470 8475 9272 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_11470 9371 9622 gene locus_tag LOCUS_11480 9371 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence092 731 1981 gene locus_tag LOCUS_11490 731 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_11490 2041 2433 gene locus_tag LOCUS_11500 2041 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_11500 2458 3564 gene locus_tag LOCUS_11510 2458 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3686 4417 gene locus_tag LOCUS_11520 gene trmB 3686 4417 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNV5 protein_id gnl|my_center|LOCUS_11520 5333 4485 gene locus_tag LOCUS_11530 5333 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106060.1 protein_id gnl|my_center|LOCUS_11530 5790 7526 gene locus_tag LOCUS_11540 5790 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7612 8517 gene locus_tag LOCUS_11550 gene psd 7612 8517 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK8 protein_id gnl|my_center|LOCUS_11550 8514 9464 gene locus_tag LOCUS_11560 gene gshB 8514 9464 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_11560 >Feature sequence093 127 1257 gene locus_tag LOCUS_11570 127 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2301 1348 gene locus_tag LOCUS_11580 gene tal 2301 1348 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZP1 protein_id gnl|my_center|LOCUS_11580 2587 2285 gene locus_tag LOCUS_11590 2587 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2605 2859 gene locus_tag LOCUS_11600 2605 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4234 2903 gene locus_tag LOCUS_11610 4234 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 6587 4479 gene locus_tag LOCUS_11620 6587 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 8284 6584 gene locus_tag LOCUS_11630 8284 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9467 8178 gene locus_tag LOCUS_11640 9467 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence094 1651 401 gene locus_tag LOCUS_11650 1651 401 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_11650 3200 1620 gene locus_tag LOCUS_11660 3200 1620 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_11660 3875 3252 gene locus_tag LOCUS_11670 3875 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5263 3881 gene locus_tag LOCUS_11680 gene argH 5263 3881 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_11680 5750 6418 gene locus_tag LOCUS_11690 5750 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 6450 7184 gene locus_tag LOCUS_11700 gene algR 6450 7184 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_11700 7321 8241 gene locus_tag LOCUS_11710 gene hemC 7321 8241 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_11710 8293 9042 gene locus_tag LOCUS_11720 gene hemD 8293 9042 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_11720 >Feature sequence095 336 121 gene locus_tag LOCUS_11730 336 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2404 464 gene locus_tag LOCUS_11740 gene aceF 2404 464 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJL9 protein_id gnl|my_center|LOCUS_11740 5132 2478 gene locus_tag LOCUS_11750 5132 2478 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ34 protein_id gnl|my_center|LOCUS_11750 5654 6556 gene locus_tag LOCUS_11760 gene miaA 5654 6556 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY1 protein_id gnl|my_center|LOCUS_11760 6942 7193 gene locus_tag LOCUS_11770 gene hfq 6942 7193 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_11770 7365 8657 gene locus_tag LOCUS_11780 gene hflX 7365 8657 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX9 protein_id gnl|my_center|LOCUS_11780 >Feature sequence096 189 1217 gene locus_tag LOCUS_11790 gene tsaD 189 1217 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V7 protein_id gnl|my_center|LOCUS_11790 1221 1622 gene locus_tag LOCUS_11800 1221 1622 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL2 protein_id gnl|my_center|LOCUS_11800 1619 1987 gene locus_tag LOCUS_11810 1619 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3988 2240 gene locus_tag LOCUS_11820 gene ggt 3988 2240 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262987.1 protein_id gnl|my_center|LOCUS_11820 5142 4021 gene locus_tag LOCUS_11830 gene cca 5142 4021 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XTY6 protein_id gnl|my_center|LOCUS_11830 5309 6814 gene locus_tag LOCUS_11840 gene putP 5309 6814 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_11840 6940 6865 gene locus_tag LOCUS_t00190 6940 6865 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8646 6940 gene locus_tag LOCUS_11850 gene pilB 8646 6940 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_11850 9220 8747 gene locus_tag LOCUS_11860 9220 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence097 1598 396 gene locus_tag LOCUS_11870 1598 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1928 1626 gene locus_tag LOCUS_11880 1928 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2954 1965 gene locus_tag LOCUS_11890 gene epmA 2954 1965 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIQ4 protein_id gnl|my_center|LOCUS_11890 3210 7328 gene locus_tag LOCUS_11900 3210 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 8160 7591 gene locus_tag LOCUS_11910 gene efp 8160 7591 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_11910 8190 9218 gene locus_tag LOCUS_11920 gene yjeK 8190 9218 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262738.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence098 377 120 gene locus_tag LOCUS_11930 377 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 577 981 gene locus_tag LOCUS_11940 577 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1025 2032 gene locus_tag LOCUS_11950 1025 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3464 2097 gene locus_tag LOCUS_11960 gene gor 3464 2097 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704063.1 protein_id gnl|my_center|LOCUS_11960 5788 4106 gene locus_tag LOCUS_11970 gene maeA 5788 4106 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTY5 protein_id gnl|my_center|LOCUS_11970 6113 6262 gene locus_tag LOCUS_11980 6113 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6443 7105 gene locus_tag LOCUS_11990 6443 7105 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_11990 7122 7436 gene locus_tag LOCUS_12000 7122 7436 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_12000 8336 7593 gene locus_tag LOCUS_12010 8336 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 9214 8642 gene locus_tag LOCUS_12020 9214 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence099 493 972 gene locus_tag LOCUS_12030 493 972 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_12030 1053 2267 gene locus_tag LOCUS_12040 gene iscS 1053 2267 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_12040 2327 2710 gene locus_tag LOCUS_12050 gene iscU 2327 2710 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_12050 2805 3128 gene locus_tag LOCUS_12060 2805 3128 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX32 protein_id gnl|my_center|LOCUS_12060 3238 3780 gene locus_tag LOCUS_12070 gene hscB 3238 3780 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU6 protein_id gnl|my_center|LOCUS_12070 3800 5662 gene locus_tag LOCUS_12080 gene hscA 3800 5662 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51382 protein_id gnl|my_center|LOCUS_12080 5665 6003 gene locus_tag LOCUS_12090 gene fdx 5665 6003 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_12090 6288 6491 gene locus_tag LOCUS_12100 6288 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_12100 6883 6536 gene locus_tag LOCUS_12110 6883 6536 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_12110 7183 7599 gene locus_tag LOCUS_12120 gene ndk 7183 7599 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_12120 7938 9095 gene locus_tag LOCUS_12130 gene rlmN 7938 9095 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 protein_id gnl|my_center|LOCUS_12130 >Feature sequence100 1679 513 gene locus_tag LOCUS_12140 1679 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3761 1797 gene locus_tag LOCUS_12150 3761 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4682 3936 gene locus_tag LOCUS_12160 4682 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4793 5458 gene locus_tag LOCUS_12170 4793 5458 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_12170 7517 6219 gene locus_tag LOCUS_12180 7517 6219 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_12180 <9314 7514 gene locus_tag LOCUS_12190 <9314 7514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:multidrug transporter AcrB >Feature sequence101 1678 290 gene locus_tag LOCUS_12200 gene pabB 1678 290 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765730.1 protein_id gnl|my_center|LOCUS_12200 1899 2774 gene locus_tag LOCUS_12210 1899 2774 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_12210 2838 3962 gene locus_tag LOCUS_12220 gene prpC 2838 3962 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_12220 3986 5473 gene locus_tag LOCUS_12230 gene prpD 3986 5473 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_12230 5691 7109 gene locus_tag LOCUS_12240 gene pykF 5691 7109 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2J3 protein_id gnl|my_center|LOCUS_12240 7251 8708 gene locus_tag LOCUS_12250 7251 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 <9261 8734 gene locus_tag LOCUS_12260 <9261 8734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947236.1:sodium:hydrogen antiporter >Feature sequence102 989 495 gene locus_tag LOCUS_12270 989 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1278 2675 gene locus_tag LOCUS_12280 1278 2675 CDS product Na+/H+ antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 protein_id gnl|my_center|LOCUS_12280 3226 4503 gene locus_tag LOCUS_12290 3226 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_12290 4500 5012 gene locus_tag LOCUS_12300 4500 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6628 5180 gene locus_tag LOCUS_12310 gene gatB 6628 5180 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_12310 8106 6640 gene locus_tag LOCUS_12320 gene gatA 8106 6640 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_12320 8445 8158 gene locus_tag LOCUS_12330 gene gatC 8445 8158 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS8 protein_id gnl|my_center|LOCUS_12330 >Feature sequence103 177 1598 gene locus_tag LOCUS_12340 177 1598 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_12340 1602 3026 gene locus_tag LOCUS_12350 1602 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5661 3124 gene locus_tag LOCUS_12360 5661 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6320 5949 gene locus_tag LOCUS_12370 6320 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6607 6353 gene locus_tag LOCUS_12380 6607 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6879 6628 gene locus_tag LOCUS_12390 6879 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 8332 6866 gene locus_tag LOCUS_12400 8332 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence104 1737 268 gene locus_tag LOCUS_12410 gene ubiD 1737 268 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_12410 3078 1819 gene locus_tag LOCUS_12420 gene rho 3078 1819 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_12420 3741 3418 gene locus_tag LOCUS_12430 gene trxA 3741 3418 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_12430 3993 5519 gene locus_tag LOCUS_12440 3993 5519 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266304.1 protein_id gnl|my_center|LOCUS_12440 7320 5512 gene locus_tag LOCUS_12450 7320 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 7565 8002 gene locus_tag LOCUS_12460 7565 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 8818 8024 gene locus_tag LOCUS_12470 8818 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence105 5121 319 gene locus_tag LOCUS_12480 5121 319 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_12480 5726 5962 gene locus_tag LOCUS_12490 gene rpmB 5726 5962 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN8 protein_id gnl|my_center|LOCUS_12490 5983 6150 gene locus_tag LOCUS_12500 gene rpmG 5983 6150 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4B7 protein_id gnl|my_center|LOCUS_12500 6306 7622 gene locus_tag LOCUS_12510 6306 7622 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211023.1 protein_id gnl|my_center|LOCUS_12510 8871 7663 gene locus_tag LOCUS_12520 gene y1062 8871 7663 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence106 286 1320 gene locus_tag LOCUS_12530 286 1320 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073373.1 protein_id gnl|my_center|LOCUS_12530 4639 1649 gene locus_tag LOCUS_12540 4639 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5678 4770 gene locus_tag LOCUS_12550 5678 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6219 7745 gene locus_tag LOCUS_12560 6219 7745 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_12560 8380 7832 gene locus_tag LOCUS_12570 8380 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8476 8694 gene locus_tag LOCUS_12580 8476 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence107 753 1997 gene locus_tag LOCUS_12590 753 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2507 2043 gene locus_tag LOCUS_12600 gene ibpA 2507 2043 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_12600 3150 2659 gene locus_tag LOCUS_12610 3150 2659 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_12610 4107 3445 gene locus_tag LOCUS_12620 gene pphA 4107 3445 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930070.1 protein_id gnl|my_center|LOCUS_12620 5423 4134 gene locus_tag LOCUS_12630 5423 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5592 5413 gene locus_tag LOCUS_12640 5592 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5696 6949 gene locus_tag LOCUS_12650 5696 6949 CDS product proline/betaine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958628.1 protein_id gnl|my_center|LOCUS_12650 7035 8024 gene locus_tag LOCUS_12660 7035 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 8597 8283 gene locus_tag LOCUS_12670 8597 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence108 1712 2515 gene locus_tag LOCUS_12680 1712 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2672 4141 gene locus_tag LOCUS_12690 gene agcS-2 2672 4141 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_12690 4723 4178 gene locus_tag LOCUS_12700 4723 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119314.1 protein_id gnl|my_center|LOCUS_12700 4864 5106 gene locus_tag LOCUS_12710 gene xseB 4864 5106 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889P9 protein_id gnl|my_center|LOCUS_12710 5109 6017 gene locus_tag LOCUS_12720 gene ispA 5109 6017 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_12720 6227 8161 gene locus_tag LOCUS_12730 gene dxs 6227 8161 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_12730 >Feature sequence109 3089 606 gene locus_tag LOCUS_12740 3089 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3261 5549 gene locus_tag LOCUS_12750 gene metE 3261 5549 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XJ9 protein_id gnl|my_center|LOCUS_12750 5687 6982 gene locus_tag LOCUS_12760 5687 6982 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWP3 protein_id gnl|my_center|LOCUS_12760 6995 7825 gene locus_tag LOCUS_12770 6995 7825 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 protein_id gnl|my_center|LOCUS_12770 8119 7829 gene locus_tag LOCUS_12780 8119 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12780 8446 8213 gene locus_tag LOCUS_12790 8446 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 8707 8453 gene locus_tag LOCUS_12800 8707 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence110 1144 2088 gene locus_tag LOCUS_12810 gene fmt 1144 2088 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRE8 protein_id gnl|my_center|LOCUS_12810 2088 3392 gene locus_tag LOCUS_12820 gene rsmB 2088 3392 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_12820 3421 4797 gene locus_tag LOCUS_12830 gene trkA 3421 4797 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_12830 4977 6425 gene locus_tag LOCUS_12840 gene trkH 4977 6425 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_12840 6964 7944 gene locus_tag LOCUS_12850 6964 7944 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12850 8059 8295 gene locus_tag LOCUS_12860 8059 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence111 3655 4638 gene locus_tag LOCUS_12870 3655 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_12870 4643 5563 gene locus_tag LOCUS_12880 4643 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_12880 5609 6085 gene locus_tag LOCUS_12890 5609 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_12890 6078 7106 gene locus_tag LOCUS_12900 6078 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence112 811 188 gene locus_tag LOCUS_12910 811 188 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 protein_id gnl|my_center|LOCUS_12910 1540 857 gene locus_tag LOCUS_12920 gene yugP 1540 857 CDS product putative membrane protease YugP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05248 protein_id gnl|my_center|LOCUS_12920 2068 1604 gene locus_tag LOCUS_12930 2068 1604 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 protein_id gnl|my_center|LOCUS_12930 2525 2061 gene locus_tag LOCUS_12940 gene nrdR 2525 2061 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_12940 3922 2669 gene locus_tag LOCUS_12950 gene glyA 3922 2669 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_12950 4795 4124 gene locus_tag LOCUS_12960 4795 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5582 7561 gene locus_tag LOCUS_12970 5582 7561 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_12970 7784 8308 gene locus_tag LOCUS_12980 7784 8308 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083123.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence113 198 929 gene locus_tag LOCUS_12990 198 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2386 980 gene locus_tag LOCUS_13000 gene yclF 2386 980 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_13000 2760 3656 gene locus_tag LOCUS_13010 2760 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3702 4646 gene locus_tag LOCUS_13020 3702 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4900 6516 gene locus_tag LOCUS_13030 gene cydA 4900 6516 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261597.1 protein_id gnl|my_center|LOCUS_13030 6529 7662 gene locus_tag LOCUS_13040 gene cydB 6529 7662 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_13040 7675 7803 gene locus_tag LOCUS_13050 gene ybgT 7675 7803 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270284.1 protein_id gnl|my_center|LOCUS_13050 7929 8204 gene locus_tag LOCUS_13060 7929 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence114 336 112 gene locus_tag LOCUS_13070 336 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 795 367 gene locus_tag LOCUS_13080 795 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2338 968 gene locus_tag LOCUS_13090 2338 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3798 2503 gene locus_tag LOCUS_13100 3798 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3915 7004 gene locus_tag LOCUS_13110 3915 7004 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104207.1 protein_id gnl|my_center|LOCUS_13110 7292 7128 gene locus_tag LOCUS_13120 7292 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 7339 7854 gene locus_tag LOCUS_13130 7339 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence115 1777 329 gene locus_tag LOCUS_13140 1777 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_13140 2047 1856 gene locus_tag LOCUS_13150 2047 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2618 1950 gene locus_tag LOCUS_13160 2618 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6637 2765 gene locus_tag LOCUS_13170 6637 2765 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_13170 8194 6722 gene locus_tag LOCUS_13180 gene cafA 8194 6722 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence116 715 3297 gene locus_tag LOCUS_13190 gene rnr 715 3297 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_13190 3708 4991 gene locus_tag LOCUS_13200 3708 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 6046 5072 gene locus_tag LOCUS_13210 6046 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_13210 7482 6052 gene locus_tag LOCUS_13220 gene phr 7482 6052 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_13220 7732 8478 gene locus_tag LOCUS_13230 gene rlmB 7732 8478 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_13230 >Feature sequence117 2780 1800 gene locus_tag LOCUS_13240 gene pfkA 2780 1800 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_13240 4235 2802 gene locus_tag LOCUS_13250 gene pykA 4235 2802 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E082 protein_id gnl|my_center|LOCUS_13250 5521 4514 gene locus_tag LOCUS_13260 gene gapA 5521 4514 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN3 protein_id gnl|my_center|LOCUS_13260 6259 6002 gene locus_tag LOCUS_13270 gene hpr 6259 6002 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164859.1 protein_id gnl|my_center|LOCUS_13270 7449 6916 gene locus_tag LOCUS_13280 7449 6916 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_13280 8317 7613 gene locus_tag LOCUS_13290 8317 7613 CDS product class B acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE46 protein_id gnl|my_center|LOCUS_13290 >Feature sequence118 2153 132 gene locus_tag LOCUS_13300 gene pilQ 2153 132 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_13300 2857 2333 gene locus_tag LOCUS_13310 gene pilP 2857 2333 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_13310 3468 2854 gene locus_tag LOCUS_13320 gene pilO 3468 2854 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_13320 4028 3465 gene locus_tag LOCUS_13330 gene pilN 4028 3465 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_13330 5092 4028 gene locus_tag LOCUS_13340 gene pilM 5092 4028 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_13340 5433 7829 gene locus_tag LOCUS_13350 gene mrcA 5433 7829 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_13350 >Feature sequence119 313 122 gene locus_tag LOCUS_13360 313 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 904 491 gene locus_tag LOCUS_13370 gene yaeJ 904 491 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_13370 1417 1091 gene locus_tag LOCUS_13380 1417 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_13380 2326 2541 gene locus_tag LOCUS_13390 2326 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2638 3087 gene locus_tag LOCUS_13400 2638 3087 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262667.1 protein_id gnl|my_center|LOCUS_13400 3191 5152 gene locus_tag LOCUS_13410 gene dnaG 3191 5152 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF2 protein_id gnl|my_center|LOCUS_13410 5405 7234 gene locus_tag LOCUS_13420 gene rpoD 5405 7234 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_13420 7268 7867 gene locus_tag LOCUS_13430 7268 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence120 311 1135 gene locus_tag LOCUS_13440 311 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1704 3095 gene locus_tag LOCUS_13450 1704 3095 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 protein_id gnl|my_center|LOCUS_13450 3181 3729 gene locus_tag LOCUS_13460 3181 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3825 4025 gene locus_tag LOCUS_13470 3825 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4022 4276 gene locus_tag LOCUS_13480 4022 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4273 5160 gene locus_tag LOCUS_13490 4273 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5157 6989 gene locus_tag LOCUS_13500 5157 6989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946812.1 protein_id gnl|my_center|LOCUS_13500 7621 8049 gene locus_tag LOCUS_13510 7621 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence121 671 195 gene locus_tag LOCUS_13520 gene greA 671 195 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_13520 3889 668 gene locus_tag LOCUS_13530 gene carB 3889 668 CDS product carbamoyl-phosphate synthase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP4 protein_id gnl|my_center|LOCUS_13530 5220 4081 gene locus_tag LOCUS_13540 gene carA 5220 4081 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38098 protein_id gnl|my_center|LOCUS_13540 6274 5471 gene locus_tag LOCUS_13550 gene dapB 6274 5471 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_13550 7638 6466 gene locus_tag LOCUS_13560 7638 6466 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_13560 7882 7673 gene locus_tag LOCUS_13570 7882 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence122 1663 344 gene locus_tag LOCUS_13580 gene deoA 1663 344 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE3 protein_id gnl|my_center|LOCUS_13580 2546 1665 gene locus_tag LOCUS_13590 gene deoC 2546 1665 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M22 protein_id gnl|my_center|LOCUS_13590 2952 3902 gene locus_tag LOCUS_13600 gene ydhB 2952 3902 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423889.1 protein_id gnl|my_center|LOCUS_13600 4750 5424 gene locus_tag LOCUS_13610 4750 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5501 6499 gene locus_tag LOCUS_13620 gene pstS 5501 6499 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_13620 7828 6656 gene locus_tag LOCUS_13630 7828 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence123 178 933 gene locus_tag LOCUS_13640 178 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 875 1729 gene locus_tag LOCUS_13650 gene queD 875 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_13650 3294 1831 gene locus_tag LOCUS_13660 3294 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_13660 3458 4672 gene locus_tag LOCUS_13670 gene argD 3458 4672 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59320 protein_id gnl|my_center|LOCUS_13670 5115 4729 gene locus_tag LOCUS_13680 5115 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5217 6473 gene locus_tag LOCUS_13690 5217 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_13690 6485 7291 gene locus_tag LOCUS_13700 6485 7291 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_13700 7463 7621 gene locus_tag LOCUS_13710 7463 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence124 3514 1790 gene locus_tag LOCUS_13720 3514 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5109 3793 gene locus_tag LOCUS_13730 gene clpX 5109 3793 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_13730 5955 5308 gene locus_tag LOCUS_13740 gene clpP1 5955 5308 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U1 protein_id gnl|my_center|LOCUS_13740 7476 6127 gene locus_tag LOCUS_13750 gene tig 7476 6127 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_13750 7876 7792 gene locus_tag LOCUS_t00200 7876 7792 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 1418 141 gene locus_tag LOCUS_13760 1418 141 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266998.1 protein_id gnl|my_center|LOCUS_13760 3052 1571 gene locus_tag LOCUS_13770 3052 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3539 4015 gene locus_tag LOCUS_13780 3539 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4018 5373 gene locus_tag LOCUS_13790 4018 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5579 5851 gene locus_tag LOCUS_13800 5579 5851 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_13800 5888 7681 gene locus_tag LOCUS_13810 gene aspS 5888 7681 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_13810 >Feature sequence126 459 136 gene locus_tag LOCUS_13820 459 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13820 831 517 gene locus_tag LOCUS_13830 831 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13830 1328 2842 gene locus_tag LOCUS_13840 gene gshA 1328 2842 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_13840 3392 3856 gene locus_tag LOCUS_13850 gene algQ 3392 3856 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738602.1 protein_id gnl|my_center|LOCUS_13850 4290 4946 gene locus_tag LOCUS_13860 4290 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5270 7213 gene locus_tag LOCUS_13870 5270 7213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_13870 7671 7423 gene locus_tag LOCUS_13880 gene zapB 7671 7423 CDS product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KER2 protein_id gnl|my_center|LOCUS_13880 >Feature sequence127 1635 763 gene locus_tag LOCUS_13890 1635 763 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479072.1 protein_id gnl|my_center|LOCUS_13890 2412 1639 gene locus_tag LOCUS_13900 2412 1639 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSH1 protein_id gnl|my_center|LOCUS_13900 3716 2412 gene locus_tag LOCUS_13910 3716 2412 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461090.1 protein_id gnl|my_center|LOCUS_13910 4747 3746 gene locus_tag LOCUS_13920 4747 3746 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101064.1 protein_id gnl|my_center|LOCUS_13920 5124 4816 gene locus_tag LOCUS_13930 gene celC 5124 4816 CDS product PTS N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815722.1 protein_id gnl|my_center|LOCUS_13930 6538 5210 gene locus_tag LOCUS_13940 6538 5210 CDS product permease IIC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LH6 protein_id gnl|my_center|LOCUS_13940 6902 6591 gene locus_tag LOCUS_13950 6902 6591 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478850.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence128 332 1693 gene locus_tag LOCUS_13960 gene puuA 332 1693 CDS product gamma-glutamylputrescine synthetase PuuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P78061 protein_id gnl|my_center|LOCUS_13960 2000 3295 gene locus_tag LOCUS_13970 2000 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3995 3444 gene locus_tag LOCUS_13980 3995 3444 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_13980 4924 4007 gene locus_tag LOCUS_13990 gene potI 4924 4007 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071492.1 protein_id gnl|my_center|LOCUS_13990 5831 4914 gene locus_tag LOCUS_14000 gene potH 5831 4914 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707794.1 protein_id gnl|my_center|LOCUS_14000 6944 5841 gene locus_tag LOCUS_14010 gene potG 6944 5841 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHF2 protein_id gnl|my_center|LOCUS_14010 7683 7288 gene locus_tag LOCUS_14020 7683 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence129 1411 908 gene locus_tag LOCUS_14030 1411 908 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_14030 1763 1440 gene locus_tag LOCUS_14040 1763 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3085 1823 gene locus_tag LOCUS_14050 gene wecC 3085 1823 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAE4 protein_id gnl|my_center|LOCUS_14050 4248 3082 gene locus_tag LOCUS_14060 gene wecB 4248 3082 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_14060 5497 4460 gene locus_tag LOCUS_14070 5497 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5914 6753 gene locus_tag LOCUS_14080 5914 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 7699 6638 gene locus_tag LOCUS_14090 7699 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence130 474 1199 gene locus_tag LOCUS_14100 gene recO 474 1199 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44642 protein_id gnl|my_center|LOCUS_14100 1232 1969 gene locus_tag LOCUS_14110 gene pdxJ 1232 1969 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V870 protein_id gnl|my_center|LOCUS_14110 1966 2343 gene locus_tag LOCUS_14120 gene acpS 1966 2343 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB6 protein_id gnl|my_center|LOCUS_14120 4829 2349 gene locus_tag LOCUS_14130 4829 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5191 6093 gene locus_tag LOCUS_14140 gene cysM 5191 6093 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Y9 protein_id gnl|my_center|LOCUS_14140 6293 7621 gene locus_tag LOCUS_14150 gene rlmD 6293 7621 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I525 protein_id gnl|my_center|LOCUS_14150 >Feature sequence131 94 169 gene locus_tag LOCUS_t00210 94 169 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 904 206 gene locus_tag LOCUS_14160 904 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2840 1761 gene locus_tag LOCUS_14170 gene fbaA 2840 1761 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_14170 3656 5377 gene locus_tag LOCUS_14180 gene ptsI-2 3656 5377 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP1 protein_id gnl|my_center|LOCUS_14180 5427 5993 gene locus_tag LOCUS_14190 5427 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence132 1875 2165 gene locus_tag LOCUS_14200 1875 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3605 2232 gene locus_tag LOCUS_14210 3605 2232 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_14210 4511 3906 gene locus_tag LOCUS_14220 4511 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5869 4586 gene locus_tag LOCUS_14230 gene kpsS 5869 4586 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161834.1 protein_id gnl|my_center|LOCUS_14230 <7689 6354 gene locus_tag LOCUS_14240 <7689 6354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000579521.1:capsule polysaccharide transporter >Feature sequence133 539 66 gene locus_tag LOCUS_14250 gene mucC 539 66 CDS product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_14250 1693 677 gene locus_tag LOCUS_14260 gene mucB 1693 677 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_14260 2407 1697 gene locus_tag LOCUS_14270 2407 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3112 2528 gene locus_tag LOCUS_14280 gene algU 3112 2528 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_14280 3632 5278 gene locus_tag LOCUS_14290 gene nadB 3632 5278 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_14290 5887 5450 gene locus_tag LOCUS_14300 5887 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 6143 5874 gene locus_tag LOCUS_14310 6143 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_14310 6260 7297 gene locus_tag LOCUS_14320 6260 7297 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD0 protein_id gnl|my_center|LOCUS_14320 >Feature sequence134 931 257 gene locus_tag LOCUS_14330 931 257 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8M5 protein_id gnl|my_center|LOCUS_14330 1010 2239 gene locus_tag LOCUS_14340 gene coaBC 1010 2239 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_14340 2595 3329 gene locus_tag LOCUS_14350 2595 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3439 3894 gene locus_tag LOCUS_14360 gene dut 3439 3894 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XSB0 protein_id gnl|my_center|LOCUS_14360 3954 4853 gene locus_tag LOCUS_14370 gene argB 3954 4853 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_14370 4861 5451 gene locus_tag LOCUS_14380 gene slmA 4861 5451 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_14380 5605 7527 gene locus_tag LOCUS_14390 5605 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence135 390 1319 gene locus_tag LOCUS_14400 gene cysD 390 1319 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E831 protein_id gnl|my_center|LOCUS_14400 1319 3034 gene locus_tag LOCUS_14410 gene cysNC 1319 3034 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50274 protein_id gnl|my_center|LOCUS_14410 3730 3257 gene locus_tag LOCUS_14420 3730 3257 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HM3 protein_id gnl|my_center|LOCUS_14420 5667 3730 gene locus_tag LOCUS_14430 gene nrdD 5667 3730 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43752 protein_id gnl|my_center|LOCUS_14430 6048 7400 gene locus_tag LOCUS_14440 6048 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence136 958 74 gene locus_tag LOCUS_14450 958 74 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_14450 1988 1080 gene locus_tag LOCUS_14460 1988 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2904 2149 gene locus_tag LOCUS_14470 2904 2149 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116045.1 protein_id gnl|my_center|LOCUS_14470 3009 5114 gene locus_tag LOCUS_14480 3009 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5349 6299 gene locus_tag LOCUS_14490 gene dusA 5349 6299 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E844 protein_id gnl|my_center|LOCUS_14490 6812 6312 gene locus_tag LOCUS_14500 6812 6312 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315067.1 protein_id gnl|my_center|LOCUS_14500 <7623 6815 gene locus_tag LOCUS_14510 <7623 6815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407019.1:fused response regulator/phosphatase >Feature sequence137 279 1373 gene locus_tag LOCUS_14520 279 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2542 1370 gene locus_tag LOCUS_14530 2542 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 protein_id gnl|my_center|LOCUS_14530 3066 2545 gene locus_tag LOCUS_14540 3066 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3493 3083 gene locus_tag LOCUS_14550 3493 3083 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084988.1 protein_id gnl|my_center|LOCUS_14550 4231 3581 gene locus_tag LOCUS_14560 4231 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4320 5516 gene locus_tag LOCUS_14570 4320 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6185 5496 gene locus_tag LOCUS_14580 6185 5496 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_14580 6849 6223 gene locus_tag LOCUS_14590 6849 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_252421.2 protein_id gnl|my_center|LOCUS_14590 6848 6997 gene locus_tag LOCUS_14600 6848 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence138 2262 925 gene locus_tag LOCUS_14610 gene glmM 2262 925 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_14610 3138 2299 gene locus_tag LOCUS_14620 gene folP 3138 2299 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_14620 4750 4496 gene locus_tag LOCUS_14630 4750 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5048 5830 gene locus_tag LOCUS_14640 5048 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <7350 5885 gene locus_tag LOCUS_14650 <7350 5885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HV48:ATP-dependent zinc metalloprotease FtsH >Feature sequence139 359 54 gene locus_tag LOCUS_14660 gene zapA 359 54 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_14660 568 359 gene locus_tag LOCUS_14670 568 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 742 1326 gene locus_tag LOCUS_14680 742 1326 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 protein_id gnl|my_center|LOCUS_14680 1345 2562 gene locus_tag LOCUS_14690 gene ubiH 1345 2562 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_14690 2568 3788 gene locus_tag LOCUS_14700 2568 3788 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_14700 4062 4874 gene locus_tag LOCUS_14710 4062 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5181 5576 gene locus_tag LOCUS_14720 5181 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5768 5989 gene locus_tag LOCUS_14730 5768 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7114 6167 gene locus_tag LOCUS_14740 7114 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence140 969 184 gene locus_tag LOCUS_14750 969 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2018 1221 gene locus_tag LOCUS_14760 2018 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2769 2104 gene locus_tag LOCUS_14770 2769 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4362 2866 gene locus_tag LOCUS_14780 4362 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence141 242 811 gene locus_tag LOCUS_14790 242 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_14790 853 1626 gene locus_tag LOCUS_14800 853 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071636.1 protein_id gnl|my_center|LOCUS_14800 1658 2095 gene locus_tag LOCUS_14810 1658 2095 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_14810 2092 2403 gene locus_tag LOCUS_14820 2092 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_14820 3633 2848 gene locus_tag LOCUS_14830 3633 2848 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703807.1 protein_id gnl|my_center|LOCUS_14830 3753 5186 gene locus_tag LOCUS_14840 gene manC 3753 5186 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348016.1 protein_id gnl|my_center|LOCUS_14840 5448 6818 gene locus_tag LOCUS_14850 5448 6818 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence142 2232 1204 gene locus_tag LOCUS_14860 gene tdh 2232 1204 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_14860 3529 2333 gene locus_tag LOCUS_14870 gene kbl 3529 2333 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFH2 protein_id gnl|my_center|LOCUS_14870 4581 3727 gene locus_tag LOCUS_14880 4581 3727 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926911.1 protein_id gnl|my_center|LOCUS_14880 5376 4615 gene locus_tag LOCUS_14890 5376 4615 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_14890 5525 6574 gene locus_tag LOCUS_14900 5525 6574 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence143 1806 703 gene locus_tag LOCUS_14910 1806 703 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 protein_id gnl|my_center|LOCUS_14910 2888 1818 gene locus_tag LOCUS_14920 gene aapQ 2888 1818 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419738.1 protein_id gnl|my_center|LOCUS_14920 4103 3066 gene locus_tag LOCUS_14930 4103 3066 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_14930 4254 4805 gene locus_tag LOCUS_14940 gene folE2 4254 4805 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_14940 5432 4869 gene locus_tag LOCUS_14950 5432 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5704 5429 gene locus_tag LOCUS_14960 5704 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6249 5734 gene locus_tag LOCUS_14970 6249 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence144 1472 330 gene locus_tag LOCUS_14980 1472 330 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 protein_id gnl|my_center|LOCUS_14980 2757 1678 gene locus_tag LOCUS_14990 2757 1678 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 protein_id gnl|my_center|LOCUS_14990 4313 3621 gene locus_tag LOCUS_15000 4313 3621 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JW6 protein_id gnl|my_center|LOCUS_15000 4654 5766 gene locus_tag LOCUS_15010 4654 5766 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_15010 5794 6990 gene locus_tag LOCUS_15020 5794 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence145 1196 294 gene locus_tag LOCUS_15030 1196 294 CDS product putative aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72208 protein_id gnl|my_center|LOCUS_15030 2900 1545 gene locus_tag LOCUS_15040 2900 1545 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454045.1 protein_id gnl|my_center|LOCUS_15040 3469 3020 gene locus_tag LOCUS_15050 3469 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3849 3577 gene locus_tag LOCUS_15060 3849 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3975 5033 gene locus_tag LOCUS_15070 3975 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 5354 5040 gene locus_tag LOCUS_15080 5354 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6084 5347 gene locus_tag LOCUS_15090 6084 5347 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461994.1 protein_id gnl|my_center|LOCUS_15090 7013 6102 gene locus_tag LOCUS_15100 7013 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence146 1955 2797 gene locus_tag LOCUS_15110 1955 2797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_15110 2971 2879 gene locus_tag LOCUS_t00220 2971 2879 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3471 3268 gene locus_tag LOCUS_15120 gene csrA 3471 3268 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_15120 5166 3925 gene locus_tag LOCUS_15130 5166 3925 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_15130 6463 5390 gene locus_tag LOCUS_15140 gene dcm 6463 5390 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389915.1 protein_id gnl|my_center|LOCUS_15140 6808 7005 gene locus_tag LOCUS_15150 6808 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence147 1014 112 gene locus_tag LOCUS_15160 1014 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2372 1143 gene locus_tag LOCUS_15170 gene serA 2372 1143 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_15170 2843 2583 gene locus_tag LOCUS_15180 2843 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2962 3624 gene locus_tag LOCUS_15190 gene ycgM 2962 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76004 protein_id gnl|my_center|LOCUS_15190 3945 4346 gene locus_tag LOCUS_15200 3945 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4795 4394 gene locus_tag LOCUS_15210 4795 4394 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705756.1 protein_id gnl|my_center|LOCUS_15210 6214 4838 gene locus_tag LOCUS_15220 6214 4838 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_15220 6749 6207 gene locus_tag LOCUS_15230 6749 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence148 910 497 gene locus_tag LOCUS_15240 910 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3079 1094 gene locus_tag LOCUS_15250 3079 1094 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895490.1 protein_id gnl|my_center|LOCUS_15250 4112 3069 gene locus_tag LOCUS_15260 gene gshB 4112 3069 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF44 protein_id gnl|my_center|LOCUS_15260 6687 4633 gene locus_tag LOCUS_15270 gene metG 6687 4633 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC7 protein_id gnl|my_center|LOCUS_15270 >Feature sequence149 1204 209 gene locus_tag LOCUS_15280 1204 209 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704084.1 protein_id gnl|my_center|LOCUS_15280 1532 2881 gene locus_tag LOCUS_15290 1532 2881 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 protein_id gnl|my_center|LOCUS_15290 2984 4405 gene locus_tag LOCUS_15300 gene melB 2984 4405 CDS product melibiose carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P02921 protein_id gnl|my_center|LOCUS_15300 5558 4455 gene locus_tag LOCUS_15310 5558 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5883 6917 gene locus_tag LOCUS_15320 5883 6917 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence150 242 964 gene locus_tag LOCUS_15330 242 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 1114 2340 gene locus_tag LOCUS_15340 gene deoB 1114 2340 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJ99 protein_id gnl|my_center|LOCUS_15340 2358 3059 gene locus_tag LOCUS_15350 gene deoD-2 2358 3059 CDS product purine nucleoside phosphorylase DeoD-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE1 protein_id gnl|my_center|LOCUS_15350 4212 3145 gene locus_tag LOCUS_15360 4212 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 5047 4274 gene locus_tag LOCUS_15370 gene znuB 5047 4274 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_15370 5952 5056 gene locus_tag LOCUS_15380 gene znuA 5952 5056 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 protein_id gnl|my_center|LOCUS_15380 6688 5936 gene locus_tag LOCUS_15390 6688 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence151 250 894 gene locus_tag LOCUS_15400 250 894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_15400 1056 1481 gene locus_tag LOCUS_15410 1056 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1622 2086 gene locus_tag LOCUS_15420 1622 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2091 2804 gene locus_tag LOCUS_15430 2091 2804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769006.1 protein_id gnl|my_center|LOCUS_15430 2843 3973 gene locus_tag LOCUS_15440 2843 3973 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 protein_id gnl|my_center|LOCUS_15440 4046 5170 gene locus_tag LOCUS_15450 gene frmA 4046 5170 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_15450 5167 6021 gene locus_tag LOCUS_15460 5167 6021 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886L8 protein_id gnl|my_center|LOCUS_15460 6460 6065 gene locus_tag LOCUS_15470 6460 6065 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143787.1 protein_id gnl|my_center|LOCUS_15470 6687 6457 gene locus_tag LOCUS_15480 6687 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6909 6730 gene locus_tag LOCUS_15490 6909 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence152 1233 175 gene locus_tag LOCUS_15500 1233 175 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 protein_id gnl|my_center|LOCUS_15500 2329 1226 gene locus_tag LOCUS_15510 2329 1226 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_15510 2505 3992 gene locus_tag LOCUS_15520 gene pepA 2505 3992 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_15520 6007 6429 gene locus_tag LOCUS_15530 gene holC 6007 6429 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28905 protein_id gnl|my_center|LOCUS_15530 6476 6904 gene locus_tag LOCUS_15540 6476 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence153 1602 244 gene locus_tag LOCUS_15550 1602 244 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_15550 1925 1656 gene locus_tag LOCUS_15560 gene ptsH 1925 1656 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV2 protein_id gnl|my_center|LOCUS_15560 2782 1925 gene locus_tag LOCUS_15570 2782 1925 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_15570 3454 2996 gene locus_tag LOCUS_15580 3454 2996 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_15580 3779 3468 gene locus_tag LOCUS_15590 3779 3468 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_15590 5417 3912 gene locus_tag LOCUS_15600 gene rpoN 5417 3912 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_15600 5644 6729 gene locus_tag LOCUS_15610 5644 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence154 2794 269 gene locus_tag LOCUS_15620 gene infB 2794 269 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_15620 4314 2821 gene locus_tag LOCUS_15630 gene nusA 4314 2821 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_15630 4915 4457 gene locus_tag LOCUS_15640 gene rimP 4915 4457 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_15640 5200 5124 gene locus_tag LOCUS_t00230 5200 5124 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5372 5286 gene locus_tag LOCUS_t00240 5372 5286 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5844 5419 gene locus_tag LOCUS_15650 gene secG 5844 5419 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_15650 6593 5847 gene locus_tag LOCUS_15660 gene tpiA 6593 5847 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence155 1611 994 gene locus_tag LOCUS_15670 gene atpD 1611 994 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51119 protein_id gnl|my_center|LOCUS_15670 3011 1617 gene locus_tag LOCUS_15680 gene atpB 3011 1617 CDS product V-type ATP synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51120 protein_id gnl|my_center|LOCUS_15680 4114 3107 gene locus_tag LOCUS_15690 gene argF 4114 3107 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LF9 protein_id gnl|my_center|LOCUS_15690 5312 4569 gene locus_tag LOCUS_15700 5312 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5495 6370 gene locus_tag LOCUS_15710 5495 6370 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence156 1015 854 gene locus_tag LOCUS_15720 1015 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1311 1012 gene locus_tag LOCUS_15730 1311 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1597 1292 gene locus_tag LOCUS_15740 1597 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2026 1598 gene locus_tag LOCUS_15750 2026 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2482 2030 gene locus_tag LOCUS_15760 2482 2030 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815672.1 protein_id gnl|my_center|LOCUS_15760 3645 2506 gene locus_tag LOCUS_15770 3645 2506 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097393.1 protein_id gnl|my_center|LOCUS_15770 4361 3663 gene locus_tag LOCUS_15780 4361 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4840 4361 gene locus_tag LOCUS_15790 4840 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5301 4837 gene locus_tag LOCUS_15800 gene gpL 5301 4837 CDS product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815668.1 protein_id gnl|my_center|LOCUS_15800 6106 5405 gene locus_tag LOCUS_15810 6106 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 <6911 6106 gene locus_tag LOCUS_15820 <6911 6106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532901.1:phage capsid protein >Feature sequence157 758 994 gene locus_tag LOCUS_15830 758 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1053 1232 gene locus_tag LOCUS_15840 1053 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2269 1268 gene locus_tag LOCUS_15850 2269 1268 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 protein_id gnl|my_center|LOCUS_15850 2748 4175 gene locus_tag LOCUS_15860 2748 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262683.1 protein_id gnl|my_center|LOCUS_15860 4451 6616 gene locus_tag LOCUS_15870 4451 6616 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence158 679 1647 gene locus_tag LOCUS_15880 679 1647 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771078.1 protein_id gnl|my_center|LOCUS_15880 1999 2817 gene locus_tag LOCUS_15890 1999 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771074.1 protein_id gnl|my_center|LOCUS_15890 3295 4749 gene locus_tag LOCUS_15900 3295 4749 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_15900 6237 5068 gene locus_tag LOCUS_15910 6237 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6695 6273 gene locus_tag LOCUS_15920 6695 6273 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381490.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence159 818 1603 gene locus_tag LOCUS_15930 818 1603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765867.1 protein_id gnl|my_center|LOCUS_15930 1698 2954 gene locus_tag LOCUS_15940 1698 2954 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_15940 3101 4318 gene locus_tag LOCUS_15950 3101 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4698 4372 gene locus_tag LOCUS_15960 4698 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 5464 4847 gene locus_tag LOCUS_15970 5464 4847 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 protein_id gnl|my_center|LOCUS_15970 5564 5415 gene locus_tag LOCUS_15980 5564 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5613 6173 gene locus_tag LOCUS_15990 5613 6173 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_15990 6508 6197 gene locus_tag LOCUS_16000 6508 6197 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266925.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence160 415 867 gene locus_tag LOCUS_16010 415 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 970 1302 gene locus_tag LOCUS_16020 970 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1483 3750 gene locus_tag LOCUS_16030 1483 3750 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 protein_id gnl|my_center|LOCUS_16030 3755 4285 gene locus_tag LOCUS_16040 3755 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5038 5253 gene locus_tag LOCUS_16050 5038 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence161 1095 379 gene locus_tag LOCUS_16060 1095 379 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_16060 1144 1314 gene locus_tag LOCUS_16070 1144 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2503 1430 gene locus_tag LOCUS_16080 2503 1430 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_16080 3048 2500 gene locus_tag LOCUS_16090 3048 2500 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_16090 4303 3140 gene locus_tag LOCUS_16100 4303 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481094.1 protein_id gnl|my_center|LOCUS_16100 4405 5451 gene locus_tag LOCUS_16110 gene purM 4405 5451 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H3 protein_id gnl|my_center|LOCUS_16110 5641 6306 gene locus_tag LOCUS_16120 gene purN 5641 6306 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ91 protein_id gnl|my_center|LOCUS_16120 >Feature sequence162 3375 934 gene locus_tag LOCUS_16130 3375 934 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850310.1 protein_id gnl|my_center|LOCUS_16130 3782 4357 gene locus_tag LOCUS_16140 3782 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231988.2 protein_id gnl|my_center|LOCUS_16140 >Feature sequence163 2401 314 gene locus_tag LOCUS_16150 2401 314 CDS product EscV/YscV/HrcV family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105897.1 protein_id gnl|my_center|LOCUS_16150 2736 2443 gene locus_tag LOCUS_16160 2736 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3174 2749 gene locus_tag LOCUS_16170 3174 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3339 5396 gene locus_tag LOCUS_16180 3339 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5450 5674 gene locus_tag LOCUS_16190 5450 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence164 1641 157 gene locus_tag LOCUS_16200 gene dtpA 1641 157 CDS product dipeptide and tripeptide permease A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77304 protein_id gnl|my_center|LOCUS_16200 4844 2202 gene locus_tag LOCUS_16210 gene ppc 4844 2202 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFU8 protein_id gnl|my_center|LOCUS_16210 5027 5302 gene locus_tag LOCUS_16220 5027 5302 CDS product UPF0381 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44686 protein_id gnl|my_center|LOCUS_16220 >Feature sequence165 1886 135 gene locus_tag LOCUS_16230 1886 135 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399986.1 protein_id gnl|my_center|LOCUS_16230 2184 3173 gene locus_tag LOCUS_16240 2184 3173 CDS product sucrose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706775.1 protein_id gnl|my_center|LOCUS_16240 3268 3978 gene locus_tag LOCUS_16250 3268 3978 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705041.1 protein_id gnl|my_center|LOCUS_16250 4516 4091 gene locus_tag LOCUS_16260 4516 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5108 4773 gene locus_tag LOCUS_16270 5108 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5896 5117 gene locus_tag LOCUS_16280 5896 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5999 6337 gene locus_tag LOCUS_16290 gene glnK 5999 6337 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence166 69 335 gene locus_tag LOCUS_16300 gene rpsT 69 335 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM1 protein_id gnl|my_center|LOCUS_16300 1627 404 gene locus_tag LOCUS_16310 1627 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2053 1754 gene locus_tag LOCUS_16320 2053 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3298 2147 gene locus_tag LOCUS_16330 gene proB 3298 2147 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_16330 4502 3309 gene locus_tag LOCUS_16340 gene obg 4502 3309 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_16340 4842 4585 gene locus_tag LOCUS_16350 gene rpmA 4842 4585 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS9 protein_id gnl|my_center|LOCUS_16350 5252 4941 gene locus_tag LOCUS_16360 gene rplU 5252 4941 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL6 protein_id gnl|my_center|LOCUS_16360 5652 6428 gene locus_tag LOCUS_16370 5652 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence167 2616 1891 gene locus_tag LOCUS_16380 2616 1891 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_16380 3682 2816 gene locus_tag LOCUS_16390 gene metF 3682 2816 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I687 protein_id gnl|my_center|LOCUS_16390 5086 3689 gene locus_tag LOCUS_16400 gene ahcY 5086 3689 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I685 protein_id gnl|my_center|LOCUS_16400 5304 6227 gene locus_tag LOCUS_16410 5304 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence168 1048 179 gene locus_tag LOCUS_16420 1048 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2320 1472 gene locus_tag LOCUS_16430 2320 1472 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_16430 3744 2458 gene locus_tag LOCUS_16440 3744 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4588 3800 gene locus_tag LOCUS_16450 gene phhA 4588 3800 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43334 protein_id gnl|my_center|LOCUS_16450 6033 4957 gene locus_tag LOCUS_16460 6033 4957 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709497.1 protein_id gnl|my_center|LOCUS_16460 6217 6693 gene locus_tag LOCUS_16470 6217 6693 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266276.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence169 2 1237 gene locus_tag LOCUS_16480 2 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707203.1 protein_id gnl|my_center|LOCUS_16480 1572 4640 gene locus_tag LOCUS_16490 1572 4640 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_16490 4637 5731 gene locus_tag LOCUS_16500 4637 5731 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_16500 6124 5717 gene locus_tag LOCUS_16510 6124 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence170 1160 930 gene locus_tag LOCUS_16520 1160 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5111 1215 gene locus_tag LOCUS_16530 5111 1215 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 protein_id gnl|my_center|LOCUS_16530 <6633 5168 gene locus_tag LOCUS_16540 <6633 5168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091643.1:long-chain-fatty-acid--CoA ligase >Feature sequence171 659 366 gene locus_tag LOCUS_16550 659 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1159 656 gene locus_tag LOCUS_16560 1159 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072887.1 protein_id gnl|my_center|LOCUS_16560 1591 1160 gene locus_tag LOCUS_16570 1591 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2361 1591 gene locus_tag LOCUS_16580 2361 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3253 2258 gene locus_tag LOCUS_16590 3253 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4032 3250 gene locus_tag LOCUS_16600 4032 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4303 4067 gene locus_tag LOCUS_16610 4303 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4521 4901 gene locus_tag LOCUS_16620 4521 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4923 5630 gene locus_tag LOCUS_16630 4923 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 6063 5815 gene locus_tag LOCUS_16640 6063 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6258 6488 gene locus_tag LOCUS_16650 6258 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence172 1505 2569 gene locus_tag LOCUS_16660 1505 2569 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456654.1 protein_id gnl|my_center|LOCUS_16660 2989 4503 gene locus_tag LOCUS_16670 2989 4503 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence173 1595 945 gene locus_tag LOCUS_16680 gene bscL 1595 945 CDS product type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930820.1 protein_id gnl|my_center|LOCUS_16680 2266 1574 gene locus_tag LOCUS_16690 2266 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 3086 2253 gene locus_tag LOCUS_16700 gene pscJ 3086 2253 CDS product type III export protein PscJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120329.1 protein_id gnl|my_center|LOCUS_16700 3636 3199 gene locus_tag LOCUS_16710 3636 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4119 3748 gene locus_tag LOCUS_16720 4119 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4454 4116 gene locus_tag LOCUS_16730 4454 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 5457 4447 gene locus_tag LOCUS_16740 5457 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence174 <1 1239 gene locus_tag LOCUS_16750 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072001.1:3-methylcrotonyl-CoA carboxylase subunit alpha 1229 2146 gene locus_tag LOCUS_16760 gene liuE 1229 2146 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 protein_id gnl|my_center|LOCUS_16760 2161 4107 gene locus_tag LOCUS_16770 2161 4107 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence175 913 134 gene locus_tag LOCUS_16780 913 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 993 2759 gene locus_tag LOCUS_16790 993 2759 CDS product helicase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231273.2 protein_id gnl|my_center|LOCUS_16790 2870 3547 gene locus_tag LOCUS_16800 2870 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704238.1 protein_id gnl|my_center|LOCUS_16800 3963 3544 gene locus_tag LOCUS_16810 3963 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5113 4196 gene locus_tag LOCUS_16820 gene glsA 5113 4196 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7S8 protein_id gnl|my_center|LOCUS_16820 5323 5619 gene locus_tag LOCUS_16830 5323 5619 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 protein_id gnl|my_center|LOCUS_16830 5679 5873 gene locus_tag LOCUS_16840 5679 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 5866 6081 gene locus_tag LOCUS_16850 5866 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence176 4312 2936 gene locus_tag LOCUS_16860 gene sdaA 4312 2936 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_16860 4868 4569 gene locus_tag LOCUS_16870 4868 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5177 4971 gene locus_tag LOCUS_16880 5177 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16880 5274 5501 gene locus_tag LOCUS_16890 5274 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 5799 6359 gene locus_tag LOCUS_16900 5799 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence177 235 780 gene locus_tag LOCUS_16910 235 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1622 846 gene locus_tag LOCUS_16920 1622 846 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z2 protein_id gnl|my_center|LOCUS_16920 2177 1776 gene locus_tag LOCUS_16930 2177 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2321 3352 gene locus_tag LOCUS_16940 gene bioB 2321 3352 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I618 protein_id gnl|my_center|LOCUS_16940 3360 4523 gene locus_tag LOCUS_16950 gene bioF 3360 4523 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA9 protein_id gnl|my_center|LOCUS_16950 5905 4550 gene locus_tag LOCUS_16960 gene gdhA 5905 4550 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_16960 >Feature sequence178 705 1010 gene locus_tag LOCUS_16970 705 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1126 2016 gene locus_tag LOCUS_16980 1126 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2595 1984 gene locus_tag LOCUS_16990 gene ubiX 2595 1984 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_16990 4233 2875 gene locus_tag LOCUS_17000 gene mpl 4233 2875 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYS2 protein_id gnl|my_center|LOCUS_17000 4412 5683 gene locus_tag LOCUS_17010 gene pfp 4412 5683 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_17010 6377 5949 gene locus_tag LOCUS_17020 6377 5949 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence179 2466 643 gene locus_tag LOCUS_17030 2466 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2818 2612 gene locus_tag LOCUS_17040 gene yacG 2818 2612 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP7 protein_id gnl|my_center|LOCUS_17040 3739 2873 gene locus_tag LOCUS_17050 gene bamD 3739 2873 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_17050 3936 4892 gene locus_tag LOCUS_17060 gene rluD 3936 4892 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_17060 4895 5656 gene locus_tag LOCUS_17070 4895 5656 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_17070 6260 5682 gene locus_tag LOCUS_17080 6260 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence180 428 652 gene locus_tag LOCUS_17090 428 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 901 2046 gene locus_tag LOCUS_17100 gene metX 901 2046 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57714 protein_id gnl|my_center|LOCUS_17100 2043 2651 gene locus_tag LOCUS_17110 2043 2651 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_17110 2651 3133 gene locus_tag LOCUS_17120 2651 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_17120 3138 3794 gene locus_tag LOCUS_17130 3138 3794 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUQ9 protein_id gnl|my_center|LOCUS_17130 3870 4436 gene locus_tag LOCUS_17140 3870 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4612 5649 gene locus_tag LOCUS_17150 4612 5649 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_17150 5651 5977 gene locus_tag LOCUS_17160 5651 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5994 6206 gene locus_tag LOCUS_17170 5994 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence181 507 1223 gene locus_tag LOCUS_17180 507 1223 CDS product high-affinity branched-chain amino acid transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSW1 protein_id gnl|my_center|LOCUS_17180 2030 1548 gene locus_tag LOCUS_17190 2030 1548 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974551.1 protein_id gnl|my_center|LOCUS_17190 2172 6407 gene locus_tag LOCUS_17200 2172 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence182 1604 1005 gene locus_tag LOCUS_17210 gene recR 1604 1005 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H9 protein_id gnl|my_center|LOCUS_17210 2093 1767 gene locus_tag LOCUS_17220 2093 1767 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_17220 4152 2176 gene locus_tag LOCUS_17230 gene dnaX 4152 2176 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_17230 5106 4552 gene locus_tag LOCUS_17240 5106 4552 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094926.1 protein_id gnl|my_center|LOCUS_17240 <6404 5372 gene locus_tag LOCUS_17250 <6404 5372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CM62:nicotinate phosphoribosyltransferase >Feature sequence183 1208 336 gene locus_tag LOCUS_17260 1208 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2788 1238 gene locus_tag LOCUS_17270 gene leuA 2788 1238 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_17270 3150 3740 gene locus_tag LOCUS_17280 3150 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 4728 3706 gene locus_tag LOCUS_17290 gene hemH 4728 3706 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888A2 protein_id gnl|my_center|LOCUS_17290 6043 4862 gene locus_tag LOCUS_17300 gene nhaA 6043 4862 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG33 protein_id gnl|my_center|LOCUS_17300 >Feature sequence184 151 76 gene locus_tag LOCUS_t00250 151 76 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 553 1221 gene locus_tag LOCUS_17310 553 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1286 3061 gene locus_tag LOCUS_17320 1286 3061 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_17320 4501 3146 gene locus_tag LOCUS_17330 4501 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4685 5443 gene locus_tag LOCUS_17340 4685 5443 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N0 protein_id gnl|my_center|LOCUS_17340 5504 6229 gene locus_tag LOCUS_17350 5504 6229 CDS product branched-chain amino acid efflux pump permease component 1 AzlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence185 276 1001 gene locus_tag LOCUS_17360 276 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1157 1801 gene locus_tag LOCUS_17370 1157 1801 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_17370 4649 2400 gene locus_tag LOCUS_17380 gene parC 4649 2400 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH6 protein_id gnl|my_center|LOCUS_17380 5000 4701 gene locus_tag LOCUS_17390 5000 4701 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175590.1 protein_id gnl|my_center|LOCUS_17390 6084 5383 gene locus_tag LOCUS_17400 gene endA 6084 5383 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261220.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence186 824 138 gene locus_tag LOCUS_17410 gene ubiE 824 138 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT98 protein_id gnl|my_center|LOCUS_17410 1358 993 gene locus_tag LOCUS_17420 1358 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_17420 1503 2624 gene locus_tag LOCUS_17430 1503 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4012 2675 gene locus_tag LOCUS_17440 gene hslU 4012 2675 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_17440 4577 4032 gene locus_tag LOCUS_17450 gene hslV 4577 4032 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A95 protein_id gnl|my_center|LOCUS_17450 5207 4689 gene locus_tag LOCUS_17460 5207 4689 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence187 152 994 gene locus_tag LOCUS_17470 152 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2379 1024 gene locus_tag LOCUS_17480 gene cbrB 2379 1024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_17480 5713 2666 gene locus_tag LOCUS_17490 5713 2666 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246100.1 protein_id gnl|my_center|LOCUS_17490 5894 5703 gene locus_tag LOCUS_17500 5894 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence188 298 579 gene locus_tag LOCUS_17510 298 579 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480677.1 protein_id gnl|my_center|LOCUS_17510 1765 644 gene locus_tag LOCUS_17520 gene ald 1765 644 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_17520 2078 2269 gene locus_tag LOCUS_17530 2078 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2327 2740 gene locus_tag LOCUS_17540 2327 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2694 3260 gene locus_tag LOCUS_17550 2694 3260 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_17550 3763 3326 gene locus_tag LOCUS_17560 3763 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3960 4511 gene locus_tag LOCUS_17570 3960 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4593 5207 gene locus_tag LOCUS_17580 4593 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 protein_id gnl|my_center|LOCUS_17580 6313 5204 gene locus_tag LOCUS_17590 6313 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence189 461 1387 gene locus_tag LOCUS_17600 461 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2426 1419 gene locus_tag LOCUS_17610 gene ruvB 2426 1419 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL1 protein_id gnl|my_center|LOCUS_17610 2588 3478 gene locus_tag LOCUS_17620 2588 3478 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_17620 3555 3965 gene locus_tag LOCUS_17630 3555 3965 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_17630 4026 4706 gene locus_tag LOCUS_17640 gene tolQ 4026 4706 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_17640 4723 5160 gene locus_tag LOCUS_17650 gene tolR 4723 5160 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_17650 5161 6000 gene locus_tag LOCUS_17660 5161 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence190 399 130 gene locus_tag LOCUS_17670 399 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4159 494 gene locus_tag LOCUS_17680 4159 494 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJB4 protein_id gnl|my_center|LOCUS_17680 4329 4802 gene locus_tag LOCUS_17690 gene putR 4329 4802 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313921.1 protein_id gnl|my_center|LOCUS_17690 5920 4826 gene locus_tag LOCUS_17700 5920 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence191 849 49 gene locus_tag LOCUS_17710 849 49 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 protein_id gnl|my_center|LOCUS_17710 883 1434 gene locus_tag LOCUS_17720 883 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1447 1959 gene locus_tag LOCUS_17730 1447 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2574 2182 gene locus_tag LOCUS_17740 2574 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 protein_id gnl|my_center|LOCUS_17740 2726 3340 gene locus_tag LOCUS_17750 2726 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4986 3337 gene locus_tag LOCUS_17760 4986 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 6075 5068 gene locus_tag LOCUS_17770 6075 5068 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_17770 >Feature sequence192 1909 749 gene locus_tag LOCUS_17780 1909 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 4159 1979 gene locus_tag LOCUS_17790 gene glgB 4159 1979 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP85 protein_id gnl|my_center|LOCUS_17790 4500 5738 gene locus_tag LOCUS_17800 gene malE 4500 5738 CDS product maltose ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence193 1600 1265 gene locus_tag LOCUS_17810 1600 1265 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_17810 2785 1670 gene locus_tag LOCUS_17820 gene tgt 2785 1670 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 protein_id gnl|my_center|LOCUS_17820 3853 2822 gene locus_tag LOCUS_17830 gene queA 3853 2822 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_17830 6044 3996 gene locus_tag LOCUS_17840 6044 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence194 580 843 gene locus_tag LOCUS_17850 gene tusA 580 843 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE8 protein_id gnl|my_center|LOCUS_17850 1162 3114 gene locus_tag LOCUS_17860 1162 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3151 3432 gene locus_tag LOCUS_17870 3151 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5462 3435 gene locus_tag LOCUS_17880 5462 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6009 5446 gene locus_tag LOCUS_17890 6009 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence195 1126 89 gene locus_tag LOCUS_17900 1126 89 CDS product bifunctional PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478424.1 protein_id gnl|my_center|LOCUS_17900 1319 2320 gene locus_tag LOCUS_17910 gene fruR 1319 2320 CDS product DNA-binding transcriptional regulator FruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706191.1 protein_id gnl|my_center|LOCUS_17910 2555 4084 gene locus_tag LOCUS_17920 2555 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4258 5883 gene locus_tag LOCUS_17930 4258 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence196 1092 2126 gene locus_tag LOCUS_17940 gene oprF 1092 2126 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382460.1 protein_id gnl|my_center|LOCUS_17940 3007 2414 gene locus_tag LOCUS_17950 gene ribA 3007 2414 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q3 protein_id gnl|my_center|LOCUS_17950 3563 3090 gene locus_tag LOCUS_17960 gene pgpA 3563 3090 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_17960 4560 3580 gene locus_tag LOCUS_17970 gene thiL 4560 3580 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSL2 protein_id gnl|my_center|LOCUS_17970 5068 4655 gene locus_tag LOCUS_17980 gene nusB 5068 4655 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_17980 5543 5070 gene locus_tag LOCUS_17990 gene ribH1 5543 5070 CDS product 6,7-dimethyl-8-ribityllumazine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q6 protein_id gnl|my_center|LOCUS_17990 <6172 5630 gene locus_tag LOCUS_18000 <6172 5630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWX4:3,4-dihydroxy-2-butanone 4-phosphate synthase >Feature sequence197 <1 2379 gene locus_tag LOCUS_18010 <1 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXW7:glycerol-3-phosphate acyltransferase 3158 2376 gene locus_tag LOCUS_18020 gene rsmJ 3158 2376 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_18020 3403 3663 gene locus_tag LOCUS_18030 3403 3663 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_18030 3713 5449 gene locus_tag LOCUS_18040 3713 5449 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence198 275 1225 gene locus_tag LOCUS_18050 275 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1373 3025 gene locus_tag LOCUS_18060 gene pstA 1373 3025 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_18060 3055 3972 gene locus_tag LOCUS_18070 gene pstB 3055 3972 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_18070 3972 4694 gene locus_tag LOCUS_18080 gene phoU 3972 4694 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_18080 4859 6058 gene locus_tag LOCUS_18090 4859 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence199 404 1777 gene locus_tag LOCUS_18100 404 1777 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263456.1 protein_id gnl|my_center|LOCUS_18100 2815 2030 gene locus_tag LOCUS_18110 gene traT 2815 2030 CDS product conjugal transfer protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602147.1 protein_id gnl|my_center|LOCUS_18110 3110 4171 gene locus_tag LOCUS_18120 gene oprF 3110 4171 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382460.1 protein_id gnl|my_center|LOCUS_18120 5495 4221 gene locus_tag LOCUS_18130 5495 4221 CDS product UPF0597 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH28 protein_id gnl|my_center|LOCUS_18130 6046 5937 gene locus_tag LOCUS_r00010 6046 5937 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence200 <1 896 gene locus_tag LOCUS_18140 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQI5:arginine--tRNA ligase 1357 2769 gene locus_tag LOCUS_18150 1357 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3290 2853 gene locus_tag LOCUS_18160 gene dtd 3290 2853 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX9 protein_id gnl|my_center|LOCUS_18160 4269 3310 gene locus_tag LOCUS_18170 gene pip 4269 3310 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UX8 protein_id gnl|my_center|LOCUS_18170 4436 4759 gene locus_tag LOCUS_18180 4436 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 <6116 4873 gene locus_tag LOCUS_18190 <6116 4873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096009.1:GTP-binding protein TypA >Feature sequence201 158 487 gene locus_tag LOCUS_18200 158 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 484 1131 gene locus_tag LOCUS_18210 484 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2253 1144 gene locus_tag LOCUS_18220 gene alr 2253 1144 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4R0 protein_id gnl|my_center|LOCUS_18220 3529 2534 gene locus_tag LOCUS_18230 gene ycjF 3529 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263200.1 protein_id gnl|my_center|LOCUS_18230 4905 3526 gene locus_tag LOCUS_18240 4905 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence202 327 1304 gene locus_tag LOCUS_18250 gene ispB 327 1304 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_18250 1439 3019 gene locus_tag LOCUS_18260 gene prfC 1439 3019 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_18260 3332 4528 gene locus_tag LOCUS_18270 3332 4528 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707543.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence203 17 289 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccctgcgcccgcagggatgaaccg 966 343 gene locus_tag LOCUS_18280 966 343 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153584.1 protein_id gnl|my_center|LOCUS_18280 2029 944 gene locus_tag LOCUS_18290 gene tqsA 2029 944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_18290 2151 3584 gene locus_tag LOCUS_18300 2151 3584 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173586.1 protein_id gnl|my_center|LOCUS_18300 3556 4206 gene locus_tag LOCUS_18310 3556 4206 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891166.1 protein_id gnl|my_center|LOCUS_18310 4199 5089 gene locus_tag LOCUS_18320 4199 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5118 5768 gene locus_tag LOCUS_18330 5118 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence204 192 2483 gene locus_tag LOCUS_18340 192 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2677 3855 gene locus_tag LOCUS_18350 2677 3855 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263014.1 protein_id gnl|my_center|LOCUS_18350 3901 4413 gene locus_tag LOCUS_18360 gene yhbS 3901 4413 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence205 753 1865 gene locus_tag LOCUS_18370 753 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2098 1862 gene locus_tag LOCUS_18380 2098 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2387 5902 gene locus_tag LOCUS_18390 2387 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence206 248 514 gene locus_tag LOCUS_18400 248 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1887 562 gene locus_tag LOCUS_18410 1887 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2503 2099 gene locus_tag LOCUS_18420 2503 2099 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TD9 protein_id gnl|my_center|LOCUS_18420 3149 2496 gene locus_tag LOCUS_18430 3149 2496 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_18430 3212 3772 gene locus_tag LOCUS_18440 3212 3772 CDS product ADP-ribose diphosphatase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_18440 3760 4608 gene locus_tag LOCUS_18450 3760 4608 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_18450 4998 4612 gene locus_tag LOCUS_18460 4998 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385036.1 protein_id gnl|my_center|LOCUS_18460 5265 5735 gene locus_tag LOCUS_18470 5265 5735 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence207 202 1602 gene locus_tag LOCUS_18480 202 1602 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_18480 1606 2889 gene locus_tag LOCUS_18490 1606 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_18490 3050 5698 gene locus_tag LOCUS_18500 3050 5698 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence208 529 795 gene locus_tag LOCUS_18510 529 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528043.1 protein_id gnl|my_center|LOCUS_18510 1515 868 gene locus_tag LOCUS_18520 gene narL 1515 868 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_18520 3262 1508 gene locus_tag LOCUS_18530 gene narX 3262 1508 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD66 protein_id gnl|my_center|LOCUS_18530 3708 4049 gene locus_tag LOCUS_18540 3708 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4049 4309 gene locus_tag LOCUS_18550 4049 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence209 1684 911 gene locus_tag LOCUS_18560 gene yfcA 1684 911 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJB3 protein_id gnl|my_center|LOCUS_18560 2509 2985 gene locus_tag LOCUS_18570 2509 2985 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_18570 3164 3090 gene locus_tag LOCUS_t00260 3164 3090 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3266 3190 gene locus_tag LOCUS_t00270 3266 3190 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4231 3887 gene locus_tag LOCUS_18580 4231 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4643 4341 gene locus_tag LOCUS_18590 4643 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 5165 4689 gene locus_tag LOCUS_18600 5165 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 5301 5510 gene locus_tag LOCUS_18610 5301 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence210 2504 219 gene locus_tag LOCUS_18620 2504 219 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_18620 2925 3782 gene locus_tag LOCUS_18630 2925 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 3785 4234 gene locus_tag LOCUS_18640 3785 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 5162 4299 gene locus_tag LOCUS_18650 5162 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence211 442 119 gene locus_tag LOCUS_18660 442 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2993 813 gene locus_tag LOCUS_18670 gene uvrD 2993 813 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_18670 3121 3687 gene locus_tag LOCUS_18680 3121 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3816 3992 gene locus_tag LOCUS_18690 3816 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4839 4090 gene locus_tag LOCUS_18700 4839 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence212 1023 256 gene locus_tag LOCUS_18710 gene gspN 1023 256 CDS product type II secretion protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704549.1 protein_id gnl|my_center|LOCUS_18710 1538 1020 gene locus_tag LOCUS_18720 gene epsM 1538 1020 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41851 protein_id gnl|my_center|LOCUS_18720 2701 1535 gene locus_tag LOCUS_18730 gene gspL 2701 1535 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT4 protein_id gnl|my_center|LOCUS_18730 3910 2915 gene locus_tag LOCUS_18740 gene gspK 3910 2915 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT3 protein_id gnl|my_center|LOCUS_18740 4508 3897 gene locus_tag LOCUS_18750 gene gspJ 4508 3897 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704545.1 protein_id gnl|my_center|LOCUS_18750 5119 4745 gene locus_tag LOCUS_18760 gene gspI 5119 4745 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 protein_id gnl|my_center|LOCUS_18760 5696 5103 gene locus_tag LOCUS_18770 gene gspH 5696 5103 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence213 902 327 gene locus_tag LOCUS_18780 902 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1940 915 gene locus_tag LOCUS_18790 gene msrP 1940 915 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_18790 2131 2373 gene locus_tag LOCUS_18800 2131 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3687 2431 gene locus_tag LOCUS_18810 3687 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4005 4250 gene locus_tag LOCUS_18820 4005 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263313.1 protein_id gnl|my_center|LOCUS_18820 4721 4407 gene locus_tag LOCUS_18830 4721 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5527 4784 gene locus_tag LOCUS_18840 5527 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence214 916 116 gene locus_tag LOCUS_18850 916 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2757 913 gene locus_tag LOCUS_18860 2757 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4425 2764 gene locus_tag LOCUS_18870 4425 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 5162 4422 gene locus_tag LOCUS_18880 5162 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18880 5453 5205 gene locus_tag LOCUS_18890 5453 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence215 1168 230 gene locus_tag LOCUS_18900 gene xerC 1168 230 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_18900 1890 1165 gene locus_tag LOCUS_18910 1890 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_18910 2768 1887 gene locus_tag LOCUS_18920 gene dapF 2768 1887 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_18920 3996 2740 gene locus_tag LOCUS_18930 gene lysA 3996 2740 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_18930 4647 4243 gene locus_tag LOCUS_18940 gene mvpA 4647 4243 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV79 protein_id gnl|my_center|LOCUS_18940 4877 4647 gene locus_tag LOCUS_18950 4877 4647 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970129.1 protein_id gnl|my_center|LOCUS_18950 4876 5322 gene locus_tag LOCUS_18960 4876 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence216 5452 5051 gene locus_tag LOCUS_18970 5452 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence217 1522 23 gene locus_tag LOCUS_18980 gene der 1522 23 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 protein_id gnl|my_center|LOCUS_18980 2788 1607 gene locus_tag LOCUS_18990 gene bamB 2788 1607 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_18990 3495 2806 gene locus_tag LOCUS_19000 3495 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 protein_id gnl|my_center|LOCUS_19000 4794 3499 gene locus_tag LOCUS_19010 gene hisS 4794 3499 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX0 protein_id gnl|my_center|LOCUS_19010 5621 4953 gene locus_tag LOCUS_19020 5621 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence218 1562 93 gene locus_tag LOCUS_19030 1562 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1537 1743 gene locus_tag LOCUS_19040 1537 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1913 2923 gene locus_tag LOCUS_19050 gene glpX 1913 2923 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNB6 protein_id gnl|my_center|LOCUS_19050 3254 3520 gene locus_tag LOCUS_19060 3254 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368982.1 protein_id gnl|my_center|LOCUS_19060 3610 4167 gene locus_tag LOCUS_19070 3610 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4174 4911 gene locus_tag LOCUS_19080 4174 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 5050 5310 gene locus_tag LOCUS_19090 5050 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence219 1584 490 gene locus_tag LOCUS_19100 1584 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2571 2371 gene locus_tag LOCUS_19110 2571 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2916 3851 gene locus_tag LOCUS_19120 2916 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4138 3842 gene locus_tag LOCUS_19130 4138 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5011 4250 gene locus_tag LOCUS_19140 gene fabG 5011 4250 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268829.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence220 1641 223 gene locus_tag LOCUS_19150 1641 223 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HP2 protein_id gnl|my_center|LOCUS_19150 3226 1685 gene locus_tag LOCUS_19160 gene pntA 3226 1685 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6X5 protein_id gnl|my_center|LOCUS_19160 3937 5367 gene locus_tag LOCUS_19170 3937 5367 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_19170 >Feature sequence221 <1 616 gene locus_tag LOCUS_19180 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000801254.1:SAM-dependent methyltransferase 633 1070 gene locus_tag LOCUS_19190 gene rnhA 633 1070 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_19190 1084 1803 gene locus_tag LOCUS_19200 gene dnaQ 1084 1803 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_19200 1899 2669 gene locus_tag LOCUS_19210 1899 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2759 3481 gene locus_tag LOCUS_19220 gene nudC 2759 3481 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDZ8 protein_id gnl|my_center|LOCUS_19220 3914 3591 gene locus_tag LOCUS_19230 3914 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_19230 4097 5146 gene locus_tag LOCUS_19240 4097 5146 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence222 1184 3091 gene locus_tag LOCUS_19250 1184 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence223 835 1692 gene locus_tag LOCUS_19260 gene tauD 835 1692 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_19260 1818 2993 gene locus_tag LOCUS_19270 1818 2993 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_19270 3047 4216 gene locus_tag LOCUS_19280 gene ivdC 3047 4216 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_19280 4219 4998 gene locus_tag LOCUS_19290 4219 4998 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483360.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence224 2549 1458 gene locus_tag LOCUS_19300 gene rfbB 2549 1458 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_19300 3519 2650 gene locus_tag LOCUS_19310 gene rfbD 3519 2650 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_19310 4109 3516 gene locus_tag LOCUS_19320 4109 3516 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946493.1 protein_id gnl|my_center|LOCUS_19320 5049 4126 gene locus_tag LOCUS_19330 gene rfbA 5049 4126 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMQ5 protein_id gnl|my_center|LOCUS_19330 >Feature sequence225 1371 1613 gene locus_tag LOCUS_19340 gene rpsP 1371 1613 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 protein_id gnl|my_center|LOCUS_19340 1627 2178 gene locus_tag LOCUS_19350 gene rimM 1627 2178 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_19350 2179 3009 gene locus_tag LOCUS_19360 gene trmD 2179 3009 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZ16 protein_id gnl|my_center|LOCUS_19360 3054 3407 gene locus_tag LOCUS_19370 gene rplS 3054 3407 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_19370 3561 4448 gene locus_tag LOCUS_19380 gene xerD 3561 4448 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886U8 protein_id gnl|my_center|LOCUS_19380 5382 4399 gene locus_tag LOCUS_19390 gene yidZ 5382 4399 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260920.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence226 935 126 gene locus_tag LOCUS_19400 gene rpsB 935 126 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_19400 1314 2108 gene locus_tag LOCUS_19410 gene map 1314 2108 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS9 protein_id gnl|my_center|LOCUS_19410 2340 5048 gene locus_tag LOCUS_19420 gene glnD 2340 5048 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_19420 >Feature sequence227 335 1252 gene locus_tag LOCUS_19430 335 1252 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403882.1 protein_id gnl|my_center|LOCUS_19430 1489 1217 gene locus_tag LOCUS_19440 1489 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2429 1575 gene locus_tag LOCUS_19450 gene purU1 2429 1575 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 protein_id gnl|my_center|LOCUS_19450 2898 2545 gene locus_tag LOCUS_19460 2898 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3548 2943 gene locus_tag LOCUS_19470 3548 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4152 3541 gene locus_tag LOCUS_19480 4152 3541 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707476.1 protein_id gnl|my_center|LOCUS_19480 4718 4149 gene locus_tag LOCUS_19490 4718 4149 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717524.1 protein_id gnl|my_center|LOCUS_19490 5166 5038 gene locus_tag LOCUS_19500 5166 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence228 1056 169 gene locus_tag LOCUS_19510 1056 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1551 1090 gene locus_tag LOCUS_19520 1551 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2127 1666 gene locus_tag LOCUS_19530 2127 1666 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262849.1 protein_id gnl|my_center|LOCUS_19530 4310 2202 gene locus_tag LOCUS_19540 4310 2202 CDS product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 protein_id gnl|my_center|LOCUS_19540 4930 4556 gene locus_tag LOCUS_19550 4930 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence229 511 1188 gene locus_tag LOCUS_19560 511 1188 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMI1 protein_id gnl|my_center|LOCUS_19560 1479 2180 gene locus_tag LOCUS_19570 gene gph 1479 2180 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_19570 2204 2551 gene locus_tag LOCUS_19580 2204 2551 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881844.1 protein_id gnl|my_center|LOCUS_19580 2563 3600 gene locus_tag LOCUS_19590 gene dapD 2563 3600 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_19590 4216 3659 gene locus_tag LOCUS_19600 4216 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 <5521 4366 gene locus_tag LOCUS_19610 <5521 4366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481584.1:MATE family efflux transporter >Feature sequence230 <1 598 gene locus_tag LOCUS_19620 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227089.1:alanine-phosphoribitol ligase 1946 795 gene locus_tag LOCUS_19630 gene galK 1946 795 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQH8 protein_id gnl|my_center|LOCUS_19630 3005 1971 gene locus_tag LOCUS_19640 3005 1971 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKY1 protein_id gnl|my_center|LOCUS_19640 4239 3223 gene locus_tag LOCUS_19650 gene galE-1 4239 3223 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_19650 4420 5307 gene locus_tag LOCUS_19660 4420 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence231 464 883 gene locus_tag LOCUS_19670 464 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2428 857 gene locus_tag LOCUS_19680 2428 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3416 2715 gene locus_tag LOCUS_19690 3416 2715 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PTX7 protein_id gnl|my_center|LOCUS_19690 4231 3413 gene locus_tag LOCUS_19700 gene mazG 4231 3413 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_19700 <5435 4250 gene locus_tag LOCUS_19710 <5435 4250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086042.1:GTP pyrophosphokinase >Feature sequence232 278 1546 gene locus_tag LOCUS_19720 278 1546 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 protein_id gnl|my_center|LOCUS_19720 1640 1834 gene locus_tag LOCUS_19730 1640 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2561 1851 gene locus_tag LOCUS_19740 2561 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_19740 2764 3180 gene locus_tag LOCUS_19750 2764 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3401 4165 gene locus_tag LOCUS_19760 3401 4165 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160484.1 protein_id gnl|my_center|LOCUS_19760 4450 4262 gene locus_tag LOCUS_19770 4450 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5216 4386 gene locus_tag LOCUS_19780 5216 4386 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261914.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence233 412 83 gene locus_tag LOCUS_19790 412 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2079 409 gene locus_tag LOCUS_19800 gene ilvG 2079 409 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XAV4 protein_id gnl|my_center|LOCUS_19800 3964 2633 gene locus_tag LOCUS_19810 3964 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261111.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence234 2459 48 gene locus_tag LOCUS_19820 gene ftsK 2459 48 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U1 protein_id gnl|my_center|LOCUS_19820 3003 3455 gene locus_tag LOCUS_19830 3003 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence235 2023 818 gene locus_tag LOCUS_19840 2023 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2463 5099 gene locus_tag LOCUS_19850 2463 5099 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918425.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence236 140 292 gene locus_tag LOCUS_19860 140 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 834 334 gene locus_tag LOCUS_19870 834 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1810 842 gene locus_tag LOCUS_19880 gene hutG 1810 842 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF85 protein_id gnl|my_center|LOCUS_19880 3090 1807 gene locus_tag LOCUS_19890 gene hutI 3090 1807 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU91 protein_id gnl|my_center|LOCUS_19890 3225 4925 gene locus_tag LOCUS_19900 gene hutU 3225 4925 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ5 protein_id gnl|my_center|LOCUS_19900 >Feature sequence237 60 1478 gene locus_tag LOCUS_19910 60 1478 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945903.1 protein_id gnl|my_center|LOCUS_19910 1525 1986 gene locus_tag LOCUS_19920 1525 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3607 2048 gene locus_tag LOCUS_19930 3607 2048 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_19930 4886 3600 gene locus_tag LOCUS_19940 4886 3600 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V0 protein_id gnl|my_center|LOCUS_19940 >Feature sequence238 544 308 gene locus_tag LOCUS_19950 544 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1250 624 gene locus_tag LOCUS_19960 gene upp 1250 624 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKZ8 protein_id gnl|my_center|LOCUS_19960 1605 2162 gene locus_tag LOCUS_19970 1605 2162 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_19970 2978 2211 gene locus_tag LOCUS_19980 2978 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3528 3208 gene locus_tag LOCUS_19990 3528 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4269 3643 gene locus_tag LOCUS_20000 4269 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5244 4360 gene locus_tag LOCUS_20010 5244 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence239 361 83 gene locus_tag LOCUS_20020 361 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 553 963 gene locus_tag LOCUS_20030 gene merR-2 553 963 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640387.1 protein_id gnl|my_center|LOCUS_20030 960 1616 gene locus_tag LOCUS_20040 960 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1730 2293 gene locus_tag LOCUS_20050 1730 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2811 2290 gene locus_tag LOCUS_20060 2811 2290 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_20060 3084 2812 gene locus_tag LOCUS_20070 3084 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015870.1 protein_id gnl|my_center|LOCUS_20070 3293 4669 gene locus_tag LOCUS_20080 3293 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence240 1769 240 gene locus_tag LOCUS_20090 1769 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2544 1984 gene locus_tag LOCUS_20100 2544 1984 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_20100 3397 2573 gene locus_tag LOCUS_20110 gene queF 3397 2573 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I037 protein_id gnl|my_center|LOCUS_20110 4199 3399 gene locus_tag LOCUS_20120 4199 3399 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUD2 protein_id gnl|my_center|LOCUS_20120 5116 4196 gene locus_tag LOCUS_20130 5116 4196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence241 2846 1971 gene locus_tag LOCUS_20140 2846 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3913 2846 gene locus_tag LOCUS_20150 3913 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence242 1045 803 gene locus_tag LOCUS_20160 gene tusA 1045 803 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_20160 2419 1073 gene locus_tag LOCUS_20170 gene dinF 2419 1073 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262808.1 protein_id gnl|my_center|LOCUS_20170 2914 2573 gene locus_tag LOCUS_20180 2914 2573 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_20180 3791 4399 gene locus_tag LOCUS_20190 3791 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4686 4483 gene locus_tag LOCUS_20200 4686 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5122 4691 gene locus_tag LOCUS_20210 5122 4691 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence243 1459 443 gene locus_tag LOCUS_20220 gene melR 1459 443 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106992.1 protein_id gnl|my_center|LOCUS_20220 2150 3493 gene locus_tag LOCUS_20230 gene lamB 2150 3493 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUY4 protein_id gnl|my_center|LOCUS_20230 3799 5292 gene locus_tag LOCUS_20240 3799 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence244 783 205 gene locus_tag LOCUS_20250 gene maf-1 783 205 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG2 protein_id gnl|my_center|LOCUS_20250 933 1505 gene locus_tag LOCUS_20260 933 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_20260 1540 1722 gene locus_tag LOCUS_20270 gene rpmF 1540 1722 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_20270 1956 2792 gene locus_tag LOCUS_20280 gene plsX 1956 2792 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX9 protein_id gnl|my_center|LOCUS_20280 2947 3885 gene locus_tag LOCUS_20290 2947 3885 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV77 protein_id gnl|my_center|LOCUS_20290 3887 4636 gene locus_tag LOCUS_20300 gene fabG 3887 4636 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770626.1 protein_id gnl|my_center|LOCUS_20300 4978 5211 gene locus_tag LOCUS_20310 gene acpP1 4978 5211 CDS product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 protein_id gnl|my_center|LOCUS_20310 >Feature sequence245 935 288 gene locus_tag LOCUS_20320 935 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1016 2080 gene locus_tag LOCUS_20330 1016 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5299 2165 gene locus_tag LOCUS_20340 5299 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence246 1785 130 gene locus_tag LOCUS_20350 1785 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2445 1912 gene locus_tag LOCUS_20360 2445 1912 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_20360 3226 3555 gene locus_tag LOCUS_20370 3226 3555 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738577.1 protein_id gnl|my_center|LOCUS_20370 3569 3847 gene locus_tag LOCUS_20380 3569 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_20380 4874 3906 gene locus_tag LOCUS_20390 gene thi3 4874 3906 CDS product thiamine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947294.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence247 886 686 gene locus_tag LOCUS_20400 886 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2453 1071 gene locus_tag LOCUS_20410 2453 1071 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065240.1 protein_id gnl|my_center|LOCUS_20410 4270 2579 gene locus_tag LOCUS_20420 4270 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence248 58 1035 gene locus_tag LOCUS_20430 58 1035 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 protein_id gnl|my_center|LOCUS_20430 1093 2580 gene locus_tag LOCUS_20440 gene trkH2 1093 2580 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q4 protein_id gnl|my_center|LOCUS_20440 2594 3589 gene locus_tag LOCUS_20450 2594 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence249 380 850 gene locus_tag LOCUS_20460 380 850 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318521.1 protein_id gnl|my_center|LOCUS_20460 897 2066 gene locus_tag LOCUS_20470 gene liuA 897 2066 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_20470 2072 3679 gene locus_tag LOCUS_20480 2072 3679 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267706.1 protein_id gnl|my_center|LOCUS_20480 3705 4490 gene locus_tag LOCUS_20490 3705 4490 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483374.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence250 675 94 gene locus_tag LOCUS_20500 675 94 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 protein_id gnl|my_center|LOCUS_20500 1598 852 gene locus_tag LOCUS_20510 1598 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3560 1599 gene locus_tag LOCUS_20520 3560 1599 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_20520 <5250 3563 gene locus_tag LOCUS_20530 <5250 3563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870228.1:helicase >Feature sequence251 930 646 gene locus_tag LOCUS_20540 930 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence252 439 4896 gene locus_tag LOCUS_20550 gene gltB 439 4896 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence253 48 1583 gene locus_tag LOCUS_20560 48 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1570 3141 gene locus_tag LOCUS_20570 1570 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3760 3227 gene locus_tag LOCUS_20580 3760 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4981 3761 gene locus_tag LOCUS_20590 4981 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence254 97 705 gene locus_tag LOCUS_20600 97 705 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_20600 948 1997 gene locus_tag LOCUS_20610 gene nadA 948 1997 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_20610 3658 2198 gene locus_tag LOCUS_20620 3658 2198 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_20620 4013 4243 gene locus_tag LOCUS_20630 4013 4243 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence255 >Feature sequence256 365 1204 gene locus_tag LOCUS_20640 365 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2686 1241 gene locus_tag LOCUS_20650 2686 1241 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_20650 3981 2839 gene locus_tag LOCUS_20660 3981 2839 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_20660 4221 4904 gene locus_tag LOCUS_20670 4221 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence257 515 1075 gene locus_tag LOCUS_20680 515 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2252 1035 gene locus_tag LOCUS_20690 gene gspF 2252 1035 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_20690 3721 2255 gene locus_tag LOCUS_20700 gene epsE 3721 2255 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37093 protein_id gnl|my_center|LOCUS_20700 <5176 3724 gene locus_tag LOCUS_20710 <5176 3724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011378861.1:type II secretion system protein GspD >Feature sequence258 422 1357 gene locus_tag LOCUS_20720 422 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_20720 1678 2586 gene locus_tag LOCUS_20730 1678 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20730 2608 4434 gene locus_tag LOCUS_20740 2608 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20740 >Feature sequence259 <1 599 gene locus_tag LOCUS_20750 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVN5:chaperone protein ClpB 2029 689 gene locus_tag LOCUS_20760 2029 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2201 3004 gene locus_tag LOCUS_20770 2201 3004 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 protein_id gnl|my_center|LOCUS_20770 3242 4045 gene locus_tag LOCUS_20780 3242 4045 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213463.1 protein_id gnl|my_center|LOCUS_20780 4107 5078 gene locus_tag LOCUS_20790 4107 5078 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836403.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence260 2368 527 gene locus_tag LOCUS_20800 gene ilvD 2368 527 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ83 protein_id gnl|my_center|LOCUS_20800 3124 2411 gene locus_tag LOCUS_20810 3124 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_20810 3317 4159 gene locus_tag LOCUS_20820 3317 4159 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455357.1 protein_id gnl|my_center|LOCUS_20820 4423 4283 gene locus_tag LOCUS_20830 4423 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 4627 4475 gene locus_tag LOCUS_20840 4627 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4778 5026 gene locus_tag LOCUS_20850 4778 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence261 2898 154 gene locus_tag LOCUS_20860 gene polA 2898 154 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_20860 2955 3350 gene locus_tag LOCUS_20870 2955 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4866 3400 gene locus_tag LOCUS_20880 4866 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence262 72 950 gene locus_tag LOCUS_20890 72 950 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140154.1 protein_id gnl|my_center|LOCUS_20890 1277 2749 gene locus_tag LOCUS_20900 1277 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2958 4073 gene locus_tag LOCUS_20910 gene apbE 2958 4073 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WC52 protein_id gnl|my_center|LOCUS_20910 4091 4318 gene locus_tag LOCUS_20920 4091 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_20920 4390 5106 gene locus_tag LOCUS_20930 4390 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence263 127 849 gene locus_tag LOCUS_20940 127 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2261 876 gene locus_tag LOCUS_20950 gene trkH 2261 876 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_20950 4792 2831 gene locus_tag LOCUS_20960 gene cpdB 4792 2831 CDS product bifunctional 2',3'-cyclic nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232190.2 protein_id gnl|my_center|LOCUS_20960 >Feature sequence264 <1 696 gene locus_tag LOCUS_20970 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZMG6:4-hydroxythreonine-4-phosphate dehydrogenase 2352 775 gene locus_tag LOCUS_20980 2352 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2764 3558 gene locus_tag LOCUS_20990 gene rsmA 2764 3558 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_20990 3573 4385 gene locus_tag LOCUS_21000 gene apaH 3573 4385 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_21000 >Feature sequence265 523 693 gene locus_tag LOCUS_21010 523 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 869 1591 gene locus_tag LOCUS_21020 869 1591 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_21020 1595 3193 gene locus_tag LOCUS_21030 1595 3193 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_21030 4061 3369 gene locus_tag LOCUS_21040 4061 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4482 4081 gene locus_tag LOCUS_21050 4482 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4887 4981 gene locus_tag LOCUS_t00280 4887 4981 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence266 1322 369 gene locus_tag LOCUS_21060 gene ribF 1322 369 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_21060 1571 2749 gene locus_tag LOCUS_21070 1571 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4341 2743 gene locus_tag LOCUS_21080 gene murJ 4341 2743 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_21080 >Feature sequence267 97 297 gene locus_tag LOCUS_21090 97 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 282 437 gene locus_tag LOCUS_21100 282 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 647 1513 gene locus_tag LOCUS_21110 gene nadC 647 1513 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_21110 1547 2575 gene locus_tag LOCUS_21120 gene galE-1 1547 2575 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_21120 2584 4218 gene locus_tag LOCUS_21130 gene ligB 2584 4218 CDS product DNA ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK8 protein_id gnl|my_center|LOCUS_21130 4698 4294 gene locus_tag LOCUS_21140 gene ppdD 4698 4294 CDS product prepilin peptidase-dependent protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44623 protein_id gnl|my_center|LOCUS_21140 >Feature sequence268 1088 54 gene locus_tag LOCUS_21150 1088 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1989 1375 gene locus_tag LOCUS_21160 gene ruvA 1989 1375 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QU8 protein_id gnl|my_center|LOCUS_21160 2111 2650 gene locus_tag LOCUS_21170 2111 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3261 2647 gene locus_tag LOCUS_21180 gene ruvC 3261 2647 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence269 <1 921 gene locus_tag LOCUS_21190 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268692.1:branched chain amino acid ABC transporter substrate-binding protein 1242 2210 gene locus_tag LOCUS_21200 1242 2210 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 protein_id gnl|my_center|LOCUS_21200 2207 3529 gene locus_tag LOCUS_21210 gene livM 2207 3529 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704140.1 protein_id gnl|my_center|LOCUS_21210 3587 4357 gene locus_tag LOCUS_21220 gene livG 3587 4357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence270 130 753 gene locus_tag LOCUS_21230 gene thiE 130 753 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_21230 765 2048 gene locus_tag LOCUS_21240 gene hemL 765 2048 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 protein_id gnl|my_center|LOCUS_21240 2150 2791 gene locus_tag LOCUS_21250 2150 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3150 2830 gene locus_tag LOCUS_21260 3150 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_21260 3543 4898 gene locus_tag LOCUS_21270 gene miaB 3543 4898 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_21270 >Feature sequence271 57 365 gene locus_tag LOCUS_21280 57 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875287.1 protein_id gnl|my_center|LOCUS_21280 580 1164 gene locus_tag LOCUS_21290 580 1164 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP94 protein_id gnl|my_center|LOCUS_21290 3591 1579 gene locus_tag LOCUS_21300 gene rep 3591 1579 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ8 protein_id gnl|my_center|LOCUS_21300 4769 3927 gene locus_tag LOCUS_21310 gene rhdA 4769 3927 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_21310 >Feature sequence272 <1 530 gene locus_tag LOCUS_21320 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CFP5:GMP reductase 1249 1926 gene locus_tag LOCUS_21330 1249 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2659 1928 gene locus_tag LOCUS_21340 gene pflA 2659 1928 CDS product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED57 protein_id gnl|my_center|LOCUS_21340 <4948 2731 gene locus_tag LOCUS_21350 <4948 2731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367478.1:formate acetyltransferase >Feature sequence273 909 1223 gene locus_tag LOCUS_21360 909 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947058.1 protein_id gnl|my_center|LOCUS_21360 1548 1228 gene locus_tag LOCUS_21370 gene bolA 1548 1228 CDS product DNA-binding transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPS0 protein_id gnl|my_center|LOCUS_21370 2141 1602 gene locus_tag LOCUS_21380 2141 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2539 4059 gene locus_tag LOCUS_21390 2539 4059 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP61 protein_id gnl|my_center|LOCUS_21390 4263 4502 gene locus_tag LOCUS_21400 4263 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence274 1497 205 gene locus_tag LOCUS_21410 gene purA 1497 205 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_21410 2746 1556 gene locus_tag LOCUS_21420 gene hisZ 2746 1556 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_21420 3003 2809 gene locus_tag LOCUS_21430 3003 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_21430 3963 3091 gene locus_tag LOCUS_21440 3963 3091 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX7 protein_id gnl|my_center|LOCUS_21440 <4938 3960 gene locus_tag LOCUS_21450 <4938 3960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106427.1:protease modulator HflK >Feature sequence275 1240 803 gene locus_tag LOCUS_21460 1240 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2913 1318 gene locus_tag LOCUS_21470 2913 1318 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_21470 3494 3372 gene locus_tag LOCUS_21480 3494 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence276 <1 1078 gene locus_tag LOCUS_21490 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482999.1:protein GltP 1713 4145 gene locus_tag LOCUS_21500 1713 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence277 <1 687 gene locus_tag LOCUS_21510 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000976921.1:polysialic acid transporter 755 1024 gene locus_tag LOCUS_21520 755 1024 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_21520 1011 1403 gene locus_tag LOCUS_21530 1011 1403 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_21530 1877 1461 gene locus_tag LOCUS_21540 1877 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_21540 2274 1870 gene locus_tag LOCUS_21550 2274 1870 CDS product toxin-antitoxin system antidote Mnt family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_21550 3215 2274 gene locus_tag LOCUS_21560 3215 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4286 3372 gene locus_tag LOCUS_21570 4286 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4641 4408 gene locus_tag LOCUS_21580 4641 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence278 102 434 gene locus_tag LOCUS_21590 gene hisE 102 434 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_21590 474 695 gene locus_tag LOCUS_21600 474 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 828 1178 gene locus_tag LOCUS_21610 828 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1181 1930 gene locus_tag LOCUS_21620 gene tatC 1181 1930 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_21620 2037 2333 gene locus_tag LOCUS_21630 2037 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2420 3130 gene locus_tag LOCUS_21640 2420 3130 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_21640 3246 3950 gene locus_tag LOCUS_21650 3246 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4085 4525 gene locus_tag LOCUS_21660 4085 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence279 252 1484 gene locus_tag LOCUS_21670 252 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1494 1703 gene locus_tag LOCUS_21680 1494 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1708 2727 gene locus_tag LOCUS_21690 1708 2727 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533600.1 protein_id gnl|my_center|LOCUS_21690 2916 2840 gene locus_tag LOCUS_t00290 2916 2840 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3245 3018 gene locus_tag LOCUS_21700 3245 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3584 4288 gene locus_tag LOCUS_21710 3584 4288 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence280 863 207 gene locus_tag LOCUS_21720 863 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480953.1 protein_id gnl|my_center|LOCUS_21720 2334 1099 gene locus_tag LOCUS_21730 gene ispG 2334 1099 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH64 protein_id gnl|my_center|LOCUS_21730 4501 2474 gene locus_tag LOCUS_21740 4501 2474 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268340.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence281 716 177 gene locus_tag LOCUS_21750 716 177 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263448.1 protein_id gnl|my_center|LOCUS_21750 2230 926 gene locus_tag LOCUS_21760 2230 926 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071485.1 protein_id gnl|my_center|LOCUS_21760 3732 2236 gene locus_tag LOCUS_21770 3732 2236 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_21770 4517 3747 gene locus_tag LOCUS_21780 4517 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence282 1730 1083 gene locus_tag LOCUS_21790 gene engB 1730 1083 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ86 protein_id gnl|my_center|LOCUS_21790 1955 2560 gene locus_tag LOCUS_21800 gene cc4 1955 2560 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_21800 2673 3503 gene locus_tag LOCUS_21810 2673 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3605 4477 gene locus_tag LOCUS_21820 3605 4477 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence283 <1 1514 gene locus_tag LOCUS_21830 <1 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S4M5:DNA helicase 1911 1546 gene locus_tag LOCUS_21840 1911 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4749 2578 gene locus_tag LOCUS_21850 4749 2578 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_21850 >Feature sequence284 1528 638 gene locus_tag LOCUS_21860 gene gspC 1528 638 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence285 1406 33 gene locus_tag LOCUS_21870 gene cysG 1406 33 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_21870 2767 1748 gene locus_tag LOCUS_21880 2767 1748 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 protein_id gnl|my_center|LOCUS_21880 3632 2784 gene locus_tag LOCUS_21890 3632 2784 CDS product anaerobic sulfite reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706396.1 protein_id gnl|my_center|LOCUS_21890 4662 3625 gene locus_tag LOCUS_21900 4662 3625 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706395.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence286 282 1337 gene locus_tag LOCUS_21910 282 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3429 1579 gene locus_tag LOCUS_21920 3429 1579 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 protein_id gnl|my_center|LOCUS_21920 4533 3442 gene locus_tag LOCUS_21930 4533 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence287 381 2411 gene locus_tag LOCUS_21940 381 2411 CDS product periplasmic alpha-galactoside-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530190.1 protein_id gnl|my_center|LOCUS_21940 2764 2558 gene locus_tag LOCUS_21950 2764 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence288 <1 2714 gene locus_tag LOCUS_21960 <1 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQ59:RecBCD enzyme subunit RecC >Feature sequence289 121 1623 gene locus_tag LOCUS_21970 gene purF 121 1623 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_21970 2203 1922 gene locus_tag LOCUS_21980 2203 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3037 2249 gene locus_tag LOCUS_21990 gene xni 3037 2249 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE3 protein_id gnl|my_center|LOCUS_21990 3401 4597 gene locus_tag LOCUS_22000 gene metZ 3401 4597 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_22000 >Feature sequence290 1621 185 gene locus_tag LOCUS_22010 1621 185 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_22010 1938 2846 gene locus_tag LOCUS_22020 1938 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464929.1 protein_id gnl|my_center|LOCUS_22020 2827 3762 gene locus_tag LOCUS_22030 gene dcyD 2827 3762 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_22030 3812 4090 gene locus_tag LOCUS_22040 gene ppiC-2 3812 4090 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880W6 protein_id gnl|my_center|LOCUS_22040 >Feature sequence291 <1 765 gene locus_tag LOCUS_22050 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q883S5:phospho-2-dehydro-3-deoxyheptonate aldolase 1160 774 gene locus_tag LOCUS_22060 1160 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1817 1332 gene locus_tag LOCUS_22070 gene greB 1817 1332 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8N1 protein_id gnl|my_center|LOCUS_22070 2515 1925 gene locus_tag LOCUS_22080 gene nfuA 2515 1925 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_22080 2619 3059 gene locus_tag LOCUS_22090 2619 3059 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_22090 3166 3981 gene locus_tag LOCUS_22100 gene yeeZ 3166 3981 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_22100 <4597 4036 gene locus_tag LOCUS_22110 <4597 4036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87SB7:branched-chain amino acid transport system carrier protein >Feature sequence292 1343 228 gene locus_tag LOCUS_22120 gene mnmA 1343 228 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_22120 1687 3912 gene locus_tag LOCUS_22130 1687 3912 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence293 137 1354 gene locus_tag LOCUS_22140 137 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1772 4402 gene locus_tag LOCUS_22150 1772 4402 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706903.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence294 1803 340 gene locus_tag LOCUS_22160 1803 340 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 protein_id gnl|my_center|LOCUS_22160 1966 3249 gene locus_tag LOCUS_22170 1966 3249 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_22170 4198 3272 gene locus_tag LOCUS_22180 gene ilvE 4198 3272 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_22180 >Feature sequence295 905 318 gene locus_tag LOCUS_22190 905 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2231 999 gene locus_tag LOCUS_22200 gene argG 2231 999 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_22200 2644 3684 gene locus_tag LOCUS_22210 gene pyrC 2644 3684 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_22210 3694 4317 gene locus_tag LOCUS_22220 gene rnt 3694 4317 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ7 protein_id gnl|my_center|LOCUS_22220 >Feature sequence296 <1 1155 gene locus_tag LOCUS_22230 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112522.1:ATP-dependent DNA helicase DinG 3469 1166 gene locus_tag LOCUS_22240 3469 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence297 919 1761 gene locus_tag LOCUS_22250 919 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1780 2262 gene locus_tag LOCUS_22260 gene sycD 1780 2262 CDS product CesD/SycD/LcrH family type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117633.1 protein_id gnl|my_center|LOCUS_22260 2267 3859 gene locus_tag LOCUS_22270 2267 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence298 245 1567 gene locus_tag LOCUS_22280 gene hmgA 245 1567 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RD3 protein_id gnl|my_center|LOCUS_22280 1564 2883 gene locus_tag LOCUS_22290 gene fahA 1564 2883 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_22290 2894 3520 gene locus_tag LOCUS_22300 gene hmgA 2894 3520 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_22300 4281 3517 gene locus_tag LOCUS_22310 4281 3517 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence299 131 56 gene locus_tag LOCUS_t00300 131 56 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 323 1240 gene locus_tag LOCUS_22320 gene rdgC 323 1240 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP9 protein_id gnl|my_center|LOCUS_22320 2163 1309 gene locus_tag LOCUS_22330 2163 1309 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_22330 2912 4015 gene locus_tag LOCUS_22340 gene purC 2912 4015 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q87 protein_id gnl|my_center|LOCUS_22340 >Feature sequence300 28 114 gene locus_tag LOCUS_t00310 28 114 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 371 1741 gene locus_tag LOCUS_22350 gene phoA 371 1741 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_22350 3528 1738 gene locus_tag LOCUS_22360 3528 1738 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_22360 3761 4276 gene locus_tag LOCUS_22370 3761 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence301 787 44 gene locus_tag LOCUS_22380 787 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1397 2089 gene locus_tag LOCUS_22390 1397 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2160 3533 gene locus_tag LOCUS_22400 gene radA 2160 3533 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z0T8 protein_id gnl|my_center|LOCUS_22400 >Feature sequence302 <1 1021 gene locus_tag LOCUS_22410 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261563.1:thiol reductant ABC exporter subunit CydD 1014 2705 gene locus_tag LOCUS_22420 1014 2705 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706826.1 protein_id gnl|my_center|LOCUS_22420 4250 2706 gene locus_tag LOCUS_22430 4250 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence303 208 1338 gene locus_tag LOCUS_22440 gene ribD 208 1338 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_22440 1344 2003 gene locus_tag LOCUS_22450 gene ribC 1344 2003 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_22450 3526 3131 gene locus_tag LOCUS_22460 gene vapC 3526 3131 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_22460 3717 3523 gene locus_tag LOCUS_22470 3717 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64878 protein_id gnl|my_center|LOCUS_22470 >Feature sequence304 462 1277 gene locus_tag LOCUS_22480 462 1277 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_22480 1277 2737 gene locus_tag LOCUS_22490 1277 2737 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_22490 2748 3269 gene locus_tag LOCUS_22500 2748 3269 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_22500 3512 3916 gene locus_tag LOCUS_22510 3512 3916 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence305 169 399 gene locus_tag LOCUS_22520 169 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1116 493 gene locus_tag LOCUS_22530 1116 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1612 1121 gene locus_tag LOCUS_22540 1612 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_22540 3326 1596 gene locus_tag LOCUS_22550 gene cysI 3326 1596 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_22550 4230 3463 gene locus_tag LOCUS_22560 4230 3463 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNM0 protein_id gnl|my_center|LOCUS_22560 >Feature sequence306 1307 735 gene locus_tag LOCUS_22570 1307 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1441 1779 gene locus_tag LOCUS_22580 1441 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence307 450 716 gene locus_tag LOCUS_22590 450 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933583.1 protein_id gnl|my_center|LOCUS_22590 1112 1783 gene locus_tag LOCUS_22600 1112 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1832 2188 gene locus_tag LOCUS_22610 1832 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2175 2555 gene locus_tag LOCUS_22620 2175 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2860 3180 gene locus_tag LOCUS_22630 2860 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 3149 3319 gene locus_tag LOCUS_22640 3149 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3316 3555 gene locus_tag LOCUS_22650 3316 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3684 4118 gene locus_tag LOCUS_22660 3684 4118 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257767.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence308 543 349 gene locus_tag LOCUS_22670 543 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 945 676 gene locus_tag LOCUS_22680 945 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2295 1003 gene locus_tag LOCUS_22690 gene eno 2295 1003 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEM8 protein_id gnl|my_center|LOCUS_22690 2505 2885 gene locus_tag LOCUS_22700 2505 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3306 2896 gene locus_tag LOCUS_22710 3306 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4410 3427 gene locus_tag LOCUS_22720 4410 3427 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence309 196 1365 gene locus_tag LOCUS_22730 196 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2911 1745 gene locus_tag LOCUS_22740 2911 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3420 2911 gene locus_tag LOCUS_22750 3420 2911 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_22750 3971 3420 gene locus_tag LOCUS_22760 gene dsbE 3971 3420 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence310 3766 1070 gene locus_tag LOCUS_22770 gene cas3-2 3766 1070 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942033.1 protein_id gnl|my_center|LOCUS_22770 3994 4293 gene locus_tag LOCUS_22780 3994 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence311 377 135 gene locus_tag LOCUS_22790 377 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1377 469 gene locus_tag LOCUS_22800 1377 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2527 1469 gene locus_tag LOCUS_22810 gene holA 2527 1469 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_22810 3087 2527 gene locus_tag LOCUS_22820 gene lptE 3087 2527 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN89 protein_id gnl|my_center|LOCUS_22820 3891 3616 gene locus_tag LOCUS_22830 3891 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence312 197 1357 gene locus_tag LOCUS_22840 197 1357 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWC5 protein_id gnl|my_center|LOCUS_22840 1903 3918 gene locus_tag LOCUS_22850 1903 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence313 1994 1722 gene locus_tag LOCUS_22860 gene acyP 1994 1722 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUC1 protein_id gnl|my_center|LOCUS_22860 2454 1963 gene locus_tag LOCUS_22870 2454 1963 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_22870 3653 2451 gene locus_tag LOCUS_22880 3653 2451 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_22880 >Feature sequence314 457 2232 gene locus_tag LOCUS_22890 457 2232 CDS product bifunctional molybdopterin-guanine dinucleotide biosynthesis protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479452.1 protein_id gnl|my_center|LOCUS_22890 2616 2314 gene locus_tag LOCUS_22900 2616 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence315 419 976 gene locus_tag LOCUS_22910 419 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_22910 1207 3621 gene locus_tag LOCUS_22920 1207 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence316 854 1657 gene locus_tag LOCUS_22930 gene fleN 854 1657 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884V8 protein_id gnl|my_center|LOCUS_22930 1660 2385 gene locus_tag LOCUS_22940 gene fliA 1660 2385 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV3 protein_id gnl|my_center|LOCUS_22940 2642 3121 gene locus_tag LOCUS_22950 2642 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3430 4104 gene locus_tag LOCUS_22960 gene ccmA 3430 4104 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE58 protein_id gnl|my_center|LOCUS_22960 >Feature sequence317 <1 525 gene locus_tag LOCUS_22970 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51423:transcriptional regulatory protein PmpR 1016 582 gene locus_tag LOCUS_22980 1016 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2040 1036 gene locus_tag LOCUS_22990 2040 1036 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072814.1 protein_id gnl|my_center|LOCUS_22990 <4312 2367 gene locus_tag LOCUS_23000 <4312 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KID4:pyruvate-flavodoxin oxidoreductase >Feature sequence318 724 101 gene locus_tag LOCUS_23010 724 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23010 1152 787 gene locus_tag LOCUS_23020 1152 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23020 1374 1246 gene locus_tag LOCUS_23030 1374 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1680 2054 gene locus_tag LOCUS_23040 1680 2054 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268830.1 protein_id gnl|my_center|LOCUS_23040 2077 2277 gene locus_tag LOCUS_23050 2077 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3892 2336 gene locus_tag LOCUS_23060 3892 2336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence319 2186 495 gene locus_tag LOCUS_23070 2186 495 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 protein_id gnl|my_center|LOCUS_23070 2972 2277 gene locus_tag LOCUS_23080 2972 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3298 3513 gene locus_tag LOCUS_23090 3298 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_23090 3599 4084 gene locus_tag LOCUS_23100 3599 4084 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP05 protein_id gnl|my_center|LOCUS_23100 >Feature sequence320 761 141 gene locus_tag LOCUS_23110 gene udk 761 141 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFZ9 protein_id gnl|my_center|LOCUS_23110 1265 882 gene locus_tag LOCUS_23120 1265 882 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705458.1 protein_id gnl|my_center|LOCUS_23120 2766 1300 gene locus_tag LOCUS_23130 2766 1300 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_23130 2860 3939 gene locus_tag LOCUS_23140 gene rsmC 2860 3939 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LY1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence321 2055 58 gene locus_tag LOCUS_23150 gene topB 2055 58 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECS1 protein_id gnl|my_center|LOCUS_23150 2155 3606 gene locus_tag LOCUS_23160 gene dgt 2155 3606 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJQ7 protein_id gnl|my_center|LOCUS_23160 >Feature sequence322 987 106 gene locus_tag LOCUS_23170 987 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_23170 1252 2328 gene locus_tag LOCUS_23180 1252 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2325 3437 gene locus_tag LOCUS_23190 2325 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence323 1133 249 gene locus_tag LOCUS_23200 1133 249 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5V2 protein_id gnl|my_center|LOCUS_23200 2783 1245 gene locus_tag LOCUS_23210 2783 1245 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 protein_id gnl|my_center|LOCUS_23210 3990 2884 gene locus_tag LOCUS_23220 gene pepT 3990 2884 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LS8 protein_id gnl|my_center|LOCUS_23220 >Feature sequence324 1530 130 gene locus_tag LOCUS_23230 1530 130 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409202.1 protein_id gnl|my_center|LOCUS_23230 1693 1487 gene locus_tag LOCUS_23240 1693 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2115 1756 gene locus_tag LOCUS_23250 2115 1756 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_23250 2450 2112 gene locus_tag LOCUS_23260 2450 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3427 2630 gene locus_tag LOCUS_23270 3427 2630 CDS product oxalate:formate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261931.1 protein_id gnl|my_center|LOCUS_23270 3653 4081 gene locus_tag LOCUS_23280 3653 4081 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883461.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence325 821 2281 gene locus_tag LOCUS_23290 821 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2379 2750 gene locus_tag LOCUS_23300 2379 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2747 3406 gene locus_tag LOCUS_23310 2747 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence326 1768 941 gene locus_tag LOCUS_23320 1768 941 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_23320 2049 1771 gene locus_tag LOCUS_23330 gene rpmE 2049 1771 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_23330 >Feature sequence327 3211 1547 gene locus_tag LOCUS_23340 3211 1547 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_23340 3688 3377 gene locus_tag LOCUS_23350 3688 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938093.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence328 2428 2159 gene locus_tag LOCUS_23360 gene rpsO 2428 2159 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ7 protein_id gnl|my_center|LOCUS_23360 3618 2545 gene locus_tag LOCUS_23370 gene truB 3618 2545 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3H9 protein_id gnl|my_center|LOCUS_23370 4025 3621 gene locus_tag LOCUS_23380 gene rbfA 4025 3621 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_23380 >Feature sequence329 1059 472 gene locus_tag LOCUS_23390 gene fabA 1059 472 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33877 protein_id gnl|my_center|LOCUS_23390 1468 2508 gene locus_tag LOCUS_23400 gene gpsA 1468 2508 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV7 protein_id gnl|my_center|LOCUS_23400 2548 2853 gene locus_tag LOCUS_23410 2548 2853 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_23410 2850 3299 gene locus_tag LOCUS_23420 gene sixA 2850 3299 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 protein_id gnl|my_center|LOCUS_23420 4029 3286 gene locus_tag LOCUS_23430 gene lpxH 4029 3286 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 protein_id gnl|my_center|LOCUS_23430 >Feature sequence330 618 82 gene locus_tag LOCUS_23440 618 82 CDS product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_23440 884 615 gene locus_tag LOCUS_23450 884 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232878.2 protein_id gnl|my_center|LOCUS_23450 3054 1162 gene locus_tag LOCUS_23460 gene parE 3054 1162 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_23460 3577 3215 gene locus_tag LOCUS_23470 3577 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3995 4132 gene locus_tag LOCUS_23480 3995 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence331 1739 261 gene locus_tag LOCUS_23490 gene pqaA 1739 261 CDS product PhoPQ-activated pathogenicity-related protein PqaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455941.1 protein_id gnl|my_center|LOCUS_23490 4036 2789 gene locus_tag LOCUS_23500 4036 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence332 3810 76 gene locus_tag LOCUS_23510 3810 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence333 68 811 gene locus_tag LOCUS_23520 68 811 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_23520 1008 1262 gene locus_tag LOCUS_23530 1008 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1361 2737 gene locus_tag LOCUS_23540 1361 2737 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205687.1 protein_id gnl|my_center|LOCUS_23540 3024 4022 gene locus_tag LOCUS_23550 3024 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence334 234 908 gene locus_tag LOCUS_23560 234 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3565 1121 gene locus_tag LOCUS_23570 3565 1121 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence335 251 664 gene locus_tag LOCUS_23580 251 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2237 816 gene locus_tag LOCUS_23590 2237 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23590 <4062 2331 gene locus_tag LOCUS_23600 <4062 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase note possible pseudo, internal stop codon >Feature sequence336 538 1323 gene locus_tag LOCUS_23610 538 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 2584 1388 gene locus_tag LOCUS_23620 2584 1388 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 protein_id gnl|my_center|LOCUS_23620 3743 2724 gene locus_tag LOCUS_23630 3743 2724 CDS product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPN6 protein_id gnl|my_center|LOCUS_23630 >Feature sequence337 186 1280 gene locus_tag LOCUS_23640 186 1280 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 protein_id gnl|my_center|LOCUS_23640 1896 1321 gene locus_tag LOCUS_23650 1896 1321 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531131.1 protein_id gnl|my_center|LOCUS_23650 2079 2567 gene locus_tag LOCUS_23660 2079 2567 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_23660 2644 2967 gene locus_tag LOCUS_23670 2644 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3918 2950 gene locus_tag LOCUS_23680 3918 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence338 2733 1225 gene locus_tag LOCUS_23690 2733 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3685 2723 gene locus_tag LOCUS_23700 3685 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence339 1053 160 gene locus_tag LOCUS_23710 1053 160 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704336.1 protein_id gnl|my_center|LOCUS_23710 1219 2322 gene locus_tag LOCUS_23720 1219 2322 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704335.1 protein_id gnl|my_center|LOCUS_23720 2324 3880 gene locus_tag LOCUS_23730 gene rmrB 2324 3880 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070866.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence340 805 1206 gene locus_tag LOCUS_23740 805 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1911 1453 gene locus_tag LOCUS_23750 gene mgsA 1911 1453 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLN2 protein_id gnl|my_center|LOCUS_23750 3345 2047 gene locus_tag LOCUS_23760 3345 2047 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704360.1 protein_id gnl|my_center|LOCUS_23760 <4030 3358 gene locus_tag LOCUS_23770 <4030 3358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_230442.1:oxaloacetate decarboxylase >Feature sequence341 181 855 gene locus_tag LOCUS_23780 gene phoP 181 855 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082436.1 protein_id gnl|my_center|LOCUS_23780 908 2293 gene locus_tag LOCUS_23790 908 2293 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268599.1 protein_id gnl|my_center|LOCUS_23790 2374 3069 gene locus_tag LOCUS_23800 2374 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence342 1722 1342 gene locus_tag LOCUS_23810 gene crcB 1722 1342 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5A7 protein_id gnl|my_center|LOCUS_23810 3328 2003 gene locus_tag LOCUS_23820 3328 2003 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence343 <1 924 gene locus_tag LOCUS_23830 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87Y40:protein TolB 1010 1585 gene locus_tag LOCUS_23840 gene pal 1010 1585 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z4 protein_id gnl|my_center|LOCUS_23840 1680 2516 gene locus_tag LOCUS_23850 1680 2516 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 protein_id gnl|my_center|LOCUS_23850 2599 3246 gene locus_tag LOCUS_23860 gene queE 2599 3246 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 protein_id gnl|my_center|LOCUS_23860 3248 3928 gene locus_tag LOCUS_23870 gene queC 3248 3928 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z2 protein_id gnl|my_center|LOCUS_23870 >Feature sequence344 203 460 gene locus_tag LOCUS_23880 203 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1753 527 gene locus_tag LOCUS_23890 gene nqrF 1753 527 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_23890 2365 1769 gene locus_tag LOCUS_23900 gene nqrE 2365 1769 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_23900 3034 2369 gene locus_tag LOCUS_23910 gene nqrD 3034 2369 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS2 protein_id gnl|my_center|LOCUS_23910 3846 3034 gene locus_tag LOCUS_23920 gene nqrC 3846 3034 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_23920 >Feature sequence345 2617 464 gene locus_tag LOCUS_23930 2617 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3800 2925 gene locus_tag LOCUS_23940 gene galU-1 3800 2925 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKA0 protein_id gnl|my_center|LOCUS_23940 >Feature sequence346 150 626 gene locus_tag LOCUS_23950 150 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2454 919 gene locus_tag LOCUS_23960 gene ilvA1 2454 919 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_23960 2636 3310 gene locus_tag LOCUS_23970 gene rpiA 2636 3310 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence347 208 1140 gene locus_tag LOCUS_23980 208 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_23980 1157 2125 gene locus_tag LOCUS_23990 1157 2125 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_23990 <3945 2154 gene locus_tag LOCUS_24000 <3945 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071290.1:methionine synthase >Feature sequence348 1227 1853 gene locus_tag LOCUS_24010 1227 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2277 1873 gene locus_tag LOCUS_24020 2277 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2491 3183 gene locus_tag LOCUS_24030 gene rlmE 2491 3183 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP7 protein_id gnl|my_center|LOCUS_24030 >Feature sequence349 >Feature sequence350 591 1694 gene locus_tag LOCUS_24040 gene rluC 591 1694 CDS product ribosomal large subunit pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM9 protein_id gnl|my_center|LOCUS_24040 1691 2380 gene locus_tag LOCUS_24050 1691 2380 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 protein_id gnl|my_center|LOCUS_24050 2390 3379 gene locus_tag LOCUS_24060 2390 3379 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence351 327 133 gene locus_tag LOCUS_24070 327 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 805 2364 gene locus_tag LOCUS_24080 805 2364 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_24080 2533 2811 gene locus_tag LOCUS_24090 2533 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3319 2876 gene locus_tag LOCUS_24100 3319 2876 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence352 1323 709 gene locus_tag LOCUS_24110 1323 709 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_24110 3136 3306 gene locus_tag LOCUS_24120 3136 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence353 460 59 gene locus_tag LOCUS_24130 460 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 807 2657 gene locus_tag LOCUS_24140 gene recD 807 2657 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPB7 protein_id gnl|my_center|LOCUS_24140 2848 2654 gene locus_tag LOCUS_24150 2848 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence354 144 317 gene locus_tag LOCUS_24160 144 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1668 328 gene locus_tag LOCUS_24170 1668 328 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_24170 2142 1684 gene locus_tag LOCUS_24180 gene argR 2142 1684 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG11 protein_id gnl|my_center|LOCUS_24180 2593 3462 gene locus_tag LOCUS_24190 gene yeaD 2593 3462 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261570.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence355 501 2312 gene locus_tag LOCUS_24200 501 2312 CDS product solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113590.1 protein_id gnl|my_center|LOCUS_24200 2427 3233 gene locus_tag LOCUS_24210 2427 3233 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966250.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence356 954 679 gene locus_tag LOCUS_24220 954 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1866 2594 gene locus_tag LOCUS_24230 1866 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083620.1 protein_id gnl|my_center|LOCUS_24230 2594 3058 gene locus_tag LOCUS_24240 2594 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073203.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence357 264 470 gene locus_tag LOCUS_24250 264 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 701 1924 gene locus_tag LOCUS_24260 gene sorA 701 1924 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071029.1 protein_id gnl|my_center|LOCUS_24260 1921 2301 gene locus_tag LOCUS_24270 gene sorB 1921 2301 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071030.1 protein_id gnl|my_center|LOCUS_24270 2298 2696 gene locus_tag LOCUS_24280 2298 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 <3862 2759 gene locus_tag LOCUS_24290 <3862 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113976.1:ABC transporter ATP-binding protein >Feature sequence358 1304 750 gene locus_tag LOCUS_24300 1304 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2551 1379 gene locus_tag LOCUS_24310 2551 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2902 2579 gene locus_tag LOCUS_24320 2902 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 3675 2899 gene locus_tag LOCUS_24330 gene fpr 3675 2899 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence359 166 561 gene locus_tag LOCUS_24340 166 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 646 1023 gene locus_tag LOCUS_24350 646 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1361 1101 gene locus_tag LOCUS_24360 1361 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1542 2723 gene locus_tag LOCUS_24370 gene cry 1542 2723 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JP5 protein_id gnl|my_center|LOCUS_24370 >Feature sequence360 906 187 gene locus_tag LOCUS_24380 906 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1044 2309 gene locus_tag LOCUS_24390 1044 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 <3841 2478 gene locus_tag LOCUS_24400 <3841 2478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456743.1:lytic transglycosylase >Feature sequence361 1237 56 gene locus_tag LOCUS_24410 1237 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2733 1459 gene locus_tag LOCUS_24420 2733 1459 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU61 protein_id gnl|my_center|LOCUS_24420 3486 2992 gene locus_tag LOCUS_24430 3486 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence362 1979 2113 gene locus_tag LOCUS_24440 1979 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2517 2302 gene locus_tag LOCUS_24450 2517 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3601 2642 gene locus_tag LOCUS_24460 3601 2642 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence363 <1 1235 gene locus_tag LOCUS_24470 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6G3:enoyl-[acyl-carrier-protein] reductase [NADH] 1995 1456 gene locus_tag LOCUS_24480 1995 1456 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106004.1 protein_id gnl|my_center|LOCUS_24480 3400 2075 gene locus_tag LOCUS_24490 3400 2075 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQJ5 protein_id gnl|my_center|LOCUS_24490 >Feature sequence364 3576 1756 gene locus_tag LOCUS_24500 3576 1756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence365 2756 126 gene locus_tag LOCUS_24510 gene pepN 2756 126 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_24510 3600 2767 gene locus_tag LOCUS_24520 3600 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence366 700 251 gene locus_tag LOCUS_24530 700 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2201 774 gene locus_tag LOCUS_24540 2201 774 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 protein_id gnl|my_center|LOCUS_24540 3100 2276 gene locus_tag LOCUS_24550 3100 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence367 1394 264 gene locus_tag LOCUS_24560 1394 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1409 2050 gene locus_tag LOCUS_24570 1409 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_24570 3355 3029 gene locus_tag LOCUS_24580 3355 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3658 3377 gene locus_tag LOCUS_24590 3658 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence368 <1 1790 gene locus_tag LOCUS_24600 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2T8:peptidylprolyl isomerase 2409 1834 gene locus_tag LOCUS_24610 2409 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2523 3296 gene locus_tag LOCUS_24620 2523 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197081.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence369 1046 408 gene locus_tag LOCUS_24630 gene omt 1046 408 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_24630 1834 1160 gene locus_tag LOCUS_24640 1834 1160 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174130.1 protein_id gnl|my_center|LOCUS_24640 2149 1850 gene locus_tag LOCUS_24650 gene yciL 2149 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_24650 2725 2150 gene locus_tag LOCUS_24660 2725 2150 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885M2 protein_id gnl|my_center|LOCUS_24660 >Feature sequence370 167 2653 gene locus_tag LOCUS_24670 gene hsdR 167 2653 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_24670 3645 3079 gene locus_tag LOCUS_24680 gene tag 3645 3079 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence371 <1 2238 gene locus_tag LOCUS_24690 <1 2238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103249.1:autotransporter 3424 2252 gene locus_tag LOCUS_24700 3424 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence372 1337 123 gene locus_tag LOCUS_24710 gene trpS 1337 123 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_24710 2397 1465 gene locus_tag LOCUS_24720 2397 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3622 2996 gene locus_tag LOCUS_24730 3622 2996 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence373 <1 930 gene locus_tag LOCUS_24740 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G3XDA2:3-oxoacyl-[acyl-carrier-protein] synthase 2 930 1784 gene locus_tag LOCUS_24750 gene pabC 930 1784 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_24750 1785 2816 gene locus_tag LOCUS_24760 1785 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_24760 2841 3455 gene locus_tag LOCUS_24770 gene tmk 2841 3455 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence374 <1 948 gene locus_tag LOCUS_24780 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KIM1:periplasmic nitrate reductase 984 1511 gene locus_tag LOCUS_24790 984 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1525 2136 gene locus_tag LOCUS_24800 gene napC 1525 2136 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4G5 protein_id gnl|my_center|LOCUS_24800 2171 2299 gene locus_tag LOCUS_24810 2171 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3569 2376 gene locus_tag LOCUS_24820 3569 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence375 2078 3505 gene locus_tag LOCUS_24830 2078 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence376 529 1197 gene locus_tag LOCUS_24840 529 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2207 1206 gene locus_tag LOCUS_24850 2207 1206 CDS product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705456.1 protein_id gnl|my_center|LOCUS_24850 2393 2836 gene locus_tag LOCUS_24860 2393 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 <3653 2833 gene locus_tag LOCUS_24870 <3653 2833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JSC0:cyclic pyranopterin monophosphate synthase >Feature sequence377 1358 168 gene locus_tag LOCUS_24880 1358 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1545 1871 gene locus_tag LOCUS_24890 1545 1871 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_24890 2381 1905 gene locus_tag LOCUS_24900 gene bfr 2381 1905 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD63 protein_id gnl|my_center|LOCUS_24900 2857 3459 gene locus_tag LOCUS_24910 2857 3459 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence378 207 866 gene locus_tag LOCUS_24920 207 866 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_24920 1543 1100 gene locus_tag LOCUS_24930 1543 1100 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_24930 >Feature sequence379 312 1370 gene locus_tag LOCUS_24940 gene ldh 312 1370 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_24940 1370 2467 gene locus_tag LOCUS_24950 1370 2467 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706668.1 protein_id gnl|my_center|LOCUS_24950 2467 3450 gene locus_tag LOCUS_24960 2467 3450 CDS product pyruvate dehydrogenase E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706667.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence380 1209 3329 gene locus_tag LOCUS_24970 1209 3329 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099343.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence381 598 200 gene locus_tag LOCUS_24980 598 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 870 1589 gene locus_tag LOCUS_24990 gene aat 870 1589 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_24990 1586 2296 gene locus_tag LOCUS_25000 gene ate 1586 2296 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_25000 2377 2595 gene locus_tag LOCUS_25010 gene infA 2377 2595 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_25010 <3597 2639 gene locus_tag LOCUS_25020 <3597 2639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090432.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence382 2492 1155 gene locus_tag LOCUS_25030 2492 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2926 3501 gene locus_tag LOCUS_25040 2926 3501 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence383 913 2484 gene locus_tag LOCUS_25050 913 2484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262975.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence384 1739 2569 gene locus_tag LOCUS_25060 1739 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2897 3274 gene locus_tag LOCUS_25070 2897 3274 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence385 315 94 gene locus_tag LOCUS_25080 315 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_25080 706 413 gene locus_tag LOCUS_25090 706 413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_25090 1086 706 gene locus_tag LOCUS_25100 1086 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1512 1138 gene locus_tag LOCUS_25110 1512 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1769 1512 gene locus_tag LOCUS_25120 1769 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2565 3413 gene locus_tag LOCUS_25130 2565 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence386 1286 225 gene locus_tag LOCUS_25140 1286 225 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 protein_id gnl|my_center|LOCUS_25140 1468 2676 gene locus_tag LOCUS_25150 1468 2676 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_25150 2774 3202 gene locus_tag LOCUS_25160 gene comEB 2774 3202 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence387 2062 1286 gene locus_tag LOCUS_25170 2062 1286 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704056.1 protein_id gnl|my_center|LOCUS_25170 3245 2088 gene locus_tag LOCUS_25180 3245 2088 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704057.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence388 1436 348 gene locus_tag LOCUS_25190 1436 348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_25190 3388 1433 gene locus_tag LOCUS_25200 3388 1433 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence389 977 2515 gene locus_tag LOCUS_25210 977 2515 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_25210 2533 3264 gene locus_tag LOCUS_25220 2533 3264 CDS product putative insertion sequence ATP-binding protein y4pL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55617 protein_id gnl|my_center|LOCUS_25220 >Feature sequence390 <1 1071 gene locus_tag LOCUS_25230 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000850260.1:dimethyl sulfoxide reductase subunit A 1075 1695 gene locus_tag LOCUS_25240 1075 1695 CDS product dimethylsulfoxide reductase, chain B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097316.1 protein_id gnl|my_center|LOCUS_25240 1699 2547 gene locus_tag LOCUS_25250 gene dmsC 1699 2547 CDS product dimethyl sulfoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209429.1 protein_id gnl|my_center|LOCUS_25250 2802 3473 gene locus_tag LOCUS_25260 2802 3473 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence391 86 1018 gene locus_tag LOCUS_25270 86 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113045.1 protein_id gnl|my_center|LOCUS_25270 1028 1765 gene locus_tag LOCUS_25280 gene poxF 1028 1765 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020049.1 protein_id gnl|my_center|LOCUS_25280 2974 1754 gene locus_tag LOCUS_25290 2974 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence392 837 316 gene locus_tag LOCUS_25300 837 316 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815932.1 protein_id gnl|my_center|LOCUS_25300 1145 2521 gene locus_tag LOCUS_25310 1145 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence393 276 416 gene locus_tag LOCUS_25320 276 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1157 729 gene locus_tag LOCUS_25330 1157 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 2500 1169 gene locus_tag LOCUS_25340 2500 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551161.1 protein_id gnl|my_center|LOCUS_25340 2946 3359 gene locus_tag LOCUS_25350 2946 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence394 <1 936 gene locus_tag LOCUS_25360 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVW0:arabinose 5-phosphate isomerase KdsD 978 1547 gene locus_tag LOCUS_25370 978 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1534 2094 gene locus_tag LOCUS_25380 gene lptA 1534 2094 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV7 protein_id gnl|my_center|LOCUS_25380 2165 2890 gene locus_tag LOCUS_25390 2165 2890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence395 1225 1986 gene locus_tag LOCUS_25400 gene udp 1225 1986 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8L3 protein_id gnl|my_center|LOCUS_25400 2096 2464 gene locus_tag LOCUS_25410 2096 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3250 2519 gene locus_tag LOCUS_25420 3250 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence396 2652 1240 gene locus_tag LOCUS_25430 2652 1240 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_25430 3329 2667 gene locus_tag LOCUS_25440 3329 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25440 >Feature sequence397 <1 827 gene locus_tag LOCUS_25450 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37798:biotin carboxylase 1328 2209 gene locus_tag LOCUS_25460 1328 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2322 3209 gene locus_tag LOCUS_25470 gene prmA 2322 3209 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJR7 protein_id gnl|my_center|LOCUS_25470 >Feature sequence398 322 1566 gene locus_tag LOCUS_25480 322 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2558 1563 gene locus_tag LOCUS_25490 gene menC 2558 1563 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFN5 protein_id gnl|my_center|LOCUS_25490 3334 2555 gene locus_tag LOCUS_25500 gene menH 3334 2555 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVD9 protein_id gnl|my_center|LOCUS_25500 >Feature sequence399 765 1478 gene locus_tag LOCUS_25510 765 1478 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459332.1 protein_id gnl|my_center|LOCUS_25510 1628 2287 gene locus_tag LOCUS_25520 1628 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2713 3201 gene locus_tag LOCUS_25530 2713 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence400 1780 311 gene locus_tag LOCUS_25540 gene sdaA 1780 311 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810569.1 protein_id gnl|my_center|LOCUS_25540 3106 1835 gene locus_tag LOCUS_25550 3106 1835 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706270.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence401 649 2679 gene locus_tag LOCUS_25560 649 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3229 2684 gene locus_tag LOCUS_25570 3229 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence402 595 341 gene locus_tag LOCUS_25580 595 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 825 556 gene locus_tag LOCUS_25590 825 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1027 1578 gene locus_tag LOCUS_25600 1027 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_25600 1600 2871 gene locus_tag LOCUS_25610 gene codA 1600 2871 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704114.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence403 647 790 gene locus_tag LOCUS_25620 647 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25620 799 1932 gene locus_tag LOCUS_25630 gene bioA 799 1932 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGC1 protein_id gnl|my_center|LOCUS_25630 3212 1941 gene locus_tag LOCUS_25640 3212 1941 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873658.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence404 1043 240 gene locus_tag LOCUS_25650 gene ybbM 1043 240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263654.1 protein_id gnl|my_center|LOCUS_25650 1698 1033 gene locus_tag LOCUS_25660 1698 1033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787813.1 protein_id gnl|my_center|LOCUS_25660 1764 2084 gene locus_tag LOCUS_25670 1764 2084 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence405 831 1103 gene locus_tag LOCUS_25680 831 1103 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658248.1 protein_id gnl|my_center|LOCUS_25680 1522 1193 gene locus_tag LOCUS_25690 1522 1193 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035759.1 protein_id gnl|my_center|LOCUS_25690 2489 1692 gene locus_tag LOCUS_25700 2489 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2703 2533 gene locus_tag LOCUS_25710 2703 2533 CDS product XapX domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 protein_id gnl|my_center|LOCUS_25710 <3373 2816 gene locus_tag LOCUS_25720 <3373 2816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0WJM7:nucleoside permease >Feature sequence406 2200 1976 gene locus_tag LOCUS_25730 2200 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2347 2760 gene locus_tag LOCUS_25740 2347 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence407 145 615 gene locus_tag LOCUS_25750 145 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1088 612 gene locus_tag LOCUS_25760 1088 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1943 1245 gene locus_tag LOCUS_25770 1943 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2100 1975 gene locus_tag LOCUS_25780 2100 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2575 2069 gene locus_tag LOCUS_25790 2575 2069 CDS product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25790 3107 2565 gene locus_tag LOCUS_25800 3107 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence408 264 1577 gene locus_tag LOCUS_25810 264 1577 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_25810 1729 1848 gene locus_tag LOCUS_25820 1729 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2493 1948 gene locus_tag LOCUS_25830 2493 1948 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 protein_id gnl|my_center|LOCUS_25830 3215 2763 gene locus_tag LOCUS_25840 3215 2763 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence409 974 1600 gene locus_tag LOCUS_25850 gene gpmB 974 1600 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_25850 2639 1617 gene locus_tag LOCUS_25860 2639 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence410 383 1081 gene locus_tag LOCUS_25870 383 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246128.1 protein_id gnl|my_center|LOCUS_25870 1062 1475 gene locus_tag LOCUS_25880 1062 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103354.1 protein_id gnl|my_center|LOCUS_25880 1505 1852 gene locus_tag LOCUS_25890 1505 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1935 2177 gene locus_tag LOCUS_25900 gene parD-1 1935 2177 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_25900 2174 2470 gene locus_tag LOCUS_25910 2174 2470 CDS product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_25910 2890 2524 gene locus_tag LOCUS_tm00020 2890 2524 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence411 557 922 gene locus_tag LOCUS_25920 557 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1379 1125 gene locus_tag LOCUS_25930 1379 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 1545 2975 gene locus_tag LOCUS_25940 1545 2975 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367184.1 protein_id gnl|my_center|LOCUS_25940 3222 2977 gene locus_tag LOCUS_25950 3222 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence412 1406 504 gene locus_tag LOCUS_25960 1406 504 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_25960 2362 1409 gene locus_tag LOCUS_25970 2362 1409 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_25970 2659 2462 gene locus_tag LOCUS_25980 2659 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence413 1674 1543 gene locus_tag LOCUS_25990 1674 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1787 2908 gene locus_tag LOCUS_26000 1787 2908 CDS product insertion sequence IS91 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_707640.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence414 144 752 gene locus_tag LOCUS_26010 gene sodC 144 752 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBA0 protein_id gnl|my_center|LOCUS_26010 1774 971 gene locus_tag LOCUS_26020 gene trpC 1774 971 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 protein_id gnl|my_center|LOCUS_26020 2820 1783 gene locus_tag LOCUS_26030 gene trpD 2820 1783 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML2 protein_id gnl|my_center|LOCUS_26030 >Feature sequence415 2672 504 gene locus_tag LOCUS_26040 2672 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26040 <3227 2685 gene locus_tag LOCUS_26050 <3227 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482717.1:hemolysin D >Feature sequence416 85 645 gene locus_tag LOCUS_26060 85 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26060 608 1066 gene locus_tag LOCUS_26070 608 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26070 1450 2469 gene locus_tag LOCUS_26080 gene epd 1450 2469 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_26080 2525 3094 gene locus_tag LOCUS_26090 2525 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence417 435 827 gene locus_tag LOCUS_26100 435 827 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268263.1 protein_id gnl|my_center|LOCUS_26100 829 1188 gene locus_tag LOCUS_26110 gene tusC 829 1188 CDS product protein TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L41 protein_id gnl|my_center|LOCUS_26110 1188 1460 gene locus_tag LOCUS_26120 1188 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1644 2237 gene locus_tag LOCUS_26130 1644 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_26130 2911 2264 gene locus_tag LOCUS_26140 2911 2264 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence418 995 111 gene locus_tag LOCUS_26150 995 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26150 1457 1143 gene locus_tag LOCUS_26160 1457 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3163 1535 gene locus_tag LOCUS_26170 3163 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence419 191 637 gene locus_tag LOCUS_26180 191 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 730 2205 gene locus_tag LOCUS_26190 730 2205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703155.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence420 <1 1770 gene locus_tag LOCUS_26200 <1 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003163304.1:motility protein FimV 1872 2675 gene locus_tag LOCUS_26210 gene truA 1872 2675 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 protein_id gnl|my_center|LOCUS_26210 >Feature sequence421 184 2940 gene locus_tag LOCUS_26220 184 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence422 1369 536 gene locus_tag LOCUS_26230 1369 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1796 2866 gene locus_tag LOCUS_26240 1796 2866 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence423 621 1811 gene locus_tag LOCUS_26250 gene hemY 621 1811 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_26250 <3175 1808 gene locus_tag LOCUS_26260 <3175 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480039.1:ABC transporter ATP-binding protein >Feature sequence424 311 1663 gene locus_tag LOCUS_26270 311 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2655 1729 gene locus_tag LOCUS_26280 2655 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3161 2817 gene locus_tag LOCUS_26290 3161 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 >Feature sequence425 178 102 gene locus_tag LOCUS_t00320 178 102 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1613 288 gene locus_tag LOCUS_26300 1613 288 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_26300 2003 2251 gene locus_tag LOCUS_26310 2003 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 3103 2267 gene locus_tag LOCUS_26320 3103 2267 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103137.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence426 1946 717 gene locus_tag LOCUS_26330 gene ftsZ 1946 717 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSB0 protein_id gnl|my_center|LOCUS_26330 <3157 2009 gene locus_tag LOCUS_26340 <3157 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZNZ4:cell division protein FtsA >Feature sequence427 <1 853 gene locus_tag LOCUS_26350 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211331.1:formate transporter FocA 970 1515 gene locus_tag LOCUS_26360 970 1515 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749H7 protein_id gnl|my_center|LOCUS_26360 1512 2126 gene locus_tag LOCUS_26370 gene yqiA 1512 2126 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence428 1730 306 gene locus_tag LOCUS_26380 1730 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2333 1995 gene locus_tag LOCUS_26390 2333 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence429 <1 751 gene locus_tag LOCUS_26400 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I541:ribosomal protein S12 methylthiotransferase RimO >Feature sequence430 2176 239 gene locus_tag LOCUS_26410 gene mutL 2176 239 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_26410 2698 2279 gene locus_tag LOCUS_26420 2698 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence431 520 996 gene locus_tag LOCUS_26430 520 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_26430 1289 1038 gene locus_tag LOCUS_26440 1289 1038 CDS product UPF0153 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT48 protein_id gnl|my_center|LOCUS_26440 >Feature sequence432 2220 889 gene locus_tag LOCUS_26450 2220 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2833 2261 gene locus_tag LOCUS_26460 gene cheB2 2833 2261 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_26460 >Feature sequence433 1719 475 gene locus_tag LOCUS_26470 1719 475 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SB7 protein_id gnl|my_center|LOCUS_26470 1876 2580 gene locus_tag LOCUS_26480 1876 2580 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946517.1 protein_id gnl|my_center|LOCUS_26480 <3106 2564 gene locus_tag LOCUS_26490 <3106 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZEI2:cardiolipin synthase A >Feature sequence434 375 1040 gene locus_tag LOCUS_26500 375 1040 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_26500 1073 2185 gene locus_tag LOCUS_26510 gene rpoS 1073 2185 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_26510 2577 2254 gene locus_tag LOCUS_26520 gene fdxA 2577 2254 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_26520 >Feature sequence435 1131 1673 gene locus_tag LOCUS_26530 1131 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence436 >Feature sequence437 <1 716 gene locus_tag LOCUS_26540 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096276.1:secretion pathway ATPase 776 1657 gene locus_tag LOCUS_26550 776 1657 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_26550 1767 2714 gene locus_tag LOCUS_26560 1767 2714 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence438 2405 987 gene locus_tag LOCUS_26570 gene rhlB 2405 987 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_26570 2951 2541 gene locus_tag LOCUS_26580 2951 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence439 <1 1449 gene locus_tag LOCUS_26590 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103249.1:autotransporter 2303 2728 gene locus_tag LOCUS_26600 2303 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence440 1791 790 gene locus_tag LOCUS_26610 1791 790 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_26610 2521 1793 gene locus_tag LOCUS_26620 2521 1793 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039036.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence441 3018 2779 gene locus_tag LOCUS_26630 3018 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence442 <1 2346 gene locus_tag LOCUS_26640 <1 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KP73:valine--tRNA ligase >Feature sequence443 474 1475 gene locus_tag LOCUS_26650 gene holB 474 1475 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_26650 1492 1833 gene locus_tag LOCUS_26660 gene pilZ 1492 1833 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_26660 1897 2685 gene locus_tag LOCUS_26670 1897 2685 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408301.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence444 685 32 gene locus_tag LOCUS_26680 685 32 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459160.1 protein_id gnl|my_center|LOCUS_26680 1763 675 gene locus_tag LOCUS_26690 gene metN 1763 675 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTJ5 protein_id gnl|my_center|LOCUS_26690 2699 1947 gene locus_tag LOCUS_26700 2699 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence445 654 13 gene locus_tag LOCUS_26710 gene maf-2 654 13 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS4 protein_id gnl|my_center|LOCUS_26710 1085 597 gene locus_tag LOCUS_26720 gene mreD 1085 597 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_26720 1933 1082 gene locus_tag LOCUS_26730 gene mreC 1933 1082 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_26730 3030 2059 gene locus_tag LOCUS_26740 3030 2059 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence446 125 664 gene locus_tag LOCUS_26750 125 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 <3032 724 gene locus_tag LOCUS_26760 <3032 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261091.1:transporter >Feature sequence447 1275 1057 gene locus_tag LOCUS_26770 1275 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1379 1522 gene locus_tag LOCUS_26780 1379 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1720 2307 gene locus_tag LOCUS_26790 1720 2307 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence448 1063 2247 gene locus_tag LOCUS_26800 gene ackA1 1063 2247 CDS product acetate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MZ4 protein_id gnl|my_center|LOCUS_26800 >Feature sequence449 224 1324 gene locus_tag LOCUS_26810 gene ivdE 224 1324 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_26810 1963 1340 gene locus_tag LOCUS_26820 1963 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2449 2138 gene locus_tag LOCUS_26830 2449 2138 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_26830 <2982 2480 gene locus_tag LOCUS_26840 <2982 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090707.1:TetR family transcriptional regulator >Feature sequence450 240 79 gene locus_tag LOCUS_26850 240 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 857 210 gene locus_tag LOCUS_26860 857 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1602 1159 gene locus_tag LOCUS_26870 1602 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2516 1770 gene locus_tag LOCUS_26880 2516 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence451 1663 461 gene locus_tag LOCUS_26890 gene coxB 1663 461 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_26890 >Feature sequence452 1085 495 gene locus_tag LOCUS_26900 1085 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2632 1280 gene locus_tag LOCUS_26910 2632 1280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence453 225 515 gene locus_tag LOCUS_26920 225 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26920 685 1359 gene locus_tag LOCUS_26930 685 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26930 2770 1436 gene locus_tag LOCUS_26940 2770 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence454 <2915 612 gene locus_tag LOCUS_26950 <2915 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2Q2:methionine synthase >Feature sequence455 944 303 gene locus_tag LOCUS_26960 gene pyrE 944 303 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50587 protein_id gnl|my_center|LOCUS_26960 1294 2067 gene locus_tag LOCUS_26970 gene crc 1294 2067 CDS product catabolite repression control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_26970 2726 2118 gene locus_tag LOCUS_26980 2726 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence456 1801 911 gene locus_tag LOCUS_26990 gene malG 1801 911 CDS product maltose transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_26990 <2898 1838 gene locus_tag LOCUS_27000 <2898 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705559.1:maltose ABC transporter permease MalF >Feature sequence457 273 1073 gene locus_tag LOCUS_27010 273 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 <2896 1570 gene locus_tag LOCUS_27020 <2896 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705867.1:peptidase M16 >Feature sequence458 902 552 gene locus_tag LOCUS_27030 902 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2234 1041 gene locus_tag LOCUS_27040 gene emrD 2234 1041 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705603.1 protein_id gnl|my_center|LOCUS_27040 2424 2741 gene locus_tag LOCUS_27050 2424 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence459 <1 1836 gene locus_tag LOCUS_27060 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087413.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence460 85 618 gene locus_tag LOCUS_27070 85 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 790 2430 gene locus_tag LOCUS_27080 790 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071880.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence461 <1 1617 gene locus_tag LOCUS_27090 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KTM7:proline--tRNA ligase 1658 2173 gene locus_tag LOCUS_27100 1658 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence462 83 1243 gene locus_tag LOCUS_27110 83 1243 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_27110 2051 1320 gene locus_tag LOCUS_27120 2051 1320 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_27120 2207 2752 gene locus_tag LOCUS_27130 2207 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence463 1014 421 gene locus_tag LOCUS_27140 1014 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_27140 2060 1032 gene locus_tag LOCUS_27150 gene metX 2060 1032 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 protein_id gnl|my_center|LOCUS_27150 2429 2854 gene locus_tag LOCUS_27160 2429 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence464 841 1065 gene locus_tag LOCUS_27170 841 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1065 1478 gene locus_tag LOCUS_27180 1065 1478 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_27180 2572 1487 gene locus_tag LOCUS_27190 2572 1487 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880750.1 protein_id gnl|my_center|LOCUS_27190 2814 2569 gene locus_tag LOCUS_27200 2814 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence465 1731 580 gene locus_tag LOCUS_27210 gene rfe 1731 580 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8H1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence466 >Feature sequence467 >Feature sequence468 1479 394 gene locus_tag LOCUS_27220 gene aroC 1479 394 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ85 protein_id gnl|my_center|LOCUS_27220 2440 1496 gene locus_tag LOCUS_27230 gene prmB 2440 1496 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I347 protein_id gnl|my_center|LOCUS_27230 2712 2636 gene locus_tag LOCUS_t00330 2712 2636 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2845 2753 gene locus_tag LOCUS_t00340 2845 2753 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence469 146 1477 gene locus_tag LOCUS_27240 146 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167501.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence470 237 1085 gene locus_tag LOCUS_27250 gene lgt 237 1085 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_27250 1082 1915 gene locus_tag LOCUS_27260 gene thyA 1082 1915 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence471 768 205 gene locus_tag LOCUS_27270 768 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1958 945 gene locus_tag LOCUS_27280 1958 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976394.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence472 142 528 gene locus_tag LOCUS_27290 142 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence473 731 1207 gene locus_tag LOCUS_27300 gene rppH 731 1207 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD65 protein_id gnl|my_center|LOCUS_27300 >Feature sequence474 904 38 gene locus_tag LOCUS_27310 904 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1445 2182 gene locus_tag LOCUS_27320 1445 2182 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_27320 2736 2224 gene locus_tag LOCUS_27330 2736 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence475 <1 2670 gene locus_tag LOCUS_27340 <1 2670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWR3:DNA-directed DNA polymerase >Feature sequence476 994 545 gene locus_tag LOCUS_27350 994 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2003 1233 gene locus_tag LOCUS_27360 2003 1233 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122123.1 protein_id gnl|my_center|LOCUS_27360 2312 2055 gene locus_tag LOCUS_27370 2312 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence477 500 177 gene locus_tag LOCUS_27380 500 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 587 829 gene locus_tag LOCUS_27390 587 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 826 1227 gene locus_tag LOCUS_27400 826 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2231 1245 gene locus_tag LOCUS_27410 2231 1245 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence478 1434 667 gene locus_tag LOCUS_27420 gene dsbC 1434 667 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_27420 <2770 1657 gene locus_tag LOCUS_27430 <2770 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000806400.1:Bcr/CflA family drug resistance efflux transporter >Feature sequence479 2619 346 gene locus_tag LOCUS_27440 2619 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence480 581 1615 gene locus_tag LOCUS_27450 581 1615 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969496.1 protein_id gnl|my_center|LOCUS_27450 1626 2582 gene locus_tag LOCUS_27460 1626 2582 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence481 231 1586 gene locus_tag LOCUS_27470 gene pmbA 231 1586 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence482 2437 1100 gene locus_tag LOCUS_27480 gene nqrA 2437 1100 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_27480 2547 2735 gene locus_tag LOCUS_27490 2547 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence483 1025 498 gene locus_tag LOCUS_27500 gene ppa 1025 498 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 protein_id gnl|my_center|LOCUS_27500 1204 1656 gene locus_tag LOCUS_27510 1204 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2148 1687 gene locus_tag LOCUS_27520 2148 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence484 <1 715 gene locus_tag LOCUS_27530 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E328:2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase 715 1200 gene locus_tag LOCUS_27540 gene ispF 715 1200 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_27540 1197 2267 gene locus_tag LOCUS_27550 gene truD 1197 2267 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_27550 >Feature sequence485 1782 2258 gene locus_tag LOCUS_27560 1782 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence486 1965 2306 gene locus_tag LOCUS_27570 1965 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence487 358 486 gene locus_tag LOCUS_27580 358 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 500 1147 gene locus_tag LOCUS_27590 500 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1177 2343 gene locus_tag LOCUS_27600 1177 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence488 >Feature sequence489 514 233 gene locus_tag LOCUS_27610 514 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1676 525 gene locus_tag LOCUS_27620 1676 525 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609761.1 protein_id gnl|my_center|LOCUS_27620 1742 2434 gene locus_tag LOCUS_27630 gene rsuA 1742 2434 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5J6 protein_id gnl|my_center|LOCUS_27630 >Feature sequence490 180 560 gene locus_tag LOCUS_27640 180 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 573 917 gene locus_tag LOCUS_27650 573 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1018 1314 gene locus_tag LOCUS_27660 1018 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1449 2177 gene locus_tag LOCUS_27670 1449 2177 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477748.1 protein_id gnl|my_center|LOCUS_27670 2256 2426 gene locus_tag LOCUS_27680 2256 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence491 350 1390 gene locus_tag LOCUS_27690 gene rsgA2 350 1390 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_27690 1539 1997 gene locus_tag LOCUS_27700 1539 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence492 <1 840 gene locus_tag LOCUS_27710 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZN38:tRNA-dihydrouridine synthase B 837 1130 gene locus_tag LOCUS_27720 837 1130 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_27720 >Feature sequence493 1654 1289 gene locus_tag LOCUS_27730 1654 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 protein_id gnl|my_center|LOCUS_27730 1937 1626 gene locus_tag LOCUS_27740 gene ihfA 1937 1626 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 protein_id gnl|my_center|LOCUS_27740 <2652 2044 gene locus_tag LOCUS_27750 <2652 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q883H7:phenylalanine--tRNA ligase beta subunit >Feature sequence494 121 954 gene locus_tag LOCUS_27760 gene bax 121 954 CDS product glucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_27760 972 1796 gene locus_tag LOCUS_27770 972 1796 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence495 <2641 228 gene locus_tag LOCUS_27780 <2641 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707198.1:outer membrane protein >Feature sequence496 1697 1104 gene locus_tag LOCUS_27790 1697 1104 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_27790 >Feature sequence497 398 658 gene locus_tag LOCUS_27800 398 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 729 2468 gene locus_tag LOCUS_27810 729 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086037.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence498 1122 2372 gene locus_tag LOCUS_27820 gene ltrA 1122 2372 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence499 <1 1190 gene locus_tag LOCUS_27830 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004599076.1:methyltransferase 1198 2508 gene locus_tag LOCUS_27840 1198 2508 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599076.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence500 2147 990 gene locus_tag LOCUS_27850 2147 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence501 1016 135 gene locus_tag LOCUS_27860 1016 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2381 1164 gene locus_tag LOCUS_27870 2381 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430586.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence502 <1 1074 gene locus_tag LOCUS_27880 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003382103.1:glutamine synthetase >Feature sequence503 2155 1151 gene locus_tag LOCUS_27890 gene asd-2 2155 1151 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN9 protein_id gnl|my_center|LOCUS_27890 >Feature sequence504 2243 804 gene locus_tag LOCUS_27900 gene lpdG 2243 804 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence505 614 279 gene locus_tag LOCUS_27910 614 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2005 923 gene locus_tag LOCUS_27920 2005 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2469 2002 gene locus_tag LOCUS_27930 2469 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence506 468 136 gene locus_tag LOCUS_27940 468 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1658 471 gene locus_tag LOCUS_27950 1658 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2156 1668 gene locus_tag LOCUS_27960 2156 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence507 279 2315 gene locus_tag LOCUS_27970 279 2315 CDS product dTDP-D-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence508 1210 296 gene locus_tag LOCUS_27980 1210 296 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704088.1 protein_id gnl|my_center|LOCUS_27980 1358 2263 gene locus_tag LOCUS_27990 1358 2263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704087.1 protein_id gnl|my_center|LOCUS_27990 2374 2449 gene locus_tag LOCUS_t00350 2374 2449 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence509 225 692 gene locus_tag LOCUS_28000 gene purE 225 692 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_28000 689 1798 gene locus_tag LOCUS_28010 gene purK 689 1798 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE0 protein_id gnl|my_center|LOCUS_28010 1891 2424 gene locus_tag LOCUS_28020 1891 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence510 1240 491 gene locus_tag LOCUS_28030 gene galU 1240 491 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_28030 1579 1908 gene locus_tag LOCUS_28040 1579 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2401 2012 gene locus_tag LOCUS_28050 2401 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence511 722 2275 gene locus_tag LOCUS_28060 722 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_28060 >Feature sequence512 127 1008 gene locus_tag LOCUS_28070 127 1008 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQF7 protein_id gnl|my_center|LOCUS_28070 >Feature sequence513 1070 300 gene locus_tag LOCUS_28080 gene ygdL 1070 300 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 protein_id gnl|my_center|LOCUS_28080 1857 1267 gene locus_tag LOCUS_28090 1857 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence514 202 1335 gene locus_tag LOCUS_28100 202 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence515 314 628 gene locus_tag LOCUS_28110 314 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2015 762 gene locus_tag LOCUS_28120 2015 762 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence516 1054 512 gene locus_tag LOCUS_28130 gene ccmE 1054 512 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_28130 1305 1051 gene locus_tag LOCUS_28140 1305 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2055 1321 gene locus_tag LOCUS_28150 gene ccmC 2055 1321 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_28150 2499 2098 gene locus_tag LOCUS_28160 2499 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence517 <1 918 gene locus_tag LOCUS_28170 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B7NA97:ATP-dependent RNA helicase RhlE 920 1321 gene locus_tag LOCUS_28180 920 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099687.1 protein_id gnl|my_center|LOCUS_28180 2221 1484 gene locus_tag LOCUS_28190 2221 1484 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence518 <1 1190 gene locus_tag LOCUS_28200 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229330.1:beta-glucosidase 2421 1405 gene locus_tag LOCUS_28210 2421 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28210 >Feature sequence519 481 810 gene locus_tag LOCUS_28220 481 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2141 1026 gene locus_tag LOCUS_28230 2141 1026 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I01 protein_id gnl|my_center|LOCUS_28230 >Feature sequence520 >Feature sequence521 <1 775 gene locus_tag LOCUS_28240 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5G7:signal peptidase I 1041 1739 gene locus_tag LOCUS_28250 gene rnc 1041 1739 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence522 249 833 gene locus_tag LOCUS_28260 gene rnfA 249 833 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 protein_id gnl|my_center|LOCUS_28260 853 1446 gene locus_tag LOCUS_28270 853 1446 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_28270 >Feature sequence523 2190 1714 gene locus_tag LOCUS_28280 2190 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence524 1049 2116 gene locus_tag LOCUS_28290 1049 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28290 2132 2305 gene locus_tag LOCUS_28300 2132 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence525 1576 263 gene locus_tag LOCUS_28310 gene hisD 1576 263 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_28310 2232 1573 gene locus_tag LOCUS_28320 gene hisG 2232 1573 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 protein_id gnl|my_center|LOCUS_28320 >Feature sequence526 <1 1356 gene locus_tag LOCUS_28330 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011242272.1:DNA methyltransferase >Feature sequence527 44 868 gene locus_tag LOCUS_28340 gene insH 44 868 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322394.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28340 >Feature sequence528 1779 28 gene locus_tag LOCUS_28350 1779 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence529 362 132 gene locus_tag LOCUS_28360 362 132 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYE3 protein_id gnl|my_center|LOCUS_28360 1096 359 gene locus_tag LOCUS_28370 1096 359 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_28370 2335 1184 gene locus_tag LOCUS_28380 2335 1184 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence530 2144 2071 gene locus_tag LOCUS_t00360 2144 2071 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2405 2332 gene locus_tag LOCUS_t00370 2405 2332 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence531 >Feature sequence532 551 2290 gene locus_tag LOCUS_28390 gene lepA 551 2290 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_28390 >Feature sequence533 58 1419 gene locus_tag LOCUS_28400 58 1419 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074069.1 protein_id gnl|my_center|LOCUS_28400 2105 1602 gene locus_tag LOCUS_28410 2105 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence534 323 844 gene locus_tag LOCUS_28420 323 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1143 1328 gene locus_tag LOCUS_28430 1143 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2215 1343 gene locus_tag LOCUS_28440 2215 1343 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence535 151 705 gene locus_tag LOCUS_28450 151 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1891 872 gene locus_tag LOCUS_28460 gene pyrD 1891 872 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 protein_id gnl|my_center|LOCUS_28460 >Feature sequence536 1504 2184 gene locus_tag LOCUS_28470 1504 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence537 41 313 gene locus_tag LOCUS_28480 41 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1910 507 gene locus_tag LOCUS_28490 1910 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence538 <1 783 gene locus_tag LOCUS_28500 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F9Y6:tryptophan synthase alpha chain 794 1732 gene locus_tag LOCUS_28510 gene accD 794 1732 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_28510 1774 2208 gene locus_tag LOCUS_28520 1774 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817109.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence539 132 749 gene locus_tag LOCUS_28530 132 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081997.1 protein_id gnl|my_center|LOCUS_28530 1965 811 gene locus_tag LOCUS_28540 1965 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489206.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence540 >Feature sequence541 1586 621 gene locus_tag LOCUS_28550 1586 621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704970.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence542 77 580 gene locus_tag LOCUS_28560 77 580 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK4 protein_id gnl|my_center|LOCUS_28560 714 1694 gene locus_tag LOCUS_28570 714 1694 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence543 1082 279 gene locus_tag LOCUS_28580 gene uppP1 1082 279 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_28580 1822 1151 gene locus_tag LOCUS_28590 1822 1151 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence544 <1 620 gene locus_tag LOCUS_28600 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074299.1:isochorismate synthase >Feature sequence545 >Feature sequence546 577 2082 gene locus_tag LOCUS_28610 577 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence547 >Feature sequence548 115 1326 gene locus_tag LOCUS_28620 115 1326 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_28620 2072 1332 gene locus_tag LOCUS_28630 2072 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence549 <1 726 gene locus_tag LOCUS_28640 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5U2:LPS-assembly protein LptD 734 2029 gene locus_tag LOCUS_28650 gene surA 734 2029 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_28650 >Feature sequence550 1891 1801 gene locus_tag LOCUS_t00380 1891 1801 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2049 1959 gene locus_tag LOCUS_t00390 2049 1959 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence551 288 956 gene locus_tag LOCUS_28660 gene pcm 288 956 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP9 protein_id gnl|my_center|LOCUS_28660 1150 2079 gene locus_tag LOCUS_28670 1150 2079 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence552 <2244 257 gene locus_tag LOCUS_28680 <2244 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973799.1:nitric oxide reductase NorD protein >Feature sequence553 >Feature sequence554 928 263 gene locus_tag LOCUS_28690 928 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1281 2189 gene locus_tag LOCUS_28700 1281 2189 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527957.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence555 878 759 gene locus_tag LOCUS_28710 878 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2028 1864 gene locus_tag LOCUS_28720 2028 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence556 523 1701 gene locus_tag LOCUS_28730 523 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707575.1 protein_id gnl|my_center|LOCUS_28730 2081 1719 gene locus_tag LOCUS_28740 2081 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence557 >Feature sequence558 1794 670 gene locus_tag LOCUS_28750 gene acads 1794 670 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_28750 2207 1806 gene locus_tag LOCUS_28760 2207 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence559 <1 1005 gene locus_tag LOCUS_28770 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXI1:protein translocase subunit SecD 1016 1939 gene locus_tag LOCUS_28780 gene secF 1016 1939 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_28780 >Feature sequence560 >Feature sequence561 1195 368 gene locus_tag LOCUS_28790 gene uspE 1195 368 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence562 303 1793 gene locus_tag LOCUS_28800 gene gltX 303 1793 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCL6 protein_id gnl|my_center|LOCUS_28800 2081 2156 gene locus_tag LOCUS_t00400 2081 2156 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence563 965 1099 gene locus_tag LOCUS_28810 965 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence564 372 1340 gene locus_tag LOCUS_28820 gene hldD 372 1340 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CD21 protein_id gnl|my_center|LOCUS_28820 >Feature sequence565 610 302 gene locus_tag LOCUS_28830 610 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28830 1047 769 gene locus_tag LOCUS_28840 1047 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 1544 975 gene locus_tag LOCUS_28850 1544 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28850 >Feature sequence566 >Feature sequence567 497 1417 gene locus_tag LOCUS_28860 gene pyrB 497 1417 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG0 protein_id gnl|my_center|LOCUS_28860 1432 1890 gene locus_tag LOCUS_28870 gene pyrI 1432 1890 CDS product aspartate carbamoyltransferase regulatory chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQG1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence568 804 376 gene locus_tag LOCUS_28880 804 376 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_28880 1481 801 gene locus_tag LOCUS_28890 1481 801 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 protein_id gnl|my_center|LOCUS_28890 <2155 1456 gene locus_tag LOCUS_28900 <2155 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072146.1:helicase >Feature sequence569 663 2042 gene locus_tag LOCUS_28910 gene hutW 663 2042 CDS product putative heme utilization radical SAM enzyme HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261842.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence570 1815 433 gene locus_tag LOCUS_28920 gene cysS 1815 433 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVN9 protein_id gnl|my_center|LOCUS_28920 >Feature sequence571 60 1283 gene locus_tag LOCUS_28930 gene kpsE 60 1283 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851300.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence572 919 1269 gene locus_tag LOCUS_28940 919 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence573 221 1018 gene locus_tag LOCUS_28950 221 1018 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_28950 1128 1901 gene locus_tag LOCUS_28960 1128 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence574 639 211 gene locus_tag LOCUS_28970 gene rplM 639 211 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ3 protein_id gnl|my_center|LOCUS_28970 805 650 gene locus_tag LOCUS_28980 805 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 931 1962 gene locus_tag LOCUS_28990 931 1962 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence575 759 352 gene locus_tag LOCUS_29000 gene pilE 759 352 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_29000 2120 756 gene locus_tag LOCUS_29010 2120 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence576 680 285 gene locus_tag LOCUS_29020 680 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1671 1219 gene locus_tag LOCUS_29030 1671 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence577 >Feature sequence578 522 142 gene locus_tag LOCUS_29040 522 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 873 526 gene locus_tag LOCUS_29050 gene yfgD 873 526 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL01 protein_id gnl|my_center|LOCUS_29050 1007 1558 gene locus_tag LOCUS_29060 1007 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence579 >Feature sequence580 1206 157 gene locus_tag LOCUS_29070 1206 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence581 >Feature sequence582 1019 186 gene locus_tag LOCUS_29080 1019 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1625 1951 gene locus_tag LOCUS_29090 1625 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence583 579 809 gene locus_tag LOCUS_29100 579 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence584 435 133 gene locus_tag LOCUS_29110 435 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence585 922 245 gene locus_tag LOCUS_29120 922 245 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_29120 1576 935 gene locus_tag LOCUS_29130 1576 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence586 323 1327 gene locus_tag LOCUS_29140 gene pilC 323 1327 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence587 2 493 gene locus_tag LOCUS_29150 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 515 1153 gene locus_tag LOCUS_29160 515 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence588 1209 322 gene locus_tag LOCUS_29170 gene hdtR 1209 322 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_29170 1331 1678 gene locus_tag LOCUS_29180 1331 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence589 1402 1067 gene locus_tag LOCUS_29190 1402 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence590 879 142 gene locus_tag LOCUS_29200 879 142 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence591 <1 550 gene locus_tag LOCUS_29210 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081423274.1:restriction endonuclease subunit S >Feature sequence592 1 1578 gene locus_tag LOCUS_29220 1 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence593 1155 985 gene locus_tag LOCUS_29230 1155 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 <2024 1398 gene locus_tag LOCUS_29240 <2024 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY30:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence594 >Feature sequence595 517 1407 gene locus_tag LOCUS_29250 517 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1452 1898 gene locus_tag LOCUS_29260 1452 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence596 757 458 gene locus_tag LOCUS_29270 757 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 935 750 gene locus_tag LOCUS_29280 935 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1154 939 gene locus_tag LOCUS_29290 1154 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1361 1942 gene locus_tag LOCUS_29300 1361 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence597 991 1581 gene locus_tag LOCUS_29310 991 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326532.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence598 654 178 gene locus_tag LOCUS_29320 654 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1079 804 gene locus_tag LOCUS_29330 1079 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1342 1076 gene locus_tag LOCUS_29340 1342 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence599 >Feature sequence600 2 193 gene locus_tag LOCUS_29350 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 602 324 gene locus_tag LOCUS_29360 602 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1185 679 gene locus_tag LOCUS_29370 1185 679 CDS product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085175.1 protein_id gnl|my_center|LOCUS_29370 <2010 1182 gene locus_tag LOCUS_29380 <2010 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113197.1:bacteriophage protein >Feature sequence601 >Feature sequence602 1912 473 gene locus_tag LOCUS_29390 1912 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence603 <1 1008 gene locus_tag LOCUS_29400 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62GE0:histidinol-phosphate aminotransferase 1 1838 1014 gene locus_tag LOCUS_29410 1838 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence604 >Feature sequence605 <1997 213 gene locus_tag LOCUS_29420 <1997 213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948958.1:methyl-accepting chemotaxis protein >Feature sequence606 261 524 gene locus_tag LOCUS_29430 261 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 525 1817 gene locus_tag LOCUS_29440 525 1817 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005837038.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence607 487 1884 gene locus_tag LOCUS_29450 487 1884 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707739.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence608 <1 511 gene locus_tag LOCUS_29460 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E8X4:Trk system potassium uptake protein 569 1435 gene locus_tag LOCUS_29470 gene lpxM 569 1435 CDS product lipid A biosynthesis myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVD4 protein_id gnl|my_center|LOCUS_29470 >Feature sequence609 <1 940 gene locus_tag LOCUS_29480 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532680.1:serine/threonine dehydratase 1827 946 gene locus_tag LOCUS_29490 1827 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence610 564 1814 gene locus_tag LOCUS_29500 564 1814 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence611 <1973 1372 gene locus_tag LOCUS_29510 <1973 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E5T2:UPF0721 transmembrane protein note possible pseudo, internal stop codon >Feature sequence612 430 1035 gene locus_tag LOCUS_29520 430 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1050 1700 gene locus_tag LOCUS_29530 1050 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence613 602 237 gene locus_tag LOCUS_29540 602 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1069 683 gene locus_tag LOCUS_29550 1069 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_29550 <1963 1085 gene locus_tag LOCUS_29560 <1963 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KIB5:succinyl-diaminopimelate desuccinylase >Feature sequence614 549 40 gene locus_tag LOCUS_29570 549 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence615 718 278 gene locus_tag LOCUS_29580 718 278 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479871.1 protein_id gnl|my_center|LOCUS_29580 <1953 876 gene locus_tag LOCUS_29590 <1953 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000080288.1:aldehyde dehydrogenase >Feature sequence616 1209 304 gene locus_tag LOCUS_29600 1209 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1809 1294 gene locus_tag LOCUS_29610 gene smpB 1809 1294 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_29610 >Feature sequence617 571 1722 gene locus_tag LOCUS_29620 571 1722 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884086.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence618 1391 30 gene locus_tag LOCUS_29630 gene phoQ 1391 30 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039015.1 protein_id gnl|my_center|LOCUS_29630 <1940 1388 gene locus_tag LOCUS_29640 <1940 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002808458.1:DNA-binding response regulator >Feature sequence619 529 1116 gene locus_tag LOCUS_29650 529 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29650 >Feature sequence620 >Feature sequence621 1681 665 gene locus_tag LOCUS_29660 1681 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence622 1833 229 gene locus_tag LOCUS_29670 1833 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence623 <1918 872 gene locus_tag LOCUS_29680 <1918 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KJU3:Lon protease >Feature sequence624 >Feature sequence625 550 1713 gene locus_tag LOCUS_29690 550 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence626 1907 864 gene locus_tag LOCUS_29700 1907 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence627 430 5 gene locus_tag LOCUS_29710 430 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1657 452 gene locus_tag LOCUS_29720 1657 452 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571083.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence628 <1896 1320 gene locus_tag LOCUS_29730 <1896 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0L1:high frequency lysogenization protein HflD >Feature sequence629 1367 357 gene locus_tag LOCUS_29740 gene galE 1367 357 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_29740 1892 1374 gene locus_tag LOCUS_29750 1892 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence630 <1888 382 gene locus_tag LOCUS_29760 <1888 382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001154355.1:ABC transporter >Feature sequence631 53 283 gene locus_tag LOCUS_29770 53 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 523 1107 gene locus_tag LOCUS_29780 523 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704659.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence632 <1 1478 gene locus_tag LOCUS_29790 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5A5:phosphate acetyltransferase 1732 1490 gene locus_tag LOCUS_29800 1732 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence633 <1855 1147 gene locus_tag LOCUS_29810 <1855 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263237.1:multidrug transporter AcrB >Feature sequence634 <1 1183 gene locus_tag LOCUS_29820 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087940.1:ABC transporter ATP-binding protein 1564 1220 gene locus_tag LOCUS_29830 1564 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence635 161 793 gene locus_tag LOCUS_29840 161 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 1322 819 gene locus_tag LOCUS_29850 1322 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence636 1756 869 gene locus_tag LOCUS_29860 1756 869 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403135.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence637 1127 240 gene locus_tag LOCUS_29870 1127 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence638 1008 580 gene locus_tag LOCUS_29880 gene ibpA 1008 580 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_29880 1639 1139 gene locus_tag LOCUS_29890 1639 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence639 1032 367 gene locus_tag LOCUS_29900 gene cas5e 1032 367 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942037.1 protein_id gnl|my_center|LOCUS_29900 <1799 1035 gene locus_tag LOCUS_29910 <1799 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942036.1:type I-E CRISPR-associated protein Cas7/Cse4/CasC >Feature sequence640 <1 1622 gene locus_tag LOCUS_29920 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EII0:histidine kinase >Feature sequence641 1786 1223 gene locus_tag LOCUS_29930 1786 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence642 1665 733 gene locus_tag LOCUS_29940 1665 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence643 380 1021 gene locus_tag LOCUS_29950 gene leuD 380 1021 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_29950 >Feature sequence644 94 912 gene locus_tag LOCUS_29960 94 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence645 974 330 gene locus_tag LOCUS_29970 974 330 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence646 270 959 gene locus_tag LOCUS_29980 270 959 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 protein_id gnl|my_center|LOCUS_29980 972 1763 gene locus_tag LOCUS_29990 972 1763 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence647 406 98 gene locus_tag LOCUS_30000 406 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 718 1173 gene locus_tag LOCUS_30010 718 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1612 1358 gene locus_tag LOCUS_30020 1612 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence648 <1761 886 gene locus_tag LOCUS_30030 <1761 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705189.1:MATE family efflux transporter >Feature sequence649 1386 232 gene locus_tag LOCUS_30040 gene nhaA 1386 232 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY62 protein_id gnl|my_center|LOCUS_30040 >Feature sequence650 >Feature sequence651 <1 526 gene locus_tag LOCUS_30050 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088101.1:transcriptional regulator 1183 542 gene locus_tag LOCUS_30060 1183 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence652 >Feature sequence653 1070 159 gene locus_tag LOCUS_30070 1070 159 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIL2 protein_id gnl|my_center|LOCUS_30070 <1726 1145 gene locus_tag LOCUS_30080 <1726 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209496.1:glycerol-3-phosphate dehydrogenase >Feature sequence654 1653 367 gene locus_tag LOCUS_30090 1653 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence655 579 322 gene locus_tag LOCUS_30100 579 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1369 614 gene locus_tag LOCUS_30110 1369 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence656 426 1100 gene locus_tag LOCUS_30120 426 1100 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence657 1055 894 gene locus_tag LOCUS_30130 1055 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence658 959 138 gene locus_tag LOCUS_30140 959 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 <1681 1124 gene locus_tag LOCUS_30150 <1681 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZZE1:aminotransferase >Feature sequence659 <1676 671 gene locus_tag LOCUS_30160 <1676 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TKT0:acetylornithine aminotransferase >Feature sequence660 >Feature sequence661 737 408 gene locus_tag LOCUS_30170 737 408 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056468.1 protein_id gnl|my_center|LOCUS_30170 <1665 920 gene locus_tag LOCUS_30180 <1665 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095726.1:acyl-CoA dehydrogenase >Feature sequence662 1501 728 gene locus_tag LOCUS_30190 1501 728 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence663 1275 163 gene locus_tag LOCUS_30200 1275 163 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137336.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence664 372 1277 gene locus_tag LOCUS_30210 gene menB 372 1277 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C7 protein_id gnl|my_center|LOCUS_30210 >Feature sequence665 >Feature sequence666 578 132 gene locus_tag LOCUS_30220 578 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 757 1146 gene locus_tag LOCUS_30230 757 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence667 <1613 237 gene locus_tag LOCUS_30240 <1613 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:multidrug transporter AcrB >Feature sequence668 245 1198 gene locus_tag LOCUS_30250 245 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence669 795 283 gene locus_tag LOCUS_30260 795 283 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence670 724 35 gene locus_tag LOCUS_30270 724 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1100 771 gene locus_tag LOCUS_30280 1100 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence671 <1546 444 gene locus_tag LOCUS_30290 <1546 444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVM5:Lon protease >Feature sequence672 636 1076 gene locus_tag LOCUS_30300 636 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence673 149 1039 gene locus_tag LOCUS_30310 gene rluB 149 1039 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ55 protein_id gnl|my_center|LOCUS_30310 1204 1503 gene locus_tag LOCUS_30320 1204 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence674 998 288 gene locus_tag LOCUS_30330 998 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence675 430 1026 gene locus_tag LOCUS_30340 430 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence676 107 622 gene locus_tag LOCUS_30350 107 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 634 1488 gene locus_tag LOCUS_30360 634 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360