>Feature sequence001 257 1534 gene locus_tag LOCUS_00010 257 1534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_00010 2856 1591 gene locus_tag LOCUS_00020 gene yxaM 2856 1591 CDS product putative MFS-type transporter YxaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42112 protein_id gnl|my_center|LOCUS_00020 3343 4143 gene locus_tag LOCUS_00030 3343 4143 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970566.1 protein_id gnl|my_center|LOCUS_00030 4150 6684 gene locus_tag LOCUS_00040 4150 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7084 7956 gene locus_tag LOCUS_00050 7084 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064422.1 protein_id gnl|my_center|LOCUS_00050 8068 8796 gene locus_tag LOCUS_00060 8068 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036548.1 protein_id gnl|my_center|LOCUS_00060 8961 10502 gene locus_tag LOCUS_00070 8961 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00070 10566 11054 gene locus_tag LOCUS_00080 10566 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 13783 11123 gene locus_tag LOCUS_00090 13783 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15880 13784 gene locus_tag LOCUS_00100 15880 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16762 16391 gene locus_tag LOCUS_00110 16762 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 17821 16871 gene locus_tag LOCUS_00120 17821 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 20718 17965 gene locus_tag LOCUS_00130 20718 17965 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_00130 21192 22778 gene locus_tag LOCUS_00140 21192 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22867 23580 gene locus_tag LOCUS_00150 22867 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23739 24833 gene locus_tag LOCUS_00160 23739 24833 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_00160 26975 24909 gene locus_tag LOCUS_00170 26975 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_00170 27393 27139 gene locus_tag LOCUS_00180 gene yoeB 27393 27139 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69348 protein_id gnl|my_center|LOCUS_00180 27593 27384 gene locus_tag LOCUS_00190 gene yefM 27593 27384 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69346 protein_id gnl|my_center|LOCUS_00190 28570 27845 gene locus_tag LOCUS_00200 28570 27845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 29572 28595 gene locus_tag LOCUS_00210 gene rbsC 29572 28595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120702.1 protein_id gnl|my_center|LOCUS_00210 31062 29569 gene locus_tag LOCUS_00220 gene rbsA 31062 29569 CDS product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120703.1 protein_id gnl|my_center|LOCUS_00220 32022 31084 gene locus_tag LOCUS_00230 gene rbsB 32022 31084 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120704.1 protein_id gnl|my_center|LOCUS_00230 33674 32019 gene locus_tag LOCUS_00240 33674 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 34007 34606 gene locus_tag LOCUS_00250 34007 34606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 36675 34759 gene locus_tag LOCUS_00260 36675 34759 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 protein_id gnl|my_center|LOCUS_00260 36785 37717 gene locus_tag LOCUS_00270 36785 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 37877 38749 gene locus_tag LOCUS_00280 37877 38749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 40991 38760 gene locus_tag LOCUS_00290 40991 38760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 41098 42669 gene locus_tag LOCUS_00300 41098 42669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_00300 43977 42697 gene locus_tag LOCUS_00310 43977 42697 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_00310 44853 44077 gene locus_tag LOCUS_00320 44853 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_00320 45439 44966 gene locus_tag LOCUS_00330 45439 44966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119866.1 protein_id gnl|my_center|LOCUS_00330 45887 45519 gene locus_tag LOCUS_00340 45887 45519 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_00340 46059 45910 gene locus_tag LOCUS_00350 46059 45910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46949 46098 gene locus_tag LOCUS_00360 gene echA2 46949 46098 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_00360 49664 47334 gene locus_tag LOCUS_00370 49664 47334 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_00370 49809 50804 gene locus_tag LOCUS_00380 49809 50804 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_00380 52266 50860 gene locus_tag LOCUS_00390 52266 50860 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_00390 53436 52417 gene locus_tag LOCUS_00400 53436 52417 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188711.1 protein_id gnl|my_center|LOCUS_00400 55077 53524 gene locus_tag LOCUS_00410 55077 53524 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013532.1 protein_id gnl|my_center|LOCUS_00410 55285 56811 gene locus_tag LOCUS_00420 55285 56811 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_00420 57433 58599 gene locus_tag LOCUS_00430 57433 58599 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_00430 58602 59672 gene locus_tag LOCUS_00440 58602 59672 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_00440 59741 60598 gene locus_tag LOCUS_00450 59741 60598 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_00450 60636 61493 gene locus_tag LOCUS_00460 60636 61493 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_00460 61541 62077 gene locus_tag LOCUS_00470 61541 62077 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_00470 62255 63814 gene locus_tag LOCUS_00480 62255 63814 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_00480 64724 63915 gene locus_tag LOCUS_00490 64724 63915 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_00490 66134 64938 gene locus_tag LOCUS_00500 66134 64938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038988.1 protein_id gnl|my_center|LOCUS_00500 67290 66139 gene locus_tag LOCUS_00510 67290 66139 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_00510 67988 67287 gene locus_tag LOCUS_00520 gene tptC 67988 67287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_00520 69296 68040 gene locus_tag LOCUS_00530 gene acrE 69296 68040 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038985.1 protein_id gnl|my_center|LOCUS_00530 69575 70207 gene locus_tag LOCUS_00540 69575 70207 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_00540 70372 70767 gene locus_tag LOCUS_00550 70372 70767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70764 71141 gene locus_tag LOCUS_00560 70764 71141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 71165 71347 gene locus_tag LOCUS_00570 71165 71347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 71592 71984 gene locus_tag LOCUS_00580 71592 71984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 72511 72077 gene locus_tag LOCUS_00590 72511 72077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72758 72498 gene locus_tag LOCUS_00600 72758 72498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 72987 74186 gene locus_tag LOCUS_00610 72987 74186 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_00610 74196 74639 gene locus_tag LOCUS_00620 74196 74639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74748 75623 gene locus_tag LOCUS_00630 74748 75623 CDS product putative short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96825 protein_id gnl|my_center|LOCUS_00630 75881 76399 gene locus_tag LOCUS_00640 75881 76399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 77960 76821 gene locus_tag LOCUS_00650 77960 76821 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_00650 79105 78215 gene locus_tag LOCUS_00660 79105 78215 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393279.1 protein_id gnl|my_center|LOCUS_00660 80518 79115 gene locus_tag LOCUS_00670 80518 79115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393274.1 protein_id gnl|my_center|LOCUS_00670 81204 80545 gene locus_tag LOCUS_00680 81204 80545 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393275.1 protein_id gnl|my_center|LOCUS_00680 82058 81207 gene locus_tag LOCUS_00690 82058 81207 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393280.1 protein_id gnl|my_center|LOCUS_00690 82272 82904 gene locus_tag LOCUS_00700 82272 82904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 84069 82945 gene locus_tag LOCUS_00710 84069 82945 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_00710 84330 85226 gene locus_tag LOCUS_00720 gene uspE 84330 85226 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_00720 86457 85327 gene locus_tag LOCUS_00730 86457 85327 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_00730 87197 86478 gene locus_tag LOCUS_00740 87197 86478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 87235 88149 gene locus_tag LOCUS_00750 87235 88149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88169 91669 gene locus_tag LOCUS_00760 88169 91669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 93663 91705 gene locus_tag LOCUS_00770 93663 91705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 94452 93664 gene locus_tag LOCUS_00780 94452 93664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 94600 94938 gene locus_tag LOCUS_00790 94600 94938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 95196 95531 gene locus_tag LOCUS_00800 95196 95531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 >Feature sequence002 72 548 gene locus_tag LOCUS_00810 72 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 545 2455 gene locus_tag LOCUS_00820 545 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 2581 2799 gene locus_tag LOCUS_00830 2581 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 2804 3505 gene locus_tag LOCUS_00840 2804 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3759 5414 gene locus_tag LOCUS_00850 3759 5414 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_00850 6902 5529 gene locus_tag LOCUS_00860 6902 5529 CDS product putative sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702286.1 protein_id gnl|my_center|LOCUS_00860 7163 9565 gene locus_tag LOCUS_00870 gene pflD 7163 9565 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_00870 10368 9742 gene locus_tag LOCUS_00880 10368 9742 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390381.1 protein_id gnl|my_center|LOCUS_00880 10654 14103 gene locus_tag LOCUS_00890 10654 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 14846 14217 gene locus_tag LOCUS_00900 14846 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 15183 15007 gene locus_tag LOCUS_00910 15183 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 16277 15219 gene locus_tag LOCUS_00920 16277 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 16603 16427 gene locus_tag LOCUS_00930 16603 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 17220 17041 gene locus_tag LOCUS_00940 17220 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 18987 17404 gene locus_tag LOCUS_00950 18987 17404 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_00950 20528 19110 gene locus_tag LOCUS_00960 20528 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 21239 21057 gene locus_tag LOCUS_00970 21239 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 21354 23072 gene locus_tag LOCUS_00980 21354 23072 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_00980 24045 25472 gene locus_tag LOCUS_00990 24045 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 25607 27193 gene locus_tag LOCUS_01000 25607 27193 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01000 27426 31544 gene locus_tag LOCUS_01010 27426 31544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 31763 33463 gene locus_tag LOCUS_01020 31763 33463 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01020 33460 34998 gene locus_tag LOCUS_01030 33460 34998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 35465 35938 gene locus_tag LOCUS_01040 35465 35938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 35979 37130 gene locus_tag LOCUS_01050 35979 37130 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_01050 37159 38655 gene locus_tag LOCUS_01060 37159 38655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_01060 39370 38738 gene locus_tag LOCUS_01070 gene rluA 39370 38738 CDS product ribosomal large subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIK1 protein_id gnl|my_center|LOCUS_01070 39504 40607 gene locus_tag LOCUS_01080 39504 40607 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084168.1 protein_id gnl|my_center|LOCUS_01080 41662 40787 gene locus_tag LOCUS_01090 41662 40787 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_01090 41735 42214 gene locus_tag LOCUS_01100 41735 42214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 43487 42297 gene locus_tag LOCUS_01110 43487 42297 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_01110 44709 43603 gene locus_tag LOCUS_01120 44709 43603 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_01120 45318 44950 gene locus_tag LOCUS_01130 45318 44950 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_01130 48660 45478 gene locus_tag LOCUS_01140 48660 45478 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_01140 49757 48657 gene locus_tag LOCUS_01150 49757 48657 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262581.1 protein_id gnl|my_center|LOCUS_01150 50179 50676 gene locus_tag LOCUS_01160 50179 50676 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932672.1 protein_id gnl|my_center|LOCUS_01160 51573 50701 gene locus_tag LOCUS_01170 51573 50701 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_01170 52597 51602 gene locus_tag LOCUS_01180 52597 51602 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209270.1 protein_id gnl|my_center|LOCUS_01180 52833 53834 gene locus_tag LOCUS_01190 gene cysK2 52833 53834 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708041.1 protein_id gnl|my_center|LOCUS_01190 55086 53974 gene locus_tag LOCUS_01200 55086 53974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 protein_id gnl|my_center|LOCUS_01200 55915 55283 gene locus_tag LOCUS_01210 55915 55283 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_01210 56741 55941 gene locus_tag LOCUS_01220 56741 55941 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085496.1 protein_id gnl|my_center|LOCUS_01220 57793 57032 gene locus_tag LOCUS_01230 57793 57032 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_01230 58243 57809 gene locus_tag LOCUS_01240 58243 57809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 58757 58257 gene locus_tag LOCUS_01250 58757 58257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 59423 60544 gene locus_tag LOCUS_01260 59423 60544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01260 60745 63576 gene locus_tag LOCUS_01270 gene uvrA 60745 63576 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCB4 protein_id gnl|my_center|LOCUS_01270 63685 64527 gene locus_tag LOCUS_01280 63685 64527 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_01280 65729 64596 gene locus_tag LOCUS_01290 65729 64596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 66034 67152 gene locus_tag LOCUS_01300 66034 67152 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228921.1 protein_id gnl|my_center|LOCUS_01300 67152 68312 gene locus_tag LOCUS_01310 67152 68312 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_01310 68453 69355 gene locus_tag LOCUS_01320 68453 69355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 69858 69472 gene locus_tag LOCUS_01330 69858 69472 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_01330 70998 70606 gene locus_tag LOCUS_01340 70998 70606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 72850 71009 gene locus_tag LOCUS_01350 72850 71009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 73384 73530 gene locus_tag LOCUS_01360 73384 73530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 74626 74267 gene locus_tag LOCUS_01370 74626 74267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 74854 79035 gene locus_tag LOCUS_01380 74854 79035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence003 295 3474 gene locus_tag LOCUS_01390 gene ileS 295 3474 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B0B9C6 protein_id gnl|my_center|LOCUS_01390 3581 4966 gene locus_tag LOCUS_01400 3581 4966 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_01400 5194 6537 gene locus_tag LOCUS_01410 5194 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_01410 6558 6971 gene locus_tag LOCUS_01420 6558 6971 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 protein_id gnl|my_center|LOCUS_01420 7040 7318 gene locus_tag LOCUS_01430 7040 7318 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_01430 7549 8667 gene locus_tag LOCUS_01440 gene degP 7549 8667 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_01440 8769 9116 gene locus_tag LOCUS_01450 8769 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9407 9123 gene locus_tag LOCUS_01460 9407 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 9898 11001 gene locus_tag LOCUS_01470 9898 11001 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_01470 11180 11770 gene locus_tag LOCUS_01480 11180 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11923 12645 gene locus_tag LOCUS_01490 11923 12645 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_01490 12803 14548 gene locus_tag LOCUS_01500 gene estA 12803 14548 CDS product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_01500 14722 15582 gene locus_tag LOCUS_01510 14722 15582 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_01510 15613 16440 gene locus_tag LOCUS_01520 gene modA 15613 16440 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_01520 16469 17152 gene locus_tag LOCUS_01530 gene modB 16469 17152 CDS product molybdenum transporter ModB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_01530 17149 18249 gene locus_tag LOCUS_01540 gene modC 17149 18249 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_01540 18242 19231 gene locus_tag LOCUS_01550 gene srkA 18242 19231 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM98 protein_id gnl|my_center|LOCUS_01550 19741 20046 gene locus_tag LOCUS_01560 19741 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228958.1 protein_id gnl|my_center|LOCUS_01560 20101 21606 gene locus_tag LOCUS_01570 20101 21606 CDS product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 protein_id gnl|my_center|LOCUS_01570 23372 21726 gene locus_tag LOCUS_01580 gene exaA 23372 21726 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_01580 24142 23369 gene locus_tag LOCUS_01590 24142 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 25546 24551 gene locus_tag LOCUS_01600 25546 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 26601 25528 gene locus_tag LOCUS_01610 26601 25528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 29025 26605 gene locus_tag LOCUS_01620 29025 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 29886 30536 gene locus_tag LOCUS_01630 29886 30536 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_01630 30769 32433 gene locus_tag LOCUS_01640 30769 32433 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_01640 33434 32586 gene locus_tag LOCUS_01650 gene paaG 33434 32586 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811489.1 protein_id gnl|my_center|LOCUS_01650 34161 33658 gene locus_tag LOCUS_01660 34161 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 34628 34191 gene locus_tag LOCUS_01670 34628 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 34536 34760 gene locus_tag LOCUS_01680 34536 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 35750 34764 gene locus_tag LOCUS_01690 35750 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 35845 37239 gene locus_tag LOCUS_01700 35845 37239 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_01700 38189 37257 gene locus_tag LOCUS_01710 38189 37257 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_01710 39440 38319 gene locus_tag LOCUS_01720 39440 38319 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_01720 39603 40838 gene locus_tag LOCUS_01730 39603 40838 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_01730 40925 41266 gene locus_tag LOCUS_01740 40925 41266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 41335 41670 gene locus_tag LOCUS_01750 41335 41670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 41655 43211 gene locus_tag LOCUS_01760 41655 43211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01760 43290 44741 gene locus_tag LOCUS_01770 43290 44741 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_01770 46002 44767 gene locus_tag LOCUS_01780 46002 44767 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530920.1 protein_id gnl|my_center|LOCUS_01780 47234 45999 gene locus_tag LOCUS_01790 47234 45999 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929645.1 protein_id gnl|my_center|LOCUS_01790 47431 48705 gene locus_tag LOCUS_01800 47431 48705 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_01800 49767 48724 gene locus_tag LOCUS_01810 49767 48724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_01810 50868 49771 gene locus_tag LOCUS_01820 gene yejB 50868 49771 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537534.1 protein_id gnl|my_center|LOCUS_01820 52697 50868 gene locus_tag LOCUS_01830 52697 50868 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_01830 55783 52868 gene locus_tag LOCUS_01840 55783 52868 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJD6 protein_id gnl|my_center|LOCUS_01840 56961 55972 gene locus_tag LOCUS_01850 56961 55972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 57133 57738 gene locus_tag LOCUS_01860 57133 57738 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_01860 58955 57801 gene locus_tag LOCUS_01870 58955 57801 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768804.1 protein_id gnl|my_center|LOCUS_01870 59808 59068 gene locus_tag LOCUS_01880 59808 59068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 60795 60079 gene locus_tag LOCUS_01890 60795 60079 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776439.1 protein_id gnl|my_center|LOCUS_01890 61042 61251 gene locus_tag LOCUS_01900 61042 61251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 61531 62055 gene locus_tag LOCUS_01910 61531 62055 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 protein_id gnl|my_center|LOCUS_01910 62329 63882 gene locus_tag LOCUS_01920 62329 63882 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_01920 66551 63909 gene locus_tag LOCUS_01930 gene ppc 66551 63909 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV3 protein_id gnl|my_center|LOCUS_01930 66707 67054 gene locus_tag LOCUS_01940 66707 67054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 67192 67725 gene locus_tag LOCUS_01950 67192 67725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 67846 68406 gene locus_tag LOCUS_01960 67846 68406 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4S9 protein_id gnl|my_center|LOCUS_01960 68409 68891 gene locus_tag LOCUS_01970 68409 68891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 68888 69406 gene locus_tag LOCUS_01980 68888 69406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 69507 70040 gene locus_tag LOCUS_01990 gene syd 69507 70040 CDS product protein Syd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTJ9 protein_id gnl|my_center|LOCUS_01990 70063 71355 gene locus_tag LOCUS_02000 gene aroA 70063 71355 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRB0 protein_id gnl|my_center|LOCUS_02000 71483 72757 gene locus_tag LOCUS_02010 71483 72757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_02010 73271 72783 gene locus_tag LOCUS_02020 73271 72783 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_02020 74732 73275 gene locus_tag LOCUS_02030 74732 73275 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_02030 74937 75104 gene locus_tag LOCUS_02040 74937 75104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 75101 76456 gene locus_tag LOCUS_02050 75101 76456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 77716 76532 gene locus_tag LOCUS_02060 77716 76532 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence004 973 23 gene locus_tag LOCUS_02070 973 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2446 1478 gene locus_tag LOCUS_02080 2446 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 2720 3865 gene locus_tag LOCUS_02090 2720 3865 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_02090 5213 4065 gene locus_tag LOCUS_02100 5213 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6666 5386 gene locus_tag LOCUS_02110 6666 5386 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391935.1 protein_id gnl|my_center|LOCUS_02110 6787 10143 gene locus_tag LOCUS_02120 gene recC 6787 10143 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ59 protein_id gnl|my_center|LOCUS_02120 10140 13670 gene locus_tag LOCUS_02130 gene recB 10140 13670 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPP6 protein_id gnl|my_center|LOCUS_02130 13779 15641 gene locus_tag LOCUS_02140 gene recD 13779 15641 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDI0 protein_id gnl|my_center|LOCUS_02140 15981 15655 gene locus_tag LOCUS_02150 15981 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671654.1 protein_id gnl|my_center|LOCUS_02150 16919 15993 gene locus_tag LOCUS_02160 16919 15993 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_02160 17071 17607 gene locus_tag LOCUS_02170 17071 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18636 17617 gene locus_tag LOCUS_02180 18636 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 19645 18758 gene locus_tag LOCUS_02190 gene ansA 19645 18758 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_02190 20184 19801 gene locus_tag LOCUS_02200 20184 19801 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_02200 20408 20184 gene locus_tag LOCUS_02210 20408 20184 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL05 protein_id gnl|my_center|LOCUS_02210 20726 21436 gene locus_tag LOCUS_02220 20726 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 21423 21986 gene locus_tag LOCUS_02230 21423 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 23123 22101 gene locus_tag LOCUS_02240 23123 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 27978 23128 gene locus_tag LOCUS_02250 27978 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 28079 28264 gene locus_tag LOCUS_02260 28079 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 28376 29653 gene locus_tag LOCUS_02270 gene hcaK 28376 29653 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411707.1 protein_id gnl|my_center|LOCUS_02270 29803 30084 gene locus_tag LOCUS_02280 29803 30084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 30676 30068 gene locus_tag LOCUS_02290 30676 30068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 31245 30688 gene locus_tag LOCUS_02300 31245 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 32055 31807 gene locus_tag LOCUS_02310 32055 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 32376 33683 gene locus_tag LOCUS_02320 32376 33683 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266169.1 protein_id gnl|my_center|LOCUS_02320 34004 33708 gene locus_tag LOCUS_02330 34004 33708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 34110 34703 gene locus_tag LOCUS_02340 34110 34703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 34960 34778 gene locus_tag LOCUS_02350 34960 34778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 35262 37691 gene locus_tag LOCUS_02360 35262 37691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 37688 38806 gene locus_tag LOCUS_02370 37688 38806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 41464 38867 gene locus_tag LOCUS_02380 41464 38867 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_02380 41887 41522 gene locus_tag LOCUS_02390 41887 41522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 42226 41909 gene locus_tag LOCUS_02400 42226 41909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 43164 42295 gene locus_tag LOCUS_02410 43164 42295 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705372.1 protein_id gnl|my_center|LOCUS_02410 43721 43203 gene locus_tag LOCUS_02420 43721 43203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 44795 43761 gene locus_tag LOCUS_02430 44795 43761 CDS product ABC transporter integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346299.1 protein_id gnl|my_center|LOCUS_02430 45887 44883 gene locus_tag LOCUS_02440 45887 44883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_02440 47713 45887 gene locus_tag LOCUS_02450 47713 45887 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_02450 48157 48579 gene locus_tag LOCUS_02460 48157 48579 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479871.1 protein_id gnl|my_center|LOCUS_02460 48928 50469 gene locus_tag LOCUS_02470 48928 50469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 51691 50486 gene locus_tag LOCUS_02480 gene ybjZ 51691 50486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_02480 53021 51702 gene locus_tag LOCUS_02490 53021 51702 CDS product ABC macrolide family export system permease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073486.1 protein_id gnl|my_center|LOCUS_02490 53231 54298 gene locus_tag LOCUS_02500 53231 54298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 55027 54317 gene locus_tag LOCUS_02510 55027 54317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 55824 55057 gene locus_tag LOCUS_02520 55824 55057 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887095.1 protein_id gnl|my_center|LOCUS_02520 56374 55913 gene locus_tag LOCUS_02530 56374 55913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 57338 56403 gene locus_tag LOCUS_02540 57338 56403 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_02540 57733 59025 gene locus_tag LOCUS_02550 57733 59025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596011.1 protein_id gnl|my_center|LOCUS_02550 59209 60402 gene locus_tag LOCUS_02560 59209 60402 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040515.1 protein_id gnl|my_center|LOCUS_02560 60426 61325 gene locus_tag LOCUS_02570 60426 61325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 62237 61422 gene locus_tag LOCUS_02580 gene znuB 62237 61422 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_02580 63145 62237 gene locus_tag LOCUS_02590 gene scbA 63145 62237 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_02590 64369 63155 gene locus_tag LOCUS_02600 64369 63155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67918 protein_id gnl|my_center|LOCUS_02600 65019 64882 gene locus_tag LOCUS_02610 65019 64882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 66576 65377 gene locus_tag LOCUS_02620 66576 65377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(66133..66135),aa:Sec) note codon on position 148 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02620 67146 66757 gene locus_tag LOCUS_02630 67146 66757 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_02630 67631 67356 gene locus_tag LOCUS_02640 67631 67356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence005 <1 1029 gene locus_tag LOCUS_02650 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272585.1:phosphoenolpyruvate synthase 1073 2233 gene locus_tag LOCUS_02660 1073 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2236 5019 gene locus_tag LOCUS_02670 2236 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8115 5353 gene locus_tag LOCUS_02680 8115 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10815 9004 gene locus_tag LOCUS_02690 10815 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11806 10826 gene locus_tag LOCUS_02700 11806 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12007 12387 gene locus_tag LOCUS_02710 12007 12387 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_02710 12390 13277 gene locus_tag LOCUS_02720 12390 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 13274 14722 gene locus_tag LOCUS_02730 13274 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 14995 14789 gene locus_tag LOCUS_02740 14995 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 15270 16457 gene locus_tag LOCUS_02750 15270 16457 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_02750 16490 17755 gene locus_tag LOCUS_02760 gene rifK 16490 17755 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_02760 17767 19032 gene locus_tag LOCUS_02770 17767 19032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_02770 19136 19456 gene locus_tag LOCUS_02780 19136 19456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 19623 21092 gene locus_tag LOCUS_02790 19623 21092 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_02790 21100 21789 gene locus_tag LOCUS_02800 21100 21789 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_02800 21797 22411 gene locus_tag LOCUS_02810 21797 22411 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_02810 23923 22406 gene locus_tag LOCUS_02820 23923 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 24803 24018 gene locus_tag LOCUS_02830 24803 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 25574 24828 gene locus_tag LOCUS_02840 gene adc 25574 24828 CDS product putative acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62EK3 protein_id gnl|my_center|LOCUS_02840 25822 26505 gene locus_tag LOCUS_02850 25822 26505 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_02850 27054 26524 gene locus_tag LOCUS_02860 27054 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 29732 27078 gene locus_tag LOCUS_02870 29732 27078 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02870 30948 29725 gene locus_tag LOCUS_02880 30948 29725 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_02880 31712 30960 gene locus_tag LOCUS_02890 31712 30960 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_02890 31757 33505 gene locus_tag LOCUS_02900 31757 33505 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_02900 33507 33875 gene locus_tag LOCUS_02910 33507 33875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 35248 34406 gene locus_tag LOCUS_02920 gene ku 35248 34406 CDS product non-homologous end joining protein Ku inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34859 protein_id gnl|my_center|LOCUS_02920 35288 37885 gene locus_tag LOCUS_02930 35288 37885 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 protein_id gnl|my_center|LOCUS_02930 38188 37928 gene locus_tag LOCUS_02940 38188 37928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 39417 38185 gene locus_tag LOCUS_02950 39417 38185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_02950 39692 39895 gene locus_tag LOCUS_02960 39692 39895 CDS product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142894.1 protein_id gnl|my_center|LOCUS_02960 39892 40284 gene locus_tag LOCUS_02970 gene vapC 39892 40284 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCS9 protein_id gnl|my_center|LOCUS_02970 41347 40298 gene locus_tag LOCUS_02980 41347 40298 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_02980 44687 41337 gene locus_tag LOCUS_02990 44687 41337 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_02990 45052 44708 gene locus_tag LOCUS_03000 gene hlyU 45052 44708 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261241.1 protein_id gnl|my_center|LOCUS_03000 45152 45295 gene locus_tag LOCUS_03010 45152 45295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 46207 45416 gene locus_tag LOCUS_03020 46207 45416 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_03020 47972 46248 gene locus_tag LOCUS_03030 47972 46248 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_03030 48583 48002 gene locus_tag LOCUS_03040 48583 48002 CDS product Rieske iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088961.1 protein_id gnl|my_center|LOCUS_03040 49640 48723 gene locus_tag LOCUS_03050 49640 48723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 50537 49650 gene locus_tag LOCUS_03060 50537 49650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03060 51197 51724 gene locus_tag LOCUS_03070 51197 51724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 51796 52284 gene locus_tag LOCUS_03080 51796 52284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03080 52317 53393 gene locus_tag LOCUS_03090 52317 53393 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729745.1 protein_id gnl|my_center|LOCUS_03090 54566 53457 gene locus_tag LOCUS_03100 54566 53457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03100 55268 54588 gene locus_tag LOCUS_03110 55268 54588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03110 57022 55265 gene locus_tag LOCUS_03120 57022 55265 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142713.1 protein_id gnl|my_center|LOCUS_03120 57134 58540 gene locus_tag LOCUS_03130 57134 58540 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_03130 59657 58593 gene locus_tag LOCUS_03140 59657 58593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 61118 59703 gene locus_tag LOCUS_03150 61118 59703 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123366.1 protein_id gnl|my_center|LOCUS_03150 61321 61184 gene locus_tag LOCUS_03160 61321 61184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 61963 61358 gene locus_tag LOCUS_03170 61963 61358 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03170 62183 62983 gene locus_tag LOCUS_03180 62183 62983 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_03180 63619 63014 gene locus_tag LOCUS_03190 63619 63014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 64072 63737 gene locus_tag LOCUS_03200 64072 63737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 66491 64503 gene locus_tag LOCUS_03210 66491 64503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence006 29 244 gene locus_tag LOCUS_03220 29 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 189 560 gene locus_tag LOCUS_03230 189 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 1587 565 gene locus_tag LOCUS_03240 gene holA 1587 565 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_03240 1994 1584 gene locus_tag LOCUS_03250 1994 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3771 2254 gene locus_tag LOCUS_03260 gene lnt 3771 2254 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_03260 4712 3852 gene locus_tag LOCUS_03270 4712 3852 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_03270 5203 4709 gene locus_tag LOCUS_03280 gene ybeY 5203 4709 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX37 protein_id gnl|my_center|LOCUS_03280 6173 5190 gene locus_tag LOCUS_03290 6173 5190 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_03290 7653 6307 gene locus_tag LOCUS_03300 gene miaB 7653 6307 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_03300 7904 8239 gene locus_tag LOCUS_03310 7904 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_03310 8274 9806 gene locus_tag LOCUS_03320 8274 9806 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_03320 9912 10658 gene locus_tag LOCUS_03330 9912 10658 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_03330 11228 10692 gene locus_tag LOCUS_03340 gene folK 11228 10692 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_03340 11436 12008 gene locus_tag LOCUS_03350 11436 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 12071 13420 gene locus_tag LOCUS_03360 gene accC 12071 13420 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811625.1 protein_id gnl|my_center|LOCUS_03360 13433 13654 gene locus_tag LOCUS_03370 gene madF 13433 13654 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_03370 13722 14768 gene locus_tag LOCUS_03380 13722 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 14812 15225 gene locus_tag LOCUS_03390 14812 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15946 15308 gene locus_tag LOCUS_03400 15946 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16028 16183 gene locus_tag LOCUS_03410 16028 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 17069 16278 gene locus_tag LOCUS_03420 17069 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 18206 17091 gene locus_tag LOCUS_03430 18206 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 20122 18236 gene locus_tag LOCUS_03440 20122 18236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_03440 20865 20134 gene locus_tag LOCUS_03450 20865 20134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_03450 21788 20865 gene locus_tag LOCUS_03460 21788 20865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_03460 22714 22923 gene locus_tag LOCUS_03470 22714 22923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 22978 23649 gene locus_tag LOCUS_03480 22978 23649 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_03480 25024 23990 gene locus_tag LOCUS_03490 25024 23990 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_03490 25113 25337 gene locus_tag LOCUS_03500 25113 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 26525 25233 gene locus_tag LOCUS_03510 26525 25233 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189169.1 protein_id gnl|my_center|LOCUS_03510 26729 27481 gene locus_tag LOCUS_03520 26729 27481 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_03520 27513 28034 gene locus_tag LOCUS_03530 gene apt 27513 28034 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5E9 protein_id gnl|my_center|LOCUS_03530 29565 28063 gene locus_tag LOCUS_03540 29565 28063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 31864 29834 gene locus_tag LOCUS_03550 31864 29834 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010691.2 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03550 32227 31907 gene locus_tag LOCUS_03560 32227 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03560 32727 33746 gene locus_tag LOCUS_03570 gene add 32727 33746 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_03570 33941 33747 gene locus_tag LOCUS_03580 33941 33747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 34283 34071 gene locus_tag LOCUS_03590 34283 34071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 35946 34459 gene locus_tag LOCUS_03600 35946 34459 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_03600 37667 35958 gene locus_tag LOCUS_03610 37667 35958 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_03610 38919 37660 gene locus_tag LOCUS_03620 gene glgC 38919 37660 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_03620 39994 38972 gene locus_tag LOCUS_03630 gene gap 39994 38972 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17721 protein_id gnl|my_center|LOCUS_03630 40232 41713 gene locus_tag LOCUS_03640 gene glgA 40232 41713 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSI5 protein_id gnl|my_center|LOCUS_03640 42855 41695 gene locus_tag LOCUS_03650 gene glgC 42855 41695 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_03650 45496 43013 gene locus_tag LOCUS_03660 gene glgP 45496 43013 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UFR8 protein_id gnl|my_center|LOCUS_03660 47615 45489 gene locus_tag LOCUS_03670 gene glgB 47615 45489 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 protein_id gnl|my_center|LOCUS_03670 47981 48925 gene locus_tag LOCUS_03680 47981 48925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 51753 49003 gene locus_tag LOCUS_03690 51753 49003 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_03690 52823 52128 gene locus_tag LOCUS_03700 52823 52128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 54058 52835 gene locus_tag LOCUS_03710 54058 52835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 54639 54055 gene locus_tag LOCUS_03720 54639 54055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 55115 54636 gene locus_tag LOCUS_03730 55115 54636 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_03730 55317 58544 gene locus_tag LOCUS_03740 55317 58544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 58896 59693 gene locus_tag LOCUS_03750 58896 59693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 60313 59804 gene locus_tag LOCUS_03760 60313 59804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 60880 60518 gene locus_tag LOCUS_03770 60880 60518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 61041 61385 gene locus_tag LOCUS_03780 61041 61385 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782778.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence007 1447 2328 gene locus_tag LOCUS_03790 1447 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4175 2334 gene locus_tag LOCUS_03800 gene ilvD 4175 2334 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 protein_id gnl|my_center|LOCUS_03800 5582 4239 gene locus_tag LOCUS_03810 gene argA 5582 4239 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59293 protein_id gnl|my_center|LOCUS_03810 6636 5584 gene locus_tag LOCUS_03820 gene argE 6636 5584 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_03820 6668 6826 gene locus_tag LOCUS_03830 6668 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7060 8859 gene locus_tag LOCUS_03840 7060 8859 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_03840 8946 11855 gene locus_tag LOCUS_03850 gene glnE 8946 11855 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 protein_id gnl|my_center|LOCUS_03850 12033 12965 gene locus_tag LOCUS_03860 gene ilvE 12033 12965 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_03860 12979 14022 gene locus_tag LOCUS_03870 gene waaF 12979 14022 CDS product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_03870 14111 15187 gene locus_tag LOCUS_03880 gene waaC 14111 15187 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244577.1 protein_id gnl|my_center|LOCUS_03880 15199 17457 gene locus_tag LOCUS_03890 15199 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 17563 18393 gene locus_tag LOCUS_03900 gene waaP 17563 18393 CDS product lipopolysaccharide core heptose(I) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329M7 protein_id gnl|my_center|LOCUS_03900 18404 19153 gene locus_tag LOCUS_03910 18404 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_03910 19223 20689 gene locus_tag LOCUS_03920 19223 20689 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266465.1 protein_id gnl|my_center|LOCUS_03920 20754 22511 gene locus_tag LOCUS_03930 20754 22511 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431977.1 protein_id gnl|my_center|LOCUS_03930 22515 23639 gene locus_tag LOCUS_03940 22515 23639 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105263.1 protein_id gnl|my_center|LOCUS_03940 24442 23771 gene locus_tag LOCUS_03950 24442 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_03950 25126 24446 gene locus_tag LOCUS_03960 25126 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 25510 26931 gene locus_tag LOCUS_03970 gene hldE 25510 26931 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF4 protein_id gnl|my_center|LOCUS_03970 27773 26982 gene locus_tag LOCUS_03980 27773 26982 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_03980 28992 27781 gene locus_tag LOCUS_03990 28992 27781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_03990 29151 30443 gene locus_tag LOCUS_04000 gene waaA 29151 30443 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_04000 30623 31087 gene locus_tag LOCUS_04010 30623 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_04010 31348 32148 gene locus_tag LOCUS_04020 gene cpdA 31348 32148 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_04020 32200 34104 gene locus_tag LOCUS_04030 gene parE 32200 34104 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH3 protein_id gnl|my_center|LOCUS_04030 34446 36695 gene locus_tag LOCUS_04040 gene parC 34446 36695 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_04040 37822 36716 gene locus_tag LOCUS_04050 37822 36716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 37946 39184 gene locus_tag LOCUS_04060 37946 39184 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266487.1 protein_id gnl|my_center|LOCUS_04060 41155 39233 gene locus_tag LOCUS_04070 gene fimX 41155 39233 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_04070 42362 41349 gene locus_tag LOCUS_04080 42362 41349 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_04080 42362 42964 gene locus_tag LOCUS_04090 gene efp 42362 42964 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_04090 42979 43971 gene locus_tag LOCUS_04100 42979 43971 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR3 protein_id gnl|my_center|LOCUS_04100 44722 43973 gene locus_tag LOCUS_04110 gene psd 44722 43973 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P353 protein_id gnl|my_center|LOCUS_04110 45652 44855 gene locus_tag LOCUS_04120 gene rhdA 45652 44855 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_04120 45792 46355 gene locus_tag LOCUS_04130 gene orn 45792 46355 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRY0 protein_id gnl|my_center|LOCUS_04130 47524 46427 gene locus_tag LOCUS_04140 gene queG 47524 46427 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_04140 47849 49390 gene locus_tag LOCUS_04150 gene nnr 47849 49390 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_04150 49418 49900 gene locus_tag LOCUS_04160 49418 49900 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_04160 49897 51306 gene locus_tag LOCUS_04170 gene amiB 49897 51306 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_04170 51341 53134 gene locus_tag LOCUS_04180 gene mutL 51341 53134 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E4 protein_id gnl|my_center|LOCUS_04180 53268 54239 gene locus_tag LOCUS_04190 gene miaA 53268 54239 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6K5 protein_id gnl|my_center|LOCUS_04190 54405 54656 gene locus_tag LOCUS_04200 gene hfq 54405 54656 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_04200 54692 55981 gene locus_tag LOCUS_04210 gene hflX 54692 55981 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CV3 protein_id gnl|my_center|LOCUS_04210 56130 57281 gene locus_tag LOCUS_04220 56130 57281 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_04220 57278 58168 gene locus_tag LOCUS_04230 gene hflC 57278 58168 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_04230 58247 58435 gene locus_tag LOCUS_04240 58247 58435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 58530 59786 gene locus_tag LOCUS_04250 gene purA 58530 59786 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_04250 60076 59801 gene locus_tag LOCUS_04260 60076 59801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence008 669 593 gene locus_tag LOCUS_t00010 669 593 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2302 770 gene locus_tag LOCUS_04270 2302 770 CDS product inosine 5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_04270 2762 3064 gene locus_tag LOCUS_04280 gene ihfB 2762 3064 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51473 protein_id gnl|my_center|LOCUS_04280 4502 3186 gene locus_tag LOCUS_04290 gene xylA 4502 3186 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44398 protein_id gnl|my_center|LOCUS_04290 6017 4542 gene locus_tag LOCUS_04300 gene xylB 6017 4542 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817426.1 protein_id gnl|my_center|LOCUS_04300 6988 6338 gene locus_tag LOCUS_04310 gene dsbA 6988 6338 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_04310 7267 7878 gene locus_tag LOCUS_04320 gene engB 7267 7878 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT0 protein_id gnl|my_center|LOCUS_04320 10826 8136 gene locus_tag LOCUS_04330 gene polA 10826 8136 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_04330 10928 11194 gene locus_tag LOCUS_04340 10928 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 11223 12173 gene locus_tag LOCUS_04350 gene thrB 11223 12173 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AP1 protein_id gnl|my_center|LOCUS_04350 13187 12273 gene locus_tag LOCUS_04360 gene cyoE1 13187 12273 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_04360 13404 13210 gene locus_tag LOCUS_04370 13404 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 16335 14287 gene locus_tag LOCUS_04380 gene prlC 16335 14287 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_04380 17171 16341 gene locus_tag LOCUS_04390 gene aroE 17171 16341 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B50 protein_id gnl|my_center|LOCUS_04390 17725 17168 gene locus_tag LOCUS_04400 gene tsaC 17725 17168 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S6 protein_id gnl|my_center|LOCUS_04400 18234 17722 gene locus_tag LOCUS_04410 gene purE-2 18234 17722 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 protein_id gnl|my_center|LOCUS_04410 19251 18553 gene locus_tag LOCUS_04420 19251 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 20867 19788 gene locus_tag LOCUS_04430 20867 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_04430 21013 21516 gene locus_tag LOCUS_04440 gene def 21013 21516 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRZ1 protein_id gnl|my_center|LOCUS_04440 21534 22526 gene locus_tag LOCUS_04450 gene fmt 21534 22526 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NDQ9 protein_id gnl|my_center|LOCUS_04450 22523 23818 gene locus_tag LOCUS_04460 gene rsmB 22523 23818 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_04460 23909 25288 gene locus_tag LOCUS_04470 gene trkA 23909 25288 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_04470 25311 26765 gene locus_tag LOCUS_04480 gene trkH 25311 26765 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_04480 26942 27550 gene locus_tag LOCUS_04490 26942 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 28451 27513 gene locus_tag LOCUS_04500 28451 27513 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_04500 29090 28473 gene locus_tag LOCUS_04510 gene tag 29090 28473 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_04510 29205 30146 gene locus_tag LOCUS_04520 gene glyQ 29205 30146 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD4 protein_id gnl|my_center|LOCUS_04520 30143 32224 gene locus_tag LOCUS_04530 gene glyS 30143 32224 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45651 protein_id gnl|my_center|LOCUS_04530 32240 32779 gene locus_tag LOCUS_04540 32240 32779 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA9 protein_id gnl|my_center|LOCUS_04540 35217 32800 gene locus_tag LOCUS_04550 gene gyrB 35217 32800 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_04550 36312 35218 gene locus_tag LOCUS_04560 gene recF 36312 35218 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 protein_id gnl|my_center|LOCUS_04560 37382 36309 gene locus_tag LOCUS_04570 gene dnaN 37382 36309 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_04570 38650 37550 gene locus_tag LOCUS_04580 gene dnaN 38650 37550 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_04580 40033 38714 gene locus_tag LOCUS_04590 gene dnaA 40033 38714 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEC3 protein_id gnl|my_center|LOCUS_04590 40647 41108 gene locus_tag LOCUS_04600 40647 41108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 41368 43077 gene locus_tag LOCUS_04610 gene yidC 41368 43077 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 protein_id gnl|my_center|LOCUS_04610 43107 44474 gene locus_tag LOCUS_04620 gene mnmE 43107 44474 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_04620 44641 46533 gene locus_tag LOCUS_04630 gene mnmG 44641 46533 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F5X1 protein_id gnl|my_center|LOCUS_04630 46577 47203 gene locus_tag LOCUS_04640 gene rsmG 46577 47203 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS4 protein_id gnl|my_center|LOCUS_04640 47218 47994 gene locus_tag LOCUS_04650 gene soj 47218 47994 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_04650 48169 49056 gene locus_tag LOCUS_04660 gene spoOJ 48169 49056 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_04660 49180 49608 gene locus_tag LOCUS_04670 gene atpI 49180 49608 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948673.1 protein_id gnl|my_center|LOCUS_04670 49620 50447 gene locus_tag LOCUS_04680 gene atpB 49620 50447 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_04680 50480 50707 gene locus_tag LOCUS_04690 gene atpE 50480 50707 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY3 protein_id gnl|my_center|LOCUS_04690 50747 51217 gene locus_tag LOCUS_04700 gene atpF 50747 51217 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 protein_id gnl|my_center|LOCUS_04700 51383 51928 gene locus_tag LOCUS_04710 gene atpH 51383 51928 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_04710 51947 53491 gene locus_tag LOCUS_04720 gene atpA 51947 53491 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_04720 53521 54381 gene locus_tag LOCUS_04730 gene atpG 53521 54381 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_04730 54424 55800 gene locus_tag LOCUS_04740 gene atpD 54424 55800 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTC6 protein_id gnl|my_center|LOCUS_04740 55813 56241 gene locus_tag LOCUS_04750 gene atpC 55813 56241 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_04750 >Feature sequence009 1145 570 gene locus_tag LOCUS_04760 1145 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2725 1673 gene locus_tag LOCUS_04770 2725 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04770 3004 2726 gene locus_tag LOCUS_04780 3004 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04780 4125 3001 gene locus_tag LOCUS_04790 4125 3001 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_04790 5221 4217 gene locus_tag LOCUS_04800 5221 4217 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_04800 7524 5365 gene locus_tag LOCUS_04810 7524 5365 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_04810 7969 7565 gene locus_tag LOCUS_04820 gene mceE 7969 7565 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_04820 10717 8012 gene locus_tag LOCUS_04830 10717 8012 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943912.1 protein_id gnl|my_center|LOCUS_04830 12658 10907 gene locus_tag LOCUS_04840 12658 10907 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_04840 13001 14794 gene locus_tag LOCUS_04850 13001 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_04850 14898 16754 gene locus_tag LOCUS_04860 14898 16754 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_04860 17985 16774 gene locus_tag LOCUS_04870 17985 16774 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_04870 19413 18118 gene locus_tag LOCUS_04880 19413 18118 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_04880 19627 20268 gene locus_tag LOCUS_04890 19627 20268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 20322 20627 gene locus_tag LOCUS_04900 20322 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 23075 20640 gene locus_tag LOCUS_04910 23075 20640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24053 23295 gene locus_tag LOCUS_04920 24053 23295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 25073 24123 gene locus_tag LOCUS_04930 25073 24123 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_04930 26047 25073 gene locus_tag LOCUS_04940 26047 25073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583524.1 protein_id gnl|my_center|LOCUS_04940 26916 26047 gene locus_tag LOCUS_04950 26916 26047 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272652.1 protein_id gnl|my_center|LOCUS_04950 27826 26909 gene locus_tag LOCUS_04960 gene appB 27826 26909 CDS product glutathione ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368429.1 protein_id gnl|my_center|LOCUS_04960 29384 27834 gene locus_tag LOCUS_04970 29384 27834 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 protein_id gnl|my_center|LOCUS_04970 31023 29425 gene locus_tag LOCUS_04980 31023 29425 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_04980 31690 31109 gene locus_tag LOCUS_04990 31690 31109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 32073 34175 gene locus_tag LOCUS_05000 32073 34175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 35529 34306 gene locus_tag LOCUS_05010 35529 34306 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_05010 36644 35532 gene locus_tag LOCUS_05020 36644 35532 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727997.1 protein_id gnl|my_center|LOCUS_05020 36926 37177 gene locus_tag LOCUS_05030 36926 37177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 37347 37544 gene locus_tag LOCUS_05040 37347 37544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 37840 37664 gene locus_tag LOCUS_05050 37840 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 38369 38935 gene locus_tag LOCUS_05060 38369 38935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 40685 39156 gene locus_tag LOCUS_05070 40685 39156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 41404 41670 gene locus_tag LOCUS_05080 41404 41670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 42056 42838 gene locus_tag LOCUS_05090 42056 42838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 44261 42861 gene locus_tag LOCUS_05100 44261 42861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 44957 44523 gene locus_tag LOCUS_05110 44957 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 45122 46255 gene locus_tag LOCUS_05120 45122 46255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05120 46274 46450 gene locus_tag LOCUS_05130 46274 46450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 47566 46451 gene locus_tag LOCUS_05140 47566 46451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_05140 48279 49673 gene locus_tag LOCUS_05150 48279 49673 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_05150 49679 50059 gene locus_tag LOCUS_05160 49679 50059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 50272 50622 gene locus_tag LOCUS_05170 50272 50622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 50876 51769 gene locus_tag LOCUS_05180 50876 51769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 51871 52758 gene locus_tag LOCUS_05190 51871 52758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 52816 53736 gene locus_tag LOCUS_05200 52816 53736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence010 476 1288 gene locus_tag LOCUS_05210 gene tsf 476 1288 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_05210 1404 2141 gene locus_tag LOCUS_05220 gene pyrH 1404 2141 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_05220 2453 3034 gene locus_tag LOCUS_05230 gene frr 2453 3034 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_05230 3058 3864 gene locus_tag LOCUS_05240 gene cdsA-1 3058 3864 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_05240 3869 5056 gene locus_tag LOCUS_05250 gene dxr 3869 5056 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N7 protein_id gnl|my_center|LOCUS_05250 5078 6490 gene locus_tag LOCUS_05260 5078 6490 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_05260 6554 8881 gene locus_tag LOCUS_05270 gene bamA 6554 8881 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_05270 8978 9508 gene locus_tag LOCUS_05280 8978 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9537 10589 gene locus_tag LOCUS_05290 gene lpxD 9537 10589 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR8 protein_id gnl|my_center|LOCUS_05290 10601 11038 gene locus_tag LOCUS_05300 gene fabZ 10601 11038 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_05300 11119 12273 gene locus_tag LOCUS_05310 gene lpxB 11119 12273 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N0 protein_id gnl|my_center|LOCUS_05310 12270 12923 gene locus_tag LOCUS_05320 gene rnhB 12270 12923 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_05320 13098 16520 gene locus_tag LOCUS_05330 gene dnaE 13098 16520 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 protein_id gnl|my_center|LOCUS_05330 16623 17915 gene locus_tag LOCUS_05340 gene tilS 16623 17915 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_05340 18013 19638 gene locus_tag LOCUS_05350 gene pyrG 18013 19638 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_05350 19691 20518 gene locus_tag LOCUS_05360 gene kdsA 19691 20518 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA3 protein_id gnl|my_center|LOCUS_05360 20557 21837 gene locus_tag LOCUS_05370 gene eno 20557 21837 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_05370 21834 22130 gene locus_tag LOCUS_05380 gene ftsB 21834 22130 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M2 protein_id gnl|my_center|LOCUS_05380 22208 22873 gene locus_tag LOCUS_05390 gene ispD 22208 22873 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z471 protein_id gnl|my_center|LOCUS_05390 22887 23363 gene locus_tag LOCUS_05400 gene ispF 22887 23363 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E329 protein_id gnl|my_center|LOCUS_05400 23379 24329 gene locus_tag LOCUS_05410 gene truD 23379 24329 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_05410 24322 25110 gene locus_tag LOCUS_05420 gene pcm 24322 25110 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP9 protein_id gnl|my_center|LOCUS_05420 25264 26214 gene locus_tag LOCUS_05430 25264 26214 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_05430 26574 27140 gene locus_tag LOCUS_05440 26574 27140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 27888 27565 gene locus_tag LOCUS_05450 gene fdxA 27888 27565 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_05450 30645 28018 gene locus_tag LOCUS_05460 gene mutS 30645 28018 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ2 protein_id gnl|my_center|LOCUS_05460 30960 32021 gene locus_tag LOCUS_05470 gene recA 30960 32021 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_05470 32041 32484 gene locus_tag LOCUS_05480 gene recX 32041 32484 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XY8 protein_id gnl|my_center|LOCUS_05480 32570 32794 gene locus_tag LOCUS_05490 32570 32794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 32873 35470 gene locus_tag LOCUS_05500 gene alaS 32873 35470 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI4 protein_id gnl|my_center|LOCUS_05500 35597 36844 gene locus_tag LOCUS_05510 35597 36844 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_05510 37073 37270 gene locus_tag LOCUS_05520 gene csrA 37073 37270 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69078 protein_id gnl|my_center|LOCUS_05520 38664 37384 gene locus_tag LOCUS_05530 38664 37384 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_05530 39917 38661 gene locus_tag LOCUS_05540 39917 38661 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921391.1 protein_id gnl|my_center|LOCUS_05540 40959 40033 gene locus_tag LOCUS_05550 40959 40033 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727874.1 protein_id gnl|my_center|LOCUS_05550 41173 43560 gene locus_tag LOCUS_05560 gene pflD 41173 43560 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_05560 44399 43584 gene locus_tag LOCUS_05570 44399 43584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_05570 45342 44392 gene locus_tag LOCUS_05580 45342 44392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_05580 46460 45342 gene locus_tag LOCUS_05590 46460 45342 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_05590 47436 46453 gene locus_tag LOCUS_05600 47436 46453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970413.1 protein_id gnl|my_center|LOCUS_05600 48340 47669 gene locus_tag LOCUS_05610 gene hypB 48340 47669 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_05610 48696 48340 gene locus_tag LOCUS_05620 48696 48340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 49714 48713 gene locus_tag LOCUS_05630 49714 48713 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_05630 50005 51399 gene locus_tag LOCUS_05640 50005 51399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 51672 52472 gene locus_tag LOCUS_05650 gene paaG 51672 52472 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_05650 53415 52519 gene locus_tag LOCUS_05660 gene tfdA 53415 52519 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence011 163 1029 gene locus_tag LOCUS_05670 163 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1947 1189 gene locus_tag LOCUS_05680 1947 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2143 2496 gene locus_tag LOCUS_05690 2143 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3078 2533 gene locus_tag LOCUS_05700 3078 2533 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 protein_id gnl|my_center|LOCUS_05700 3229 3732 gene locus_tag LOCUS_05710 3229 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3748 4362 gene locus_tag LOCUS_05720 3748 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4597 5274 gene locus_tag LOCUS_05730 4597 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5556 7034 gene locus_tag LOCUS_05740 gene pilB 5556 7034 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_05740 8393 7038 gene locus_tag LOCUS_05750 8393 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9376 8600 gene locus_tag LOCUS_05760 9376 8600 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_05760 9657 11165 gene locus_tag LOCUS_05770 9657 11165 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_05770 11201 12166 gene locus_tag LOCUS_05780 11201 12166 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_05780 12949 12179 gene locus_tag LOCUS_05790 12949 12179 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_05790 14193 13207 gene locus_tag LOCUS_05800 gene echA2 14193 13207 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_05800 14557 15381 gene locus_tag LOCUS_05810 gene fabG 14557 15381 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_05810 15622 15410 gene locus_tag LOCUS_05820 15622 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 15822 15631 gene locus_tag LOCUS_05830 15822 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 17790 17323 gene locus_tag LOCUS_05840 17790 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 18429 17842 gene locus_tag LOCUS_05850 18429 17842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 18742 18329 gene locus_tag LOCUS_05860 18742 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 19896 18886 gene locus_tag LOCUS_05870 gene glpQ 19896 18886 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_05870 20692 19883 gene locus_tag LOCUS_05880 20692 19883 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538258.1 protein_id gnl|my_center|LOCUS_05880 21502 20696 gene locus_tag LOCUS_05890 21502 20696 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_05890 22323 21499 gene locus_tag LOCUS_05900 gene phnC 22323 21499 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 protein_id gnl|my_center|LOCUS_05900 23384 22335 gene locus_tag LOCUS_05910 23384 22335 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_05910 23521 24363 gene locus_tag LOCUS_05920 23521 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 24360 25124 gene locus_tag LOCUS_05930 gene echA5 24360 25124 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_05930 25111 25500 gene locus_tag LOCUS_05940 25111 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 25581 26303 gene locus_tag LOCUS_05950 25581 26303 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388085.1 protein_id gnl|my_center|LOCUS_05950 26310 27449 gene locus_tag LOCUS_05960 26310 27449 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_05960 28730 27471 gene locus_tag LOCUS_05970 28730 27471 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_05970 29556 28825 gene locus_tag LOCUS_05980 29556 28825 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_05980 30057 29644 gene locus_tag LOCUS_05990 30057 29644 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 protein_id gnl|my_center|LOCUS_05990 30181 30375 gene locus_tag LOCUS_06000 30181 30375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 31235 30399 gene locus_tag LOCUS_06010 31235 30399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 32058 31336 gene locus_tag LOCUS_06020 gene cysZ 32058 31336 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXQ1 protein_id gnl|my_center|LOCUS_06020 32168 34381 gene locus_tag LOCUS_06030 32168 34381 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_06030 35400 34390 gene locus_tag LOCUS_06040 35400 34390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 35619 36908 gene locus_tag LOCUS_06050 35619 36908 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_06050 36995 38005 gene locus_tag LOCUS_06060 36995 38005 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_06060 38548 38033 gene locus_tag LOCUS_06070 38548 38033 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729619.1 protein_id gnl|my_center|LOCUS_06070 39574 38639 gene locus_tag LOCUS_06080 39574 38639 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_06080 39772 40119 gene locus_tag LOCUS_06090 39772 40119 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_06090 40284 41249 gene locus_tag LOCUS_06100 gene acoA 40284 41249 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 protein_id gnl|my_center|LOCUS_06100 41293 42303 gene locus_tag LOCUS_06110 41293 42303 CDS product TPP-dependent acetoin dehydrogenase complex, E1 protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_06110 42308 43537 gene locus_tag LOCUS_06120 gene pdhC 42308 43537 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMZ5 protein_id gnl|my_center|LOCUS_06120 43559 44647 gene locus_tag LOCUS_06130 43559 44647 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086750.1 protein_id gnl|my_center|LOCUS_06130 44847 45431 gene locus_tag LOCUS_06140 44847 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 45487 46488 gene locus_tag LOCUS_06150 45487 46488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 46714 47361 gene locus_tag LOCUS_06160 46714 47361 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_06160 48215 47931 gene locus_tag LOCUS_06170 48215 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 48464 49324 gene locus_tag LOCUS_06180 48464 49324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 49889 50452 gene locus_tag LOCUS_06190 49889 50452 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_06190 50479 50670 gene locus_tag LOCUS_06200 50479 50670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 50991 50626 gene locus_tag LOCUS_06210 50991 50626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 52637 51144 gene locus_tag LOCUS_06220 52637 51144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749215.1 protein_id gnl|my_center|LOCUS_06220 52764 52582 gene locus_tag LOCUS_06230 52764 52582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence012 309 758 gene locus_tag LOCUS_06240 309 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 824 1063 gene locus_tag LOCUS_06250 824 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1035 2078 gene locus_tag LOCUS_06260 1035 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2238 2162 gene locus_tag LOCUS_t00020 2238 2162 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2767 2444 gene locus_tag LOCUS_06270 2767 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2859 3950 gene locus_tag LOCUS_06280 2859 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4046 5245 gene locus_tag LOCUS_06290 4046 5245 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_06290 8708 5265 gene locus_tag LOCUS_06300 8708 5265 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090027.1 protein_id gnl|my_center|LOCUS_06300 9076 10176 gene locus_tag LOCUS_06310 9076 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 10539 11621 gene locus_tag LOCUS_06320 10539 11621 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_06320 12503 11715 gene locus_tag LOCUS_06330 12503 11715 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_06330 12765 13577 gene locus_tag LOCUS_06340 12765 13577 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_06340 14379 13657 gene locus_tag LOCUS_06350 14379 13657 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJR4 protein_id gnl|my_center|LOCUS_06350 16538 14457 gene locus_tag LOCUS_06360 16538 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 17036 19390 gene locus_tag LOCUS_06370 gene pflD 17036 19390 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_06370 19810 21015 gene locus_tag LOCUS_06380 19810 21015 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_06380 22107 21040 gene locus_tag LOCUS_06390 22107 21040 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230695.1 protein_id gnl|my_center|LOCUS_06390 23400 22207 gene locus_tag LOCUS_06400 23400 22207 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727455.1 protein_id gnl|my_center|LOCUS_06400 24232 23912 gene locus_tag LOCUS_06410 24232 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 24113 24403 gene locus_tag LOCUS_06420 24113 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 24400 25794 gene locus_tag LOCUS_06430 24400 25794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_06430 26150 27736 gene locus_tag LOCUS_06440 26150 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 27752 28825 gene locus_tag LOCUS_06450 27752 28825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 28812 29708 gene locus_tag LOCUS_06460 28812 29708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 29710 30372 gene locus_tag LOCUS_06470 29710 30372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 30427 31242 gene locus_tag LOCUS_06480 30427 31242 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532945.1 protein_id gnl|my_center|LOCUS_06480 32191 31352 gene locus_tag LOCUS_06490 32191 31352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 33046 32300 gene locus_tag LOCUS_06500 33046 32300 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775810.1 protein_id gnl|my_center|LOCUS_06500 33259 34659 gene locus_tag LOCUS_06510 33259 34659 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_06510 34735 35181 gene locus_tag LOCUS_06520 34735 35181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 35361 35522 gene locus_tag LOCUS_06530 35361 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 36635 35553 gene locus_tag LOCUS_06540 36635 35553 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020714.1 protein_id gnl|my_center|LOCUS_06540 37026 38198 gene locus_tag LOCUS_06550 37026 38198 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_06550 38191 41343 gene locus_tag LOCUS_06560 38191 41343 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06560 41359 41871 gene locus_tag LOCUS_06570 41359 41871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 42975 41878 gene locus_tag LOCUS_06580 42975 41878 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266766.1 protein_id gnl|my_center|LOCUS_06580 43393 42998 gene locus_tag LOCUS_06590 43393 42998 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978533.1 protein_id gnl|my_center|LOCUS_06590 44300 43473 gene locus_tag LOCUS_06600 gene fabG 44300 43473 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_06600 44737 44537 gene locus_tag LOCUS_06610 44737 44537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 46395 44905 gene locus_tag LOCUS_06620 46395 44905 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_06620 46817 46503 gene locus_tag LOCUS_06630 46817 46503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 47114 48322 gene locus_tag LOCUS_06640 47114 48322 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_06640 48375 48713 gene locus_tag LOCUS_06650 48375 48713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 48732 49763 gene locus_tag LOCUS_06660 48732 49763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06660 49858 50685 gene locus_tag LOCUS_06670 49858 50685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 50810 52102 gene locus_tag LOCUS_06680 50810 52102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence013 252 2033 gene locus_tag LOCUS_06690 252 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2823 3260 gene locus_tag LOCUS_06700 2823 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4497 3238 gene locus_tag LOCUS_06710 4497 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4646 4494 gene locus_tag LOCUS_06720 4646 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5202 6572 gene locus_tag LOCUS_06730 5202 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7061 6582 gene locus_tag LOCUS_06740 7061 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978452.1 protein_id gnl|my_center|LOCUS_06740 8576 7125 gene locus_tag LOCUS_06750 8576 7125 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_06750 9832 8810 gene locus_tag LOCUS_06760 9832 8810 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_06760 11700 9829 gene locus_tag LOCUS_06770 11700 9829 CDS product putative ferredoxin oxidoreductase, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702333.1 protein_id gnl|my_center|LOCUS_06770 13514 11985 gene locus_tag LOCUS_06780 13514 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13697 14599 gene locus_tag LOCUS_06790 13697 14599 CDS product luciferase-like hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701714.1 protein_id gnl|my_center|LOCUS_06790 15152 14616 gene locus_tag LOCUS_06800 15152 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17055 15280 gene locus_tag LOCUS_06810 17055 15280 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_06810 17152 17898 gene locus_tag LOCUS_06820 17152 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 18437 18841 gene locus_tag LOCUS_06830 gene nuoA 18437 18841 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZQ9 protein_id gnl|my_center|LOCUS_06830 18841 19500 gene locus_tag LOCUS_06840 gene nuoB 18841 19500 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFD0 protein_id gnl|my_center|LOCUS_06840 19552 21327 gene locus_tag LOCUS_06850 gene nuoC 19552 21327 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J9 protein_id gnl|my_center|LOCUS_06850 21372 21860 gene locus_tag LOCUS_06860 gene nuoE 21372 21860 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_06860 21863 23161 gene locus_tag LOCUS_06870 21863 23161 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 protein_id gnl|my_center|LOCUS_06870 23226 25991 gene locus_tag LOCUS_06880 gene nuoG 23226 25991 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J6 protein_id gnl|my_center|LOCUS_06880 26003 26989 gene locus_tag LOCUS_06890 gene nuoH 26003 26989 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI35 protein_id gnl|my_center|LOCUS_06890 27066 27587 gene locus_tag LOCUS_06900 gene nuoI 27066 27587 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI36 protein_id gnl|my_center|LOCUS_06900 27608 28126 gene locus_tag LOCUS_06910 27608 28126 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317979.1 protein_id gnl|my_center|LOCUS_06910 28126 28440 gene locus_tag LOCUS_06920 gene nuoK 28126 28440 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J2 protein_id gnl|my_center|LOCUS_06920 28442 30295 gene locus_tag LOCUS_06930 28442 30295 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705658.1 protein_id gnl|my_center|LOCUS_06930 30314 31852 gene locus_tag LOCUS_06940 gene nuoM 30314 31852 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J0 protein_id gnl|my_center|LOCUS_06940 31849 33330 gene locus_tag LOCUS_06950 gene nuoN 31849 33330 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0I9 protein_id gnl|my_center|LOCUS_06950 34112 33375 gene locus_tag LOCUS_06960 34112 33375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 34540 34088 gene locus_tag LOCUS_06970 34540 34088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 36045 34540 gene locus_tag LOCUS_06980 36045 34540 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894296.1 protein_id gnl|my_center|LOCUS_06980 36955 36071 gene locus_tag LOCUS_06990 36955 36071 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_06990 37124 37294 gene locus_tag LOCUS_07000 37124 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37315 38493 gene locus_tag LOCUS_07010 37315 38493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 38695 39033 gene locus_tag LOCUS_07020 38695 39033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 39110 39544 gene locus_tag LOCUS_07030 39110 39544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 39558 41108 gene locus_tag LOCUS_07040 39558 41108 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_07040 41111 41551 gene locus_tag LOCUS_07050 41111 41551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 42431 41583 gene locus_tag LOCUS_07060 42431 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085509.1 protein_id gnl|my_center|LOCUS_07060 42817 44772 gene locus_tag LOCUS_07070 42817 44772 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_07070 44892 46133 gene locus_tag LOCUS_07080 44892 46133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 46403 46957 gene locus_tag LOCUS_07090 46403 46957 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_07090 46954 49176 gene locus_tag LOCUS_07100 46954 49176 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_07100 50510 49362 gene locus_tag LOCUS_07110 50510 49362 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_07110 50673 51905 gene locus_tag LOCUS_07120 50673 51905 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence014 139 1974 gene locus_tag LOCUS_07130 gene glmS 139 1974 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 protein_id gnl|my_center|LOCUS_07130 2291 4543 gene locus_tag LOCUS_07140 gene uvrD 2291 4543 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_07140 4591 5655 gene locus_tag LOCUS_07150 4591 5655 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_07150 7062 5680 gene locus_tag LOCUS_07160 7062 5680 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_07160 7503 7072 gene locus_tag LOCUS_07170 7503 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8708 7779 gene locus_tag LOCUS_07180 gene ubiA 8708 7779 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_07180 8906 10162 gene locus_tag LOCUS_07190 8906 10162 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_07190 12304 10211 gene locus_tag LOCUS_07200 gene recG 12304 10211 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_07200 12878 12483 gene locus_tag LOCUS_07210 12878 12483 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_07210 15001 12887 gene locus_tag LOCUS_07220 gene spoT 15001 12887 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_07220 15541 15269 gene locus_tag LOCUS_07230 15541 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 16236 15610 gene locus_tag LOCUS_07240 gene gmk 16236 15610 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_07240 17286 16420 gene locus_tag LOCUS_07250 17286 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_07250 17468 18187 gene locus_tag LOCUS_07260 gene rph 17468 18187 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_07260 18213 18863 gene locus_tag LOCUS_07270 gene pyrE 18213 18863 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVD5 protein_id gnl|my_center|LOCUS_07270 18903 19547 gene locus_tag LOCUS_07280 18903 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 20134 19544 gene locus_tag LOCUS_07290 gene slmA 20134 19544 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_07290 21109 20189 gene locus_tag LOCUS_07300 gene argB 21109 20189 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_07300 23654 21126 gene locus_tag LOCUS_07310 23654 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 24114 23659 gene locus_tag LOCUS_07320 gene dut 24114 23659 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP5 protein_id gnl|my_center|LOCUS_07320 25364 24111 gene locus_tag LOCUS_07330 gene coaC 25364 24111 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_07330 25601 26269 gene locus_tag LOCUS_07340 25601 26269 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_07340 26375 26611 gene locus_tag LOCUS_07350 gene rpmB 26375 26611 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44364 protein_id gnl|my_center|LOCUS_07350 26612 26767 gene locus_tag LOCUS_07360 gene rpmG 26612 26767 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN0 protein_id gnl|my_center|LOCUS_07360 28616 26760 gene locus_tag LOCUS_07370 gene hyuA 28616 26760 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_07370 28569 28748 gene locus_tag LOCUS_07380 28569 28748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 29203 30018 gene locus_tag LOCUS_07390 gene mutM 29203 30018 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_07390 30176 30496 gene locus_tag LOCUS_07400 30176 30496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402254.1 protein_id gnl|my_center|LOCUS_07400 30977 30498 gene locus_tag LOCUS_07410 gene coaD 30977 30498 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_07410 31611 31051 gene locus_tag LOCUS_07420 31611 31051 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C4 protein_id gnl|my_center|LOCUS_07420 31746 32678 gene locus_tag LOCUS_07430 31746 32678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 32742 33398 gene locus_tag LOCUS_07440 gene ftsE 32742 33398 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_07440 33388 34380 gene locus_tag LOCUS_07450 33388 34380 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF80 protein_id gnl|my_center|LOCUS_07450 34519 35370 gene locus_tag LOCUS_07460 gene rpoH 34519 35370 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_07460 35539 36243 gene locus_tag LOCUS_07470 gene trmB 35539 36243 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P631 protein_id gnl|my_center|LOCUS_07470 37449 36295 gene locus_tag LOCUS_07480 37449 36295 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_07480 38039 37446 gene locus_tag LOCUS_07490 38039 37446 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 protein_id gnl|my_center|LOCUS_07490 38286 38089 gene locus_tag LOCUS_07500 38286 38089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 38974 38378 gene locus_tag LOCUS_07510 38974 38378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_07510 39847 39029 gene locus_tag LOCUS_07520 gene proC 39847 39029 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_07520 40577 39867 gene locus_tag LOCUS_07530 40577 39867 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_07530 40704 41741 gene locus_tag LOCUS_07540 gene pilT 40704 41741 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_07540 41814 42959 gene locus_tag LOCUS_07550 gene pilU 41814 42959 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_07550 43405 42968 gene locus_tag LOCUS_07560 43405 42968 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY0 protein_id gnl|my_center|LOCUS_07560 43997 43389 gene locus_tag LOCUS_07570 gene algH 43997 43389 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_07570 45085 44189 gene locus_tag LOCUS_07580 gene tonB3 45085 44189 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_07580 46195 45233 gene locus_tag LOCUS_07590 gene gshB 46195 45233 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA4 protein_id gnl|my_center|LOCUS_07590 >Feature sequence015 371 147 gene locus_tag LOCUS_07600 371 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1168 839 gene locus_tag LOCUS_07610 1168 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2020 1580 gene locus_tag LOCUS_07620 2020 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2546 2217 gene locus_tag LOCUS_07630 2546 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 3304 2660 gene locus_tag LOCUS_07640 3304 2660 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_07640 3813 3412 gene locus_tag LOCUS_07650 3813 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4224 3895 gene locus_tag LOCUS_07660 4224 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 4952 4173 gene locus_tag LOCUS_07670 4952 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5404 5066 gene locus_tag LOCUS_07680 5404 5066 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086843.1 protein_id gnl|my_center|LOCUS_07680 5941 5714 gene locus_tag LOCUS_07690 5941 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6335 6084 gene locus_tag LOCUS_07700 6335 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7086 6682 gene locus_tag LOCUS_07710 7086 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7480 7193 gene locus_tag LOCUS_07720 gene higA 7480 7193 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403401.1 protein_id gnl|my_center|LOCUS_07720 7760 7482 gene locus_tag LOCUS_07730 7760 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605675.1 protein_id gnl|my_center|LOCUS_07730 8291 7830 gene locus_tag LOCUS_07740 8291 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8799 8377 gene locus_tag LOCUS_07750 8799 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 9379 8876 gene locus_tag LOCUS_07760 9379 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 9863 9492 gene locus_tag LOCUS_07770 9863 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 11014 10541 gene locus_tag LOCUS_07780 11014 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 11916 11122 gene locus_tag LOCUS_07790 11916 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12907 12554 gene locus_tag LOCUS_07800 12907 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 13235 14206 gene locus_tag LOCUS_07810 13235 14206 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_07810 14355 15335 gene locus_tag LOCUS_07820 14355 15335 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930756.1 protein_id gnl|my_center|LOCUS_07820 15492 16655 gene locus_tag LOCUS_07830 15492 16655 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_07830 17919 16999 gene locus_tag LOCUS_07840 17919 16999 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_07840 19259 17919 gene locus_tag LOCUS_07850 19259 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814854.1 protein_id gnl|my_center|LOCUS_07850 19404 21818 gene locus_tag LOCUS_07860 19404 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 22166 25009 gene locus_tag LOCUS_07870 22166 25009 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_07870 25025 25309 gene locus_tag LOCUS_07880 25025 25309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07880 25311 26669 gene locus_tag LOCUS_07890 25311 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 26872 27438 gene locus_tag LOCUS_07900 26872 27438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 27675 27448 gene locus_tag LOCUS_07910 27675 27448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 27922 27737 gene locus_tag LOCUS_07920 27922 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 28076 29626 gene locus_tag LOCUS_07930 28076 29626 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_07930 30130 32694 gene locus_tag LOCUS_07940 30130 32694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 32757 37931 gene locus_tag LOCUS_07950 32757 37931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 37924 40026 gene locus_tag LOCUS_07960 37924 40026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 40037 41065 gene locus_tag LOCUS_07970 40037 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 41089 41874 gene locus_tag LOCUS_07980 41089 41874 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_07980 41883 42296 gene locus_tag LOCUS_07990 41883 42296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 42289 43029 gene locus_tag LOCUS_08000 gene macB 42289 43029 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF1 protein_id gnl|my_center|LOCUS_08000 44197 43106 gene locus_tag LOCUS_08010 44197 43106 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_08010 44616 44407 gene locus_tag LOCUS_08020 44616 44407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 45280 44894 gene locus_tag LOCUS_08030 45280 44894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence016 3357 133 gene locus_tag LOCUS_08040 gene mcm 3357 133 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_08040 4918 3383 gene locus_tag LOCUS_08050 gene fadD13 4918 3383 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_08050 5742 4939 gene locus_tag LOCUS_08060 5742 4939 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_08060 5909 8206 gene locus_tag LOCUS_08070 5909 8206 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_08070 8375 10534 gene locus_tag LOCUS_08080 8375 10534 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256930.1 protein_id gnl|my_center|LOCUS_08080 11095 10541 gene locus_tag LOCUS_08090 11095 10541 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706202.1 protein_id gnl|my_center|LOCUS_08090 11266 13344 gene locus_tag LOCUS_08100 11266 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 13341 13724 gene locus_tag LOCUS_08110 13341 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 13739 14464 gene locus_tag LOCUS_08120 13739 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 14708 15028 gene locus_tag LOCUS_08130 14708 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 15049 15774 gene locus_tag LOCUS_08140 gene pspA 15049 15774 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_08140 15771 16010 gene locus_tag LOCUS_08150 15771 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 16672 16007 gene locus_tag LOCUS_08160 16672 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 17174 16731 gene locus_tag LOCUS_08170 17174 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 17874 17167 gene locus_tag LOCUS_08180 17874 17167 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_08180 19281 17902 gene locus_tag LOCUS_08190 19281 17902 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_08190 21017 19503 gene locus_tag LOCUS_08200 gene rmuC 21017 19503 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4U3 protein_id gnl|my_center|LOCUS_08200 21962 21108 gene locus_tag LOCUS_08210 gene trxA 21962 21108 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_08210 22829 22299 gene locus_tag LOCUS_08220 22829 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 24008 22893 gene locus_tag LOCUS_08230 24008 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 24204 24938 gene locus_tag LOCUS_08240 24204 24938 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_08240 25063 25431 gene locus_tag LOCUS_08250 25063 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 25702 25454 gene locus_tag LOCUS_08260 25702 25454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 26805 25819 gene locus_tag LOCUS_08270 26805 25819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 27082 27819 gene locus_tag LOCUS_08280 27082 27819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 27851 28516 gene locus_tag LOCUS_08290 27851 28516 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125812.1 protein_id gnl|my_center|LOCUS_08290 28578 28919 gene locus_tag LOCUS_08300 28578 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 28901 29884 gene locus_tag LOCUS_08310 28901 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 29958 30887 gene locus_tag LOCUS_08320 29958 30887 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGB9 protein_id gnl|my_center|LOCUS_08320 30951 31820 gene locus_tag LOCUS_08330 30951 31820 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_08330 31851 32498 gene locus_tag LOCUS_08340 31851 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 32563 33099 gene locus_tag LOCUS_08350 32563 33099 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887565.1 protein_id gnl|my_center|LOCUS_08350 33549 33160 gene locus_tag LOCUS_08360 33549 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 33851 33543 gene locus_tag LOCUS_08370 33851 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 34027 34785 gene locus_tag LOCUS_08380 gene fabG 34027 34785 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_08380 35716 34865 gene locus_tag LOCUS_08390 35716 34865 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564059.1 protein_id gnl|my_center|LOCUS_08390 36061 38484 gene locus_tag LOCUS_08400 gene pflD 36061 38484 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_08400 38560 39003 gene locus_tag LOCUS_08410 38560 39003 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_08410 39041 39442 gene locus_tag LOCUS_08420 39041 39442 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_08420 39795 40361 gene locus_tag LOCUS_08430 39795 40361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 40380 40658 gene locus_tag LOCUS_08440 40380 40658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 40746 41585 gene locus_tag LOCUS_08450 gene pcaD 40746 41585 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973944.1 protein_id gnl|my_center|LOCUS_08450 41847 41632 gene locus_tag LOCUS_08460 41847 41632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 42411 42232 gene locus_tag LOCUS_08470 42411 42232 CDS product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070858.1 protein_id gnl|my_center|LOCUS_08470 42599 43528 gene locus_tag LOCUS_08480 42599 43528 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086663.1 protein_id gnl|my_center|LOCUS_08480 43685 44527 gene locus_tag LOCUS_08490 43685 44527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 44709 44885 gene locus_tag LOCUS_08500 44709 44885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence017 204 620 gene locus_tag LOCUS_08510 204 620 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_08510 666 1151 gene locus_tag LOCUS_08520 gene secB 666 1151 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU56 protein_id gnl|my_center|LOCUS_08520 1648 1175 gene locus_tag LOCUS_08530 gene trmL 1648 1175 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU7 protein_id gnl|my_center|LOCUS_08530 2859 1933 gene locus_tag LOCUS_08540 2859 1933 CDS product stomatin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073827.1 protein_id gnl|my_center|LOCUS_08540 3776 2856 gene locus_tag LOCUS_08550 3776 2856 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073828.1 protein_id gnl|my_center|LOCUS_08550 4306 3827 gene locus_tag LOCUS_08560 4306 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073829.1 protein_id gnl|my_center|LOCUS_08560 5878 4448 gene locus_tag LOCUS_08570 gene ntrC 5878 4448 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_08570 6980 5862 gene locus_tag LOCUS_08580 6980 5862 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_08580 7792 7160 gene locus_tag LOCUS_08590 7792 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 9318 7906 gene locus_tag LOCUS_08600 gene glnA 9318 7906 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Q3 protein_id gnl|my_center|LOCUS_08600 9842 9609 gene locus_tag LOCUS_08610 9842 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 10930 9875 gene locus_tag LOCUS_08620 10930 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_08620 11078 12898 gene locus_tag LOCUS_08630 11078 12898 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405222.1 protein_id gnl|my_center|LOCUS_08630 12969 13931 gene locus_tag LOCUS_08640 12969 13931 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 protein_id gnl|my_center|LOCUS_08640 13951 14388 gene locus_tag LOCUS_08650 gene dtd 13951 14388 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_08650 15214 14444 gene locus_tag LOCUS_08660 gene tatC 15214 14444 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_08660 15749 15195 gene locus_tag LOCUS_08670 gene tatB 15749 15195 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB4 protein_id gnl|my_center|LOCUS_08670 16019 15777 gene locus_tag LOCUS_08680 gene tatA 16019 15777 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57051 protein_id gnl|my_center|LOCUS_08680 17801 16161 gene locus_tag LOCUS_08690 gene ubiB 17801 16161 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_08690 18790 18008 gene locus_tag LOCUS_08700 gene ubiE 18790 18008 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_08700 20346 19012 gene locus_tag LOCUS_08710 gene hslU 20346 19012 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_08710 20916 20368 gene locus_tag LOCUS_08720 gene hslV 20916 20368 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_08720 21476 21006 gene locus_tag LOCUS_08730 21476 21006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_08730 23846 21618 gene locus_tag LOCUS_08740 gene priA 23846 21618 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF4 protein_id gnl|my_center|LOCUS_08740 24044 24259 gene locus_tag LOCUS_08750 gene rpmE 24044 24259 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_08750 24334 25788 gene locus_tag LOCUS_08760 24334 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_08760 28095 25831 gene locus_tag LOCUS_08770 gene mrcA 28095 25831 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_08770 28324 28614 gene locus_tag LOCUS_08780 28324 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 28820 30799 gene locus_tag LOCUS_08790 gene pilQ 28820 30799 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_08790 30881 31426 gene locus_tag LOCUS_08800 gene aroK 30881 31426 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L67 protein_id gnl|my_center|LOCUS_08800 31436 32527 gene locus_tag LOCUS_08810 gene aroB 31436 32527 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V15 protein_id gnl|my_center|LOCUS_08810 32834 33481 gene locus_tag LOCUS_08820 32834 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 33543 36701 gene locus_tag LOCUS_08830 33543 36701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 38262 36811 gene locus_tag LOCUS_08840 gene gltD 38262 36811 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_08840 42874 38291 gene locus_tag LOCUS_08850 gene gltB 42874 38291 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_08850 44027 43233 gene locus_tag LOCUS_08860 44027 43233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596582.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence018 878 597 gene locus_tag LOCUS_08870 878 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1759 1124 gene locus_tag LOCUS_08880 1759 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2129 2054 gene locus_tag LOCUS_t00030 2129 2054 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3382 2246 gene locus_tag LOCUS_08890 3382 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 protein_id gnl|my_center|LOCUS_08890 3943 3425 gene locus_tag LOCUS_08900 3943 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4854 4105 gene locus_tag LOCUS_08910 4854 4105 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_08910 5406 4990 gene locus_tag LOCUS_08920 5406 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_08920 6718 5642 gene locus_tag LOCUS_08930 gene echA2 6718 5642 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_08930 7572 6934 gene locus_tag LOCUS_08940 7572 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 9205 7760 gene locus_tag LOCUS_08950 9205 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 9941 9234 gene locus_tag LOCUS_08960 gene cobB 9941 9234 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW3 protein_id gnl|my_center|LOCUS_08960 10836 10042 gene locus_tag LOCUS_08970 gene menB 10836 10042 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 protein_id gnl|my_center|LOCUS_08970 13967 11022 gene locus_tag LOCUS_08980 13967 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14701 15804 gene locus_tag LOCUS_08990 14701 15804 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_08990 16214 15840 gene locus_tag LOCUS_09000 16214 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 16510 16313 gene locus_tag LOCUS_09010 16510 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 16708 17370 gene locus_tag LOCUS_09020 16708 17370 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_09020 18999 17419 gene locus_tag LOCUS_09030 18999 17419 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089528.1 protein_id gnl|my_center|LOCUS_09030 19842 19012 gene locus_tag LOCUS_09040 19842 19012 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730152.1 protein_id gnl|my_center|LOCUS_09040 20247 21104 gene locus_tag LOCUS_09050 20247 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 21121 22758 gene locus_tag LOCUS_09060 21121 22758 CDS product glucose-methanol-choline oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730909.1 protein_id gnl|my_center|LOCUS_09060 22785 23867 gene locus_tag LOCUS_09070 22785 23867 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888061.1 protein_id gnl|my_center|LOCUS_09070 24939 24181 gene locus_tag LOCUS_09080 24939 24181 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_09080 25641 25045 gene locus_tag LOCUS_09090 25641 25045 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 protein_id gnl|my_center|LOCUS_09090 27355 25634 gene locus_tag LOCUS_09100 27355 25634 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_09100 27708 28070 gene locus_tag LOCUS_09110 27708 28070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 29005 28145 gene locus_tag LOCUS_09120 29005 28145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 29331 29002 gene locus_tag LOCUS_09130 29331 29002 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566205.1 protein_id gnl|my_center|LOCUS_09130 29533 30219 gene locus_tag LOCUS_09140 29533 30219 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_09140 30230 30415 gene locus_tag LOCUS_09150 30230 30415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 30702 31196 gene locus_tag LOCUS_09160 30702 31196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 31445 31221 gene locus_tag LOCUS_09170 31445 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 31688 31972 gene locus_tag LOCUS_09180 31688 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 32353 32081 gene locus_tag LOCUS_09190 32353 32081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 32722 32647 gene locus_tag LOCUS_t00040 32722 32647 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32839 33618 gene locus_tag LOCUS_09200 gene mhpC 32839 33618 CDS product lipolytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_09200 33644 34297 gene locus_tag LOCUS_09210 33644 34297 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_09210 35253 34375 gene locus_tag LOCUS_09220 35253 34375 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_09220 35423 37873 gene locus_tag LOCUS_09230 35423 37873 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_09230 37886 38707 gene locus_tag LOCUS_09240 37886 38707 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090003.1 protein_id gnl|my_center|LOCUS_09240 38819 39958 gene locus_tag LOCUS_09250 gene metX 38819 39958 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8L2 protein_id gnl|my_center|LOCUS_09250 41416 40277 gene locus_tag LOCUS_09260 41416 40277 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_09260 42629 41430 gene locus_tag LOCUS_09270 42629 41430 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_09270 43938 42733 gene locus_tag LOCUS_09280 43938 42733 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence019 430 101 gene locus_tag LOCUS_09290 gene yajC 430 101 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_09290 1674 556 gene locus_tag LOCUS_09300 gene tgt 1674 556 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_09300 2757 1729 gene locus_tag LOCUS_09310 gene queA 2757 1729 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_09310 3069 4268 gene locus_tag LOCUS_09320 3069 4268 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_09320 4523 4927 gene locus_tag LOCUS_09330 4523 4927 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_09330 5571 4924 gene locus_tag LOCUS_09340 5571 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5991 6803 gene locus_tag LOCUS_09350 5991 6803 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067689.1 protein_id gnl|my_center|LOCUS_09350 6911 7459 gene locus_tag LOCUS_09360 6911 7459 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_09360 7585 7370 gene locus_tag LOCUS_09370 7585 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7773 8207 gene locus_tag LOCUS_09380 7773 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929743.1 protein_id gnl|my_center|LOCUS_09380 8204 9418 gene locus_tag LOCUS_09390 8204 9418 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_09390 9582 10772 gene locus_tag LOCUS_09400 9582 10772 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926854.1 protein_id gnl|my_center|LOCUS_09400 10775 11188 gene locus_tag LOCUS_09410 10775 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815546.1 protein_id gnl|my_center|LOCUS_09410 11290 12420 gene locus_tag LOCUS_09420 gene acd 11290 12420 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_09420 12438 13703 gene locus_tag LOCUS_09430 12438 13703 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_09430 14230 14466 gene locus_tag LOCUS_09440 14230 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 14984 14568 gene locus_tag LOCUS_09450 14984 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 15421 14981 gene locus_tag LOCUS_09460 15421 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 16067 15426 gene locus_tag LOCUS_09470 16067 15426 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_09470 16751 16155 gene locus_tag LOCUS_09480 16751 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 18198 17008 gene locus_tag LOCUS_09490 18198 17008 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085484.1 protein_id gnl|my_center|LOCUS_09490 18443 20197 gene locus_tag LOCUS_09500 18443 20197 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_09500 21917 20307 gene locus_tag LOCUS_09510 21917 20307 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_09510 22189 22677 gene locus_tag LOCUS_09520 22189 22677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 22891 22721 gene locus_tag LOCUS_09530 22891 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 23660 22866 gene locus_tag LOCUS_09540 23660 22866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 24447 23695 gene locus_tag LOCUS_09550 24447 23695 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_09550 24532 24849 gene locus_tag LOCUS_09560 24532 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 24899 26458 gene locus_tag LOCUS_09570 24899 26458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_09570 28009 26543 gene locus_tag LOCUS_09580 28009 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 29468 28059 gene locus_tag LOCUS_09590 29468 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 30336 29494 gene locus_tag LOCUS_09600 30336 29494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_09600 31927 30404 gene locus_tag LOCUS_09610 31927 30404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 32089 33369 gene locus_tag LOCUS_09620 32089 33369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 33762 34856 gene locus_tag LOCUS_09630 33762 34856 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_09630 35423 34968 gene locus_tag LOCUS_09640 35423 34968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 35364 35633 gene locus_tag LOCUS_09650 35364 35633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 38659 36197 gene locus_tag LOCUS_09660 38659 36197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 38946 40028 gene locus_tag LOCUS_09670 38946 40028 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245919.1 protein_id gnl|my_center|LOCUS_09670 40159 41028 gene locus_tag LOCUS_09680 40159 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 41577 42233 gene locus_tag LOCUS_09690 41577 42233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 42237 42707 gene locus_tag LOCUS_09700 gene rpoE 42237 42707 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence020 338 1063 gene locus_tag LOCUS_09710 338 1063 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089892.1 protein_id gnl|my_center|LOCUS_09710 1153 2025 gene locus_tag LOCUS_09720 1153 2025 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_09720 5222 2601 gene locus_tag LOCUS_09730 5222 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 7606 5219 gene locus_tag LOCUS_09740 7606 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 8640 7606 gene locus_tag LOCUS_09750 8640 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 9793 8756 gene locus_tag LOCUS_09760 gene batA 9793 8756 CDS product aerotolerance regulator BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_09760 10845 9793 gene locus_tag LOCUS_09770 10845 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11858 10845 gene locus_tag LOCUS_09780 11858 10845 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_09780 12862 11876 gene locus_tag LOCUS_09790 12862 11876 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_09790 13043 13309 gene locus_tag LOCUS_09800 13043 13309 CDS product regulatory protein, FmdB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038148.1 protein_id gnl|my_center|LOCUS_09800 15925 13427 gene locus_tag LOCUS_09810 15925 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 16337 16131 gene locus_tag LOCUS_09820 16337 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 16564 16394 gene locus_tag LOCUS_09830 16564 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 19393 17267 gene locus_tag LOCUS_09840 19393 17267 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_09840 20379 19429 gene locus_tag LOCUS_09850 20379 19429 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_09850 21614 20469 gene locus_tag LOCUS_09860 21614 20469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 22015 21743 gene locus_tag LOCUS_09870 22015 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 22522 22034 gene locus_tag LOCUS_09880 22522 22034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255959.1 protein_id gnl|my_center|LOCUS_09880 22826 23284 gene locus_tag LOCUS_09890 22826 23284 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_09890 23425 24300 gene locus_tag LOCUS_09900 23425 24300 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085991.1 protein_id gnl|my_center|LOCUS_09900 24554 24366 gene locus_tag LOCUS_09910 24554 24366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 24578 25360 gene locus_tag LOCUS_09920 gene fadB 24578 25360 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94549 protein_id gnl|my_center|LOCUS_09920 26803 25523 gene locus_tag LOCUS_09930 26803 25523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085873.1 protein_id gnl|my_center|LOCUS_09930 27072 26902 gene locus_tag LOCUS_09940 27072 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 27159 27599 gene locus_tag LOCUS_09950 27159 27599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703123.1 protein_id gnl|my_center|LOCUS_09950 28781 27717 gene locus_tag LOCUS_09960 28781 27717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 29045 29860 gene locus_tag LOCUS_09970 29045 29860 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_09970 30335 30607 gene locus_tag LOCUS_09980 30335 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09980 30980 30822 gene locus_tag LOCUS_09990 30980 30822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 31175 31342 gene locus_tag LOCUS_10000 31175 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 32275 31442 gene locus_tag LOCUS_10010 32275 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10010 32992 32324 gene locus_tag LOCUS_10020 32992 32324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10020 34262 33156 gene locus_tag LOCUS_10030 34262 33156 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728253.1 protein_id gnl|my_center|LOCUS_10030 34500 35558 gene locus_tag LOCUS_10040 34500 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 36503 35604 gene locus_tag LOCUS_10050 36503 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 36641 37294 gene locus_tag LOCUS_10060 36641 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 42480 37375 gene locus_tag LOCUS_10070 42480 37375 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence021 3 149 gene locus_tag LOCUS_10080 3 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2039 315 gene locus_tag LOCUS_10090 2039 315 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_10090 3484 2039 gene locus_tag LOCUS_10100 3484 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6715 3641 gene locus_tag LOCUS_10110 6715 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8148 7129 gene locus_tag LOCUS_10120 8148 7129 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870152.1 protein_id gnl|my_center|LOCUS_10120 8803 8162 gene locus_tag LOCUS_10130 8803 8162 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_10130 9733 8921 gene locus_tag LOCUS_10140 gene lpxA 9733 8921 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFU2 protein_id gnl|my_center|LOCUS_10140 10186 9896 gene locus_tag LOCUS_10150 10186 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10627 11196 gene locus_tag LOCUS_10160 gene fabA 10627 11196 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y6 protein_id gnl|my_center|LOCUS_10160 11193 12407 gene locus_tag LOCUS_10170 gene fabB 11193 12407 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_10170 13129 12416 gene locus_tag LOCUS_10180 13129 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 14903 13299 gene locus_tag LOCUS_10190 14903 13299 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_10190 15386 15709 gene locus_tag LOCUS_10200 15386 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 15941 17587 gene locus_tag LOCUS_10210 15941 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_10210 17584 19971 gene locus_tag LOCUS_10220 17584 19971 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_10220 20586 20798 gene locus_tag LOCUS_10230 gene scoF 20586 20798 CDS product cold shock protein ScoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48859 protein_id gnl|my_center|LOCUS_10230 21177 21641 gene locus_tag LOCUS_10240 21177 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_10240 21684 21965 gene locus_tag LOCUS_10250 21684 21965 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_10250 22218 22424 gene locus_tag LOCUS_10260 22218 22424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 25673 22596 gene locus_tag LOCUS_10270 25673 22596 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_10270 27521 25704 gene locus_tag LOCUS_10280 gene sppA 27521 25704 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 protein_id gnl|my_center|LOCUS_10280 28220 27615 gene locus_tag LOCUS_10290 28220 27615 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_10290 28482 30116 gene locus_tag LOCUS_10300 28482 30116 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_10300 30139 31254 gene locus_tag LOCUS_10310 30139 31254 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_10310 31291 32505 gene locus_tag LOCUS_10320 31291 32505 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_10320 32544 33026 gene locus_tag LOCUS_10330 32544 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 33298 34728 gene locus_tag LOCUS_10340 33298 34728 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089346.1 protein_id gnl|my_center|LOCUS_10340 35854 34781 gene locus_tag LOCUS_10350 35854 34781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 36108 37070 gene locus_tag LOCUS_10360 gene moaA 36108 37070 CDS product cyclic pyranopterin phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ65 protein_id gnl|my_center|LOCUS_10360 37241 37008 gene locus_tag LOCUS_10370 37241 37008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 37297 37869 gene locus_tag LOCUS_10380 37297 37869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_10380 37942 39399 gene locus_tag LOCUS_10390 37942 39399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_10390 39523 40719 gene locus_tag LOCUS_10400 39523 40719 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_10400 41588 40749 gene locus_tag LOCUS_10410 41588 40749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10410 42164 41643 gene locus_tag LOCUS_10420 42164 41643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10420 >Feature sequence022 288 482 gene locus_tag LOCUS_10430 288 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3177 826 gene locus_tag LOCUS_10440 3177 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3673 3323 gene locus_tag LOCUS_10450 3673 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 5683 3839 gene locus_tag LOCUS_10460 5683 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5867 6679 gene locus_tag LOCUS_10470 5867 6679 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_10470 6694 7641 gene locus_tag LOCUS_10480 6694 7641 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_10480 7651 8052 gene locus_tag LOCUS_10490 7651 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_10490 8235 10373 gene locus_tag LOCUS_10500 8235 10373 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_10500 11609 10365 gene locus_tag LOCUS_10510 11609 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 12742 11759 gene locus_tag LOCUS_10520 12742 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 12929 13381 gene locus_tag LOCUS_10530 12929 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 13961 13398 gene locus_tag LOCUS_10540 13961 13398 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_10540 15459 14116 gene locus_tag LOCUS_10550 15459 14116 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWB6 protein_id gnl|my_center|LOCUS_10550 15721 16650 gene locus_tag LOCUS_10560 15721 16650 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 protein_id gnl|my_center|LOCUS_10560 17359 16760 gene locus_tag LOCUS_10570 17359 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 17635 18876 gene locus_tag LOCUS_10580 17635 18876 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_10580 19439 29020 gene locus_tag LOCUS_10590 19439 29020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 29209 30615 gene locus_tag LOCUS_10600 gene leuC 29209 30615 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZND5 protein_id gnl|my_center|LOCUS_10600 30640 31236 gene locus_tag LOCUS_10610 gene leuD 30640 31236 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_10610 31289 32902 gene locus_tag LOCUS_10620 31289 32902 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_10620 33099 34322 gene locus_tag LOCUS_10630 33099 34322 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269376.1 protein_id gnl|my_center|LOCUS_10630 34340 35605 gene locus_tag LOCUS_10640 34340 35605 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027053.1 protein_id gnl|my_center|LOCUS_10640 35691 36731 gene locus_tag LOCUS_10650 gene galT 35691 36731 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31764 protein_id gnl|my_center|LOCUS_10650 36724 37752 gene locus_tag LOCUS_10660 36724 37752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 37819 38601 gene locus_tag LOCUS_10670 37819 38601 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_10670 39375 38632 gene locus_tag LOCUS_10680 39375 38632 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807972.1 protein_id gnl|my_center|LOCUS_10680 39551 40597 gene locus_tag LOCUS_10690 gene mtnA1 39551 40597 CDS product methylthioribose-1-phosphate isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IK7 protein_id gnl|my_center|LOCUS_10690 40715 41614 gene locus_tag LOCUS_10700 40715 41614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence023 1440 199 gene locus_tag LOCUS_10710 gene fabV 1440 199 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLI7 protein_id gnl|my_center|LOCUS_10710 2264 1476 gene locus_tag LOCUS_10720 gene lgt 2264 1476 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_10720 2367 3104 gene locus_tag LOCUS_10730 2367 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_10730 5626 3326 gene locus_tag LOCUS_10740 gene ptsP 5626 3326 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_10740 6210 5722 gene locus_tag LOCUS_10750 gene rppH 6210 5722 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL1 protein_id gnl|my_center|LOCUS_10750 6407 7066 gene locus_tag LOCUS_10760 6407 7066 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_10760 7077 8180 gene locus_tag LOCUS_10770 7077 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9651 8188 gene locus_tag LOCUS_10780 gene gcvPB 9651 8188 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ97 protein_id gnl|my_center|LOCUS_10780 10989 9670 gene locus_tag LOCUS_10790 gene gcvPA 10989 9670 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ95 protein_id gnl|my_center|LOCUS_10790 11778 11383 gene locus_tag LOCUS_10800 gene gcvH 11778 11383 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_10800 12901 11813 gene locus_tag LOCUS_10810 gene gcvT 12901 11813 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 protein_id gnl|my_center|LOCUS_10810 14396 13032 gene locus_tag LOCUS_10820 gene pepP 14396 13032 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105380.1 protein_id gnl|my_center|LOCUS_10820 14613 14870 gene locus_tag LOCUS_10830 14613 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 14914 15252 gene locus_tag LOCUS_10840 gene zapA 14914 15252 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_10840 15448 16143 gene locus_tag LOCUS_10850 15448 16143 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW2 protein_id gnl|my_center|LOCUS_10850 16510 17046 gene locus_tag LOCUS_10860 gene def 16510 17046 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_10860 17189 17863 gene locus_tag LOCUS_10870 gene rpiA 17189 17863 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_10870 18044 18586 gene locus_tag LOCUS_10880 18044 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 18602 19474 gene locus_tag LOCUS_10890 18602 19474 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_10890 19467 22886 gene locus_tag LOCUS_10900 19467 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 22883 23326 gene locus_tag LOCUS_10910 22883 23326 CDS product methyl-viologen-reducing hydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_10910 23338 24447 gene locus_tag LOCUS_10920 23338 24447 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_10920 24478 25998 gene locus_tag LOCUS_10930 24478 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 26017 27237 gene locus_tag LOCUS_10940 gene serA 26017 27237 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_10940 28197 27262 gene locus_tag LOCUS_10950 28197 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_10950 29291 28227 gene locus_tag LOCUS_10960 29291 28227 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_10960 30508 29291 gene locus_tag LOCUS_10970 gene pgk 30508 29291 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y4 protein_id gnl|my_center|LOCUS_10970 32534 30525 gene locus_tag LOCUS_10980 gene tkt1 32534 30525 CDS product transketolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP2 protein_id gnl|my_center|LOCUS_10980 32827 33984 gene locus_tag LOCUS_10990 gene metK 32827 33984 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX3 protein_id gnl|my_center|LOCUS_10990 34203 33991 gene locus_tag LOCUS_11000 34203 33991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 34153 34839 gene locus_tag LOCUS_11010 gene metF 34153 34839 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 protein_id gnl|my_center|LOCUS_11010 35087 35824 gene locus_tag LOCUS_11020 35087 35824 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_11020 36291 35821 gene locus_tag LOCUS_11030 36291 35821 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 protein_id gnl|my_center|LOCUS_11030 <40927 36299 gene locus_tag LOCUS_11040 <40927 36299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein >Feature sequence024 1019 150 gene locus_tag LOCUS_11050 1019 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1340 1693 gene locus_tag LOCUS_11060 1340 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3064 1706 gene locus_tag LOCUS_11070 3064 1706 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 protein_id gnl|my_center|LOCUS_11070 3279 3833 gene locus_tag LOCUS_11080 3279 3833 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_11080 3899 4741 gene locus_tag LOCUS_11090 3899 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4770 6770 gene locus_tag LOCUS_11100 4770 6770 CDS product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I596 protein_id gnl|my_center|LOCUS_11100 6912 8300 gene locus_tag LOCUS_11110 6912 8300 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_11110 8303 9592 gene locus_tag LOCUS_11120 8303 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_11120 11853 9655 gene locus_tag LOCUS_11130 11853 9655 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_11130 12622 12002 gene locus_tag LOCUS_11140 12622 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12728 12943 gene locus_tag LOCUS_11150 12728 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 13056 14105 gene locus_tag LOCUS_11160 13056 14105 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_11160 14925 14128 gene locus_tag LOCUS_11170 14925 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 15201 14953 gene locus_tag LOCUS_11180 15201 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 16144 15665 gene locus_tag LOCUS_11190 16144 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 16931 16284 gene locus_tag LOCUS_11200 16931 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 17136 17993 gene locus_tag LOCUS_11210 17136 17993 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H76 protein_id gnl|my_center|LOCUS_11210 17990 18961 gene locus_tag LOCUS_11220 17990 18961 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_11220 19150 20739 gene locus_tag LOCUS_11230 19150 20739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 21770 20736 gene locus_tag LOCUS_11240 21770 20736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 21950 23176 gene locus_tag LOCUS_11250 21950 23176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 protein_id gnl|my_center|LOCUS_11250 23272 23475 gene locus_tag LOCUS_11260 23272 23475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 23435 24511 gene locus_tag LOCUS_11270 23435 24511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 protein_id gnl|my_center|LOCUS_11270 24574 25659 gene locus_tag LOCUS_11280 24574 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 25663 26097 gene locus_tag LOCUS_11290 25663 26097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 26111 26500 gene locus_tag LOCUS_11300 26111 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 26580 26810 gene locus_tag LOCUS_11310 26580 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 27102 27818 gene locus_tag LOCUS_11320 27102 27818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 28326 27991 gene locus_tag LOCUS_11330 28326 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 28815 28378 gene locus_tag LOCUS_11340 28815 28378 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 protein_id gnl|my_center|LOCUS_11340 29284 28988 gene locus_tag LOCUS_11350 29284 28988 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I449 protein_id gnl|my_center|LOCUS_11350 30439 29300 gene locus_tag LOCUS_11360 gene rnd 30439 29300 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_11360 31080 30484 gene locus_tag LOCUS_11370 gene recR 31080 30484 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ4 protein_id gnl|my_center|LOCUS_11370 31430 31107 gene locus_tag LOCUS_11380 31430 31107 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_11380 33143 31455 gene locus_tag LOCUS_11390 33143 31455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 33303 34040 gene locus_tag LOCUS_11400 33303 34040 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 protein_id gnl|my_center|LOCUS_11400 34030 34569 gene locus_tag LOCUS_11410 34030 34569 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_11410 34936 34679 gene locus_tag LOCUS_11420 34936 34679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 35396 35169 gene locus_tag LOCUS_11430 35396 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 36065 35415 gene locus_tag LOCUS_11440 36065 35415 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_11440 36992 36066 gene locus_tag LOCUS_11450 36992 36066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 37385 37146 gene locus_tag LOCUS_11460 gene pspB 37385 37146 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_11460 38192 37527 gene locus_tag LOCUS_11470 gene pspA 38192 37527 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_11470 38488 39528 gene locus_tag LOCUS_11480 gene pspF 38488 39528 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence025 171 407 gene locus_tag LOCUS_11490 171 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 655 434 gene locus_tag LOCUS_11500 655 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2649 652 gene locus_tag LOCUS_11510 2649 652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_11510 4631 2649 gene locus_tag LOCUS_11520 4631 2649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_11520 4922 5935 gene locus_tag LOCUS_11530 4922 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5932 6396 gene locus_tag LOCUS_11540 5932 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7353 6415 gene locus_tag LOCUS_11550 7353 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8597 7350 gene locus_tag LOCUS_11560 8597 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9641 8634 gene locus_tag LOCUS_11570 gene mer 9641 8634 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_11570 10721 9699 gene locus_tag LOCUS_11580 10721 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063668.1 protein_id gnl|my_center|LOCUS_11580 11940 10768 gene locus_tag LOCUS_11590 11940 10768 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_11590 13514 12111 gene locus_tag LOCUS_11600 13514 12111 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976239.1 protein_id gnl|my_center|LOCUS_11600 15215 13614 gene locus_tag LOCUS_11610 15215 13614 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_11610 15730 15440 gene locus_tag LOCUS_11620 15730 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 16341 15838 gene locus_tag LOCUS_11630 16341 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 16632 16808 gene locus_tag LOCUS_11640 16632 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 18384 19142 gene locus_tag LOCUS_11650 18384 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 19932 19570 gene locus_tag LOCUS_11660 19932 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 20158 20994 gene locus_tag LOCUS_11670 20158 20994 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_11670 20991 21188 gene locus_tag LOCUS_11680 20991 21188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 23104 21335 gene locus_tag LOCUS_11690 23104 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 24065 23820 gene locus_tag LOCUS_11700 24065 23820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 24258 24815 gene locus_tag LOCUS_11710 24258 24815 CDS product nucleoprotein/polynucleotide-associated enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_308436.2 protein_id gnl|my_center|LOCUS_11710 24882 25886 gene locus_tag LOCUS_11720 24882 25886 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_11720 26245 25907 gene locus_tag LOCUS_11730 26245 25907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 26401 27006 gene locus_tag LOCUS_11740 26401 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 27267 27860 gene locus_tag LOCUS_11750 27267 27860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 28824 27937 gene locus_tag LOCUS_11760 28824 27937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 30275 29019 gene locus_tag LOCUS_11770 gene glpT 30275 29019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 protein_id gnl|my_center|LOCUS_11770 31027 30272 gene locus_tag LOCUS_11780 31027 30272 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_11780 32442 31060 gene locus_tag LOCUS_11790 gene atrB 32442 31060 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974388.1 protein_id gnl|my_center|LOCUS_11790 33180 32788 gene locus_tag LOCUS_11800 33180 32788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064295.1 protein_id gnl|my_center|LOCUS_11800 34842 33292 gene locus_tag LOCUS_11810 34842 33292 CDS product putative acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704165.1 protein_id gnl|my_center|LOCUS_11810 35970 34888 gene locus_tag LOCUS_11820 35970 34888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 37537 36026 gene locus_tag LOCUS_11830 37537 36026 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_11830 38953 37667 gene locus_tag LOCUS_11840 38953 37667 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_11840 39508 39041 gene locus_tag LOCUS_11850 39508 39041 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence026 1747 662 gene locus_tag LOCUS_11860 1747 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1868 2803 gene locus_tag LOCUS_11870 1868 2803 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229099.1 protein_id gnl|my_center|LOCUS_11870 3677 2856 gene locus_tag LOCUS_11880 3677 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5044 3905 gene locus_tag LOCUS_11890 5044 3905 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369891.1 protein_id gnl|my_center|LOCUS_11890 5120 6109 gene locus_tag LOCUS_11900 5120 6109 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_11900 6942 6115 gene locus_tag LOCUS_11910 6942 6115 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709509.1 protein_id gnl|my_center|LOCUS_11910 7819 7043 gene locus_tag LOCUS_11920 7819 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_11920 8082 9716 gene locus_tag LOCUS_11930 gene ydiF 8082 9716 CDS product putative ABC transporter ATP-binding protein YdiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05519 protein_id gnl|my_center|LOCUS_11930 9933 10292 gene locus_tag LOCUS_11940 9933 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 10583 10921 gene locus_tag LOCUS_11950 10583 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 11199 10990 gene locus_tag LOCUS_11960 11199 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 11092 12846 gene locus_tag LOCUS_11970 11092 12846 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_11970 13195 12935 gene locus_tag LOCUS_11980 gene moaD 13195 12935 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ8 protein_id gnl|my_center|LOCUS_11980 14654 13437 gene locus_tag LOCUS_11990 gene frc 14654 13437 CDS product formyl-CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7S7 protein_id gnl|my_center|LOCUS_11990 16299 14860 gene locus_tag LOCUS_12000 gene betC 16299 14860 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_12000 16602 17588 gene locus_tag LOCUS_12010 gene tkrA 16602 17588 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521382.1 protein_id gnl|my_center|LOCUS_12010 18000 17593 gene locus_tag LOCUS_12020 gene mceE 18000 17593 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_12020 19048 18218 gene locus_tag LOCUS_12030 19048 18218 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088967.1 protein_id gnl|my_center|LOCUS_12030 19821 19045 gene locus_tag LOCUS_12040 19821 19045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_12040 20585 19818 gene locus_tag LOCUS_12050 20585 19818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_12050 21834 20689 gene locus_tag LOCUS_12060 gene moeA 21834 20689 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31703 protein_id gnl|my_center|LOCUS_12060 22126 23823 gene locus_tag LOCUS_12070 22126 23823 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_12070 24475 24050 gene locus_tag LOCUS_12080 24475 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 24586 25404 gene locus_tag LOCUS_12090 24586 25404 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_12090 25838 26956 gene locus_tag LOCUS_12100 25838 26956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 26987 28111 gene locus_tag LOCUS_12110 26987 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 28139 28591 gene locus_tag LOCUS_12120 28139 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 28581 28763 gene locus_tag LOCUS_12130 28581 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 28687 29835 gene locus_tag LOCUS_12140 28687 29835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 30417 29896 gene locus_tag LOCUS_12150 30417 29896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 31124 30543 gene locus_tag LOCUS_12160 gene clpP 31124 30543 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG69 protein_id gnl|my_center|LOCUS_12160 31335 31832 gene locus_tag LOCUS_12170 31335 31832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 32001 32261 gene locus_tag LOCUS_12180 32001 32261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 32283 32621 gene locus_tag LOCUS_12190 32283 32621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 33329 32613 gene locus_tag LOCUS_12200 33329 32613 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_12200 33405 34865 gene locus_tag LOCUS_12210 33405 34865 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_12210 34962 35894 gene locus_tag LOCUS_12220 34962 35894 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_12220 35907 36578 gene locus_tag LOCUS_12230 35907 36578 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_12230 36591 37292 gene locus_tag LOCUS_12240 36591 37292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence027 161 418 gene locus_tag LOCUS_12250 161 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 436 1623 gene locus_tag LOCUS_12260 436 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1741 2949 gene locus_tag LOCUS_12270 1741 2949 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_12270 4388 3108 gene locus_tag LOCUS_12280 4388 3108 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_12280 5247 4567 gene locus_tag LOCUS_12290 5247 4567 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_12290 7465 5330 gene locus_tag LOCUS_12300 gene ppk 7465 5330 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E4 protein_id gnl|my_center|LOCUS_12300 7560 7727 gene locus_tag LOCUS_12310 7560 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8122 9057 gene locus_tag LOCUS_12320 8122 9057 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_12320 9091 10035 gene locus_tag LOCUS_12330 gene miaA2 9091 10035 CDS product tRNA dimethylallyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK5 protein_id gnl|my_center|LOCUS_12330 11292 10027 gene locus_tag LOCUS_12340 11292 10027 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_12340 12694 11474 gene locus_tag LOCUS_12350 12694 11474 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_12350 14153 12792 gene locus_tag LOCUS_12360 14153 12792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_12360 14555 15391 gene locus_tag LOCUS_12370 14555 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 15410 15682 gene locus_tag LOCUS_12380 15410 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 15679 16236 gene locus_tag LOCUS_12390 15679 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 16261 16965 gene locus_tag LOCUS_12400 16261 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 16968 17630 gene locus_tag LOCUS_12410 16968 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 18995 17889 gene locus_tag LOCUS_12420 18995 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 20416 19166 gene locus_tag LOCUS_12430 gene estA1 20416 19166 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE40 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12430 20830 20492 gene locus_tag LOCUS_12440 20830 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12440 20963 20811 gene locus_tag LOCUS_12450 20963 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 23813 20982 gene locus_tag LOCUS_12460 gene yprA 23813 20982 CDS product putative ATP-dependent helicase YprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50830 protein_id gnl|my_center|LOCUS_12460 23941 25038 gene locus_tag LOCUS_12470 23941 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 25072 26055 gene locus_tag LOCUS_12480 25072 26055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 26068 28398 gene locus_tag LOCUS_12490 gene yprA 26068 28398 CDS product putative ATP-dependent helicase YprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50830 protein_id gnl|my_center|LOCUS_12490 29469 28552 gene locus_tag LOCUS_12500 29469 28552 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727690.1 protein_id gnl|my_center|LOCUS_12500 29597 30898 gene locus_tag LOCUS_12510 29597 30898 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122010.1 protein_id gnl|my_center|LOCUS_12510 31041 33014 gene locus_tag LOCUS_12520 31041 33014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 33306 33674 gene locus_tag LOCUS_12530 33306 33674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 33969 34316 gene locus_tag LOCUS_12540 33969 34316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 35251 34439 gene locus_tag LOCUS_12550 35251 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 35822 35301 gene locus_tag LOCUS_12560 35822 35301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 36947 35937 gene locus_tag LOCUS_12570 36947 35937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975777.1 protein_id gnl|my_center|LOCUS_12570 37118 37555 gene locus_tag LOCUS_12580 gene mceE 37118 37555 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_12580 38239 37706 gene locus_tag LOCUS_12590 38239 37706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 38545 39132 gene locus_tag LOCUS_12600 38545 39132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence028 851 300 gene locus_tag LOCUS_12610 gene rfbC 851 300 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_12610 1848 1024 gene locus_tag LOCUS_12620 1848 1024 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_12620 2046 2861 gene locus_tag LOCUS_12630 2046 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3829 2864 gene locus_tag LOCUS_12640 gene fcl 3829 2864 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MFT8 protein_id gnl|my_center|LOCUS_12640 5087 3870 gene locus_tag LOCUS_12650 gene gmd 5087 3870 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMA5 protein_id gnl|my_center|LOCUS_12650 6266 5148 gene locus_tag LOCUS_12660 gene ald 6266 5148 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_12660 6386 6871 gene locus_tag LOCUS_12670 gene alsB 6386 6871 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162770.1 protein_id gnl|my_center|LOCUS_12670 7105 7956 gene locus_tag LOCUS_12680 7105 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7959 9527 gene locus_tag LOCUS_12690 7959 9527 CDS product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036300.1 protein_id gnl|my_center|LOCUS_12690 9744 12851 gene locus_tag LOCUS_12700 gene dnaE2 9744 12851 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_12700 13354 12848 gene locus_tag LOCUS_12710 13354 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 14621 13356 gene locus_tag LOCUS_12720 gene gspL 14621 13356 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_12720 15647 14637 gene locus_tag LOCUS_12730 gene xcpX 15647 14637 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 protein_id gnl|my_center|LOCUS_12730 16365 15640 gene locus_tag LOCUS_12740 gene xcpW 16365 15640 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_12740 16784 16365 gene locus_tag LOCUS_12750 gene xcpV 16784 16365 CDS product type II secretion system protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00516 protein_id gnl|my_center|LOCUS_12750 17305 16787 gene locus_tag LOCUS_12760 gene xcpU 17305 16787 CDS product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 protein_id gnl|my_center|LOCUS_12760 17939 17385 gene locus_tag LOCUS_12770 17939 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 19192 17969 gene locus_tag LOCUS_12780 gene xcpS 19192 17969 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_12780 20673 19189 gene locus_tag LOCUS_12790 gene xcpR 20673 19189 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_12790 21074 22087 gene locus_tag LOCUS_12800 gene pyrB 21074 22087 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_12800 22084 23283 gene locus_tag LOCUS_12810 gene liuA 22084 23283 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_12810 23424 24371 gene locus_tag LOCUS_12820 23424 24371 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869316.1 protein_id gnl|my_center|LOCUS_12820 24427 25383 gene locus_tag LOCUS_12830 gene cysK 24427 25383 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P600 protein_id gnl|my_center|LOCUS_12830 25509 27455 gene locus_tag LOCUS_12840 25509 27455 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_12840 28446 27514 gene locus_tag LOCUS_12850 gene etfA 28446 27514 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_12850 29195 28443 gene locus_tag LOCUS_12860 gene etfB 29195 28443 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038916.1 protein_id gnl|my_center|LOCUS_12860 29529 31187 gene locus_tag LOCUS_12870 29529 31187 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_12870 31733 31287 gene locus_tag LOCUS_12880 31733 31287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 31938 32198 gene locus_tag LOCUS_12890 31938 32198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 32247 32744 gene locus_tag LOCUS_12900 32247 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 32784 33479 gene locus_tag LOCUS_12910 32784 33479 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_12910 34320 33691 gene locus_tag LOCUS_12920 34320 33691 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_12920 34687 35340 gene locus_tag LOCUS_12930 34687 35340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 35354 36364 gene locus_tag LOCUS_12940 35354 36364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 37164 36376 gene locus_tag LOCUS_12950 37164 36376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 38887 37166 gene locus_tag LOCUS_12960 38887 37166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence029 1444 59 gene locus_tag LOCUS_12970 1444 59 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_12970 1632 1895 gene locus_tag LOCUS_12980 1632 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2051 4741 gene locus_tag LOCUS_12990 2051 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121739.1 protein_id gnl|my_center|LOCUS_12990 4747 5574 gene locus_tag LOCUS_13000 4747 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5624 6667 gene locus_tag LOCUS_13010 gene moxR 5624 6667 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121741.1 protein_id gnl|my_center|LOCUS_13010 6695 7579 gene locus_tag LOCUS_13020 6695 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_13020 7589 9628 gene locus_tag LOCUS_13030 7589 9628 CDS product inter-alpha-trypsin inhibitor heavy chain H2 [precursor] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_13030 9714 13247 gene locus_tag LOCUS_13040 9714 13247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 13244 15556 gene locus_tag LOCUS_13050 13244 15556 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_13050 15553 16590 gene locus_tag LOCUS_13060 15553 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 17245 16577 gene locus_tag LOCUS_13070 17245 16577 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_13070 18316 17249 gene locus_tag LOCUS_13080 18316 17249 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972726.1 protein_id gnl|my_center|LOCUS_13080 19797 18529 gene locus_tag LOCUS_13090 19797 18529 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_13090 20376 20567 gene locus_tag LOCUS_13100 20376 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 20575 21489 gene locus_tag LOCUS_13110 20575 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 21926 21486 gene locus_tag LOCUS_13120 21926 21486 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325564.1 protein_id gnl|my_center|LOCUS_13120 22126 22902 gene locus_tag LOCUS_13130 22126 22902 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878686.1 protein_id gnl|my_center|LOCUS_13130 23024 23785 gene locus_tag LOCUS_13140 23024 23785 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088335.1 protein_id gnl|my_center|LOCUS_13140 24109 23927 gene locus_tag LOCUS_13150 24109 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 26750 24291 gene locus_tag LOCUS_13160 26750 24291 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533043.1 protein_id gnl|my_center|LOCUS_13160 26999 29152 gene locus_tag LOCUS_13170 26999 29152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 29184 29603 gene locus_tag LOCUS_13180 29184 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 29857 29609 gene locus_tag LOCUS_13190 29857 29609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 29983 31038 gene locus_tag LOCUS_13200 29983 31038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 32057 31209 gene locus_tag LOCUS_13210 32057 31209 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704523.1 protein_id gnl|my_center|LOCUS_13210 33366 32152 gene locus_tag LOCUS_13220 33366 32152 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705167.1 protein_id gnl|my_center|LOCUS_13220 34544 33363 gene locus_tag LOCUS_13230 gene caiB 34544 33363 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972076.1 protein_id gnl|my_center|LOCUS_13230 35755 34961 gene locus_tag LOCUS_13240 35755 34961 CDS product thioester oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941486.1 protein_id gnl|my_center|LOCUS_13240 36728 35901 gene locus_tag LOCUS_13250 36728 35901 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_13250 36832 37605 gene locus_tag LOCUS_13260 36832 37605 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_13260 >Feature sequence030 2557 224 gene locus_tag LOCUS_13270 2557 224 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272795.1 protein_id gnl|my_center|LOCUS_13270 3154 3816 gene locus_tag LOCUS_13280 3154 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3832 4191 gene locus_tag LOCUS_13290 3832 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 4328 6469 gene locus_tag LOCUS_13300 4328 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_13300 8966 6582 gene locus_tag LOCUS_13310 8966 6582 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_13310 9095 11140 gene locus_tag LOCUS_13320 9095 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 11285 11599 gene locus_tag LOCUS_13330 11285 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 11615 12619 gene locus_tag LOCUS_13340 11615 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 14077 12764 gene locus_tag LOCUS_13350 14077 12764 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459193.1 protein_id gnl|my_center|LOCUS_13350 15180 14152 gene locus_tag LOCUS_13360 15180 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544197.1 protein_id gnl|my_center|LOCUS_13360 16479 15322 gene locus_tag LOCUS_13370 16479 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13370 17334 16522 gene locus_tag LOCUS_13380 17334 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13380 17464 18609 gene locus_tag LOCUS_13390 17464 18609 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_13390 19813 18809 gene locus_tag LOCUS_13400 19813 18809 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_13400 20438 19830 gene locus_tag LOCUS_13410 gene purN 20438 19830 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_13410 21391 20492 gene locus_tag LOCUS_13420 21391 20492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085509.1 protein_id gnl|my_center|LOCUS_13420 22989 21490 gene locus_tag LOCUS_13430 22989 21490 CDS product malonyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 protein_id gnl|my_center|LOCUS_13430 25190 22998 gene locus_tag LOCUS_13440 gene plpD 25190 22998 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_13440 25353 27170 gene locus_tag LOCUS_13450 25353 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 27212 27661 gene locus_tag LOCUS_13460 27212 27661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384123.1 protein_id gnl|my_center|LOCUS_13460 29684 27789 gene locus_tag LOCUS_13470 29684 27789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 30285 29773 gene locus_tag LOCUS_13480 30285 29773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 31663 30203 gene locus_tag LOCUS_13490 31663 30203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 33071 34318 gene locus_tag LOCUS_13500 33071 34318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 35913 34372 gene locus_tag LOCUS_13510 35913 34372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 38287 36158 gene locus_tag LOCUS_13520 38287 36158 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence031 697 50 gene locus_tag LOCUS_13530 697 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1336 1049 gene locus_tag LOCUS_13540 1336 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2565 1498 gene locus_tag LOCUS_13550 2565 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3904 2666 gene locus_tag LOCUS_13560 3904 2666 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103074.1 protein_id gnl|my_center|LOCUS_13560 4111 4359 gene locus_tag LOCUS_13570 4111 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4374 6491 gene locus_tag LOCUS_13580 4374 6491 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_13580 7162 6647 gene locus_tag LOCUS_13590 gene ps305 7162 6647 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383691.1 protein_id gnl|my_center|LOCUS_13590 8462 7227 gene locus_tag LOCUS_13600 8462 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 8826 8500 gene locus_tag LOCUS_13610 8826 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 9066 10214 gene locus_tag LOCUS_13620 gene serC 9066 10214 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_13620 10277 11128 gene locus_tag LOCUS_13630 10277 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 11171 12118 gene locus_tag LOCUS_13640 11171 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 protein_id gnl|my_center|LOCUS_13640 12194 13165 gene locus_tag LOCUS_13650 12194 13165 CDS product bordetella uptake gene family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 protein_id gnl|my_center|LOCUS_13650 13205 13669 gene locus_tag LOCUS_13660 13205 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881091.1 protein_id gnl|my_center|LOCUS_13660 13716 15218 gene locus_tag LOCUS_13670 13716 15218 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706285.1 protein_id gnl|my_center|LOCUS_13670 15594 16667 gene locus_tag LOCUS_13680 gene yloQ 15594 16667 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJV8 protein_id gnl|my_center|LOCUS_13680 17986 16664 gene locus_tag LOCUS_13690 17986 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 18649 17999 gene locus_tag LOCUS_13700 18649 17999 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E130 protein_id gnl|my_center|LOCUS_13700 19070 18666 gene locus_tag LOCUS_13710 19070 18666 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_13710 19641 19129 gene locus_tag LOCUS_13720 gene exbB 19641 19129 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_13720 21004 19646 gene locus_tag LOCUS_13730 gene ttpC 21004 19646 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_13730 21783 21001 gene locus_tag LOCUS_13740 21783 21001 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_13740 25255 22316 gene locus_tag LOCUS_13750 gene preP2 25255 22316 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_13750 26023 25259 gene locus_tag LOCUS_13760 26023 25259 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_13760 27733 26054 gene locus_tag LOCUS_13770 27733 26054 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_13770 27978 29150 gene locus_tag LOCUS_13780 27978 29150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 30714 29356 gene locus_tag LOCUS_13790 gene gor-2 30714 29356 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104922.1 protein_id gnl|my_center|LOCUS_13790 30975 32177 gene locus_tag LOCUS_13800 30975 32177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_13800 32299 33408 gene locus_tag LOCUS_13810 gene leuB 32299 33408 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ26 protein_id gnl|my_center|LOCUS_13810 34044 33484 gene locus_tag LOCUS_13820 34044 33484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 34200 35378 gene locus_tag LOCUS_13830 34200 35378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 35474 36001 gene locus_tag LOCUS_13840 35474 36001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence032 139 2541 gene locus_tag LOCUS_13850 139 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4365 2575 gene locus_tag LOCUS_13860 4365 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_13860 5162 4419 gene locus_tag LOCUS_13870 5162 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5807 5493 gene locus_tag LOCUS_13880 5807 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6007 5804 gene locus_tag LOCUS_13890 6007 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6206 8125 gene locus_tag LOCUS_13900 gene gcd-1 6206 8125 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_13900 9145 8144 gene locus_tag LOCUS_13910 9145 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 9531 9755 gene locus_tag LOCUS_13920 9531 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9742 10002 gene locus_tag LOCUS_13930 9742 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_13930 10155 13361 gene locus_tag LOCUS_13940 10155 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13393 13881 gene locus_tag LOCUS_13950 13393 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 15310 14057 gene locus_tag LOCUS_13960 15310 14057 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_13960 15710 16600 gene locus_tag LOCUS_13970 15710 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 16845 17714 gene locus_tag LOCUS_13980 16845 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 17707 18396 gene locus_tag LOCUS_13990 17707 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 18445 20496 gene locus_tag LOCUS_14000 18445 20496 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_14000 21684 20575 gene locus_tag LOCUS_14010 21684 20575 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_14010 22821 21904 gene locus_tag LOCUS_14020 22821 21904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 23622 22846 gene locus_tag LOCUS_14030 23622 22846 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_14030 26038 23717 gene locus_tag LOCUS_14040 26038 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 27671 26061 gene locus_tag LOCUS_14050 27671 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 29744 27873 gene locus_tag LOCUS_14060 29744 27873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 30658 29981 gene locus_tag LOCUS_14070 30658 29981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 31739 30819 gene locus_tag LOCUS_14080 31739 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 32194 32556 gene locus_tag LOCUS_14090 32194 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 32677 32982 gene locus_tag LOCUS_14100 32677 32982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 33168 33893 gene locus_tag LOCUS_14110 33168 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 33894 36962 gene locus_tag LOCUS_14120 33894 36962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 37395 37210 gene locus_tag LOCUS_14130 37395 37210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 37717 37544 gene locus_tag LOCUS_14140 37717 37544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 37749 37898 gene locus_tag LOCUS_14150 37749 37898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence033 196 555 gene locus_tag LOCUS_14160 196 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1395 664 gene locus_tag LOCUS_14170 1395 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3101 1437 gene locus_tag LOCUS_14180 3101 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3901 3101 gene locus_tag LOCUS_14190 3901 3101 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118316.1 protein_id gnl|my_center|LOCUS_14190 4103 4309 gene locus_tag LOCUS_14200 4103 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706319.1 protein_id gnl|my_center|LOCUS_14200 4341 4640 gene locus_tag LOCUS_14210 4341 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4661 6160 gene locus_tag LOCUS_14220 gene yodF 4661 6160 CDS product putative symporter YodF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34745 protein_id gnl|my_center|LOCUS_14220 6874 6212 gene locus_tag LOCUS_14230 6874 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 8104 6953 gene locus_tag LOCUS_14240 8104 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 10958 8118 gene locus_tag LOCUS_14250 10958 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 11246 13117 gene locus_tag LOCUS_14260 11246 13117 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_14260 13114 15129 gene locus_tag LOCUS_14270 13114 15129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_14270 16355 15138 gene locus_tag LOCUS_14280 16355 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_14280 16951 16409 gene locus_tag LOCUS_14290 gene flr 16951 16409 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937691.1 protein_id gnl|my_center|LOCUS_14290 19304 17154 gene locus_tag LOCUS_14300 19304 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 19401 19805 gene locus_tag LOCUS_14310 19401 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 21061 19895 gene locus_tag LOCUS_14320 21061 19895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 21202 21486 gene locus_tag LOCUS_14330 21202 21486 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_14330 21496 21792 gene locus_tag LOCUS_14340 21496 21792 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085795.1 protein_id gnl|my_center|LOCUS_14340 21809 22546 gene locus_tag LOCUS_14350 21809 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 23273 22602 gene locus_tag LOCUS_14360 23273 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 24252 23353 gene locus_tag LOCUS_14370 24252 23353 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095723.1 protein_id gnl|my_center|LOCUS_14370 25198 24245 gene locus_tag LOCUS_14380 25198 24245 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267881.1 protein_id gnl|my_center|LOCUS_14380 26821 25229 gene locus_tag LOCUS_14390 26821 25229 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_14390 27832 26846 gene locus_tag LOCUS_14400 27832 26846 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_14400 28879 27833 gene locus_tag LOCUS_14410 28879 27833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_14410 29346 30374 gene locus_tag LOCUS_14420 29346 30374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 32271 30421 gene locus_tag LOCUS_14430 32271 30421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770766.1 protein_id gnl|my_center|LOCUS_14430 32348 32527 gene locus_tag LOCUS_14440 32348 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 33227 34948 gene locus_tag LOCUS_14450 33227 34948 CDS product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 protein_id gnl|my_center|LOCUS_14450 36476 35040 gene locus_tag LOCUS_14460 36476 35040 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence034 167 883 gene locus_tag LOCUS_14470 167 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3130 1463 gene locus_tag LOCUS_14480 3130 1463 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_14480 3815 4669 gene locus_tag LOCUS_14490 3815 4669 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_14490 4732 5103 gene locus_tag LOCUS_14500 4732 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5242 6249 gene locus_tag LOCUS_14510 5242 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 6246 6584 gene locus_tag LOCUS_14520 6246 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 7331 6549 gene locus_tag LOCUS_14530 7331 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 8286 7882 gene locus_tag LOCUS_14540 8286 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 9853 8333 gene locus_tag LOCUS_14550 9853 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 10366 12489 gene locus_tag LOCUS_14560 10366 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 13426 12728 gene locus_tag LOCUS_14570 13426 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 13542 14981 gene locus_tag LOCUS_14580 13542 14981 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_14580 15113 16537 gene locus_tag LOCUS_14590 15113 16537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 16910 16665 gene locus_tag LOCUS_14600 16910 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 17148 18452 gene locus_tag LOCUS_14610 17148 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 18445 19797 gene locus_tag LOCUS_14620 18445 19797 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706760.1 protein_id gnl|my_center|LOCUS_14620 19794 23042 gene locus_tag LOCUS_14630 19794 23042 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_14630 25862 23127 gene locus_tag LOCUS_14640 25862 23127 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_14640 26146 25877 gene locus_tag LOCUS_14650 26146 25877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015870.1 protein_id gnl|my_center|LOCUS_14650 26427 26810 gene locus_tag LOCUS_14660 26427 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 26830 27435 gene locus_tag LOCUS_14670 26830 27435 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083064.1 protein_id gnl|my_center|LOCUS_14670 27739 27482 gene locus_tag LOCUS_14680 27739 27482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 28126 27812 gene locus_tag LOCUS_14690 28126 27812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14690 28573 28433 gene locus_tag LOCUS_14700 28573 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 29817 28639 gene locus_tag LOCUS_14710 29817 28639 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKP6 protein_id gnl|my_center|LOCUS_14710 30344 29925 gene locus_tag LOCUS_14720 30344 29925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 31362 30469 gene locus_tag LOCUS_14730 31362 30469 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977372.1 protein_id gnl|my_center|LOCUS_14730 32610 31414 gene locus_tag LOCUS_14740 32610 31414 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_14740 33435 32647 gene locus_tag LOCUS_14750 33435 32647 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_14750 34474 33467 gene locus_tag LOCUS_14760 34474 33467 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_14760 35119 34508 gene locus_tag LOCUS_14770 35119 34508 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_14770 35542 35123 gene locus_tag LOCUS_14780 35542 35123 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_14780 36189 36914 gene locus_tag LOCUS_14790 36189 36914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence035 91 1119 gene locus_tag LOCUS_14800 91 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1067 1258 gene locus_tag LOCUS_14810 1067 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2125 1328 gene locus_tag LOCUS_14820 2125 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_14820 2294 3301 gene locus_tag LOCUS_14830 2294 3301 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_14830 4292 3444 gene locus_tag LOCUS_14840 gene rpoH 4292 3444 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM47 protein_id gnl|my_center|LOCUS_14840 4483 5094 gene locus_tag LOCUS_14850 4483 5094 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_14850 5167 6051 gene locus_tag LOCUS_14860 gene lipg 5167 6051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_14860 6145 6654 gene locus_tag LOCUS_14870 6145 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 7814 6717 gene locus_tag LOCUS_14880 7814 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 8246 8950 gene locus_tag LOCUS_14890 8246 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14890 9076 9525 gene locus_tag LOCUS_14900 9076 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 10379 9546 gene locus_tag LOCUS_14910 10379 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 10977 10369 gene locus_tag LOCUS_14920 10977 10369 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_14920 12622 11114 gene locus_tag LOCUS_14930 12622 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 12952 13722 gene locus_tag LOCUS_14940 gene gloB 12952 13722 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MF8 protein_id gnl|my_center|LOCUS_14940 15476 13761 gene locus_tag LOCUS_14950 15476 13761 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_14950 16256 15588 gene locus_tag LOCUS_14960 16256 15588 CDS product chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932180.1 protein_id gnl|my_center|LOCUS_14960 17307 16231 gene locus_tag LOCUS_14970 17307 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 17990 17328 gene locus_tag LOCUS_14980 17990 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 20851 17987 gene locus_tag LOCUS_14990 20851 17987 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393408.1 protein_id gnl|my_center|LOCUS_14990 20997 20827 gene locus_tag LOCUS_15000 20997 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 21225 22079 gene locus_tag LOCUS_15010 gene norQ 21225 22079 CDS product nitric oxide reductase NorQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_15010 22082 25246 gene locus_tag LOCUS_15020 22082 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 25425 26714 gene locus_tag LOCUS_15030 gene gltA 25425 26714 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 protein_id gnl|my_center|LOCUS_15030 27977 26790 gene locus_tag LOCUS_15040 27977 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15040 29195 28065 gene locus_tag LOCUS_15050 29195 28065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15050 29608 29201 gene locus_tag LOCUS_15060 29608 29201 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_15060 33947 29640 gene locus_tag LOCUS_15070 33947 29640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 34986 34114 gene locus_tag LOCUS_15080 34986 34114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence036 111 1946 gene locus_tag LOCUS_15090 111 1946 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_15090 1996 3222 gene locus_tag LOCUS_15100 1996 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090651.1 protein_id gnl|my_center|LOCUS_15100 3356 4270 gene locus_tag LOCUS_15110 3356 4270 CDS product pyruvate formate lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_15110 5121 4321 gene locus_tag LOCUS_15120 5121 4321 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_15120 5741 5118 gene locus_tag LOCUS_15130 5741 5118 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_15130 6006 5767 gene locus_tag LOCUS_15140 6006 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6106 7107 gene locus_tag LOCUS_15150 6106 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7949 7137 gene locus_tag LOCUS_15160 7949 7137 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085496.1 protein_id gnl|my_center|LOCUS_15160 8714 7995 gene locus_tag LOCUS_15170 8714 7995 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_15170 8814 10178 gene locus_tag LOCUS_15180 gene uptG 8814 10178 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171314.1 protein_id gnl|my_center|LOCUS_15180 10171 11328 gene locus_tag LOCUS_15190 gene metB 10171 11328 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_15190 11389 12597 gene locus_tag LOCUS_15200 11389 12597 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878671.1 protein_id gnl|my_center|LOCUS_15200 12648 13922 gene locus_tag LOCUS_15210 12648 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_15210 14932 13952 gene locus_tag LOCUS_15220 14932 13952 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_15220 15420 16808 gene locus_tag LOCUS_15230 15420 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDE9 protein_id gnl|my_center|LOCUS_15230 16982 17734 gene locus_tag LOCUS_15240 16982 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 18010 18639 gene locus_tag LOCUS_15250 18010 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 18804 19910 gene locus_tag LOCUS_15260 18804 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 19931 21673 gene locus_tag LOCUS_15270 gene coxN 19931 21673 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH24 protein_id gnl|my_center|LOCUS_15270 21670 22287 gene locus_tag LOCUS_15280 gene coxO 21670 22287 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086564.1 protein_id gnl|my_center|LOCUS_15280 22394 23059 gene locus_tag LOCUS_15290 gene coxP 22394 23059 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086563.1 protein_id gnl|my_center|LOCUS_15290 23071 23424 gene locus_tag LOCUS_15300 23071 23424 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709070.1 protein_id gnl|my_center|LOCUS_15300 23816 23535 gene locus_tag LOCUS_15310 23816 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15310 23969 23850 gene locus_tag LOCUS_15320 23969 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 24149 24757 gene locus_tag LOCUS_15330 24149 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 24848 25300 gene locus_tag LOCUS_15340 24848 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 25770 26309 gene locus_tag LOCUS_15350 25770 26309 CDS product class III cytochrome C domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_15350 26340 28604 gene locus_tag LOCUS_15360 26340 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 28617 29372 gene locus_tag LOCUS_15370 28617 29372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 29365 30690 gene locus_tag LOCUS_15380 29365 30690 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_15380 30691 31203 gene locus_tag LOCUS_15390 30691 31203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 31200 31727 gene locus_tag LOCUS_15400 31200 31727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 31724 32977 gene locus_tag LOCUS_15410 31724 32977 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_15410 33060 33674 gene locus_tag LOCUS_15420 33060 33674 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_15420 33735 34376 gene locus_tag LOCUS_15430 33735 34376 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704277.1 protein_id gnl|my_center|LOCUS_15430 34598 35968 gene locus_tag LOCUS_15440 34598 35968 CDS product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence037 354 1100 gene locus_tag LOCUS_15450 gene nirQ 354 1100 CDS product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 protein_id gnl|my_center|LOCUS_15450 1097 4177 gene locus_tag LOCUS_15460 1097 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4339 5280 gene locus_tag LOCUS_15470 4339 5280 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230067.1 protein_id gnl|my_center|LOCUS_15470 5635 6777 gene locus_tag LOCUS_15480 5635 6777 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_15480 9020 6789 gene locus_tag LOCUS_15490 9020 6789 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_15490 10329 9151 gene locus_tag LOCUS_15500 10329 9151 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086703.1 protein_id gnl|my_center|LOCUS_15500 11964 10369 gene locus_tag LOCUS_15510 11964 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 12472 13224 gene locus_tag LOCUS_15520 12472 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 14099 13296 gene locus_tag LOCUS_15530 14099 13296 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704891.1 protein_id gnl|my_center|LOCUS_15530 14402 15511 gene locus_tag LOCUS_15540 14402 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 15517 16065 gene locus_tag LOCUS_15550 15517 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 16062 16691 gene locus_tag LOCUS_15560 16062 16691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 16688 17218 gene locus_tag LOCUS_15570 16688 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 17402 17653 gene locus_tag LOCUS_15580 17402 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 19294 17642 gene locus_tag LOCUS_15590 19294 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_15590 19929 19399 gene locus_tag LOCUS_15600 19929 19399 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708479.1 protein_id gnl|my_center|LOCUS_15600 20640 21746 gene locus_tag LOCUS_15610 gene msrAB 20640 21746 CDS product peptide methionine sulfoxide reductase MsrA/MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLX6 protein_id gnl|my_center|LOCUS_15610 22014 23102 gene locus_tag LOCUS_15620 22014 23102 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_15620 23248 23553 gene locus_tag LOCUS_15630 23248 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 23465 24049 gene locus_tag LOCUS_15640 23465 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 24074 24457 gene locus_tag LOCUS_15650 24074 24457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 24628 24855 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggacagacagtcgacacatagaccgtcatgcagg 25084 26064 gene locus_tag LOCUS_15660 gene bioB 25084 26064 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_15660 27142 26144 gene locus_tag LOCUS_15670 27142 26144 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_15670 28382 27984 gene locus_tag LOCUS_15680 28382 27984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 28826 28503 gene locus_tag LOCUS_15690 28826 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 30344 28866 gene locus_tag LOCUS_15700 30344 28866 CDS product invasion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_15700 30662 31225 gene locus_tag LOCUS_15710 gene idi 30662 31225 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_15710 31468 32367 gene locus_tag LOCUS_15720 31468 32367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_15720 32379 34013 gene locus_tag LOCUS_15730 gene ilvB 32379 34013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810780.1 protein_id gnl|my_center|LOCUS_15730 34068 35069 gene locus_tag LOCUS_15740 gene pdxA 34068 35069 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3L9 protein_id gnl|my_center|LOCUS_15740 35869 35150 gene locus_tag LOCUS_15750 35869 35150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence038 267 2153 gene locus_tag LOCUS_15760 267 2153 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_15760 2187 3290 gene locus_tag LOCUS_15770 2187 3290 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_15770 3287 4426 gene locus_tag LOCUS_15780 3287 4426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_15780 4457 6061 gene locus_tag LOCUS_15790 4457 6061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_15790 6485 7888 gene locus_tag LOCUS_15800 6485 7888 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974850.1 protein_id gnl|my_center|LOCUS_15800 7949 9448 gene locus_tag LOCUS_15810 7949 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 9591 9905 gene locus_tag LOCUS_15820 9591 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 9817 10719 gene locus_tag LOCUS_15830 9817 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 protein_id gnl|my_center|LOCUS_15830 10745 11878 gene locus_tag LOCUS_15840 gene dauA 10745 11878 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE3 protein_id gnl|my_center|LOCUS_15840 12155 12958 gene locus_tag LOCUS_15850 12155 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13610 12972 gene locus_tag LOCUS_15860 13610 12972 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707347.1 protein_id gnl|my_center|LOCUS_15860 15060 13735 gene locus_tag LOCUS_15870 15060 13735 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_15870 15300 16532 gene locus_tag LOCUS_15880 15300 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17600 16611 gene locus_tag LOCUS_15890 17600 16611 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_15890 18662 17838 gene locus_tag LOCUS_15900 18662 17838 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_15900 20826 18874 gene locus_tag LOCUS_15910 20826 18874 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_15910 21137 20970 gene locus_tag LOCUS_15920 21137 20970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 21635 22846 gene locus_tag LOCUS_15930 21635 22846 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173900.1 protein_id gnl|my_center|LOCUS_15930 23417 23181 gene locus_tag LOCUS_15940 23417 23181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 23813 24733 gene locus_tag LOCUS_15950 gene draG 23813 24733 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_15950 25886 24819 gene locus_tag LOCUS_15960 25886 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 26519 26028 gene locus_tag LOCUS_15970 26519 26028 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571271.1 protein_id gnl|my_center|LOCUS_15970 27708 26623 gene locus_tag LOCUS_15980 27708 26623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_15980 28802 27711 gene locus_tag LOCUS_15990 28802 27711 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310022.1 protein_id gnl|my_center|LOCUS_15990 30686 28806 gene locus_tag LOCUS_16000 30686 28806 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_16000 30988 32295 gene locus_tag LOCUS_16010 30988 32295 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761790.1 protein_id gnl|my_center|LOCUS_16010 32707 32486 gene locus_tag LOCUS_16020 32707 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 33702 32854 gene locus_tag LOCUS_16030 33702 32854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 34234 34536 gene locus_tag LOCUS_16040 34234 34536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence039 1326 337 gene locus_tag LOCUS_16050 1326 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1614 2024 gene locus_tag LOCUS_16060 1614 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2021 3433 gene locus_tag LOCUS_16070 2021 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3598 5127 gene locus_tag LOCUS_16080 3598 5127 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089203.1 protein_id gnl|my_center|LOCUS_16080 5436 5627 gene locus_tag LOCUS_16090 5436 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5690 9136 gene locus_tag LOCUS_16100 5690 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 9733 9182 gene locus_tag LOCUS_16110 9733 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 9888 10079 gene locus_tag LOCUS_16120 9888 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 10411 11820 gene locus_tag LOCUS_16130 10411 11820 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_16130 12452 11901 gene locus_tag LOCUS_16140 12452 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 15227 12837 gene locus_tag LOCUS_16150 15227 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 15776 16669 gene locus_tag LOCUS_16160 15776 16669 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_16160 16666 17340 gene locus_tag LOCUS_16170 16666 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 17333 19216 gene locus_tag LOCUS_16180 17333 19216 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_16180 19515 19937 gene locus_tag LOCUS_16190 19515 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 19943 20509 gene locus_tag LOCUS_16200 19943 20509 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7S1 protein_id gnl|my_center|LOCUS_16200 20506 20868 gene locus_tag LOCUS_16210 20506 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 21862 20954 gene locus_tag LOCUS_16220 21862 20954 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181642.1 protein_id gnl|my_center|LOCUS_16220 22075 22353 gene locus_tag LOCUS_16230 22075 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 22703 22392 gene locus_tag LOCUS_16240 22703 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 22911 22747 gene locus_tag LOCUS_16250 22911 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 23084 23386 gene locus_tag LOCUS_16260 23084 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 23693 24103 gene locus_tag LOCUS_16270 23693 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 24100 24345 gene locus_tag LOCUS_16280 24100 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 24616 25392 gene locus_tag LOCUS_16290 24616 25392 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_16290 25430 26881 gene locus_tag LOCUS_16300 25430 26881 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_16300 26909 27736 gene locus_tag LOCUS_16310 26909 27736 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_16310 27901 28854 gene locus_tag LOCUS_16320 27901 28854 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931162.1 protein_id gnl|my_center|LOCUS_16320 28978 30843 gene locus_tag LOCUS_16330 28978 30843 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_16330 30840 31823 gene locus_tag LOCUS_16340 30840 31823 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_16340 32801 31839 gene locus_tag LOCUS_16350 32801 31839 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_16350 32987 34273 gene locus_tag LOCUS_16360 32987 34273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143163.1 protein_id gnl|my_center|LOCUS_16360 34266 35132 gene locus_tag LOCUS_16370 gene fox2 34266 35132 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence040 959 168 gene locus_tag LOCUS_16380 959 168 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_16380 1867 1004 gene locus_tag LOCUS_16390 1867 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3004 1997 gene locus_tag LOCUS_16400 3004 1997 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_16400 3341 3691 gene locus_tag LOCUS_16410 3341 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3749 4084 gene locus_tag LOCUS_16420 3749 4084 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_16420 4732 4115 gene locus_tag LOCUS_16430 gene tesA 4732 4115 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 protein_id gnl|my_center|LOCUS_16430 4731 5438 gene locus_tag LOCUS_16440 4731 5438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_16440 5443 7962 gene locus_tag LOCUS_16450 5443 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_16450 8282 9166 gene locus_tag LOCUS_16460 8282 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 10296 9184 gene locus_tag LOCUS_16470 10296 9184 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_16470 10500 11366 gene locus_tag LOCUS_16480 gene ttcA 10500 11366 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKM7 protein_id gnl|my_center|LOCUS_16480 11660 11878 gene locus_tag LOCUS_16490 11660 11878 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYE3 protein_id gnl|my_center|LOCUS_16490 16231 11891 gene locus_tag LOCUS_16500 16231 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 16895 17743 gene locus_tag LOCUS_16510 16895 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 18032 18487 gene locus_tag LOCUS_16520 18032 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 19105 18587 gene locus_tag LOCUS_16530 19105 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 19367 21616 gene locus_tag LOCUS_16540 gene exaA 19367 21616 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_16540 21629 22792 gene locus_tag LOCUS_16550 21629 22792 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887900.1 protein_id gnl|my_center|LOCUS_16550 22913 23155 gene locus_tag LOCUS_16560 gene tusA 22913 23155 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_16560 23171 23656 gene locus_tag LOCUS_16570 23171 23656 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200916.1 protein_id gnl|my_center|LOCUS_16570 23628 24098 gene locus_tag LOCUS_16580 23628 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 24125 25288 gene locus_tag LOCUS_16590 24125 25288 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_16590 25871 25410 gene locus_tag LOCUS_16600 25871 25410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_16600 25990 26397 gene locus_tag LOCUS_16610 gene msrB 25990 26397 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE61 protein_id gnl|my_center|LOCUS_16610 26546 27502 gene locus_tag LOCUS_16620 26546 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_16620 27551 28453 gene locus_tag LOCUS_16630 27551 28453 CDS product ATP synthase F0 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_16630 28467 30188 gene locus_tag LOCUS_16640 gene speE 28467 30188 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX8 protein_id gnl|my_center|LOCUS_16640 30404 30811 gene locus_tag LOCUS_16650 30404 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_16650 30837 31529 gene locus_tag LOCUS_16660 30837 31529 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_16660 31597 32250 gene locus_tag LOCUS_16670 31597 32250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073542.1 protein_id gnl|my_center|LOCUS_16670 32251 32589 gene locus_tag LOCUS_16680 32251 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 32693 33763 gene locus_tag LOCUS_16690 32693 33763 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769107.1 protein_id gnl|my_center|LOCUS_16690 33764 34327 gene locus_tag LOCUS_16700 33764 34327 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406500.1 protein_id gnl|my_center|LOCUS_16700 34994 34332 gene locus_tag LOCUS_16710 34994 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence041 1561 692 gene locus_tag LOCUS_16720 1561 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1902 2084 gene locus_tag LOCUS_16730 1902 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4748 2283 gene locus_tag LOCUS_16740 4748 2283 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_16740 5578 4934 gene locus_tag LOCUS_16750 5578 4934 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_16750 6256 5879 gene locus_tag LOCUS_16760 6256 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6459 6253 gene locus_tag LOCUS_16770 6459 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8211 6730 gene locus_tag LOCUS_16780 8211 6730 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_16780 8498 10318 gene locus_tag LOCUS_16790 8498 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 12720 10420 gene locus_tag LOCUS_16800 gene cutC 12720 10420 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3N9 protein_id gnl|my_center|LOCUS_16800 13726 12932 gene locus_tag LOCUS_16810 13726 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 13920 13723 gene locus_tag LOCUS_16820 13920 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 14194 13826 gene locus_tag LOCUS_16830 14194 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 14487 14867 gene locus_tag LOCUS_16840 14487 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 16085 14901 gene locus_tag LOCUS_16850 16085 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 17108 16443 gene locus_tag LOCUS_16860 17108 16443 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 protein_id gnl|my_center|LOCUS_16860 17237 18238 gene locus_tag LOCUS_16870 17237 18238 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727740.1 protein_id gnl|my_center|LOCUS_16870 18504 18899 gene locus_tag LOCUS_16880 18504 18899 CDS product dihydrolipoamide acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_16880 18966 19406 gene locus_tag LOCUS_16890 18966 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_16890 20420 19461 gene locus_tag LOCUS_16900 20420 19461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_16900 20645 22060 gene locus_tag LOCUS_16910 20645 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_16910 22050 23783 gene locus_tag LOCUS_16920 22050 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 24849 24040 gene locus_tag LOCUS_16930 24849 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 25112 25705 gene locus_tag LOCUS_16940 25112 25705 CDS product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106450.1 protein_id gnl|my_center|LOCUS_16940 27287 25836 gene locus_tag LOCUS_16950 27287 25836 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 protein_id gnl|my_center|LOCUS_16950 27543 28259 gene locus_tag LOCUS_16960 27543 28259 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_16960 28847 28359 gene locus_tag LOCUS_16970 28847 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 30706 28883 gene locus_tag LOCUS_16980 30706 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 31530 30703 gene locus_tag LOCUS_16990 31530 30703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 31782 33785 gene locus_tag LOCUS_17000 31782 33785 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_17000 33795 34142 gene locus_tag LOCUS_17010 33795 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 34734 34222 gene locus_tag LOCUS_17020 34734 34222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence042 376 633 gene locus_tag LOCUS_17030 376 633 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 protein_id gnl|my_center|LOCUS_17030 724 2481 gene locus_tag LOCUS_17040 724 2481 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_17040 2597 4081 gene locus_tag LOCUS_17050 2597 4081 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_17050 4623 4261 gene locus_tag LOCUS_17060 4623 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5022 4705 gene locus_tag LOCUS_17070 5022 4705 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_17070 5597 5019 gene locus_tag LOCUS_17080 5597 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5836 6243 gene locus_tag LOCUS_17090 5836 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7296 6247 gene locus_tag LOCUS_17100 7296 6247 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_17100 8117 7317 gene locus_tag LOCUS_17110 8117 7317 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114532.1 protein_id gnl|my_center|LOCUS_17110 8256 9260 gene locus_tag LOCUS_17120 8256 9260 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_17120 9461 10732 gene locus_tag LOCUS_17130 9461 10732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761527.1 protein_id gnl|my_center|LOCUS_17130 10766 11458 gene locus_tag LOCUS_17140 10766 11458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_17140 11451 13880 gene locus_tag LOCUS_17150 11451 13880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_17150 13908 15248 gene locus_tag LOCUS_17160 13908 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 15396 15815 gene locus_tag LOCUS_17170 15396 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 16977 15877 gene locus_tag LOCUS_17180 16977 15877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_17180 17205 18137 gene locus_tag LOCUS_17190 17205 18137 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728963.1 protein_id gnl|my_center|LOCUS_17190 18651 19406 gene locus_tag LOCUS_17200 18651 19406 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_17200 20329 19505 gene locus_tag LOCUS_17210 20329 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 20521 21636 gene locus_tag LOCUS_17220 gene sbcD 20521 21636 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBP0 protein_id gnl|my_center|LOCUS_17220 23673 21823 gene locus_tag LOCUS_17230 23673 21823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404891.1 protein_id gnl|my_center|LOCUS_17230 25691 23682 gene locus_tag LOCUS_17240 25691 23682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_17240 27565 25688 gene locus_tag LOCUS_17250 27565 25688 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_17250 28814 27846 gene locus_tag LOCUS_17260 28814 27846 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_17260 29552 28983 gene locus_tag LOCUS_17270 29552 28983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 29445 29657 gene locus_tag LOCUS_17280 29445 29657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 31074 29761 gene locus_tag LOCUS_17290 31074 29761 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583021.1 protein_id gnl|my_center|LOCUS_17290 31563 32378 gene locus_tag LOCUS_17300 31563 32378 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_17300 34682 32502 gene locus_tag LOCUS_17310 34682 32502 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence043 377 2338 gene locus_tag LOCUS_17320 377 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_17320 3299 2379 gene locus_tag LOCUS_17330 gene abnA 3299 2379 CDS product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 protein_id gnl|my_center|LOCUS_17330 3569 3814 gene locus_tag LOCUS_17340 3569 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3811 4242 gene locus_tag LOCUS_17350 gene vapC43 3811 4242 CDS product ribonuclease VapC43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF55 protein_id gnl|my_center|LOCUS_17350 5395 4331 gene locus_tag LOCUS_17360 gene aroG 5395 4331 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N9 protein_id gnl|my_center|LOCUS_17360 5832 5410 gene locus_tag LOCUS_17370 5832 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6812 5889 gene locus_tag LOCUS_17380 6812 5889 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729583.1 protein_id gnl|my_center|LOCUS_17380 7570 6809 gene locus_tag LOCUS_17390 7570 6809 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_17390 8011 8343 gene locus_tag LOCUS_17400 8011 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8674 8931 gene locus_tag LOCUS_17410 gene xseB 8674 8931 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 protein_id gnl|my_center|LOCUS_17410 8949 9830 gene locus_tag LOCUS_17420 gene ispA 8949 9830 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_17420 9948 11852 gene locus_tag LOCUS_17430 gene dxs 9948 11852 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_17430 12505 11906 gene locus_tag LOCUS_17440 gene ribA 12505 11906 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q3 protein_id gnl|my_center|LOCUS_17440 13216 12608 gene locus_tag LOCUS_17450 13216 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_17450 13794 13288 gene locus_tag LOCUS_17460 gene pgpA 13794 13288 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_17460 14787 13810 gene locus_tag LOCUS_17470 gene thiL 14787 13810 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE87 protein_id gnl|my_center|LOCUS_17470 15192 14800 gene locus_tag LOCUS_17480 gene nusB 15192 14800 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_17480 15772 15302 gene locus_tag LOCUS_17490 gene ribH 15772 15302 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_17490 16919 15792 gene locus_tag LOCUS_17500 gene ribD 16919 15792 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE88 protein_id gnl|my_center|LOCUS_17500 17394 16912 gene locus_tag LOCUS_17510 gene nrdR 17394 16912 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX1 protein_id gnl|my_center|LOCUS_17510 17921 19216 gene locus_tag LOCUS_17520 17921 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 19265 20914 gene locus_tag LOCUS_17530 19265 20914 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_17530 21077 22627 gene locus_tag LOCUS_17540 21077 22627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 24093 22744 gene locus_tag LOCUS_17550 gene radA 24093 22744 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M29 protein_id gnl|my_center|LOCUS_17550 25230 24148 gene locus_tag LOCUS_17560 gene alr1 25230 24148 CDS product alanine racemase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L78 protein_id gnl|my_center|LOCUS_17560 26615 25227 gene locus_tag LOCUS_17570 26615 25227 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW7 protein_id gnl|my_center|LOCUS_17570 27382 26936 gene locus_tag LOCUS_17580 gene rplI 27382 26936 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2E1 protein_id gnl|my_center|LOCUS_17580 28319 27459 gene locus_tag LOCUS_17590 28319 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_17590 28564 28337 gene locus_tag LOCUS_17600 gene rpsR 28564 28337 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_17600 29102 28569 gene locus_tag LOCUS_17610 gene rpsF 29102 28569 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P02358 protein_id gnl|my_center|LOCUS_17610 29331 29140 gene locus_tag LOCUS_17620 29331 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 30703 29897 gene locus_tag LOCUS_17630 gene rlmB 30703 29897 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CW6 protein_id gnl|my_center|LOCUS_17630 33059 30744 gene locus_tag LOCUS_17640 gene rnr 33059 30744 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_17640 33238 33325 gene locus_tag LOCUS_t00050 33238 33325 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 78 3 gene locus_tag LOCUS_t00060 78 3 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 411 130 gene locus_tag LOCUS_17650 411 130 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_17650 1517 408 gene locus_tag LOCUS_17660 gene mutY 1517 408 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261209.1 protein_id gnl|my_center|LOCUS_17660 1965 1543 gene locus_tag LOCUS_17670 1965 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4875 1978 gene locus_tag LOCUS_17680 4875 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5337 7697 gene locus_tag LOCUS_17690 5337 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 7713 9113 gene locus_tag LOCUS_17700 7713 9113 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_17700 9955 9110 gene locus_tag LOCUS_17710 9955 9110 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087376.1 protein_id gnl|my_center|LOCUS_17710 10814 9975 gene locus_tag LOCUS_17720 10814 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 11018 11761 gene locus_tag LOCUS_17730 11018 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 12367 11762 gene locus_tag LOCUS_17740 12367 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 12610 13884 gene locus_tag LOCUS_17750 12610 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 14030 16417 gene locus_tag LOCUS_17760 gene pflD 14030 16417 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_17760 16829 16467 gene locus_tag LOCUS_17770 16829 16467 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_17770 17396 17013 gene locus_tag LOCUS_17780 17396 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 17709 18017 gene locus_tag LOCUS_17790 17709 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_17790 18014 18277 gene locus_tag LOCUS_17800 18014 18277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 18296 18712 gene locus_tag LOCUS_17810 18296 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 19430 18771 gene locus_tag LOCUS_17820 19430 18771 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887250.1 protein_id gnl|my_center|LOCUS_17820 20959 19664 gene locus_tag LOCUS_17830 20959 19664 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_17830 21267 22541 gene locus_tag LOCUS_17840 21267 22541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868206.1 protein_id gnl|my_center|LOCUS_17840 22719 23264 gene locus_tag LOCUS_17850 22719 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 24494 23310 gene locus_tag LOCUS_17860 24494 23310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 24700 25119 gene locus_tag LOCUS_17870 24700 25119 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_17870 25335 27026 gene locus_tag LOCUS_17880 25335 27026 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_17880 27431 28378 gene locus_tag LOCUS_17890 27431 28378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 28883 28416 gene locus_tag LOCUS_17900 28883 28416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 30469 28880 gene locus_tag LOCUS_17910 30469 28880 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_17910 30675 32480 gene locus_tag LOCUS_17920 30675 32480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence045 451 95 gene locus_tag LOCUS_17930 451 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 591 1631 gene locus_tag LOCUS_17940 591 1631 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_17940 1654 2649 gene locus_tag LOCUS_17950 1654 2649 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_17950 2798 4012 gene locus_tag LOCUS_17960 2798 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4179 5318 gene locus_tag LOCUS_17970 gene acd 4179 5318 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_17970 8490 5479 gene locus_tag LOCUS_17980 8490 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 9964 8795 gene locus_tag LOCUS_17990 9964 8795 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_17990 10531 10049 gene locus_tag LOCUS_18000 10531 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_18000 12190 10535 gene locus_tag LOCUS_18010 gene cysI 12190 10535 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_18010 16146 12451 gene locus_tag LOCUS_18020 gene metH 16146 12451 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_18020 16404 16985 gene locus_tag LOCUS_18030 gene nfuA 16404 16985 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_18030 18141 17023 gene locus_tag LOCUS_18040 gene aroF-1 18141 17023 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883S5 protein_id gnl|my_center|LOCUS_18040 18579 19523 gene locus_tag LOCUS_18050 18579 19523 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_18050 21682 19532 gene locus_tag LOCUS_18060 gene dcp 21682 19532 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036603.1 protein_id gnl|my_center|LOCUS_18060 22734 21691 gene locus_tag LOCUS_18070 22734 21691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879212.1 protein_id gnl|my_center|LOCUS_18070 22868 23809 gene locus_tag LOCUS_18080 22868 23809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404655.1 protein_id gnl|my_center|LOCUS_18080 25026 23806 gene locus_tag LOCUS_18090 gene ybjZ 25026 23806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_18090 26376 25042 gene locus_tag LOCUS_18100 gene ybjZ 26376 25042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_18100 27068 26379 gene locus_tag LOCUS_18110 27068 26379 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073487.1 protein_id gnl|my_center|LOCUS_18110 28410 27139 gene locus_tag LOCUS_18120 28410 27139 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_18120 28981 29748 gene locus_tag LOCUS_18130 28981 29748 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_18130 29849 31528 gene locus_tag LOCUS_18140 gene glnS 29849 31528 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RG4 protein_id gnl|my_center|LOCUS_18140 >Feature sequence046 3195 247 gene locus_tag LOCUS_18150 3195 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3407 4267 gene locus_tag LOCUS_18160 3407 4267 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_18160 5528 4338 gene locus_tag LOCUS_18170 5528 4338 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_18170 7494 5671 gene locus_tag LOCUS_18180 7494 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 7683 9164 gene locus_tag LOCUS_18190 gene glpK1 7683 9164 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_18190 9612 13802 gene locus_tag LOCUS_18200 9612 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 15016 13850 gene locus_tag LOCUS_18210 gene argD 15016 13850 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_18210 15217 16788 gene locus_tag LOCUS_18220 gene hyuB 15217 16788 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_18220 16899 17234 gene locus_tag LOCUS_18230 16899 17234 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_18230 17900 17259 gene locus_tag LOCUS_18240 gene rnt 17900 17259 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK2 protein_id gnl|my_center|LOCUS_18240 19111 18074 gene locus_tag LOCUS_18250 gene pyrC 19111 18074 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_18250 19403 20623 gene locus_tag LOCUS_18260 gene argG 19403 20623 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_18260 21373 20741 gene locus_tag LOCUS_18270 gene nth 21373 20741 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NB87 protein_id gnl|my_center|LOCUS_18270 23420 21387 gene locus_tag LOCUS_18280 gene metG 23420 21387 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK6 protein_id gnl|my_center|LOCUS_18280 23644 24732 gene locus_tag LOCUS_18290 23644 24732 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC8 protein_id gnl|my_center|LOCUS_18290 25665 24784 gene locus_tag LOCUS_18300 25665 24784 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919230.1 protein_id gnl|my_center|LOCUS_18300 25743 26378 gene locus_tag LOCUS_18310 25743 26378 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_18310 27551 26451 gene locus_tag LOCUS_18320 27551 26451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 28850 27789 gene locus_tag LOCUS_18330 28850 27789 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086750.1 protein_id gnl|my_center|LOCUS_18330 29748 28906 gene locus_tag LOCUS_18340 29748 28906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_18340 30146 30679 gene locus_tag LOCUS_18350 gene dcd 30146 30679 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN2 protein_id gnl|my_center|LOCUS_18350 31528 30686 gene locus_tag LOCUS_18360 31528 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence047 634 2217 gene locus_tag LOCUS_18370 634 2217 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198270.1 protein_id gnl|my_center|LOCUS_18370 3525 3052 gene locus_tag LOCUS_18380 3525 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3691 4446 gene locus_tag LOCUS_18390 gene fabG 3691 4446 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_18390 5277 4921 gene locus_tag LOCUS_18400 5277 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5848 5267 gene locus_tag LOCUS_18410 5848 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 6164 6331 gene locus_tag LOCUS_18420 6164 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6804 6328 gene locus_tag LOCUS_18430 6804 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 7139 6897 gene locus_tag LOCUS_18440 7139 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7498 7136 gene locus_tag LOCUS_18450 7498 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 7952 7524 gene locus_tag LOCUS_18460 7952 7524 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986636.1 protein_id gnl|my_center|LOCUS_18460 8273 9406 gene locus_tag LOCUS_18470 8273 9406 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_18470 9666 11213 gene locus_tag LOCUS_18480 9666 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 12281 11253 gene locus_tag LOCUS_18490 12281 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 12482 13600 gene locus_tag LOCUS_18500 12482 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 13832 13647 gene locus_tag LOCUS_18510 13832 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 14091 13825 gene locus_tag LOCUS_18520 14091 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888378.1 protein_id gnl|my_center|LOCUS_18520 15084 14137 gene locus_tag LOCUS_18530 15084 14137 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_18530 16128 15139 gene locus_tag LOCUS_18540 16128 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 16376 17038 gene locus_tag LOCUS_18550 16376 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 18888 17074 gene locus_tag LOCUS_18560 gene recQ 18888 17074 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_18560 20173 19112 gene locus_tag LOCUS_18570 20173 19112 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089977.1 protein_id gnl|my_center|LOCUS_18570 21046 20564 gene locus_tag LOCUS_18580 21046 20564 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 protein_id gnl|my_center|LOCUS_18580 21243 21980 gene locus_tag LOCUS_18590 21243 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 22063 22509 gene locus_tag LOCUS_18600 22063 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 22521 23648 gene locus_tag LOCUS_18610 gene hmgA 22521 23648 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_18610 24959 23721 gene locus_tag LOCUS_18620 gene dinB 24959 23721 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8D3 protein_id gnl|my_center|LOCUS_18620 25424 25068 gene locus_tag LOCUS_18630 25424 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140137.1 protein_id gnl|my_center|LOCUS_18630 26131 25658 gene locus_tag LOCUS_18640 26131 25658 CDS product putative enoyl-CoA hydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP3 protein_id gnl|my_center|LOCUS_18640 26326 27348 gene locus_tag LOCUS_18650 gene gutB 26326 27348 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_18650 28165 27470 gene locus_tag LOCUS_18660 28165 27470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 28347 28162 gene locus_tag LOCUS_18670 28347 28162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 28315 29007 gene locus_tag LOCUS_18680 28315 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_18680 29124 29945 gene locus_tag LOCUS_18690 29124 29945 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_18690 30478 29942 gene locus_tag LOCUS_18700 30478 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence048 1179 130 gene locus_tag LOCUS_18710 1179 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1283 2173 gene locus_tag LOCUS_18720 1283 2173 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_18720 3362 2181 gene locus_tag LOCUS_18730 3362 2181 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_18730 3556 4380 gene locus_tag LOCUS_18740 3556 4380 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_18740 4412 5461 gene locus_tag LOCUS_18750 4412 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_18750 5535 5753 gene locus_tag LOCUS_18760 5535 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6620 5781 gene locus_tag LOCUS_18770 6620 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 6591 6815 gene locus_tag LOCUS_18780 6591 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6937 7401 gene locus_tag LOCUS_18790 6937 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7428 8744 gene locus_tag LOCUS_18800 7428 8744 CDS product arsenical pump family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253041.1 protein_id gnl|my_center|LOCUS_18800 10834 8819 gene locus_tag LOCUS_18810 10834 8819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_18810 13325 10827 gene locus_tag LOCUS_18820 13325 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 13717 16068 gene locus_tag LOCUS_18830 13717 16068 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249244.1 protein_id gnl|my_center|LOCUS_18830 16290 16102 gene locus_tag LOCUS_18840 16290 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 16514 16996 gene locus_tag LOCUS_18850 16514 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 17129 18016 gene locus_tag LOCUS_18860 17129 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 18124 19110 gene locus_tag LOCUS_18870 18124 19110 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_18870 19216 19638 gene locus_tag LOCUS_18880 19216 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 20637 19699 gene locus_tag LOCUS_18890 20637 19699 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_18890 20762 21640 gene locus_tag LOCUS_18900 20762 21640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 21663 21929 gene locus_tag LOCUS_18910 21663 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 23033 21966 gene locus_tag LOCUS_18920 23033 21966 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085431.1 protein_id gnl|my_center|LOCUS_18920 23286 24920 gene locus_tag LOCUS_18930 23286 24920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_18930 26983 25013 gene locus_tag LOCUS_18940 26983 25013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 28625 27072 gene locus_tag LOCUS_18950 28625 27072 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403432.1 protein_id gnl|my_center|LOCUS_18950 29137 28622 gene locus_tag LOCUS_18960 29137 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 29601 29266 gene locus_tag LOCUS_18970 29601 29266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 29610 29849 gene locus_tag LOCUS_18980 29610 29849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence049 421 861 gene locus_tag LOCUS_18990 421 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1696 749 gene locus_tag LOCUS_19000 1696 749 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_19000 2996 1803 gene locus_tag LOCUS_19010 2996 1803 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_19010 3235 4023 gene locus_tag LOCUS_19020 3235 4023 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_19020 4078 4896 gene locus_tag LOCUS_19030 4078 4896 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_19030 5148 5723 gene locus_tag LOCUS_19040 5148 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5772 6281 gene locus_tag LOCUS_19050 5772 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_19050 6329 6517 gene locus_tag LOCUS_19060 6329 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6543 6875 gene locus_tag LOCUS_19070 6543 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 8023 6947 gene locus_tag LOCUS_19080 8023 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877087.1 protein_id gnl|my_center|LOCUS_19080 10188 8272 gene locus_tag LOCUS_19090 10188 8272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_19090 10791 10549 gene locus_tag LOCUS_19100 10791 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 13079 11013 gene locus_tag LOCUS_19110 13079 11013 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249244.1 protein_id gnl|my_center|LOCUS_19110 13339 13602 gene locus_tag LOCUS_19120 13339 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 15471 13762 gene locus_tag LOCUS_19130 15471 13762 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_19130 15750 16781 gene locus_tag LOCUS_19140 15750 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 16862 17452 gene locus_tag LOCUS_19150 16862 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 17424 17642 gene locus_tag LOCUS_19160 17424 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 18847 17573 gene locus_tag LOCUS_19170 18847 17573 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_19170 19628 18900 gene locus_tag LOCUS_19180 19628 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 21309 19678 gene locus_tag LOCUS_19190 21309 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 21436 21621 gene locus_tag LOCUS_19200 21436 21621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 22296 23162 gene locus_tag LOCUS_19210 22296 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 23126 23323 gene locus_tag LOCUS_19220 23126 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 23373 23867 gene locus_tag LOCUS_19230 23373 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 23870 24115 gene locus_tag LOCUS_19240 23870 24115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 24164 24400 gene locus_tag LOCUS_19250 24164 24400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 24542 26521 gene locus_tag LOCUS_19260 24542 26521 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_19260 26748 27782 gene locus_tag LOCUS_19270 26748 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 27767 29095 gene locus_tag LOCUS_19280 27767 29095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_19280 29791 29540 gene locus_tag LOCUS_19290 29791 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence050 2300 591 gene locus_tag LOCUS_19300 gene asnB 2300 591 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_19300 3341 2307 gene locus_tag LOCUS_19310 3341 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4336 3338 gene locus_tag LOCUS_19320 4336 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4699 5751 gene locus_tag LOCUS_19330 4699 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 5908 7776 gene locus_tag LOCUS_19340 5908 7776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_19340 7968 9023 gene locus_tag LOCUS_19350 7968 9023 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_19350 9062 9817 gene locus_tag LOCUS_19360 9062 9817 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_19360 10873 9818 gene locus_tag LOCUS_19370 10873 9818 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_19370 12127 10967 gene locus_tag LOCUS_19380 12127 10967 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_19380 12267 13850 gene locus_tag LOCUS_19390 gene ggtA 12267 13850 CDS product bifunctional cephalosporin acylase/gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403933.1 protein_id gnl|my_center|LOCUS_19390 14293 13892 gene locus_tag LOCUS_19400 gene vapC 14293 13892 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06662 protein_id gnl|my_center|LOCUS_19400 14517 14293 gene locus_tag LOCUS_19410 14517 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 15062 14721 gene locus_tag LOCUS_19420 15062 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 15366 16649 gene locus_tag LOCUS_19430 15366 16649 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053636.1 protein_id gnl|my_center|LOCUS_19430 17138 17344 gene locus_tag LOCUS_19440 17138 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 18030 19013 gene locus_tag LOCUS_19450 gene ephA 18030 19013 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_19450 20497 19115 gene locus_tag LOCUS_19460 gene glnA2 20497 19115 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708670.1 protein_id gnl|my_center|LOCUS_19460 21128 20511 gene locus_tag LOCUS_19470 21128 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 22156 21194 gene locus_tag LOCUS_19480 22156 21194 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_19480 22565 22182 gene locus_tag LOCUS_19490 22565 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 23898 22606 gene locus_tag LOCUS_19500 23898 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 24390 23899 gene locus_tag LOCUS_19510 24390 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 25466 24408 gene locus_tag LOCUS_19520 25466 24408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 26312 25506 gene locus_tag LOCUS_19530 26312 25506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 27152 26493 gene locus_tag LOCUS_19540 27152 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_19540 27301 28041 gene locus_tag LOCUS_19550 gene plsC 27301 28041 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW5 protein_id gnl|my_center|LOCUS_19550 >Feature sequence051 401 117 gene locus_tag LOCUS_19560 401 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 358 1053 gene locus_tag LOCUS_19570 358 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2098 1529 gene locus_tag LOCUS_19580 2098 1529 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036332.1 protein_id gnl|my_center|LOCUS_19580 3098 2154 gene locus_tag LOCUS_19590 3098 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141810.1 protein_id gnl|my_center|LOCUS_19590 3894 3127 gene locus_tag LOCUS_19600 3894 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 5177 4029 gene locus_tag LOCUS_19610 5177 4029 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_19610 5518 5174 gene locus_tag LOCUS_19620 5518 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 7791 5746 gene locus_tag LOCUS_19630 7791 5746 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_19630 8349 8182 gene locus_tag LOCUS_19640 8349 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 9662 8505 gene locus_tag LOCUS_19650 9662 8505 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_19650 9846 10076 gene locus_tag LOCUS_19660 9846 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 10030 10905 gene locus_tag LOCUS_19670 10030 10905 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089439.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19670 12029 10902 gene locus_tag LOCUS_19680 12029 10902 CDS product acyl-CoA dehydrogenase short-chain specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_19680 13265 12114 gene locus_tag LOCUS_19690 13265 12114 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_19690 14357 13401 gene locus_tag LOCUS_19700 14357 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 14623 15342 gene locus_tag LOCUS_19710 gene rpoE 14623 15342 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_19710 15865 15365 gene locus_tag LOCUS_19720 15865 15365 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MV56 protein_id gnl|my_center|LOCUS_19720 16465 15878 gene locus_tag LOCUS_19730 16465 15878 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R72 protein_id gnl|my_center|LOCUS_19730 18198 16465 gene locus_tag LOCUS_19740 gene argS 18198 16465 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQC6 protein_id gnl|my_center|LOCUS_19740 18927 18199 gene locus_tag LOCUS_19750 18927 18199 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_19750 19882 20703 gene locus_tag LOCUS_19760 19882 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087090.1 protein_id gnl|my_center|LOCUS_19760 20700 21818 gene locus_tag LOCUS_19770 20700 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 21932 24058 gene locus_tag LOCUS_19780 21932 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 24879 24160 gene locus_tag LOCUS_19790 24879 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_19790 25525 24908 gene locus_tag LOCUS_19800 gene ubiX 25525 24908 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYS1 protein_id gnl|my_center|LOCUS_19800 26998 25592 gene locus_tag LOCUS_19810 gene mpl 26998 25592 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP18 protein_id gnl|my_center|LOCUS_19810 27577 27059 gene locus_tag LOCUS_19820 27577 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence052 297 88 gene locus_tag LOCUS_19830 297 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1593 421 gene locus_tag LOCUS_19840 1593 421 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_19840 2985 1699 gene locus_tag LOCUS_19850 2985 1699 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947654.1 protein_id gnl|my_center|LOCUS_19850 5054 3135 gene locus_tag LOCUS_19860 5054 3135 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_19860 5207 5584 gene locus_tag LOCUS_19870 5207 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496452.1 protein_id gnl|my_center|LOCUS_19870 6470 6108 gene locus_tag LOCUS_19880 6470 6108 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707889.1 protein_id gnl|my_center|LOCUS_19880 6542 7306 gene locus_tag LOCUS_19890 6542 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404044.1 protein_id gnl|my_center|LOCUS_19890 8408 7278 gene locus_tag LOCUS_19900 8408 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 8595 9698 gene locus_tag LOCUS_19910 gene ribB 8595 9698 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T835 protein_id gnl|my_center|LOCUS_19910 10018 9731 gene locus_tag LOCUS_19920 10018 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 10044 10340 gene locus_tag LOCUS_19930 10044 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 10772 10392 gene locus_tag LOCUS_19940 10772 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 12213 10945 gene locus_tag LOCUS_19950 12213 10945 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022607.1 protein_id gnl|my_center|LOCUS_19950 13536 12223 gene locus_tag LOCUS_19960 gene yegQ 13536 12223 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_19960 13690 14424 gene locus_tag LOCUS_19970 13690 14424 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_19970 14424 15203 gene locus_tag LOCUS_19980 14424 15203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_19980 15252 15602 gene locus_tag LOCUS_19990 15252 15602 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_19990 15599 16009 gene locus_tag LOCUS_20000 15599 16009 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_20000 16081 17625 gene locus_tag LOCUS_20010 16081 17625 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_20010 19188 17635 gene locus_tag LOCUS_20020 19188 17635 CDS product choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830660.1 protein_id gnl|my_center|LOCUS_20020 19338 20210 gene locus_tag LOCUS_20030 gene metF 19338 20210 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189R6 protein_id gnl|my_center|LOCUS_20030 20305 22290 gene locus_tag LOCUS_20040 20305 22290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_20040 22287 24320 gene locus_tag LOCUS_20050 22287 24320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 24688 25563 gene locus_tag LOCUS_20060 24688 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 26887 25682 gene locus_tag LOCUS_20070 gene hadA 26887 25682 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427766.1 protein_id gnl|my_center|LOCUS_20070 27491 27826 gene locus_tag LOCUS_20080 27491 27826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence053 157 1074 gene locus_tag LOCUS_20090 157 1074 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 protein_id gnl|my_center|LOCUS_20090 2576 1200 gene locus_tag LOCUS_20100 2576 1200 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_20100 3452 2589 gene locus_tag LOCUS_20110 3452 2589 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703193.1 protein_id gnl|my_center|LOCUS_20110 3743 4369 gene locus_tag LOCUS_20120 3743 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 4455 5114 gene locus_tag LOCUS_20130 4455 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 5348 6562 gene locus_tag LOCUS_20140 5348 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6595 7461 gene locus_tag LOCUS_20150 6595 7461 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_20150 7479 7766 gene locus_tag LOCUS_20160 7479 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7819 8664 gene locus_tag LOCUS_20170 7819 8664 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203918.1 protein_id gnl|my_center|LOCUS_20170 9700 8813 gene locus_tag LOCUS_20180 9700 8813 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970571.1 protein_id gnl|my_center|LOCUS_20180 10856 9759 gene locus_tag LOCUS_20190 10856 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 11369 12658 gene locus_tag LOCUS_20200 11369 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 protein_id gnl|my_center|LOCUS_20200 12842 13951 gene locus_tag LOCUS_20210 12842 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 15616 13967 gene locus_tag LOCUS_20220 15616 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141929.1 protein_id gnl|my_center|LOCUS_20220 15896 16870 gene locus_tag LOCUS_20230 15896 16870 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926674.1 protein_id gnl|my_center|LOCUS_20230 17705 17244 gene locus_tag LOCUS_20240 17705 17244 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222817.1 protein_id gnl|my_center|LOCUS_20240 18038 17712 gene locus_tag LOCUS_20250 18038 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 18778 18050 gene locus_tag LOCUS_20260 18778 18050 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021776.1 protein_id gnl|my_center|LOCUS_20260 18960 20105 gene locus_tag LOCUS_20270 18960 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 20184 20618 gene locus_tag LOCUS_20280 20184 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 20681 21028 gene locus_tag LOCUS_20290 20681 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 21834 21025 gene locus_tag LOCUS_20300 21834 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 22680 22021 gene locus_tag LOCUS_20310 22680 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 24096 22825 gene locus_tag LOCUS_20320 24096 22825 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704479.1 protein_id gnl|my_center|LOCUS_20320 24302 24862 gene locus_tag LOCUS_20330 24302 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 25132 25857 gene locus_tag LOCUS_20340 25132 25857 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222527.1 protein_id gnl|my_center|LOCUS_20340 25894 26544 gene locus_tag LOCUS_20350 25894 26544 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262921.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence054 183 1214 gene locus_tag LOCUS_20360 gene ruvB 183 1214 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 protein_id gnl|my_center|LOCUS_20360 1362 2042 gene locus_tag LOCUS_20370 gene tolQ 1362 2042 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_20370 1999 2154 gene locus_tag LOCUS_20380 1999 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2157 2579 gene locus_tag LOCUS_20390 gene tolR 2157 2579 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_20390 2585 3316 gene locus_tag LOCUS_20400 2585 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3433 4737 gene locus_tag LOCUS_20410 gene tolB 3433 4737 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y40 protein_id gnl|my_center|LOCUS_20410 4875 5462 gene locus_tag LOCUS_20420 gene pal 4875 5462 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 protein_id gnl|my_center|LOCUS_20420 5490 6323 gene locus_tag LOCUS_20430 5490 6323 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 protein_id gnl|my_center|LOCUS_20430 6338 6985 gene locus_tag LOCUS_20440 gene queE 6338 6985 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWK3 protein_id gnl|my_center|LOCUS_20440 7004 7696 gene locus_tag LOCUS_20450 gene queC 7004 7696 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y44 protein_id gnl|my_center|LOCUS_20450 7856 7781 gene locus_tag LOCUS_t00070 7856 7781 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8919 7990 gene locus_tag LOCUS_20460 gene gshB 8919 7990 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UII5 protein_id gnl|my_center|LOCUS_20460 9020 10090 gene locus_tag LOCUS_20470 gene nadA 9020 10090 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_20470 11557 10073 gene locus_tag LOCUS_20480 11557 10073 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_20480 11840 12082 gene locus_tag LOCUS_20490 11840 12082 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_20490 12119 13195 gene locus_tag LOCUS_20500 12119 13195 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 protein_id gnl|my_center|LOCUS_20500 13280 14158 gene locus_tag LOCUS_20510 gene dapA 13280 14158 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_20510 14229 15338 gene locus_tag LOCUS_20520 14229 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_20520 15418 16179 gene locus_tag LOCUS_20530 15418 16179 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_20530 16890 16246 gene locus_tag LOCUS_20540 16890 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 17537 16989 gene locus_tag LOCUS_20550 17537 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 18835 19716 gene locus_tag LOCUS_20560 18835 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 20146 19973 gene locus_tag LOCUS_20570 20146 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 20188 20778 gene locus_tag LOCUS_20580 20188 20778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20580 20778 21410 gene locus_tag LOCUS_20590 20778 21410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 21444 25019 gene locus_tag LOCUS_20600 gene icmF1 21444 25019 CDS product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_20600 25162 25935 gene locus_tag LOCUS_20610 25162 25935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 26032 26724 gene locus_tag LOCUS_20620 gene pppA 26032 26724 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence055 770 315 gene locus_tag LOCUS_20630 770 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1558 2484 gene locus_tag LOCUS_20640 1558 2484 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_20640 3097 2453 gene locus_tag LOCUS_20650 3097 2453 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_20650 3232 4227 gene locus_tag LOCUS_20660 3232 4227 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_20660 5117 4224 gene locus_tag LOCUS_20670 5117 4224 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_20670 5376 5678 gene locus_tag LOCUS_20680 5376 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5700 6371 gene locus_tag LOCUS_20690 5700 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 6406 6816 gene locus_tag LOCUS_20700 6406 6816 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_20700 7127 7768 gene locus_tag LOCUS_20710 7127 7768 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887706.1 protein_id gnl|my_center|LOCUS_20710 7980 9263 gene locus_tag LOCUS_20720 7980 9263 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_20720 10257 9340 gene locus_tag LOCUS_20730 10257 9340 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225035.1 protein_id gnl|my_center|LOCUS_20730 10921 10487 gene locus_tag LOCUS_20740 10921 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090460.1 protein_id gnl|my_center|LOCUS_20740 11116 11475 gene locus_tag LOCUS_20750 11116 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 12023 11472 gene locus_tag LOCUS_20760 12023 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 12222 13136 gene locus_tag LOCUS_20770 12222 13136 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728963.1 protein_id gnl|my_center|LOCUS_20770 13212 13403 gene locus_tag LOCUS_20780 13212 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 14087 13437 gene locus_tag LOCUS_20790 14087 13437 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067702.1 protein_id gnl|my_center|LOCUS_20790 14268 14681 gene locus_tag LOCUS_20800 14268 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 14793 16013 gene locus_tag LOCUS_20810 gene ybfB 14793 16013 CDS product putative MFS-type transporter YbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31444 protein_id gnl|my_center|LOCUS_20810 16189 17322 gene locus_tag LOCUS_20820 16189 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 17494 17790 gene locus_tag LOCUS_20830 17494 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 19910 17811 gene locus_tag LOCUS_20840 19910 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 20434 20063 gene locus_tag LOCUS_20850 20434 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 22147 20705 gene locus_tag LOCUS_20860 22147 20705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704413.1 protein_id gnl|my_center|LOCUS_20860 22264 22413 gene locus_tag LOCUS_20870 22264 22413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 23968 22457 gene locus_tag LOCUS_20880 23968 22457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 24306 25211 gene locus_tag LOCUS_20890 gene echA2 24306 25211 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_20890 25287 26402 gene locus_tag LOCUS_20900 25287 26402 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_20900 26432 27118 gene locus_tag LOCUS_20910 26432 27118 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence056 1498 416 gene locus_tag LOCUS_20920 1498 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2985 1495 gene locus_tag LOCUS_20930 2985 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 4838 3462 gene locus_tag LOCUS_20940 4838 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5449 6861 gene locus_tag LOCUS_20950 5449 6861 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085814.1 protein_id gnl|my_center|LOCUS_20950 6970 8061 gene locus_tag LOCUS_20960 6970 8061 CDS product pyridoxal 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 protein_id gnl|my_center|LOCUS_20960 9647 8085 gene locus_tag LOCUS_20970 9647 8085 CDS product feruloyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_20970 10535 9675 gene locus_tag LOCUS_20980 10535 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 10617 10859 gene locus_tag LOCUS_20990 10617 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 11043 10870 gene locus_tag LOCUS_21000 11043 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 11385 12329 gene locus_tag LOCUS_21010 11385 12329 CDS product putative epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701281.1 protein_id gnl|my_center|LOCUS_21010 12418 13470 gene locus_tag LOCUS_21020 12418 13470 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_21020 13738 14421 gene locus_tag LOCUS_21030 gene sigR 13738 14421 CDS product ECF RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG9 protein_id gnl|my_center|LOCUS_21030 14324 14788 gene locus_tag LOCUS_21040 14324 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 14841 15740 gene locus_tag LOCUS_21050 14841 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 16491 15781 gene locus_tag LOCUS_21060 16491 15781 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030537.1 protein_id gnl|my_center|LOCUS_21060 16620 17318 gene locus_tag LOCUS_21070 16620 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 17556 18572 gene locus_tag LOCUS_21080 17556 18572 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_21080 18738 20438 gene locus_tag LOCUS_21090 18738 20438 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_21090 20472 21497 gene locus_tag LOCUS_21100 gene tdh 20472 21497 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_21100 21548 22735 gene locus_tag LOCUS_21110 gene kbl 21548 22735 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F40 protein_id gnl|my_center|LOCUS_21110 22839 22925 gene locus_tag LOCUS_t00080 22839 22925 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23336 24598 gene locus_tag LOCUS_21120 23336 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 24653 25111 gene locus_tag LOCUS_21130 24653 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 25111 25410 gene locus_tag LOCUS_21140 25111 25410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 25712 26872 gene locus_tag LOCUS_21150 25712 26872 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence057 160 67 gene locus_tag LOCUS_t00090 160 67 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1392 496 gene locus_tag LOCUS_21160 1392 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3261 1423 gene locus_tag LOCUS_21170 3261 1423 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_21170 5239 3443 gene locus_tag LOCUS_21180 5239 3443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143661.1 protein_id gnl|my_center|LOCUS_21180 7185 5485 gene locus_tag LOCUS_21190 7185 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_21190 7309 7935 gene locus_tag LOCUS_21200 7309 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7936 8844 gene locus_tag LOCUS_21210 7936 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 9062 9532 gene locus_tag LOCUS_21220 9062 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9777 10187 gene locus_tag LOCUS_21230 9777 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 10706 10203 gene locus_tag LOCUS_21240 10706 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 11592 10819 gene locus_tag LOCUS_21250 11592 10819 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_21250 11743 13905 gene locus_tag LOCUS_21260 11743 13905 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 protein_id gnl|my_center|LOCUS_21260 14010 14684 gene locus_tag LOCUS_21270 gene nrdJb 14010 14684 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_21270 14853 15689 gene locus_tag LOCUS_21280 gene thyA 14853 15689 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRL3 protein_id gnl|my_center|LOCUS_21280 15956 18889 gene locus_tag LOCUS_21290 gene rapA 15956 18889 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ93 protein_id gnl|my_center|LOCUS_21290 19423 18944 gene locus_tag LOCUS_21300 19423 18944 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887W2 protein_id gnl|my_center|LOCUS_21300 20560 19460 gene locus_tag LOCUS_21310 20560 19460 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_21310 21470 20586 gene locus_tag LOCUS_21320 gene dhaA 21470 20586 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_21320 21781 23052 gene locus_tag LOCUS_21330 21781 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 25398 23425 gene locus_tag LOCUS_21340 25398 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 25345 25539 gene locus_tag LOCUS_21350 25345 25539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence058 1167 265 gene locus_tag LOCUS_21360 1167 265 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_21360 1337 1516 gene locus_tag LOCUS_21370 1337 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1513 1875 gene locus_tag LOCUS_21380 1513 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2028 3671 gene locus_tag LOCUS_21390 2028 3671 CDS product putative medium chain fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702815.1 protein_id gnl|my_center|LOCUS_21390 3813 4472 gene locus_tag LOCUS_21400 3813 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4530 4781 gene locus_tag LOCUS_21410 4530 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5605 4805 gene locus_tag LOCUS_21420 5605 4805 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_21420 5834 6163 gene locus_tag LOCUS_21430 5834 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6166 7365 gene locus_tag LOCUS_21440 6166 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21440 7372 8247 gene locus_tag LOCUS_21450 7372 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8253 9305 gene locus_tag LOCUS_21460 8253 9305 CDS product FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_21460 9535 10098 gene locus_tag LOCUS_21470 9535 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 10319 11431 gene locus_tag LOCUS_21480 10319 11431 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_21480 12614 11433 gene locus_tag LOCUS_21490 12614 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087892.1 protein_id gnl|my_center|LOCUS_21490 13706 12702 gene locus_tag LOCUS_21500 13706 12702 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_21500 16260 13744 gene locus_tag LOCUS_21510 16260 13744 CDS product putative 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702061.1 protein_id gnl|my_center|LOCUS_21510 16970 16263 gene locus_tag LOCUS_21520 16970 16263 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_21520 17958 16987 gene locus_tag LOCUS_21530 17958 16987 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_21530 18883 18110 gene locus_tag LOCUS_21540 18883 18110 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_21540 19554 18880 gene locus_tag LOCUS_21550 19554 18880 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878704.1 protein_id gnl|my_center|LOCUS_21550 20001 19801 gene locus_tag LOCUS_21560 20001 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 22065 20056 gene locus_tag LOCUS_21570 22065 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 22217 22402 gene locus_tag LOCUS_21580 22217 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 22416 24047 gene locus_tag LOCUS_21590 gene pruA 22416 24047 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_21590 24690 24091 gene locus_tag LOCUS_21600 24690 24091 CDS product putative pseudouridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JV8 protein_id gnl|my_center|LOCUS_21600 25054 26358 gene locus_tag LOCUS_21610 25054 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence059 2 607 gene locus_tag LOCUS_21620 2 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 742 2772 gene locus_tag LOCUS_21630 gene ccmF 742 2772 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 protein_id gnl|my_center|LOCUS_21630 2789 3340 gene locus_tag LOCUS_21640 gene ccmG 2789 3340 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420283.1 protein_id gnl|my_center|LOCUS_21640 3321 3878 gene locus_tag LOCUS_21650 3321 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3888 5150 gene locus_tag LOCUS_21660 gene cycH 3888 5150 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_21660 5342 8845 gene locus_tag LOCUS_21670 gene smc 5342 8845 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_21670 8868 9659 gene locus_tag LOCUS_21680 gene zipA 8868 9659 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I5 protein_id gnl|my_center|LOCUS_21680 9720 11744 gene locus_tag LOCUS_21690 gene ligA 9720 11744 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN5 protein_id gnl|my_center|LOCUS_21690 11734 12363 gene locus_tag LOCUS_21700 11734 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_21700 12505 13467 gene locus_tag LOCUS_21710 12505 13467 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_21710 13689 14816 gene locus_tag LOCUS_21720 gene ypgB 13689 14816 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906016.1 protein_id gnl|my_center|LOCUS_21720 15613 14813 gene locus_tag LOCUS_21730 gene fadB 15613 14813 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_21730 16817 15684 gene locus_tag LOCUS_21740 16817 15684 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_21740 18142 16988 gene locus_tag LOCUS_21750 18142 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 18323 19978 gene locus_tag LOCUS_21760 18323 19978 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730453.1 protein_id gnl|my_center|LOCUS_21760 21228 20008 gene locus_tag LOCUS_21770 gene frc 21228 20008 CDS product formyl-CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87838 protein_id gnl|my_center|LOCUS_21770 21413 23014 gene locus_tag LOCUS_21780 21413 23014 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_21780 24460 23363 gene locus_tag LOCUS_21790 24460 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 24536 24853 gene locus_tag LOCUS_21800 24536 24853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 25255 24863 gene locus_tag LOCUS_21810 25255 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 25624 25902 gene locus_tag LOCUS_21820 25624 25902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence060 397 2331 gene locus_tag LOCUS_21830 gene aceB 397 2331 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_21830 2334 4616 gene locus_tag LOCUS_21840 gene aceA 2334 4616 CDS product isocitrate lyase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TZA8 protein_id gnl|my_center|LOCUS_21840 5005 4679 gene locus_tag LOCUS_21850 5005 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 5655 5008 gene locus_tag LOCUS_21860 5655 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 5959 8406 gene locus_tag LOCUS_21870 gene leuS 5959 8406 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LB6 protein_id gnl|my_center|LOCUS_21870 9360 8425 gene locus_tag LOCUS_21880 9360 8425 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_21880 10176 9427 gene locus_tag LOCUS_21890 10176 9427 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888094.1 protein_id gnl|my_center|LOCUS_21890 11031 10240 gene locus_tag LOCUS_21900 11031 10240 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_21900 11234 12238 gene locus_tag LOCUS_21910 11234 12238 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_21910 12288 13583 gene locus_tag LOCUS_21920 12288 13583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_21920 14932 14051 gene locus_tag LOCUS_21930 gene fox2 14932 14051 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_21930 15788 14970 gene locus_tag LOCUS_21940 15788 14970 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_21940 17624 16422 gene locus_tag LOCUS_21950 17624 16422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 protein_id gnl|my_center|LOCUS_21950 17914 18774 gene locus_tag LOCUS_21960 17914 18774 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 protein_id gnl|my_center|LOCUS_21960 20039 18801 gene locus_tag LOCUS_21970 20039 18801 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022607.1 protein_id gnl|my_center|LOCUS_21970 20407 20796 gene locus_tag LOCUS_21980 20407 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 20890 23313 gene locus_tag LOCUS_21990 20890 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 24240 23689 gene locus_tag LOCUS_22000 24240 23689 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_22000 24481 24753 gene locus_tag LOCUS_22010 24481 24753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 25819 25058 gene locus_tag LOCUS_22020 25819 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence061 215 949 gene locus_tag LOCUS_22030 215 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 946 2136 gene locus_tag LOCUS_22040 946 2136 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292376.1 protein_id gnl|my_center|LOCUS_22040 2129 5392 gene locus_tag LOCUS_22050 2129 5392 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_22050 5465 5677 gene locus_tag LOCUS_22060 5465 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 6066 6383 gene locus_tag LOCUS_22070 6066 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22070 6399 7538 gene locus_tag LOCUS_22080 6399 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22080 7845 7555 gene locus_tag LOCUS_22090 7845 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 8036 9499 gene locus_tag LOCUS_22100 8036 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 9608 10981 gene locus_tag LOCUS_22110 9608 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 11212 11006 gene locus_tag LOCUS_22120 11212 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 11360 13231 gene locus_tag LOCUS_22130 11360 13231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_22130 13221 15011 gene locus_tag LOCUS_22140 13221 15011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027346.1 protein_id gnl|my_center|LOCUS_22140 15294 16481 gene locus_tag LOCUS_22150 15294 16481 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_22150 16577 17185 gene locus_tag LOCUS_22160 gene pdxH 16577 17185 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKQ9 protein_id gnl|my_center|LOCUS_22160 17401 19038 gene locus_tag LOCUS_22170 17401 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_22170 19549 19097 gene locus_tag LOCUS_22180 19549 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702793.1 protein_id gnl|my_center|LOCUS_22180 20138 19542 gene locus_tag LOCUS_22190 20138 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 20255 21406 gene locus_tag LOCUS_22200 20255 21406 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_22200 21442 22530 gene locus_tag LOCUS_22210 21442 22530 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423280.1 protein_id gnl|my_center|LOCUS_22210 22521 22736 gene locus_tag LOCUS_22220 22521 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 22729 23391 gene locus_tag LOCUS_22230 22729 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 23878 23465 gene locus_tag LOCUS_22240 23878 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 24243 23974 gene locus_tag LOCUS_22250 24243 23974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 24744 24379 gene locus_tag LOCUS_22260 24744 24379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 25342 25091 gene locus_tag LOCUS_22270 25342 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 25545 25339 gene locus_tag LOCUS_22280 25545 25339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence062 <1 732 gene locus_tag LOCUS_22290 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225728.1:enoyl-CoA hydratase 863 1810 gene locus_tag LOCUS_22300 863 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2361 1852 gene locus_tag LOCUS_22310 2361 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2965 2354 gene locus_tag LOCUS_22320 2965 2354 CDS product Ecf-type RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810497.1 protein_id gnl|my_center|LOCUS_22320 4736 2997 gene locus_tag LOCUS_22330 4736 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638263.2 protein_id gnl|my_center|LOCUS_22330 4826 5164 gene locus_tag LOCUS_22340 4826 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 5414 8098 gene locus_tag LOCUS_22350 5414 8098 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_22350 8266 8634 gene locus_tag LOCUS_22360 8266 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 8718 9149 gene locus_tag LOCUS_22370 8718 9149 CDS product PaaI-family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265987.1 protein_id gnl|my_center|LOCUS_22370 9164 9583 gene locus_tag LOCUS_22380 9164 9583 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_22380 9630 10157 gene locus_tag LOCUS_22390 9630 10157 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024085.1 protein_id gnl|my_center|LOCUS_22390 10421 11029 gene locus_tag LOCUS_22400 10421 11029 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083417.1 protein_id gnl|my_center|LOCUS_22400 11458 11066 gene locus_tag LOCUS_22410 11458 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 12005 11451 gene locus_tag LOCUS_22420 12005 11451 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_22420 12216 13058 gene locus_tag LOCUS_22430 12216 13058 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 protein_id gnl|my_center|LOCUS_22430 13068 14354 gene locus_tag LOCUS_22440 gene LolE 13068 14354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338480.1 protein_id gnl|my_center|LOCUS_22440 14358 15569 gene locus_tag LOCUS_22450 14358 15569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_22450 15566 16249 gene locus_tag LOCUS_22460 15566 16249 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_22460 16257 17498 gene locus_tag LOCUS_22470 16257 17498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 18633 17875 gene locus_tag LOCUS_22480 18633 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 20164 19025 gene locus_tag LOCUS_22490 20164 19025 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_22490 20854 20234 gene locus_tag LOCUS_22500 gene gst 20854 20234 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593328.1 protein_id gnl|my_center|LOCUS_22500 22147 21080 gene locus_tag LOCUS_22510 22147 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 22338 23180 gene locus_tag LOCUS_22520 22338 23180 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816037.1 protein_id gnl|my_center|LOCUS_22520 24363 23218 gene locus_tag LOCUS_22530 24363 23218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(23917..23919),aa:Sec) note codon on position 149 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_22530 25327 24548 gene locus_tag LOCUS_22540 25327 24548 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence063 194 871 gene locus_tag LOCUS_22550 194 871 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_22550 1070 1864 gene locus_tag LOCUS_22560 1070 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1907 2902 gene locus_tag LOCUS_22570 gene yerI 1907 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34640 protein_id gnl|my_center|LOCUS_22570 2948 3256 gene locus_tag LOCUS_22580 2948 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 6903 3823 gene locus_tag LOCUS_22590 6903 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 7532 6957 gene locus_tag LOCUS_22600 7532 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 7599 7787 gene locus_tag LOCUS_22610 7599 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 7953 8273 gene locus_tag LOCUS_22620 7953 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22620 9109 8309 gene locus_tag LOCUS_22630 9109 8309 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_22630 9293 9808 gene locus_tag LOCUS_22640 9293 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 10672 9842 gene locus_tag LOCUS_22650 10672 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI89 protein_id gnl|my_center|LOCUS_22650 15699 10927 gene locus_tag LOCUS_22660 15699 10927 CDS product 2-hydroxyglutaryl-CoA dehydratase activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545106.1 protein_id gnl|my_center|LOCUS_22660 16967 15912 gene locus_tag LOCUS_22670 16967 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 17820 17020 gene locus_tag LOCUS_22680 17820 17020 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_22680 18944 17973 gene locus_tag LOCUS_22690 18944 17973 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_22690 19153 20703 gene locus_tag LOCUS_22700 19153 20703 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_22700 20827 21066 gene locus_tag LOCUS_22710 20827 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 21115 21540 gene locus_tag LOCUS_22720 21115 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 21615 22253 gene locus_tag LOCUS_22730 21615 22253 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_22730 22338 22892 gene locus_tag LOCUS_22740 22338 22892 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465755.1 protein_id gnl|my_center|LOCUS_22740 22911 23648 gene locus_tag LOCUS_22750 gene ygaJ 22911 23648 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_22750 23579 23761 gene locus_tag LOCUS_22760 23579 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 23758 24636 gene locus_tag LOCUS_22770 23758 24636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 24644 25153 gene locus_tag LOCUS_22780 24644 25153 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932115.1 protein_id gnl|my_center|LOCUS_22780 25212 25502 gene locus_tag LOCUS_22790 25212 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence064 1003 1719 gene locus_tag LOCUS_22800 gene aruR 1003 1719 CDS product transcriptional regulatory protein AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI2 protein_id gnl|my_center|LOCUS_22800 2523 1741 gene locus_tag LOCUS_22810 gene xni 2523 1741 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE3 protein_id gnl|my_center|LOCUS_22810 4229 2547 gene locus_tag LOCUS_22820 4229 2547 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_22820 4366 5574 gene locus_tag LOCUS_22830 gene ycaQ 4366 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_22830 5964 5590 gene locus_tag LOCUS_22840 5964 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 6191 5961 gene locus_tag LOCUS_22850 6191 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 7974 6310 gene locus_tag LOCUS_22860 7974 6310 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_22860 8936 8154 gene locus_tag LOCUS_22870 8936 8154 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_22870 9926 8985 gene locus_tag LOCUS_22880 9926 8985 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_22880 10125 11075 gene locus_tag LOCUS_22890 gene argF 10125 11075 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2D1 protein_id gnl|my_center|LOCUS_22890 11810 11097 gene locus_tag LOCUS_22900 11810 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 13457 12363 gene locus_tag LOCUS_22910 gene glcE 13457 12363 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_22910 14929 13457 gene locus_tag LOCUS_22920 gene glcD 14929 13457 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_22920 15230 15523 gene locus_tag LOCUS_22930 15230 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 15818 17314 gene locus_tag LOCUS_22940 15818 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 17338 20286 gene locus_tag LOCUS_22950 17338 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22950 20327 21244 gene locus_tag LOCUS_22960 20327 21244 CDS product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_22960 23051 21285 gene locus_tag LOCUS_22970 23051 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 23879 23121 gene locus_tag LOCUS_22980 gene fabG 23879 23121 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_22980 24005 24943 gene locus_tag LOCUS_22990 24005 24943 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_22990 24981 25057 gene locus_tag LOCUS_t00100 24981 25057 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 118 552 gene locus_tag LOCUS_23000 118 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 777 1310 gene locus_tag LOCUS_23010 777 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1432 2190 gene locus_tag LOCUS_23020 1432 2190 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_23020 3214 2297 gene locus_tag LOCUS_23030 3214 2297 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229099.1 protein_id gnl|my_center|LOCUS_23030 3726 3286 gene locus_tag LOCUS_23040 3726 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5285 3795 gene locus_tag LOCUS_23050 5285 3795 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_23050 6830 5301 gene locus_tag LOCUS_23060 6830 5301 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087816.1 protein_id gnl|my_center|LOCUS_23060 7673 6864 gene locus_tag LOCUS_23070 7673 6864 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088335.1 protein_id gnl|my_center|LOCUS_23070 8858 7713 gene locus_tag LOCUS_23080 8858 7713 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897072.1 protein_id gnl|my_center|LOCUS_23080 11305 9134 gene locus_tag LOCUS_23090 11305 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 12009 11302 gene locus_tag LOCUS_23100 12009 11302 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403929.1 protein_id gnl|my_center|LOCUS_23100 12168 12716 gene locus_tag LOCUS_23110 12168 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 12713 13279 gene locus_tag LOCUS_23120 12713 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 13284 14486 gene locus_tag LOCUS_23130 13284 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 14696 15526 gene locus_tag LOCUS_23140 14696 15526 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_23140 15899 16375 gene locus_tag LOCUS_23150 15899 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 17573 16377 gene locus_tag LOCUS_23160 17573 16377 CDS product carbohydrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_23160 17878 17570 gene locus_tag LOCUS_23170 17878 17570 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_23170 18116 18907 gene locus_tag LOCUS_23180 18116 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 18936 20078 gene locus_tag LOCUS_23190 18936 20078 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892418.1 protein_id gnl|my_center|LOCUS_23190 21557 20403 gene locus_tag LOCUS_23200 21557 20403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039772.1 protein_id gnl|my_center|LOCUS_23200 21779 21645 gene locus_tag LOCUS_23210 21779 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 21964 22146 gene locus_tag LOCUS_23220 21964 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 24341 22209 gene locus_tag LOCUS_23230 24341 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 24921 24487 gene locus_tag LOCUS_23240 24921 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence066 1008 739 gene locus_tag LOCUS_23250 1008 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1607 1308 gene locus_tag LOCUS_23260 1607 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2395 1997 gene locus_tag LOCUS_23270 2395 1997 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_23270 2590 3129 gene locus_tag LOCUS_23280 2590 3129 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_23280 3142 4791 gene locus_tag LOCUS_23290 3142 4791 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_23290 4796 5962 gene locus_tag LOCUS_23300 gene porA 4796 5962 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_23300 5967 6851 gene locus_tag LOCUS_23310 5967 6851 CDS product 2-ketoisovalerate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_23310 7016 6864 gene locus_tag LOCUS_23320 7016 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 7299 7457 gene locus_tag LOCUS_23330 7299 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 9320 7485 gene locus_tag LOCUS_23340 9320 7485 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989494.1 protein_id gnl|my_center|LOCUS_23340 9749 9901 gene locus_tag LOCUS_23350 9749 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 12428 9930 gene locus_tag LOCUS_23360 12428 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 12852 12655 gene locus_tag LOCUS_23370 12852 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 12994 12770 gene locus_tag LOCUS_23380 12994 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 13181 15736 gene locus_tag LOCUS_23390 13181 15736 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_23390 15736 16350 gene locus_tag LOCUS_23400 15736 16350 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_23400 16361 17254 gene locus_tag LOCUS_23410 16361 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 17261 18145 gene locus_tag LOCUS_23420 17261 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 19094 18162 gene locus_tag LOCUS_23430 19094 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 19120 19374 gene locus_tag LOCUS_23440 19120 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 20855 19386 gene locus_tag LOCUS_23450 gene panF 20855 19386 CDS product sodium/panthothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210065.1 protein_id gnl|my_center|LOCUS_23450 21421 20852 gene locus_tag LOCUS_23460 21421 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811104.1 protein_id gnl|my_center|LOCUS_23460 21648 21454 gene locus_tag LOCUS_23470 21648 21454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 21718 22203 gene locus_tag LOCUS_23480 21718 22203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 22200 23765 gene locus_tag LOCUS_23490 22200 23765 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence067 1144 1887 gene locus_tag LOCUS_23500 gene map 1144 1887 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BV1 protein_id gnl|my_center|LOCUS_23500 1949 4651 gene locus_tag LOCUS_23510 gene glnD 1949 4651 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_23510 4811 6031 gene locus_tag LOCUS_23520 4811 6031 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_23520 6043 7074 gene locus_tag LOCUS_23530 gene dapD 6043 7074 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P9 protein_id gnl|my_center|LOCUS_23530 7119 8255 gene locus_tag LOCUS_23540 gene dapE 7119 8255 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_23540 8284 8676 gene locus_tag LOCUS_23550 8284 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 8712 9491 gene locus_tag LOCUS_23560 8712 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 9648 10556 gene locus_tag LOCUS_23570 9648 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 10819 12621 gene locus_tag LOCUS_23580 gene xcpQ 10819 12621 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_23580 12642 15185 gene locus_tag LOCUS_23590 gene plsB 12642 15185 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW7 protein_id gnl|my_center|LOCUS_23590 15897 15136 gene locus_tag LOCUS_23600 gene rsmJ 15897 15136 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW0 protein_id gnl|my_center|LOCUS_23600 16722 16021 gene locus_tag LOCUS_23610 16722 16021 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_23610 18668 16734 gene locus_tag LOCUS_23620 gene yoaA 18668 16734 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_23620 19560 19048 gene locus_tag LOCUS_23630 19560 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 20043 19795 gene locus_tag LOCUS_23640 20043 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 20800 20147 gene locus_tag LOCUS_23650 gene adk 20800 20147 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_23650 23106 20857 gene locus_tag LOCUS_23660 gene relA 23106 20857 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence068 968 93 gene locus_tag LOCUS_23670 968 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1204 1031 gene locus_tag LOCUS_23680 1204 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 1532 2125 gene locus_tag LOCUS_23690 1532 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2122 2388 gene locus_tag LOCUS_23700 2122 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2407 3405 gene locus_tag LOCUS_23710 gene hemH1 2407 3405 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_23710 3630 3971 gene locus_tag LOCUS_23720 3630 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4288 3968 gene locus_tag LOCUS_23730 4288 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4972 4394 gene locus_tag LOCUS_23740 4972 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 6878 5244 gene locus_tag LOCUS_23750 6878 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_23750 7979 6921 gene locus_tag LOCUS_23760 7979 6921 CDS product 2-ketogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089800.1 protein_id gnl|my_center|LOCUS_23760 8276 9166 gene locus_tag LOCUS_23770 8276 9166 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_23770 9783 9175 gene locus_tag LOCUS_23780 9783 9175 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_23780 11144 10368 gene locus_tag LOCUS_23790 11144 10368 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_23790 11352 11909 gene locus_tag LOCUS_23800 gene rpoE 11352 11909 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_23800 11899 12585 gene locus_tag LOCUS_23810 11899 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 12582 13484 gene locus_tag LOCUS_23820 12582 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 13713 16499 gene locus_tag LOCUS_23830 13713 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 16496 17083 gene locus_tag LOCUS_23840 16496 17083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 17210 18250 gene locus_tag LOCUS_23850 17210 18250 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029969.1 protein_id gnl|my_center|LOCUS_23850 18263 18949 gene locus_tag LOCUS_23860 18263 18949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 19000 21756 gene locus_tag LOCUS_23870 19000 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 21753 23189 gene locus_tag LOCUS_23880 21753 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065354.1 protein_id gnl|my_center|LOCUS_23880 23191 23736 gene locus_tag LOCUS_23890 23191 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 23794 24282 gene locus_tag LOCUS_23900 23794 24282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence069 102 929 gene locus_tag LOCUS_23910 102 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2878 953 gene locus_tag LOCUS_23920 2878 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3266 4813 gene locus_tag LOCUS_23930 3266 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 6755 4842 gene locus_tag LOCUS_23940 6755 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 9292 6914 gene locus_tag LOCUS_23950 9292 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 9623 10528 gene locus_tag LOCUS_23960 9623 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 10525 11562 gene locus_tag LOCUS_23970 10525 11562 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731581.1 protein_id gnl|my_center|LOCUS_23970 11517 11750 gene locus_tag LOCUS_23980 11517 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 13013 11814 gene locus_tag LOCUS_23990 gene frc 13013 11814 CDS product formyl-CoA:oxalate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7S7 protein_id gnl|my_center|LOCUS_23990 13452 13231 gene locus_tag LOCUS_24000 13452 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 13442 13852 gene locus_tag LOCUS_24010 13442 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 14028 15170 gene locus_tag LOCUS_24020 14028 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 16258 15251 gene locus_tag LOCUS_24030 16258 15251 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_24030 17266 16445 gene locus_tag LOCUS_24040 17266 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 17770 17333 gene locus_tag LOCUS_24050 17770 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 18919 17789 gene locus_tag LOCUS_24060 18919 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 21521 19419 gene locus_tag LOCUS_24070 21521 19419 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_24070 23911 21518 gene locus_tag LOCUS_24080 23911 21518 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BV4 protein_id gnl|my_center|LOCUS_24080 >Feature sequence070 262 483 gene locus_tag LOCUS_24090 262 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 498 962 gene locus_tag LOCUS_24100 498 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1086 1970 gene locus_tag LOCUS_24110 1086 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 protein_id gnl|my_center|LOCUS_24110 2052 2753 gene locus_tag LOCUS_24120 2052 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24120 2931 4265 gene locus_tag LOCUS_24130 2931 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 5503 4262 gene locus_tag LOCUS_24140 5503 4262 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509587.1 protein_id gnl|my_center|LOCUS_24140 6174 5653 gene locus_tag LOCUS_24150 6174 5653 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEB9 protein_id gnl|my_center|LOCUS_24150 7926 6310 gene locus_tag LOCUS_24160 7926 6310 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110294.1 protein_id gnl|my_center|LOCUS_24160 8925 7942 gene locus_tag LOCUS_24170 8925 7942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_24170 9929 8922 gene locus_tag LOCUS_24180 9929 8922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_24180 11904 9940 gene locus_tag LOCUS_24190 11904 9940 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_24190 12983 11916 gene locus_tag LOCUS_24200 12983 11916 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 protein_id gnl|my_center|LOCUS_24200 14018 12996 gene locus_tag LOCUS_24210 gene yejB 14018 12996 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 protein_id gnl|my_center|LOCUS_24210 14313 15848 gene locus_tag LOCUS_24220 14313 15848 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_24220 16738 15890 gene locus_tag LOCUS_24230 16738 15890 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 protein_id gnl|my_center|LOCUS_24230 18025 16871 gene locus_tag LOCUS_24240 18025 16871 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_24240 18166 18996 gene locus_tag LOCUS_24250 gene poxF 18166 18996 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946220.1 protein_id gnl|my_center|LOCUS_24250 20248 19004 gene locus_tag LOCUS_24260 20248 19004 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_24260 20412 21962 gene locus_tag LOCUS_24270 20412 21962 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_24270 22866 21967 gene locus_tag LOCUS_24280 22866 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 <24216 23251 gene locus_tag LOCUS_24290 <24216 23251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227064.1:HNH endonuclease >Feature sequence071 106 315 gene locus_tag LOCUS_24300 106 315 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_24300 1415 438 gene locus_tag LOCUS_24310 1415 438 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_24310 1691 1482 gene locus_tag LOCUS_24320 1691 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2510 1731 gene locus_tag LOCUS_24330 gene hisF 2510 1731 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62450 protein_id gnl|my_center|LOCUS_24330 3207 2548 gene locus_tag LOCUS_24340 gene hisH 3207 2548 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61779 protein_id gnl|my_center|LOCUS_24340 3333 4748 gene locus_tag LOCUS_24350 3333 4748 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_24350 5066 6313 gene locus_tag LOCUS_24360 5066 6313 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104340.1 protein_id gnl|my_center|LOCUS_24360 6465 7202 gene locus_tag LOCUS_24370 6465 7202 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_24370 12087 7186 gene locus_tag LOCUS_24380 12087 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 13852 12326 gene locus_tag LOCUS_24390 13852 12326 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_24390 14365 15354 gene locus_tag LOCUS_24400 14365 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_24400 15351 15965 gene locus_tag LOCUS_24410 15351 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268478.1 protein_id gnl|my_center|LOCUS_24410 15967 16668 gene locus_tag LOCUS_24420 15967 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 16824 18002 gene locus_tag LOCUS_24430 16824 18002 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_24430 18214 20013 gene locus_tag LOCUS_24440 gene fabY 18214 20013 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_24440 21614 20046 gene locus_tag LOCUS_24450 gene prfC 21614 20046 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXB0 protein_id gnl|my_center|LOCUS_24450 21792 22001 gene locus_tag LOCUS_24460 21792 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 22396 22031 gene locus_tag LOCUS_24470 22396 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 22859 22386 gene locus_tag LOCUS_24480 gene rimI 22859 22386 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_24480 23664 22852 gene locus_tag LOCUS_24490 23664 22852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence072 1297 17 gene locus_tag LOCUS_24500 gene serS 1297 17 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_24500 2772 1426 gene locus_tag LOCUS_24510 2772 1426 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_24510 3632 3009 gene locus_tag LOCUS_24520 gene lolA 3632 3009 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_24520 5881 3632 gene locus_tag LOCUS_24530 gene ftsK 5881 3632 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U1 protein_id gnl|my_center|LOCUS_24530 6238 6537 gene locus_tag LOCUS_24540 6238 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 6561 7505 gene locus_tag LOCUS_24550 gene trxB 6561 7505 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39916 protein_id gnl|my_center|LOCUS_24550 7537 8277 gene locus_tag LOCUS_24560 gene aat 7537 8277 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_24560 8281 8988 gene locus_tag LOCUS_24570 gene ate 8281 8988 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 protein_id gnl|my_center|LOCUS_24570 9165 9380 gene locus_tag LOCUS_24580 gene infA 9165 9380 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65115 protein_id gnl|my_center|LOCUS_24580 11720 9447 gene locus_tag LOCUS_24590 gene clpA 11720 9447 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_24590 12132 11770 gene locus_tag LOCUS_24600 gene clpS 12132 11770 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK6 protein_id gnl|my_center|LOCUS_24600 12556 12870 gene locus_tag LOCUS_24610 12556 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 14236 12980 gene locus_tag LOCUS_24620 gene icd 14236 12980 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_24620 14374 14910 gene locus_tag LOCUS_24630 14374 14910 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_24630 15438 14986 gene locus_tag LOCUS_24640 gene moaE 15438 14986 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191688.1 protein_id gnl|my_center|LOCUS_24640 15695 15441 gene locus_tag LOCUS_24650 gene moaD 15695 15441 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX96 protein_id gnl|my_center|LOCUS_24650 16229 15756 gene locus_tag LOCUS_24660 gene moaC 16229 15756 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887P4 protein_id gnl|my_center|LOCUS_24660 16362 16508 gene locus_tag LOCUS_24670 16362 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 16620 17708 gene locus_tag LOCUS_24680 gene mnmA 16620 17708 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_24680 17763 18386 gene locus_tag LOCUS_24690 gene hflD 17763 18386 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR5 protein_id gnl|my_center|LOCUS_24690 18490 19863 gene locus_tag LOCUS_24700 gene purB 18490 19863 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV8 protein_id gnl|my_center|LOCUS_24700 19882 21408 gene locus_tag LOCUS_24710 19882 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 21525 22136 gene locus_tag LOCUS_24720 21525 22136 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_24720 22172 23659 gene locus_tag LOCUS_24730 22172 23659 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence073 433 1263 gene locus_tag LOCUS_24740 433 1263 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705311.1 protein_id gnl|my_center|LOCUS_24740 1280 2485 gene locus_tag LOCUS_24750 1280 2485 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_24750 2539 2694 gene locus_tag LOCUS_24760 2539 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4221 2716 gene locus_tag LOCUS_24770 4221 2716 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_24770 5553 4372 gene locus_tag LOCUS_24780 5553 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6857 5658 gene locus_tag LOCUS_24790 6857 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941228.1 protein_id gnl|my_center|LOCUS_24790 8781 6931 gene locus_tag LOCUS_24800 8781 6931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104691.1 protein_id gnl|my_center|LOCUS_24800 9029 9589 gene locus_tag LOCUS_24810 9029 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 10375 9740 gene locus_tag LOCUS_24820 10375 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 11059 12630 gene locus_tag LOCUS_24830 11059 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 12670 13521 gene locus_tag LOCUS_24840 12670 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 13523 13780 gene locus_tag LOCUS_24850 13523 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 13794 14369 gene locus_tag LOCUS_24860 13794 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 14680 15288 gene locus_tag LOCUS_24870 14680 15288 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_24870 15298 16056 gene locus_tag LOCUS_24880 gene fabG 15298 16056 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_24880 16059 16640 gene locus_tag LOCUS_24890 16059 16640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 16841 16683 gene locus_tag LOCUS_24900 16841 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 17108 17290 gene locus_tag LOCUS_24910 17108 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 17400 18206 gene locus_tag LOCUS_24920 17400 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 18382 19173 gene locus_tag LOCUS_24930 18382 19173 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_24930 19392 19682 gene locus_tag LOCUS_24940 19392 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 19683 19847 gene locus_tag LOCUS_24950 19683 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 19859 20365 gene locus_tag LOCUS_24960 19859 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 21348 21608 gene locus_tag LOCUS_24970 21348 21608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 21756 22331 gene locus_tag LOCUS_24980 21756 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 22410 23291 gene locus_tag LOCUS_24990 gene aadK 22410 23291 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258548.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence074 319 564 gene locus_tag LOCUS_25000 319 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 645 1994 gene locus_tag LOCUS_25010 645 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2056 2736 gene locus_tag LOCUS_25020 2056 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2844 3161 gene locus_tag LOCUS_25030 2844 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 4382 3375 gene locus_tag LOCUS_25040 4382 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039772.1 protein_id gnl|my_center|LOCUS_25040 5007 4450 gene locus_tag LOCUS_25050 5007 4450 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940873.1 protein_id gnl|my_center|LOCUS_25050 5243 5070 gene locus_tag LOCUS_25060 5243 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 6023 5328 gene locus_tag LOCUS_25070 6023 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 7408 6020 gene locus_tag LOCUS_25080 7408 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 7741 10170 gene locus_tag LOCUS_25090 gene pflD 7741 10170 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_25090 11091 10252 gene locus_tag LOCUS_25100 11091 10252 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730152.1 protein_id gnl|my_center|LOCUS_25100 13193 11778 gene locus_tag LOCUS_25110 13193 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 13344 15626 gene locus_tag LOCUS_25120 13344 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 15812 19084 gene locus_tag LOCUS_25130 15812 19084 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090027.1 protein_id gnl|my_center|LOCUS_25130 19166 22669 gene locus_tag LOCUS_25140 19166 22669 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090027.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence075 141 1571 gene locus_tag LOCUS_25150 gene sbcB 141 1571 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_25150 1575 2303 gene locus_tag LOCUS_25160 1575 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2300 3790 gene locus_tag LOCUS_25170 2300 3790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_25170 5246 3927 gene locus_tag LOCUS_25180 gene apeB 5246 3927 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ3 protein_id gnl|my_center|LOCUS_25180 5883 7115 gene locus_tag LOCUS_25190 5883 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812972.1 protein_id gnl|my_center|LOCUS_25190 7264 8187 gene locus_tag LOCUS_25200 gene purC 7264 8187 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ19 protein_id gnl|my_center|LOCUS_25200 8852 8184 gene locus_tag LOCUS_25210 gene msrA 8852 8184 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_25210 8927 10069 gene locus_tag LOCUS_25220 8927 10069 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_25220 11838 10141 gene locus_tag LOCUS_25230 11838 10141 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_25230 12115 11825 gene locus_tag LOCUS_25240 12115 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 13596 12115 gene locus_tag LOCUS_25250 13596 12115 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 protein_id gnl|my_center|LOCUS_25250 15071 13593 gene locus_tag LOCUS_25260 15071 13593 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_25260 15421 15068 gene locus_tag LOCUS_25270 15421 15068 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_25270 16403 15477 gene locus_tag LOCUS_25280 16403 15477 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599366.1 protein_id gnl|my_center|LOCUS_25280 16801 16466 gene locus_tag LOCUS_25290 16801 16466 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_25290 17070 16798 gene locus_tag LOCUS_25300 17070 16798 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_25300 17534 17070 gene locus_tag LOCUS_25310 17534 17070 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_25310 17852 18151 gene locus_tag LOCUS_25320 17852 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 18243 18767 gene locus_tag LOCUS_25330 18243 18767 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_25330 18760 19983 gene locus_tag LOCUS_25340 18760 19983 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_25340 20107 20934 gene locus_tag LOCUS_25350 gene htdY 20107 20934 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_25350 21051 21230 gene locus_tag LOCUS_25360 21051 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 21281 21919 gene locus_tag LOCUS_25370 21281 21919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_25370 22927 21845 gene locus_tag LOCUS_25380 22927 21845 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence076 122 931 gene locus_tag LOCUS_25390 122 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1025 2332 gene locus_tag LOCUS_25400 1025 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2347 2547 gene locus_tag LOCUS_25410 2347 2547 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 protein_id gnl|my_center|LOCUS_25410 2556 2849 gene locus_tag LOCUS_25420 2556 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3271 2861 gene locus_tag LOCUS_25430 3271 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3918 3268 gene locus_tag LOCUS_25440 3918 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4133 3942 gene locus_tag LOCUS_25450 4133 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 5129 4140 gene locus_tag LOCUS_25460 5129 4140 CDS product hydroxylase molybdopterin-containing subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 protein_id gnl|my_center|LOCUS_25460 7541 5142 gene locus_tag LOCUS_25470 7541 5142 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_25470 8206 7538 gene locus_tag LOCUS_25480 8206 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 8388 9788 gene locus_tag LOCUS_25490 8388 9788 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_25490 10355 9771 gene locus_tag LOCUS_25500 10355 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 11172 10609 gene locus_tag LOCUS_25510 11172 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083065.1 protein_id gnl|my_center|LOCUS_25510 11804 11187 gene locus_tag LOCUS_25520 gene gst 11804 11187 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593328.1 protein_id gnl|my_center|LOCUS_25520 13081 12188 gene locus_tag LOCUS_25530 13081 12188 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528925.1 protein_id gnl|my_center|LOCUS_25530 13233 13748 gene locus_tag LOCUS_25540 13233 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 13954 13745 gene locus_tag LOCUS_25550 13954 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 14157 14029 gene locus_tag LOCUS_25560 14157 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 14179 15228 gene locus_tag LOCUS_25570 14179 15228 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_25570 15727 15284 gene locus_tag LOCUS_25580 15727 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 16270 15737 gene locus_tag LOCUS_25590 16270 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25590 17559 16276 gene locus_tag LOCUS_25600 17559 16276 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_25600 17692 18849 gene locus_tag LOCUS_25610 17692 18849 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918994.1 protein_id gnl|my_center|LOCUS_25610 18931 19155 gene locus_tag LOCUS_25620 18931 19155 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_25620 19155 19565 gene locus_tag LOCUS_25630 19155 19565 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140252.1 protein_id gnl|my_center|LOCUS_25630 19684 20064 gene locus_tag LOCUS_25640 19684 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 21133 20105 gene locus_tag LOCUS_25650 21133 20105 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_25650 21655 21263 gene locus_tag LOCUS_25660 21655 21263 CDS product VapC ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67241 protein_id gnl|my_center|LOCUS_25660 21903 21652 gene locus_tag LOCUS_25670 21903 21652 CDS product antitoxin VapB28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403184.1 protein_id gnl|my_center|LOCUS_25670 22085 22258 gene locus_tag LOCUS_25680 22085 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 22239 22508 gene locus_tag LOCUS_25690 22239 22508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence077 497 976 gene locus_tag LOCUS_25700 497 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2677 1085 gene locus_tag LOCUS_25710 gene agpS 2677 1085 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_25710 2801 3937 gene locus_tag LOCUS_25720 2801 3937 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_25720 4054 4986 gene locus_tag LOCUS_25730 4054 4986 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_25730 5131 6135 gene locus_tag LOCUS_25740 5131 6135 CDS product 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_25740 6536 7018 gene locus_tag LOCUS_25750 6536 7018 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919960.1 protein_id gnl|my_center|LOCUS_25750 7117 8343 gene locus_tag LOCUS_25760 7117 8343 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860960.1 protein_id gnl|my_center|LOCUS_25760 8502 9026 gene locus_tag LOCUS_25770 8502 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 10223 9057 gene locus_tag LOCUS_25780 10223 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423257.1 protein_id gnl|my_center|LOCUS_25780 10107 10403 gene locus_tag LOCUS_25790 10107 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 10522 11343 gene locus_tag LOCUS_25800 10522 11343 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 protein_id gnl|my_center|LOCUS_25800 11408 11638 gene locus_tag LOCUS_25810 11408 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 13556 11607 gene locus_tag LOCUS_25820 13556 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 14139 13681 gene locus_tag LOCUS_25830 14139 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 16148 14184 gene locus_tag LOCUS_25840 16148 14184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_25840 18100 16145 gene locus_tag LOCUS_25850 18100 16145 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 protein_id gnl|my_center|LOCUS_25850 19214 18426 gene locus_tag LOCUS_25860 19214 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 19992 19384 gene locus_tag LOCUS_25870 19992 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 20233 22278 gene locus_tag LOCUS_25880 20233 22278 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence078 374 1717 gene locus_tag LOCUS_25890 gene pepQ 374 1717 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEL3 protein_id gnl|my_center|LOCUS_25890 1770 3941 gene locus_tag LOCUS_25900 gene dpp4 1770 3941 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_25900 3931 4389 gene locus_tag LOCUS_25910 3931 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4758 4402 gene locus_tag LOCUS_25920 gene pilZ 4758 4402 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_25920 5826 4819 gene locus_tag LOCUS_25930 5826 4819 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_25930 6477 5845 gene locus_tag LOCUS_25940 gene tmk 6477 5845 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_25940 7517 6474 gene locus_tag LOCUS_25950 7517 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957616.1 protein_id gnl|my_center|LOCUS_25950 8394 7501 gene locus_tag LOCUS_25960 gene pabC 8394 7501 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_25960 9856 8612 gene locus_tag LOCUS_25970 gene fabF 9856 8612 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH5 protein_id gnl|my_center|LOCUS_25970 10210 9977 gene locus_tag LOCUS_25980 gene acpP1 10210 9977 CDS product acyl carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54439 protein_id gnl|my_center|LOCUS_25980 11120 10380 gene locus_tag LOCUS_25990 gene fabG 11120 10380 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_25990 12083 11151 gene locus_tag LOCUS_26000 gene fabD 12083 11151 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJ24 protein_id gnl|my_center|LOCUS_26000 13179 12169 gene locus_tag LOCUS_26010 gene plsX 13179 12169 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YG5 protein_id gnl|my_center|LOCUS_26010 13389 13207 gene locus_tag LOCUS_26020 gene rpmF 13389 13207 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_26020 13957 13442 gene locus_tag LOCUS_26030 13957 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 14068 14664 gene locus_tag LOCUS_26040 gene yceF 14068 14664 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58628 protein_id gnl|my_center|LOCUS_26040 15640 14684 gene locus_tag LOCUS_26050 gene rluC 15640 14684 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 protein_id gnl|my_center|LOCUS_26050 15807 15676 gene locus_tag LOCUS_26060 15807 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 16415 19303 gene locus_tag LOCUS_26070 gene rne 16415 19303 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 protein_id gnl|my_center|LOCUS_26070 20430 19438 gene locus_tag LOCUS_26080 gene murB 20430 19438 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF8 protein_id gnl|my_center|LOCUS_26080 20643 21176 gene locus_tag LOCUS_26090 20643 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26090 21236 21412 gene locus_tag LOCUS_26100 21236 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26100 21963 21463 gene locus_tag LOCUS_26110 21963 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26110 22385 21960 gene locus_tag LOCUS_26120 22385 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26120 >Feature sequence079 <1 605 gene locus_tag LOCUS_26130 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389042.1:trimethylamine N-oxide reductase I catalytic subunit 3303 598 gene locus_tag LOCUS_26140 3303 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3567 5114 gene locus_tag LOCUS_26150 gene ilvB 3567 5114 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_26150 5282 5620 gene locus_tag LOCUS_26160 5282 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 6809 6279 gene locus_tag LOCUS_26170 6809 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 8789 6984 gene locus_tag LOCUS_26180 8789 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 9108 9305 gene locus_tag LOCUS_26190 9108 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 9538 10761 gene locus_tag LOCUS_26200 9538 10761 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_26200 10844 11980 gene locus_tag LOCUS_26210 10844 11980 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_26210 12655 12014 gene locus_tag LOCUS_26220 12655 12014 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920499.1 protein_id gnl|my_center|LOCUS_26220 14087 12795 gene locus_tag LOCUS_26230 14087 12795 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289648.1 protein_id gnl|my_center|LOCUS_26230 14412 16277 gene locus_tag LOCUS_26240 14412 16277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_26240 16274 18286 gene locus_tag LOCUS_26250 16274 18286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_26250 18412 21549 gene locus_tag LOCUS_26260 18412 21549 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGC8 protein_id gnl|my_center|LOCUS_26260 22166 21702 gene locus_tag LOCUS_26270 22166 21702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26270 >Feature sequence080 507 166 gene locus_tag LOCUS_26280 507 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 1309 527 gene locus_tag LOCUS_26290 gene yngF 1309 527 CDS product putative enoyl-CoA hydratase/isomerase YngF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34893 protein_id gnl|my_center|LOCUS_26290 3702 1453 gene locus_tag LOCUS_26300 3702 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 4124 3918 gene locus_tag LOCUS_26310 4124 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6587 4254 gene locus_tag LOCUS_26320 gene gcd-1 6587 4254 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_26320 6874 8556 gene locus_tag LOCUS_26330 6874 8556 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_26330 9335 8553 gene locus_tag LOCUS_26340 9335 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 10523 9387 gene locus_tag LOCUS_26350 10523 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 10628 10954 gene locus_tag LOCUS_26360 10628 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 11060 11773 gene locus_tag LOCUS_26370 gene paaG 11060 11773 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_26370 14164 11849 gene locus_tag LOCUS_26380 14164 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 14400 15350 gene locus_tag LOCUS_26390 14400 15350 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_26390 16685 15606 gene locus_tag LOCUS_26400 16685 15606 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_26400 16997 17761 gene locus_tag LOCUS_26410 16997 17761 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_26410 18989 17919 gene locus_tag LOCUS_26420 18989 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 19567 19070 gene locus_tag LOCUS_26430 19567 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 21438 19633 gene locus_tag LOCUS_26440 21438 19633 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704425.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence081 143 484 gene locus_tag LOCUS_26450 143 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 592 1290 gene locus_tag LOCUS_26460 gene narI 592 1290 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 protein_id gnl|my_center|LOCUS_26460 1435 1623 gene locus_tag LOCUS_26470 1435 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2470 1778 gene locus_tag LOCUS_26480 2470 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26480 3198 2467 gene locus_tag LOCUS_26490 3198 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26490 3306 3455 gene locus_tag LOCUS_26500 3306 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4442 3798 gene locus_tag LOCUS_26510 gene senC 4442 3798 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 protein_id gnl|my_center|LOCUS_26510 4929 5198 gene locus_tag LOCUS_26520 4929 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5998 5219 gene locus_tag LOCUS_26530 5998 5219 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729052.1 protein_id gnl|my_center|LOCUS_26530 6802 6002 gene locus_tag LOCUS_26540 6802 6002 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731410.1 protein_id gnl|my_center|LOCUS_26540 6971 8149 gene locus_tag LOCUS_26550 6971 8149 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_26550 8134 9360 gene locus_tag LOCUS_26560 8134 9360 CDS product putative L-carnitine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705374.1 protein_id gnl|my_center|LOCUS_26560 10019 9381 gene locus_tag LOCUS_26570 gene pdxH 10019 9381 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI46 protein_id gnl|my_center|LOCUS_26570 10150 10776 gene locus_tag LOCUS_26580 10150 10776 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142599.1 protein_id gnl|my_center|LOCUS_26580 11759 10866 gene locus_tag LOCUS_26590 11759 10866 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147018.1 protein_id gnl|my_center|LOCUS_26590 11975 12463 gene locus_tag LOCUS_26600 11975 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 13481 12525 gene locus_tag LOCUS_26610 13481 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 14226 13501 gene locus_tag LOCUS_26620 14226 13501 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941217.1 protein_id gnl|my_center|LOCUS_26620 14625 16544 gene locus_tag LOCUS_26630 14625 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_26630 17789 16713 gene locus_tag LOCUS_26640 17789 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 18503 21082 gene locus_tag LOCUS_26650 18503 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence082 260 970 gene locus_tag LOCUS_26660 gene icc 260 970 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74RP2 protein_id gnl|my_center|LOCUS_26660 1259 1870 gene locus_tag LOCUS_26670 1259 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2480 3868 gene locus_tag LOCUS_26680 2480 3868 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729439.1 protein_id gnl|my_center|LOCUS_26680 3942 5087 gene locus_tag LOCUS_26690 3942 5087 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_26690 5088 5639 gene locus_tag LOCUS_26700 5088 5639 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_26700 5636 6988 gene locus_tag LOCUS_26710 5636 6988 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_26710 7194 7526 gene locus_tag LOCUS_26720 7194 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 7581 8543 gene locus_tag LOCUS_26730 7581 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 9054 8674 gene locus_tag LOCUS_26740 9054 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 10486 9272 gene locus_tag LOCUS_26750 10486 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 11639 11412 gene locus_tag LOCUS_26760 11639 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 11577 11762 gene locus_tag LOCUS_26770 11577 11762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 12203 11781 gene locus_tag LOCUS_26780 12203 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 12466 13125 gene locus_tag LOCUS_26790 12466 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 13186 13326 gene locus_tag LOCUS_26800 13186 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 14408 15766 gene locus_tag LOCUS_26810 14408 15766 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_26810 16996 15917 gene locus_tag LOCUS_26820 16996 15917 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_26820 17402 17082 gene locus_tag LOCUS_26830 17402 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 19547 17529 gene locus_tag LOCUS_26840 19547 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 21936 19540 gene locus_tag LOCUS_26850 21936 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence083 382 17 gene locus_tag LOCUS_26860 382 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2568 418 gene locus_tag LOCUS_26870 2568 418 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_26870 2788 3750 gene locus_tag LOCUS_26880 gene hemB 2788 3750 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_26880 3850 4173 gene locus_tag LOCUS_26890 gene trxA 3850 4173 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_26890 4427 5686 gene locus_tag LOCUS_26900 gene rho 4427 5686 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_26900 5856 7124 gene locus_tag LOCUS_26910 gene rho 5856 7124 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_26910 7153 8619 gene locus_tag LOCUS_26920 gene ubiD 7153 8619 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 protein_id gnl|my_center|LOCUS_26920 9908 8658 gene locus_tag LOCUS_26930 gene hemY 9908 8658 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_26930 11161 10055 gene locus_tag LOCUS_26940 11161 10055 CDS product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 protein_id gnl|my_center|LOCUS_26940 12042 11269 gene locus_tag LOCUS_26950 gene hemD 12042 11269 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_26950 12998 12042 gene locus_tag LOCUS_26960 gene hemC 12998 12042 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPS4 protein_id gnl|my_center|LOCUS_26960 13881 13138 gene locus_tag LOCUS_26970 gene algR 13881 13138 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_26970 15152 14058 gene locus_tag LOCUS_26980 gene algZ 15152 14058 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_26980 15371 16768 gene locus_tag LOCUS_26990 gene argH 15371 16768 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 protein_id gnl|my_center|LOCUS_26990 17132 18379 gene locus_tag LOCUS_27000 gene lysA 17132 18379 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 protein_id gnl|my_center|LOCUS_27000 18466 19314 gene locus_tag LOCUS_27010 gene dapF 18466 19314 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_27010 19311 20024 gene locus_tag LOCUS_27020 19311 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_27020 20038 20982 gene locus_tag LOCUS_27030 gene xerC 20038 20982 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_27030 20988 21683 gene locus_tag LOCUS_27040 20988 21683 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence084 991 347 gene locus_tag LOCUS_27050 991 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2345 1206 gene locus_tag LOCUS_27060 2345 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3471 2467 gene locus_tag LOCUS_27070 3471 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3631 3449 gene locus_tag LOCUS_27080 3631 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 4695 3625 gene locus_tag LOCUS_27090 4695 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 5268 4717 gene locus_tag LOCUS_27100 5268 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 5691 5416 gene locus_tag LOCUS_27110 5691 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947967.1 protein_id gnl|my_center|LOCUS_27110 6467 5754 gene locus_tag LOCUS_27120 6467 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 6562 7407 gene locus_tag LOCUS_27130 6562 7407 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_27130 9181 7511 gene locus_tag LOCUS_27140 9181 7511 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_27140 9543 11339 gene locus_tag LOCUS_27150 gene pckG 9543 11339 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93JL5 protein_id gnl|my_center|LOCUS_27150 11739 11488 gene locus_tag LOCUS_27160 11739 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 12052 11732 gene locus_tag LOCUS_27170 12052 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27170 12199 12062 gene locus_tag LOCUS_27180 12199 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 12486 13454 gene locus_tag LOCUS_27190 gene yugC 12486 13454 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_27190 15215 13686 gene locus_tag LOCUS_27200 gene comM 15215 13686 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_27200 15639 16298 gene locus_tag LOCUS_27210 15639 16298 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_27210 16359 16697 gene locus_tag LOCUS_27220 gene glnK 16359 16697 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_27220 17033 18421 gene locus_tag LOCUS_27230 gene thrC 17033 18421 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_27230 18607 21279 gene locus_tag LOCUS_27240 18607 21279 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence085 62 1066 gene locus_tag LOCUS_27250 62 1066 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_27250 2291 1152 gene locus_tag LOCUS_27260 2291 1152 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_27260 3058 2648 gene locus_tag LOCUS_27270 3058 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3127 3927 gene locus_tag LOCUS_27280 3127 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 5040 3958 gene locus_tag LOCUS_27290 5040 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_27290 5683 5159 gene locus_tag LOCUS_27300 gene ppiB 5683 5159 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_27300 5896 7377 gene locus_tag LOCUS_27310 gene lpdG 5896 7377 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_27310 7421 8590 gene locus_tag LOCUS_27320 gene sucC 7421 8590 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_27320 8587 9459 gene locus_tag LOCUS_27330 gene sucD 8587 9459 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN7 protein_id gnl|my_center|LOCUS_27330 9569 11491 gene locus_tag LOCUS_27340 gene htpG 9569 11491 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_27340 13647 11488 gene locus_tag LOCUS_27350 13647 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_27350 13937 15136 gene locus_tag LOCUS_27360 13937 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 15690 15151 gene locus_tag LOCUS_27370 gene folE2 15690 15151 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_27370 15959 17011 gene locus_tag LOCUS_27380 gene aroC 15959 17011 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM9 protein_id gnl|my_center|LOCUS_27380 17836 17222 gene locus_tag LOCUS_27390 gene thrH 17836 17222 CDS product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 protein_id gnl|my_center|LOCUS_27390 18139 18846 gene locus_tag LOCUS_27400 gene cysH 18139 18846 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_27400 18866 19198 gene locus_tag LOCUS_27410 18866 19198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087777.1 protein_id gnl|my_center|LOCUS_27410 20197 19223 gene locus_tag LOCUS_27420 gene cysB 20197 19223 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_27420 20372 21154 gene locus_tag LOCUS_27430 20372 21154 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNM0 protein_id gnl|my_center|LOCUS_27430 >Feature sequence086 7 387 gene locus_tag LOCUS_27440 7 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 642 469 gene locus_tag LOCUS_27450 642 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1051 752 gene locus_tag LOCUS_27460 1051 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1226 1008 gene locus_tag LOCUS_27470 1226 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1576 1307 gene locus_tag LOCUS_27480 1576 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1707 1522 gene locus_tag LOCUS_27490 1707 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1963 1823 gene locus_tag LOCUS_27500 1963 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2088 2321 gene locus_tag LOCUS_27510 2088 2321 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 protein_id gnl|my_center|LOCUS_27510 2321 2719 gene locus_tag LOCUS_27520 gene vapC 2321 2719 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JND5 protein_id gnl|my_center|LOCUS_27520 4131 2911 gene locus_tag LOCUS_27530 4131 2911 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_27530 4353 4565 gene locus_tag LOCUS_27540 4353 4565 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_27540 5668 7731 gene locus_tag LOCUS_27550 5668 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 7813 8247 gene locus_tag LOCUS_27560 7813 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 8290 8673 gene locus_tag LOCUS_27570 8290 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 8770 9003 gene locus_tag LOCUS_27580 gene vagC 8770 9003 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_27580 9003 9437 gene locus_tag LOCUS_27590 9003 9437 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817440.1 protein_id gnl|my_center|LOCUS_27590 9505 11481 gene locus_tag LOCUS_27600 9505 11481 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211122.1 protein_id gnl|my_center|LOCUS_27600 11520 13451 gene locus_tag LOCUS_27610 11520 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105914.1 protein_id gnl|my_center|LOCUS_27610 14201 13443 gene locus_tag LOCUS_27620 14201 13443 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_27620 14455 15222 gene locus_tag LOCUS_27630 14455 15222 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_27630 15405 16355 gene locus_tag LOCUS_27640 15405 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 16553 17302 gene locus_tag LOCUS_27650 16553 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_27650 19347 17914 gene locus_tag LOCUS_27660 gene gatB 19347 17914 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 protein_id gnl|my_center|LOCUS_27660 20839 19385 gene locus_tag LOCUS_27670 gene gatA 20839 19385 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 protein_id gnl|my_center|LOCUS_27670 >Feature sequence087 483 800 gene locus_tag LOCUS_27680 483 800 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_27680 2114 891 gene locus_tag LOCUS_27690 gene nrgC 2114 891 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084859.1 protein_id gnl|my_center|LOCUS_27690 2657 2223 gene locus_tag LOCUS_27700 2657 2223 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_27700 3642 2755 gene locus_tag LOCUS_27710 3642 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 4702 3890 gene locus_tag LOCUS_27720 4702 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_27720 5154 4816 gene locus_tag LOCUS_27730 5154 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 5268 5489 gene locus_tag LOCUS_27740 5268 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5499 6056 gene locus_tag LOCUS_27750 5499 6056 CDS product ECF-family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039400.1 protein_id gnl|my_center|LOCUS_27750 6053 6463 gene locus_tag LOCUS_27760 6053 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 7173 6541 gene locus_tag LOCUS_27770 7173 6541 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417881.1 protein_id gnl|my_center|LOCUS_27770 7530 7210 gene locus_tag LOCUS_27780 7530 7210 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KKZ9 protein_id gnl|my_center|LOCUS_27780 7662 7985 gene locus_tag LOCUS_27790 7662 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 8168 8815 gene locus_tag LOCUS_27800 gene pcm 8168 8815 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JD2 protein_id gnl|my_center|LOCUS_27800 9744 9124 gene locus_tag LOCUS_27810 9744 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 12062 9885 gene locus_tag LOCUS_27820 12062 9885 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_27820 12528 12055 gene locus_tag LOCUS_27830 12528 12055 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_27830 12998 12591 gene locus_tag LOCUS_27840 12998 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 13334 15454 gene locus_tag LOCUS_27850 13334 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_27850 15536 16957 gene locus_tag LOCUS_27860 15536 16957 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_27860 17841 17026 gene locus_tag LOCUS_27870 17841 17026 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_27870 18117 18815 gene locus_tag LOCUS_27880 18117 18815 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_27880 18828 20246 gene locus_tag LOCUS_27890 18828 20246 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence088 425 1213 gene locus_tag LOCUS_27900 425 1213 CDS product TIGR03084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029616.1 protein_id gnl|my_center|LOCUS_27900 1260 2453 gene locus_tag LOCUS_27910 1260 2453 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402774.1 protein_id gnl|my_center|LOCUS_27910 2614 2805 gene locus_tag LOCUS_27920 2614 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2809 3132 gene locus_tag LOCUS_27930 2809 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4155 3436 gene locus_tag LOCUS_27940 4155 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 5435 4230 gene locus_tag LOCUS_27950 5435 4230 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089997.1 protein_id gnl|my_center|LOCUS_27950 8038 5600 gene locus_tag LOCUS_27960 8038 5600 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_27960 9048 8128 gene locus_tag LOCUS_27970 gene bdhA 9048 8128 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34788 protein_id gnl|my_center|LOCUS_27970 9560 9135 gene locus_tag LOCUS_27980 9560 9135 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088081.1 protein_id gnl|my_center|LOCUS_27980 10792 9662 gene locus_tag LOCUS_27990 10792 9662 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085721.1 protein_id gnl|my_center|LOCUS_27990 10999 12540 gene locus_tag LOCUS_28000 10999 12540 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_28000 12579 14135 gene locus_tag LOCUS_28010 12579 14135 CDS product propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228470.1 protein_id gnl|my_center|LOCUS_28010 14271 15164 gene locus_tag LOCUS_28020 14271 15164 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_28020 16141 15242 gene locus_tag LOCUS_28030 16141 15242 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266773.1 protein_id gnl|my_center|LOCUS_28030 16724 16245 gene locus_tag LOCUS_28040 16724 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085505.1 protein_id gnl|my_center|LOCUS_28040 17704 16853 gene locus_tag LOCUS_28050 17704 16853 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_28050 18020 18241 gene locus_tag LOCUS_28060 18020 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 18533 20218 gene locus_tag LOCUS_28070 18533 20218 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence089 1195 800 gene locus_tag LOCUS_28080 1195 800 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531287.1 protein_id gnl|my_center|LOCUS_28080 1690 1226 gene locus_tag LOCUS_28090 1690 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 2067 1705 gene locus_tag LOCUS_28100 2067 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3249 2119 gene locus_tag LOCUS_28110 3249 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 4106 3282 gene locus_tag LOCUS_28120 4106 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 4472 6106 gene locus_tag LOCUS_28130 4472 6106 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_28130 6602 6162 gene locus_tag LOCUS_28140 6602 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 9520 6794 gene locus_tag LOCUS_28150 9520 6794 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860863.1 protein_id gnl|my_center|LOCUS_28150 11589 9577 gene locus_tag LOCUS_28160 11589 9577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_28160 13540 11582 gene locus_tag LOCUS_28170 13540 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 16522 13631 gene locus_tag LOCUS_28180 16522 13631 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919676.1 protein_id gnl|my_center|LOCUS_28180 17167 18393 gene locus_tag LOCUS_28190 17167 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_28190 19137 18463 gene locus_tag LOCUS_28200 19137 18463 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_28200 19957 19439 gene locus_tag LOCUS_28210 19957 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence090 179 337 gene locus_tag LOCUS_28220 179 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1811 354 gene locus_tag LOCUS_28230 1811 354 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_28230 2314 1853 gene locus_tag LOCUS_28240 2314 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2814 3641 gene locus_tag LOCUS_28250 2814 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083538.1 protein_id gnl|my_center|LOCUS_28250 5186 3681 gene locus_tag LOCUS_28260 gene yidJ 5186 3681 CDS product putative sulfatase YidJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31447 protein_id gnl|my_center|LOCUS_28260 5401 7032 gene locus_tag LOCUS_28270 5401 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 7171 7995 gene locus_tag LOCUS_28280 7171 7995 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_28280 8139 8570 gene locus_tag LOCUS_28290 8139 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 9977 8769 gene locus_tag LOCUS_28300 9977 8769 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_28300 11103 10102 gene locus_tag LOCUS_28310 11103 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_28310 11292 11831 gene locus_tag LOCUS_28320 11292 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867695.1 protein_id gnl|my_center|LOCUS_28320 12152 12532 gene locus_tag LOCUS_28330 12152 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 protein_id gnl|my_center|LOCUS_28330 12628 13107 gene locus_tag LOCUS_28340 12628 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 14722 13163 gene locus_tag LOCUS_28350 14722 13163 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_28350 14969 15154 gene locus_tag LOCUS_28360 14969 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 15195 18074 gene locus_tag LOCUS_28370 15195 18074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 18307 19485 gene locus_tag LOCUS_28380 18307 19485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence091 759 1805 gene locus_tag LOCUS_28390 759 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1857 2981 gene locus_tag LOCUS_28400 1857 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3755 2991 gene locus_tag LOCUS_28410 gene fabG 3755 2991 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_28410 3997 4899 gene locus_tag LOCUS_28420 3997 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_28420 6603 4906 gene locus_tag LOCUS_28430 6603 4906 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_28430 7171 6707 gene locus_tag LOCUS_28440 7171 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 8152 7262 gene locus_tag LOCUS_28450 8152 7262 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_28450 8270 8446 gene locus_tag LOCUS_28460 8270 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 8513 8746 gene locus_tag LOCUS_28470 8513 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 8733 8990 gene locus_tag LOCUS_28480 8733 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 10040 9030 gene locus_tag LOCUS_28490 10040 9030 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_28490 11840 10386 gene locus_tag LOCUS_28500 11840 10386 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706287.1 protein_id gnl|my_center|LOCUS_28500 11985 13076 gene locus_tag LOCUS_28510 11985 13076 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_28510 13433 13873 gene locus_tag LOCUS_28520 13433 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 13873 14304 gene locus_tag LOCUS_28530 13873 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 14481 15392 gene locus_tag LOCUS_28540 14481 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030440.1 protein_id gnl|my_center|LOCUS_28540 15465 17378 gene locus_tag LOCUS_28550 15465 17378 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_28550 17555 18718 gene locus_tag LOCUS_28560 17555 18718 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_28560 20045 18798 gene locus_tag LOCUS_28570 20045 18798 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence092 268 1290 gene locus_tag LOCUS_28580 gene gpsA 268 1290 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_28580 1499 2035 gene locus_tag LOCUS_28590 1499 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2840 2055 gene locus_tag LOCUS_28600 2840 2055 CDS product TIGR03084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726856.1 protein_id gnl|my_center|LOCUS_28600 3043 3678 gene locus_tag LOCUS_28610 3043 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28610 3729 4985 gene locus_tag LOCUS_28620 3729 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28620 8132 5019 gene locus_tag LOCUS_28630 8132 5019 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_28630 9343 8168 gene locus_tag LOCUS_28640 9343 8168 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_28640 10767 9475 gene locus_tag LOCUS_28650 gene purD 10767 9475 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E256 protein_id gnl|my_center|LOCUS_28650 12482 10902 gene locus_tag LOCUS_28660 gene purH 12482 10902 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAR3 protein_id gnl|my_center|LOCUS_28660 12939 12628 gene locus_tag LOCUS_28670 12939 12628 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_28670 13925 12936 gene locus_tag LOCUS_28680 gene dusB 13925 12936 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS1 protein_id gnl|my_center|LOCUS_28680 15472 14123 gene locus_tag LOCUS_28690 15472 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 16539 15589 gene locus_tag LOCUS_28700 gene prmA 16539 15589 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_28700 18027 16711 gene locus_tag LOCUS_28710 gene accC 18027 16711 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_28710 18590 18108 gene locus_tag LOCUS_28720 18590 18108 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269006.1 protein_id gnl|my_center|LOCUS_28720 19033 18587 gene locus_tag LOCUS_28730 gene aroQ1 19033 18587 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_28730 19347 19673 gene locus_tag LOCUS_28740 gene fer2 19347 19673 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence093 88 1116 gene locus_tag LOCUS_28750 88 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1840 1130 gene locus_tag LOCUS_28760 gene recO 1840 1130 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGF4 protein_id gnl|my_center|LOCUS_28760 2829 1933 gene locus_tag LOCUS_28770 gene era 2829 1933 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG2 protein_id gnl|my_center|LOCUS_28770 3527 2841 gene locus_tag LOCUS_28780 gene rnc 3527 2841 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX9 protein_id gnl|my_center|LOCUS_28780 3902 3528 gene locus_tag LOCUS_28790 3902 3528 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_28790 4740 3916 gene locus_tag LOCUS_28800 gene lepB 4740 3916 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_28800 6629 4830 gene locus_tag LOCUS_28810 gene lepA 6629 4830 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_28810 8149 6746 gene locus_tag LOCUS_28820 gene mucD 8149 6746 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_28820 9491 8466 gene locus_tag LOCUS_28830 9491 8466 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_28830 10071 9463 gene locus_tag LOCUS_28840 10071 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 10728 10150 gene locus_tag LOCUS_28850 gene algU 10728 10150 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_28850 11001 12611 gene locus_tag LOCUS_28860 gene nadB 11001 12611 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_28860 13293 12847 gene locus_tag LOCUS_28870 13293 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 13552 13295 gene locus_tag LOCUS_28880 13552 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G9 protein_id gnl|my_center|LOCUS_28880 13666 14589 gene locus_tag LOCUS_28890 13666 14589 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF0 protein_id gnl|my_center|LOCUS_28890 16130 14625 gene locus_tag LOCUS_28900 16130 14625 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_28900 16906 16199 gene locus_tag LOCUS_28910 gene ung 16906 16199 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDC0 protein_id gnl|my_center|LOCUS_28910 18432 16921 gene locus_tag LOCUS_28920 gene lysS 18432 16921 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A8N3 protein_id gnl|my_center|LOCUS_28920 19367 18489 gene locus_tag LOCUS_28930 gene prfB 19367 18489 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_28930 >Feature sequence094 2594 63 gene locus_tag LOCUS_28940 2594 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2833 3903 gene locus_tag LOCUS_28950 2833 3903 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_28950 4177 5118 gene locus_tag LOCUS_28960 4177 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 5144 6028 gene locus_tag LOCUS_28970 5144 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 6673 6035 gene locus_tag LOCUS_28980 6673 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7519 6929 gene locus_tag LOCUS_28990 7519 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 8255 9823 gene locus_tag LOCUS_29000 8255 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 9857 11284 gene locus_tag LOCUS_29010 9857 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 11397 12587 gene locus_tag LOCUS_29020 gene gldA 11397 12587 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_312901.2 protein_id gnl|my_center|LOCUS_29020 13437 12598 gene locus_tag LOCUS_29030 13437 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29030 14884 13967 gene locus_tag LOCUS_29040 14884 13967 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704587.1 protein_id gnl|my_center|LOCUS_29040 15436 16206 gene locus_tag LOCUS_29050 gene fadB 15436 16206 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_29050 17364 16288 gene locus_tag LOCUS_29060 17364 16288 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_29060 17717 17514 gene locus_tag LOCUS_29070 17717 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 18562 17777 gene locus_tag LOCUS_29080 gene rhmA 18562 17777 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N5L0 protein_id gnl|my_center|LOCUS_29080 18767 19531 gene locus_tag LOCUS_29090 18767 19531 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088190.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence095 1375 281 gene locus_tag LOCUS_29100 1375 281 CDS product phosphate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868516.1 protein_id gnl|my_center|LOCUS_29100 1859 1515 gene locus_tag LOCUS_29110 1859 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 2126 3370 gene locus_tag LOCUS_29120 2126 3370 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_29120 4552 3794 gene locus_tag LOCUS_29130 gene anr 4552 3794 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_29130 5655 4708 gene locus_tag LOCUS_29140 5655 4708 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 protein_id gnl|my_center|LOCUS_29140 7306 5924 gene locus_tag LOCUS_29150 gene hemN 7306 5924 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_29150 8236 7553 gene locus_tag LOCUS_29160 gene dnr 8236 7553 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_29160 9614 8379 gene locus_tag LOCUS_29170 9614 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 protein_id gnl|my_center|LOCUS_29170 11173 9737 gene locus_tag LOCUS_29180 11173 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29180 11835 11140 gene locus_tag LOCUS_29190 11835 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29190 12152 12310 gene locus_tag LOCUS_29200 12152 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 12352 12897 gene locus_tag LOCUS_29210 12352 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 12908 14605 gene locus_tag LOCUS_29220 gene coxA2 12908 14605 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 protein_id gnl|my_center|LOCUS_29220 14732 15532 gene locus_tag LOCUS_29230 14732 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 15542 17146 gene locus_tag LOCUS_29240 15542 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 17136 17702 gene locus_tag LOCUS_29250 17136 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 17944 17762 gene locus_tag LOCUS_29260 17944 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 18022 19077 gene locus_tag LOCUS_29270 gene ctaA 18022 19077 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_29270 19500 19099 gene locus_tag LOCUS_29280 19500 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence096 3238 2024 gene locus_tag LOCUS_29290 3238 2024 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402542.1 protein_id gnl|my_center|LOCUS_29290 5758 3242 gene locus_tag LOCUS_29300 5758 3242 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_29300 6464 5766 gene locus_tag LOCUS_29310 6464 5766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_29310 6590 7333 gene locus_tag LOCUS_29320 6590 7333 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_29320 7903 7349 gene locus_tag LOCUS_29330 7903 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29330 8560 7937 gene locus_tag LOCUS_29340 8560 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29340 8708 8941 gene locus_tag LOCUS_29350 8708 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 9797 9045 gene locus_tag LOCUS_29360 9797 9045 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_29360 10173 10475 gene locus_tag LOCUS_29370 10173 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 13921 10499 gene locus_tag LOCUS_29380 13921 10499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528208.1 protein_id gnl|my_center|LOCUS_29380 14110 14496 gene locus_tag LOCUS_29390 14110 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 14489 15175 gene locus_tag LOCUS_29400 14489 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 15334 15876 gene locus_tag LOCUS_29410 15334 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 15895 16128 gene locus_tag LOCUS_29420 15895 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 19334 16212 gene locus_tag LOCUS_29430 19334 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence097 108 296 gene locus_tag LOCUS_29440 108 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 359 1381 gene locus_tag LOCUS_29450 359 1381 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462165.1 protein_id gnl|my_center|LOCUS_29450 1411 3018 gene locus_tag LOCUS_29460 1411 3018 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_29460 5944 3023 gene locus_tag LOCUS_29470 5944 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 6125 7813 gene locus_tag LOCUS_29480 6125 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 7836 8381 gene locus_tag LOCUS_29490 7836 8381 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907641.1 protein_id gnl|my_center|LOCUS_29490 8471 9805 gene locus_tag LOCUS_29500 8471 9805 CDS product MATE efflux family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_29500 9956 10108 gene locus_tag LOCUS_29510 9956 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 10148 13075 gene locus_tag LOCUS_29520 10148 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 13177 15282 gene locus_tag LOCUS_29530 13177 15282 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_29530 15975 15397 gene locus_tag LOCUS_29540 15975 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 16196 17053 gene locus_tag LOCUS_29550 16196 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 17416 18909 gene locus_tag LOCUS_29560 17416 18909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence098 253 1050 gene locus_tag LOCUS_29570 gene kduD 253 1050 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_29570 1056 2687 gene locus_tag LOCUS_29580 1056 2687 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_29580 2697 3170 gene locus_tag LOCUS_29590 2697 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085505.1 protein_id gnl|my_center|LOCUS_29590 4487 3171 gene locus_tag LOCUS_29600 4487 3171 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104448.1 protein_id gnl|my_center|LOCUS_29600 5718 4717 gene locus_tag LOCUS_29610 5718 4717 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_29610 7055 5838 gene locus_tag LOCUS_29620 7055 5838 CDS product UPF0256 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0X4 protein_id gnl|my_center|LOCUS_29620 9940 7148 gene locus_tag LOCUS_29630 9940 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 10753 9974 gene locus_tag LOCUS_29640 10753 9974 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 protein_id gnl|my_center|LOCUS_29640 11011 13011 gene locus_tag LOCUS_29650 11011 13011 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109778.1 protein_id gnl|my_center|LOCUS_29650 13008 13484 gene locus_tag LOCUS_29660 13008 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13578 13964 gene locus_tag LOCUS_29670 13578 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_29670 14338 14087 gene locus_tag LOCUS_29680 14338 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 14222 14449 gene locus_tag LOCUS_29690 14222 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 14495 15955 gene locus_tag LOCUS_29700 14495 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 16028 16597 gene locus_tag LOCUS_29710 16028 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_29710 16716 17483 gene locus_tag LOCUS_29720 16716 17483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 17490 18497 gene locus_tag LOCUS_29730 17490 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 18712 19308 gene locus_tag LOCUS_29740 18712 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence099 74 253 gene locus_tag LOCUS_29750 74 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1364 579 gene locus_tag LOCUS_29760 1364 579 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729575.1 protein_id gnl|my_center|LOCUS_29760 2426 1425 gene locus_tag LOCUS_29770 2426 1425 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_29770 2826 2440 gene locus_tag LOCUS_29780 2826 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3350 3000 gene locus_tag LOCUS_29790 3350 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082872.1 protein_id gnl|my_center|LOCUS_29790 3632 3351 gene locus_tag LOCUS_29800 3632 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 3839 4240 gene locus_tag LOCUS_29810 3839 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 4738 4301 gene locus_tag LOCUS_29820 4738 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 5568 4813 gene locus_tag LOCUS_29830 5568 4813 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_29830 6429 5713 gene locus_tag LOCUS_29840 6429 5713 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 protein_id gnl|my_center|LOCUS_29840 7190 6531 gene locus_tag LOCUS_29850 7190 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_29850 7600 9774 gene locus_tag LOCUS_29860 7600 9774 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459738.1 protein_id gnl|my_center|LOCUS_29860 9830 10069 gene locus_tag LOCUS_29870 9830 10069 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_29870 10630 10154 gene locus_tag LOCUS_29880 10630 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085505.1 protein_id gnl|my_center|LOCUS_29880 12274 10670 gene locus_tag LOCUS_29890 12274 10670 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_29890 13327 12521 gene locus_tag LOCUS_29900 13327 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 13947 15059 gene locus_tag LOCUS_29910 13947 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 15056 16111 gene locus_tag LOCUS_29920 15056 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 16104 17048 gene locus_tag LOCUS_29930 16104 17048 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053645.1 protein_id gnl|my_center|LOCUS_29930 18382 17276 gene locus_tag LOCUS_29940 18382 17276 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314820.1 protein_id gnl|my_center|LOCUS_29940 19102 18389 gene locus_tag LOCUS_29950 19102 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence100 1257 271 gene locus_tag LOCUS_29960 1257 271 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197990.1 protein_id gnl|my_center|LOCUS_29960 1606 1412 gene locus_tag LOCUS_29970 1606 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1503 2669 gene locus_tag LOCUS_29980 1503 2669 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 protein_id gnl|my_center|LOCUS_29980 2960 4609 gene locus_tag LOCUS_29990 2960 4609 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_29990 4725 6500 gene locus_tag LOCUS_30000 4725 6500 CDS product NAD+ synthase (glutamine-hydrolysing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_30000 6740 7063 gene locus_tag LOCUS_30010 gene dksA 6740 7063 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338037.1 protein_id gnl|my_center|LOCUS_30010 7125 8030 gene locus_tag LOCUS_30020 7125 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_30020 8093 8539 gene locus_tag LOCUS_30030 8093 8539 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWZ8 protein_id gnl|my_center|LOCUS_30030 9208 8819 gene locus_tag LOCUS_30040 9208 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 10248 9199 gene locus_tag LOCUS_30050 10248 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 10332 11468 gene locus_tag LOCUS_30060 10332 11468 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_30060 11528 12808 gene locus_tag LOCUS_30070 gene pfp 11528 12808 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C58 protein_id gnl|my_center|LOCUS_30070 14842 12809 gene locus_tag LOCUS_30080 gene hppA 14842 12809 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5M6 protein_id gnl|my_center|LOCUS_30080 16180 15140 gene locus_tag LOCUS_30090 16180 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_30090 16927 16367 gene locus_tag LOCUS_30100 16927 16367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 17256 19154 gene locus_tag LOCUS_30110 gene dsbD 17256 19154 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS7 protein_id gnl|my_center|LOCUS_30110 >Feature sequence101 995 1681 gene locus_tag LOCUS_30120 995 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1760 1942 gene locus_tag LOCUS_30130 1760 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 2760 2113 gene locus_tag LOCUS_30140 2760 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2707 3132 gene locus_tag LOCUS_30150 2707 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3790 4356 gene locus_tag LOCUS_30160 3790 4356 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_30160 5050 4418 gene locus_tag LOCUS_30170 5050 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 6051 5263 gene locus_tag LOCUS_30180 6051 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30180 6262 7617 gene locus_tag LOCUS_30190 6262 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 7741 8409 gene locus_tag LOCUS_30200 7741 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_30200 8550 9254 gene locus_tag LOCUS_30210 8550 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 9577 9759 gene locus_tag LOCUS_30220 9577 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 9918 10502 gene locus_tag LOCUS_30230 9918 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 10535 11566 gene locus_tag LOCUS_30240 10535 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 11638 12672 gene locus_tag LOCUS_30250 11638 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 12863 14749 gene locus_tag LOCUS_30260 12863 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 15003 18431 gene locus_tag LOCUS_30270 15003 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 18466 19026 gene locus_tag LOCUS_30280 18466 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence102 1327 1884 gene locus_tag LOCUS_30290 gene pcaC 1327 1884 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KII5 protein_id gnl|my_center|LOCUS_30290 1891 2715 gene locus_tag LOCUS_30300 gene spoU 1891 2715 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969649.1 protein_id gnl|my_center|LOCUS_30300 2820 3941 gene locus_tag LOCUS_30310 2820 3941 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_30310 4070 5713 gene locus_tag LOCUS_30320 4070 5713 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_30320 8336 5742 gene locus_tag LOCUS_30330 8336 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 9677 8460 gene locus_tag LOCUS_30340 9677 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 10759 9704 gene locus_tag LOCUS_30350 10759 9704 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709137.1 protein_id gnl|my_center|LOCUS_30350 11983 10772 gene locus_tag LOCUS_30360 11983 10772 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063669.1 protein_id gnl|my_center|LOCUS_30360 12485 12024 gene locus_tag LOCUS_30370 12485 12024 CDS product molybdenum cofactor biosynthesis protein MoeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_30370 13004 12489 gene locus_tag LOCUS_30380 13004 12489 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978007.1 protein_id gnl|my_center|LOCUS_30380 13232 13005 gene locus_tag LOCUS_30390 13232 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 14680 13343 gene locus_tag LOCUS_30400 14680 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065354.1 protein_id gnl|my_center|LOCUS_30400 14980 15621 gene locus_tag LOCUS_30410 14980 15621 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_30410 15668 16333 gene locus_tag LOCUS_30420 15668 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 17276 16389 gene locus_tag LOCUS_30430 17276 16389 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_30430 17754 17458 gene locus_tag LOCUS_30440 17754 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 17945 18889 gene locus_tag LOCUS_30450 17945 18889 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence103 945 283 gene locus_tag LOCUS_30460 945 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 2217 1168 gene locus_tag LOCUS_30470 gene mraY 2217 1168 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_30470 3098 2280 gene locus_tag LOCUS_30480 3098 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4673 3168 gene locus_tag LOCUS_30490 4673 3168 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_30490 5111 6343 gene locus_tag LOCUS_30500 5111 6343 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_30500 6340 7032 gene locus_tag LOCUS_30510 6340 7032 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848573.1 protein_id gnl|my_center|LOCUS_30510 8209 7025 gene locus_tag LOCUS_30520 8209 7025 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_30520 9162 8293 gene locus_tag LOCUS_30530 9162 8293 CDS product 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706479.1 protein_id gnl|my_center|LOCUS_30530 9280 10446 gene locus_tag LOCUS_30540 9280 10446 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_30540 10701 12605 gene locus_tag LOCUS_30550 10701 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 12615 13226 gene locus_tag LOCUS_30560 12615 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 13290 14021 gene locus_tag LOCUS_30570 13290 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30570 14030 14206 gene locus_tag LOCUS_30580 14030 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30580 15394 14303 gene locus_tag LOCUS_30590 gene selU 15394 14303 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I382 protein_id gnl|my_center|LOCUS_30590 16794 15427 gene locus_tag LOCUS_30600 16794 15427 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037630.1 protein_id gnl|my_center|LOCUS_30600 16901 18031 gene locus_tag LOCUS_30610 16901 18031 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709596.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence104 214 1896 gene locus_tag LOCUS_30620 214 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 11132 2049 gene locus_tag LOCUS_30630 11132 2049 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026868.1 protein_id gnl|my_center|LOCUS_30630 17885 11178 gene locus_tag LOCUS_30640 17885 11178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence105 172 441 gene locus_tag LOCUS_30650 172 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1090 536 gene locus_tag LOCUS_30660 1090 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2291 1470 gene locus_tag LOCUS_30670 2291 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3411 2305 gene locus_tag LOCUS_30680 3411 2305 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731526.1 protein_id gnl|my_center|LOCUS_30680 4631 3408 gene locus_tag LOCUS_30690 4631 3408 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_30690 5789 4665 gene locus_tag LOCUS_30700 5789 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_30700 6717 5845 gene locus_tag LOCUS_30710 gene fdhD 6717 5845 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKQ9 protein_id gnl|my_center|LOCUS_30710 7656 6877 gene locus_tag LOCUS_30720 7656 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 7916 8350 gene locus_tag LOCUS_30730 7916 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880563.1 protein_id gnl|my_center|LOCUS_30730 8414 9721 gene locus_tag LOCUS_30740 8414 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_30740 10353 9763 gene locus_tag LOCUS_30750 10353 9763 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_30750 13201 10427 gene locus_tag LOCUS_30760 13201 10427 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_30760 14936 13194 gene locus_tag LOCUS_30770 14936 13194 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_30770 15936 17762 gene locus_tag LOCUS_30780 15936 17762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262221.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence106 605 96 gene locus_tag LOCUS_30790 605 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_30790 921 3164 gene locus_tag LOCUS_30800 921 3164 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104749.1 protein_id gnl|my_center|LOCUS_30800 3428 4225 gene locus_tag LOCUS_30810 3428 4225 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730661.1 protein_id gnl|my_center|LOCUS_30810 4236 5348 gene locus_tag LOCUS_30820 gene sdaB 4236 5348 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940681.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30820 5373 5621 gene locus_tag LOCUS_30830 5373 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30830 5742 5948 gene locus_tag LOCUS_30840 5742 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30840 6077 7360 gene locus_tag LOCUS_30850 gene nirS 6077 7360 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30850 7514 8251 gene locus_tag LOCUS_30860 7514 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 8399 8797 gene locus_tag LOCUS_30870 8399 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 8929 9420 gene locus_tag LOCUS_30880 8929 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 9652 10230 gene locus_tag LOCUS_30890 9652 10230 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30890 10230 11504 gene locus_tag LOCUS_30900 10230 11504 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_30900 12048 11554 gene locus_tag LOCUS_30910 gene greB 12048 11554 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DW4 protein_id gnl|my_center|LOCUS_30910 13154 12045 gene locus_tag LOCUS_30920 gene phy 13154 12045 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42094 protein_id gnl|my_center|LOCUS_30920 13645 13178 gene locus_tag LOCUS_30930 gene dgkA 13645 13178 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT9 protein_id gnl|my_center|LOCUS_30930 13817 16393 gene locus_tag LOCUS_30940 gene clpB 13817 16393 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_30940 16437 17084 gene locus_tag LOCUS_30950 16437 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence107 2078 2905 gene locus_tag LOCUS_30960 2078 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3056 3766 gene locus_tag LOCUS_30970 3056 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 5776 4037 gene locus_tag LOCUS_30980 gene aceK 5776 4037 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_30980 6393 6202 gene locus_tag LOCUS_30990 6393 6202 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_30990 6546 7400 gene locus_tag LOCUS_31000 6546 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475472.1 protein_id gnl|my_center|LOCUS_31000 7384 7938 gene locus_tag LOCUS_31010 7384 7938 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUK4 protein_id gnl|my_center|LOCUS_31010 9079 8024 gene locus_tag LOCUS_31020 9079 8024 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_31020 9309 10955 gene locus_tag LOCUS_31030 9309 10955 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_31030 11308 12771 gene locus_tag LOCUS_31040 gene davD 11308 12771 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_31040 12835 13551 gene locus_tag LOCUS_31050 12835 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 14103 13600 gene locus_tag LOCUS_31060 14103 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 14401 14078 gene locus_tag LOCUS_31070 gene arsR 14401 14078 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250563.1 protein_id gnl|my_center|LOCUS_31070 15001 14609 gene locus_tag LOCUS_31080 15001 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 16122 15004 gene locus_tag LOCUS_31090 gene hdc 16122 15004 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRG7 protein_id gnl|my_center|LOCUS_31090 16780 16364 gene locus_tag LOCUS_31100 16780 16364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_31100 16979 17518 gene locus_tag LOCUS_31110 16979 17518 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence108 167 1279 gene locus_tag LOCUS_31120 167 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1745 1371 gene locus_tag LOCUS_31130 1745 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 1746 1985 gene locus_tag LOCUS_31140 1746 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2026 2748 gene locus_tag LOCUS_31150 2026 2748 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479170.1 protein_id gnl|my_center|LOCUS_31150 3884 3144 gene locus_tag LOCUS_31160 3884 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 4632 3958 gene locus_tag LOCUS_31170 4632 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 7155 4741 gene locus_tag LOCUS_31180 7155 4741 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_31180 7352 8167 gene locus_tag LOCUS_31190 7352 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 9014 8274 gene locus_tag LOCUS_31200 9014 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 11424 9073 gene locus_tag LOCUS_31210 11424 9073 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_31210 12074 11763 gene locus_tag LOCUS_31220 12074 11763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 11991 13010 gene locus_tag LOCUS_31230 11991 13010 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865093.1 protein_id gnl|my_center|LOCUS_31230 13199 13990 gene locus_tag LOCUS_31240 13199 13990 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_31240 14251 14787 gene locus_tag LOCUS_31250 14251 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 14924 15730 gene locus_tag LOCUS_31260 14924 15730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31260 15910 16386 gene locus_tag LOCUS_31270 15910 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 16469 16846 gene locus_tag LOCUS_31280 16469 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence109 146 1309 gene locus_tag LOCUS_31290 146 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1584 3041 gene locus_tag LOCUS_31300 1584 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3310 3567 gene locus_tag LOCUS_31310 3310 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 5500 4649 gene locus_tag LOCUS_31320 5500 4649 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_31320 7609 5660 gene locus_tag LOCUS_31330 7609 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 8534 10348 gene locus_tag LOCUS_31340 8534 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 10455 11291 gene locus_tag LOCUS_31350 10455 11291 CDS product CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065052.1 protein_id gnl|my_center|LOCUS_31350 11313 12368 gene locus_tag LOCUS_31360 11313 12368 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_31360 13074 12418 gene locus_tag LOCUS_31370 gene pnuT 13074 12418 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_31370 13330 13067 gene locus_tag LOCUS_31380 13330 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 15485 13356 gene locus_tag LOCUS_31390 15485 13356 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_31390 15524 15682 gene locus_tag LOCUS_31400 15524 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 16686 15769 gene locus_tag LOCUS_31410 16686 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence110 321 908 gene locus_tag LOCUS_31420 321 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 905 1483 gene locus_tag LOCUS_31430 gene lptA 905 1483 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU2 protein_id gnl|my_center|LOCUS_31430 1485 2210 gene locus_tag LOCUS_31440 1485 2210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_31440 2253 3827 gene locus_tag LOCUS_31450 gene rpoN 2253 3827 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_31450 3888 4184 gene locus_tag LOCUS_31460 3888 4184 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_31460 4225 4683 gene locus_tag LOCUS_31470 4225 4683 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_31470 4790 5668 gene locus_tag LOCUS_31480 4790 5668 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_31480 5704 5973 gene locus_tag LOCUS_31490 gene ptsH 5704 5973 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65877 protein_id gnl|my_center|LOCUS_31490 6009 6521 gene locus_tag LOCUS_31500 6009 6521 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 protein_id gnl|my_center|LOCUS_31500 7373 6522 gene locus_tag LOCUS_31510 7373 6522 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_31510 11397 7378 gene locus_tag LOCUS_31520 11397 7378 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_31520 12910 11414 gene locus_tag LOCUS_31530 gene cafA 12910 11414 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_31530 13517 12942 gene locus_tag LOCUS_31540 13517 12942 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 protein_id gnl|my_center|LOCUS_31540 14032 13529 gene locus_tag LOCUS_31550 gene mreD 14032 13529 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_31550 14918 14148 gene locus_tag LOCUS_31560 gene mreC 14918 14148 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 protein_id gnl|my_center|LOCUS_31560 16120 15065 gene locus_tag LOCUS_31570 gene mreB 16120 15065 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_31570 16380 16667 gene locus_tag LOCUS_31580 gene gatC 16380 16667 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_31580 >Feature sequence111 133 993 gene locus_tag LOCUS_31590 133 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2182 1037 gene locus_tag LOCUS_31600 2182 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2975 2289 gene locus_tag LOCUS_31610 2975 2289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_31610 4224 3001 gene locus_tag LOCUS_31620 4224 3001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_31620 5579 4353 gene locus_tag LOCUS_31630 5579 4353 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_31630 6358 5597 gene locus_tag LOCUS_31640 6358 5597 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_31640 6496 7200 gene locus_tag LOCUS_31650 6496 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_31650 8004 7216 gene locus_tag LOCUS_31660 8004 7216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_31660 9368 8073 gene locus_tag LOCUS_31670 gene cysD 9368 8073 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_31670 9808 10044 gene locus_tag LOCUS_31680 9808 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11003 10104 gene locus_tag LOCUS_31690 11003 10104 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142546.1 protein_id gnl|my_center|LOCUS_31690 11117 11770 gene locus_tag LOCUS_31700 11117 11770 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_31700 12551 11826 gene locus_tag LOCUS_31710 12551 11826 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_31710 13175 13798 gene locus_tag LOCUS_31720 13175 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 15025 13820 gene locus_tag LOCUS_31730 gene ybjZ 15025 13820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_31730 16359 15040 gene locus_tag LOCUS_31740 gene ybjZ 16359 15040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_31740 16667 16377 gene locus_tag LOCUS_31750 16667 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 16668 16823 gene locus_tag LOCUS_31760 16668 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence112 1050 118 gene locus_tag LOCUS_31770 1050 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 2381 1143 gene locus_tag LOCUS_31780 2381 1143 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103074.1 protein_id gnl|my_center|LOCUS_31780 2772 3689 gene locus_tag LOCUS_31790 gene rbsK 2772 3689 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI7 protein_id gnl|my_center|LOCUS_31790 4174 4869 gene locus_tag LOCUS_31800 4174 4869 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_31800 4889 7063 gene locus_tag LOCUS_31810 4889 7063 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_31810 7880 7350 gene locus_tag LOCUS_31820 7880 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 7946 8311 gene locus_tag LOCUS_31830 7946 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_31830 8404 9414 gene locus_tag LOCUS_31840 8404 9414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_31840 9417 10793 gene locus_tag LOCUS_31850 gene ahcY 9417 10793 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V73 protein_id gnl|my_center|LOCUS_31850 10880 11353 gene locus_tag LOCUS_31860 10880 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31860 11357 11746 gene locus_tag LOCUS_31870 11357 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31870 12073 13023 gene locus_tag LOCUS_31880 12073 13023 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_31880 13069 14541 gene locus_tag LOCUS_31890 13069 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_31890 14710 15234 gene locus_tag LOCUS_31900 14710 15234 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103465.1 protein_id gnl|my_center|LOCUS_31900 15419 16360 gene locus_tag LOCUS_31910 15419 16360 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972993.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence113 1068 109 gene locus_tag LOCUS_31920 1068 109 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920985.1 protein_id gnl|my_center|LOCUS_31920 2060 1080 gene locus_tag LOCUS_31930 2060 1080 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_31930 2243 3013 gene locus_tag LOCUS_31940 2243 3013 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RI8 protein_id gnl|my_center|LOCUS_31940 3088 3948 gene locus_tag LOCUS_31950 3088 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089645.1 protein_id gnl|my_center|LOCUS_31950 4096 4893 gene locus_tag LOCUS_31960 gene hpcH 4096 4893 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_31960 5969 5043 gene locus_tag LOCUS_31970 5969 5043 CDS product 6'-aminoglycoside N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224475.1 protein_id gnl|my_center|LOCUS_31970 6227 5979 gene locus_tag LOCUS_31980 6227 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 6995 6237 gene locus_tag LOCUS_31990 6995 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_31990 7470 7033 gene locus_tag LOCUS_32000 7470 7033 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 protein_id gnl|my_center|LOCUS_32000 8761 7553 gene locus_tag LOCUS_32010 8761 7553 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933556.1 protein_id gnl|my_center|LOCUS_32010 9639 8950 gene locus_tag LOCUS_32020 9639 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 10421 9822 gene locus_tag LOCUS_32030 10421 9822 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403113.1 protein_id gnl|my_center|LOCUS_32030 10866 10486 gene locus_tag LOCUS_32040 10866 10486 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_32040 11600 10866 gene locus_tag LOCUS_32050 11600 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 12134 11664 gene locus_tag LOCUS_32060 12134 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 12237 12488 gene locus_tag LOCUS_32070 12237 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 13056 12490 gene locus_tag LOCUS_32080 13056 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 13389 13105 gene locus_tag LOCUS_32090 13389 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 13740 13438 gene locus_tag LOCUS_32100 13740 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 14289 13765 gene locus_tag LOCUS_32110 14289 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 14732 14310 gene locus_tag LOCUS_32120 14732 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 15148 14756 gene locus_tag LOCUS_32130 15148 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_32130 15696 15256 gene locus_tag LOCUS_32140 gene ytoQ 15696 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_32140 >Feature sequence114 439 3084 gene locus_tag LOCUS_32150 gene topA 439 3084 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_32150 3725 3129 gene locus_tag LOCUS_32160 gene lexA 3725 3129 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37452 protein_id gnl|my_center|LOCUS_32160 3942 5072 gene locus_tag LOCUS_32170 3942 5072 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_32170 5075 5623 gene locus_tag LOCUS_32180 5075 5623 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_32180 6198 6401 gene locus_tag LOCUS_32190 6198 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 6444 7193 gene locus_tag LOCUS_32200 6444 7193 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_32200 8260 7202 gene locus_tag LOCUS_32210 8260 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 11815 8336 gene locus_tag LOCUS_32220 gene mfd 11815 8336 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_32220 12039 13184 gene locus_tag LOCUS_32230 12039 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 13697 13191 gene locus_tag LOCUS_32240 13697 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 13991 15499 gene locus_tag LOCUS_32250 gene gap-2 13991 15499 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884J0 protein_id gnl|my_center|LOCUS_32250 >Feature sequence115 1754 39 gene locus_tag LOCUS_32260 gene recJ 1754 39 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_32260 3073 1757 gene locus_tag LOCUS_32270 gene hom 3073 1757 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_32270 4297 3122 gene locus_tag LOCUS_32280 gene yfdZ 4297 3122 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI1 protein_id gnl|my_center|LOCUS_32280 5321 4605 gene locus_tag LOCUS_32290 gene dsbC 5321 4605 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_32290 6443 5535 gene locus_tag LOCUS_32300 gene xerD 6443 5535 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_32300 6987 6628 gene locus_tag LOCUS_32310 gene rplS 6987 6628 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_32310 7744 6980 gene locus_tag LOCUS_32320 gene trmD 7744 6980 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG25 protein_id gnl|my_center|LOCUS_32320 8320 7790 gene locus_tag LOCUS_32330 gene rimM 8320 7790 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_32330 8608 8339 gene locus_tag LOCUS_32340 gene rpsP 8608 8339 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_32340 10142 8769 gene locus_tag LOCUS_32350 gene ffh 10142 8769 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH73 protein_id gnl|my_center|LOCUS_32350 10294 11097 gene locus_tag LOCUS_32360 10294 11097 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_32360 11257 12528 gene locus_tag LOCUS_32370 11257 12528 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_32370 14256 12538 gene locus_tag LOCUS_32380 gene leuA 14256 12538 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT17 protein_id gnl|my_center|LOCUS_32380 15152 14628 gene locus_tag LOCUS_32390 15152 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_32390 15522 15367 gene locus_tag LOCUS_32400 15522 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence116 1 540 gene locus_tag LOCUS_32410 1 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 552 1217 gene locus_tag LOCUS_32420 552 1217 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105577.1 protein_id gnl|my_center|LOCUS_32420 2399 1227 gene locus_tag LOCUS_32430 gene natB 2399 1227 CDS product sodium ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039040.1 protein_id gnl|my_center|LOCUS_32430 3172 2450 gene locus_tag LOCUS_32440 gene natA 3172 2450 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_32440 4613 3165 gene locus_tag LOCUS_32450 4613 3165 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140057.1 protein_id gnl|my_center|LOCUS_32450 4924 5625 gene locus_tag LOCUS_32460 4924 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 6790 5588 gene locus_tag LOCUS_32470 6790 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 7895 7107 gene locus_tag LOCUS_32480 7895 7107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_32480 8701 7895 gene locus_tag LOCUS_32490 8701 7895 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_32490 9668 8694 gene locus_tag LOCUS_32500 9668 8694 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_32500 10933 9704 gene locus_tag LOCUS_32510 gene rhlB 10933 9704 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_32510 12603 11041 gene locus_tag LOCUS_32520 12603 11041 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_32520 13944 12649 gene locus_tag LOCUS_32530 13944 12649 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_32530 14909 13956 gene locus_tag LOCUS_32540 gene argC 14909 13956 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H555 protein_id gnl|my_center|LOCUS_32540 15307 15011 gene locus_tag LOCUS_32550 15307 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence117 2495 513 gene locus_tag LOCUS_32560 2495 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 4495 2492 gene locus_tag LOCUS_32570 4495 2492 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257581.1 protein_id gnl|my_center|LOCUS_32570 4647 5651 gene locus_tag LOCUS_32580 4647 5651 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 protein_id gnl|my_center|LOCUS_32580 6416 5868 gene locus_tag LOCUS_32590 6416 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457970.1 protein_id gnl|my_center|LOCUS_32590 6675 7121 gene locus_tag LOCUS_32600 6675 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 7330 7764 gene locus_tag LOCUS_32610 7330 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 8026 7805 gene locus_tag LOCUS_32620 8026 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 8196 8023 gene locus_tag LOCUS_32630 8196 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 9326 8739 gene locus_tag LOCUS_32640 9326 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 9593 10093 gene locus_tag LOCUS_32650 9593 10093 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287237.1 protein_id gnl|my_center|LOCUS_32650 10935 10213 gene locus_tag LOCUS_32660 10935 10213 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_32660 14063 11112 gene locus_tag LOCUS_32670 gene uvrA 14063 11112 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E083 protein_id gnl|my_center|LOCUS_32670 14988 14053 gene locus_tag LOCUS_32680 14988 14053 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048093.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence118 156 1130 gene locus_tag LOCUS_32690 156 1130 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_32690 1179 1361 gene locus_tag LOCUS_32700 1179 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3319 1277 gene locus_tag LOCUS_32710 3319 1277 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_32710 3495 4631 gene locus_tag LOCUS_32720 3495 4631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_32720 4788 5720 gene locus_tag LOCUS_32730 4788 5720 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918192.1 protein_id gnl|my_center|LOCUS_32730 5849 7033 gene locus_tag LOCUS_32740 5849 7033 CDS product metal-activated pyridoxal enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948224.1 protein_id gnl|my_center|LOCUS_32740 7077 8150 gene locus_tag LOCUS_32750 7077 8150 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 protein_id gnl|my_center|LOCUS_32750 8238 9458 gene locus_tag LOCUS_32760 gene mct 8238 9458 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 protein_id gnl|my_center|LOCUS_32760 9654 10343 gene locus_tag LOCUS_32770 9654 10343 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_32770 10343 10777 gene locus_tag LOCUS_32780 10343 10777 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_32780 10777 13677 gene locus_tag LOCUS_32790 10777 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 13716 13901 gene locus_tag LOCUS_32800 13716 13901 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_32800 13994 14668 gene locus_tag LOCUS_32810 gene kdsB 13994 14668 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY8 protein_id gnl|my_center|LOCUS_32810 >Feature sequence119 1062 280 gene locus_tag LOCUS_32820 1062 280 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_32820 2193 1171 gene locus_tag LOCUS_32830 2193 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3303 2527 gene locus_tag LOCUS_32840 3303 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3408 4184 gene locus_tag LOCUS_32850 gene ubiE 3408 4184 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG3 protein_id gnl|my_center|LOCUS_32850 5014 4379 gene locus_tag LOCUS_32860 gene pcp 5014 4379 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX6 protein_id gnl|my_center|LOCUS_32860 5437 6246 gene locus_tag LOCUS_32870 5437 6246 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_32870 6258 6953 gene locus_tag LOCUS_32880 6258 6953 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970992.1 protein_id gnl|my_center|LOCUS_32880 7036 7455 gene locus_tag LOCUS_32890 7036 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 7531 8130 gene locus_tag LOCUS_32900 7531 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 8279 8497 gene locus_tag LOCUS_32910 8279 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 9122 8508 gene locus_tag LOCUS_32920 9122 8508 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_32920 9463 12687 gene locus_tag LOCUS_32930 9463 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32930 12699 13346 gene locus_tag LOCUS_32940 12699 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32940 >Feature sequence120 160 954 gene locus_tag LOCUS_32950 gene potC 160 954 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714199.1 protein_id gnl|my_center|LOCUS_32950 1213 2109 gene locus_tag LOCUS_32960 1213 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 2335 3495 gene locus_tag LOCUS_32970 2335 3495 CDS product thiamine pyrophosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_32970 3515 5365 gene locus_tag LOCUS_32980 3515 5365 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679016.1 protein_id gnl|my_center|LOCUS_32980 5391 6089 gene locus_tag LOCUS_32990 5391 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 6851 6153 gene locus_tag LOCUS_33000 6851 6153 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_33000 8039 6936 gene locus_tag LOCUS_33010 8039 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 8947 8063 gene locus_tag LOCUS_33020 gene hisG 8947 8063 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ68 protein_id gnl|my_center|LOCUS_33020 9348 8944 gene locus_tag LOCUS_33030 9348 8944 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_33030 10486 9362 gene locus_tag LOCUS_33040 10486 9362 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_33040 11805 10483 gene locus_tag LOCUS_33050 11805 10483 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_33050 13933 11810 gene locus_tag LOCUS_33060 13933 11810 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence121 743 141 gene locus_tag LOCUS_33070 gene ruvA 743 141 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL2 protein_id gnl|my_center|LOCUS_33070 1276 740 gene locus_tag LOCUS_33080 gene ruvC 1276 740 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR00 protein_id gnl|my_center|LOCUS_33080 2111 1371 gene locus_tag LOCUS_33090 2111 1371 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BE4 protein_id gnl|my_center|LOCUS_33090 4008 2236 gene locus_tag LOCUS_33100 gene aspS 4008 2236 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_33100 4411 4058 gene locus_tag LOCUS_33110 4411 4058 CDS product regulatory protein, FmdB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038148.1 protein_id gnl|my_center|LOCUS_33110 4862 5254 gene locus_tag LOCUS_33120 4862 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 6269 5313 gene locus_tag LOCUS_33130 6269 5313 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_33130 6899 6270 gene locus_tag LOCUS_33140 6899 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33140 7307 6930 gene locus_tag LOCUS_33150 7307 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33150 7821 7405 gene locus_tag LOCUS_33160 7821 7405 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268596.1 protein_id gnl|my_center|LOCUS_33160 9135 7861 gene locus_tag LOCUS_33170 9135 7861 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_33170 9663 9313 gene locus_tag LOCUS_33180 9663 9313 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904115.1 protein_id gnl|my_center|LOCUS_33180 10539 9778 gene locus_tag LOCUS_33190 10539 9778 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_33190 11248 10733 gene locus_tag LOCUS_33200 11248 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 12061 12732 gene locus_tag LOCUS_33210 12061 12732 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_33210 12744 14054 gene locus_tag LOCUS_33220 12744 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence122 1293 46 gene locus_tag LOCUS_33230 1293 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_33230 2027 1338 gene locus_tag LOCUS_33240 gene lolD 2027 1338 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J04 protein_id gnl|my_center|LOCUS_33240 3183 2032 gene locus_tag LOCUS_33250 3183 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_33250 3353 3952 gene locus_tag LOCUS_33260 3353 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251679.2 protein_id gnl|my_center|LOCUS_33260 4023 5132 gene locus_tag LOCUS_33270 gene aroF 4023 5132 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYH8 protein_id gnl|my_center|LOCUS_33270 5628 5900 gene locus_tag LOCUS_33280 5628 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 6974 5928 gene locus_tag LOCUS_33290 6974 5928 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_33290 7435 8037 gene locus_tag LOCUS_33300 7435 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 8127 9536 gene locus_tag LOCUS_33310 gene selA 8127 9536 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JQ3 protein_id gnl|my_center|LOCUS_33310 9533 11464 gene locus_tag LOCUS_33320 gene selB 9533 11464 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102294.1 protein_id gnl|my_center|LOCUS_33320 11541 12692 gene locus_tag LOCUS_33330 11541 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 12898 14136 gene locus_tag LOCUS_33340 12898 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 >Feature sequence123 280 1434 gene locus_tag LOCUS_33350 280 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_33350 1733 1461 gene locus_tag LOCUS_33360 1733 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 1850 3223 gene locus_tag LOCUS_33370 1850 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_33370 3241 3786 gene locus_tag LOCUS_33380 3241 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 3791 4549 gene locus_tag LOCUS_33390 3791 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 6886 4553 gene locus_tag LOCUS_33400 gene feoB 6886 4553 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G9 protein_id gnl|my_center|LOCUS_33400 7125 6883 gene locus_tag LOCUS_33410 7125 6883 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_33410 7376 8749 gene locus_tag LOCUS_33420 7376 8749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_33420 8733 9992 gene locus_tag LOCUS_33430 8733 9992 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_33430 9997 11508 gene locus_tag LOCUS_33440 9997 11508 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729717.1 protein_id gnl|my_center|LOCUS_33440 11556 12050 gene locus_tag LOCUS_33450 gene sixA 11556 12050 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_33450 12135 13940 gene locus_tag LOCUS_33460 12135 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence124 106 2043 gene locus_tag LOCUS_33470 106 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 2298 3164 gene locus_tag LOCUS_33480 2298 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3826 3419 gene locus_tag LOCUS_33490 3826 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 5637 4021 gene locus_tag LOCUS_33500 5637 4021 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 protein_id gnl|my_center|LOCUS_33500 7115 6531 gene locus_tag LOCUS_33510 7115 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_33510 7448 8179 gene locus_tag LOCUS_33520 gene cmoA 7448 8179 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76290 protein_id gnl|my_center|LOCUS_33520 9245 8184 gene locus_tag LOCUS_33530 gene hisC 9245 8184 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTV9 protein_id gnl|my_center|LOCUS_33530 10835 9252 gene locus_tag LOCUS_33540 10835 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 protein_id gnl|my_center|LOCUS_33540 10977 11543 gene locus_tag LOCUS_33550 10977 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 11540 12517 gene locus_tag LOCUS_33560 gene cmoB 11540 12517 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIF5 protein_id gnl|my_center|LOCUS_33560 13664 12567 gene locus_tag LOCUS_33570 13664 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence125 687 1322 gene locus_tag LOCUS_33580 687 1322 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061805.1 protein_id gnl|my_center|LOCUS_33580 3355 1469 gene locus_tag LOCUS_33590 3355 1469 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_33590 4506 3457 gene locus_tag LOCUS_33600 4506 3457 CDS product inosine-uridine preferring nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036238.1 protein_id gnl|my_center|LOCUS_33600 5381 4881 gene locus_tag LOCUS_33610 5381 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 5714 6907 gene locus_tag LOCUS_33620 5714 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 9204 7798 gene locus_tag LOCUS_33630 9204 7798 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_33630 10476 9304 gene locus_tag LOCUS_33640 gene kdnA 10476 9304 CDS product 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB1 protein_id gnl|my_center|LOCUS_33640 12228 10912 gene locus_tag LOCUS_33650 12228 10912 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_33650 12627 12289 gene locus_tag LOCUS_33660 gene glnK 12627 12289 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_33660 13217 12906 gene locus_tag LOCUS_33670 13217 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 13443 13820 gene locus_tag LOCUS_33680 13443 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence126 618 448 gene locus_tag LOCUS_33690 618 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 1204 953 gene locus_tag LOCUS_33700 1204 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1185 1766 gene locus_tag LOCUS_33710 gene trpG 1185 1766 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_33710 1799 2824 gene locus_tag LOCUS_33720 gene trpD 1799 2824 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_33720 2824 3639 gene locus_tag LOCUS_33730 gene trpC 2824 3639 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 protein_id gnl|my_center|LOCUS_33730 4268 3636 gene locus_tag LOCUS_33740 gene vfr 4268 3636 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_33740 4484 4903 gene locus_tag LOCUS_33750 4484 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_33750 4927 5643 gene locus_tag LOCUS_33760 gene speD 4927 5643 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5R7 protein_id gnl|my_center|LOCUS_33760 6753 5722 gene locus_tag LOCUS_33770 6753 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 7749 6934 gene locus_tag LOCUS_33780 7749 6934 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_33780 7773 13571 gene locus_tag LOCUS_33790 7773 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence127 227 844 gene locus_tag LOCUS_33800 227 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1893 1426 gene locus_tag LOCUS_33810 1893 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 2869 2165 gene locus_tag LOCUS_33820 2869 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 4197 2896 gene locus_tag LOCUS_33830 4197 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 6790 4391 gene locus_tag LOCUS_33840 6790 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 7648 6992 gene locus_tag LOCUS_33850 7648 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 9111 7624 gene locus_tag LOCUS_33860 9111 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 9453 9262 gene locus_tag LOCUS_33870 9453 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 9796 9885 gene locus_tag LOCUS_t00110 9796 9885 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 10870 9977 gene locus_tag LOCUS_33880 10870 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 12057 11137 gene locus_tag LOCUS_33890 12057 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 12214 12435 gene locus_tag LOCUS_33900 12214 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 12447 12971 gene locus_tag LOCUS_33910 12447 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 12977 13393 gene locus_tag LOCUS_33920 12977 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence128 1608 106 gene locus_tag LOCUS_33930 gene pepA 1608 106 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_33930 1787 2860 gene locus_tag LOCUS_33940 1787 2860 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_33940 2950 3975 gene locus_tag LOCUS_33950 2950 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3982 4827 gene locus_tag LOCUS_33960 3982 4827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_33960 4886 5689 gene locus_tag LOCUS_33970 4886 5689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_33970 5703 6722 gene locus_tag LOCUS_33980 5703 6722 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705995.1 protein_id gnl|my_center|LOCUS_33980 7362 7000 gene locus_tag LOCUS_33990 7362 7000 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941659.1 protein_id gnl|my_center|LOCUS_33990 7542 8366 gene locus_tag LOCUS_34000 7542 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34000 8391 9026 gene locus_tag LOCUS_34010 8391 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34010 9091 9453 gene locus_tag LOCUS_34020 9091 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 protein_id gnl|my_center|LOCUS_34020 9524 9838 gene locus_tag LOCUS_34030 9524 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 9838 10602 gene locus_tag LOCUS_34040 9838 10602 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_34040 10807 11445 gene locus_tag LOCUS_34050 10807 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 11702 11914 gene locus_tag LOCUS_34060 11702 11914 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_34060 12148 12678 gene locus_tag LOCUS_34070 gene pyrE 12148 12678 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNJ2 protein_id gnl|my_center|LOCUS_34070 >Feature sequence129 1558 185 gene locus_tag LOCUS_34080 1558 185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521514.1 protein_id gnl|my_center|LOCUS_34080 1731 3287 gene locus_tag LOCUS_34090 gene add 1731 3287 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635689.2 protein_id gnl|my_center|LOCUS_34090 3351 4535 gene locus_tag LOCUS_34100 3351 4535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200944.1 protein_id gnl|my_center|LOCUS_34100 6290 4581 gene locus_tag LOCUS_34110 6290 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_34110 8090 6324 gene locus_tag LOCUS_34120 8090 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 8222 9115 gene locus_tag LOCUS_34130 8222 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887314.1 protein_id gnl|my_center|LOCUS_34130 10377 9106 gene locus_tag LOCUS_34140 10377 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 10550 10386 gene locus_tag LOCUS_34150 10550 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 11326 10586 gene locus_tag LOCUS_34160 11326 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031514.1 protein_id gnl|my_center|LOCUS_34160 <12925 11380 gene locus_tag LOCUS_34170 <12925 11380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706209.1:guanylyl cyclase >Feature sequence130 460 1530 gene locus_tag LOCUS_34180 460 1530 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_34180 1692 2159 gene locus_tag LOCUS_34190 1692 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 2156 3370 gene locus_tag LOCUS_34200 2156 3370 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_34200 3351 3806 gene locus_tag LOCUS_34210 3351 3806 CDS product 3-hydroxydecanoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261526.1 protein_id gnl|my_center|LOCUS_34210 3813 4535 gene locus_tag LOCUS_34220 gene fabG 3813 4535 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222115.1 protein_id gnl|my_center|LOCUS_34220 4535 5758 gene locus_tag LOCUS_34230 gene fabF 4535 5758 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_34230 6216 5770 gene locus_tag LOCUS_34240 6216 5770 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_34240 6344 7567 gene locus_tag LOCUS_34250 6344 7567 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_34250 7725 9209 gene locus_tag LOCUS_34260 7725 9209 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704304.1 protein_id gnl|my_center|LOCUS_34260 9300 9650 gene locus_tag LOCUS_34270 9300 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 11394 9745 gene locus_tag LOCUS_34280 gene ilvB 11394 9745 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_34280 11712 12284 gene locus_tag LOCUS_34290 11712 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 12303 12671 gene locus_tag LOCUS_34300 12303 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence131 935 1726 gene locus_tag LOCUS_34310 935 1726 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_34310 2622 1738 gene locus_tag LOCUS_34320 2622 1738 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H76 protein_id gnl|my_center|LOCUS_34320 5446 2726 gene locus_tag LOCUS_34330 5446 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 7194 5794 gene locus_tag LOCUS_34340 gene asnS 7194 5794 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56112 protein_id gnl|my_center|LOCUS_34340 8897 7245 gene locus_tag LOCUS_34350 gene ilvB 8897 7245 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057661.1 protein_id gnl|my_center|LOCUS_34350 9407 9048 gene locus_tag LOCUS_34360 9407 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 9805 9419 gene locus_tag LOCUS_34370 9805 9419 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN50 protein_id gnl|my_center|LOCUS_34370 10565 9819 gene locus_tag LOCUS_34380 10565 9819 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN49 protein_id gnl|my_center|LOCUS_34380 12365 10593 gene locus_tag LOCUS_34390 gene frdA 12365 10593 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN48 protein_id gnl|my_center|LOCUS_34390 >Feature sequence132 291 458 gene locus_tag LOCUS_34400 291 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 865 545 gene locus_tag LOCUS_34410 865 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 1508 1035 gene locus_tag LOCUS_34420 1508 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 2447 1827 gene locus_tag LOCUS_34430 2447 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 2936 2568 gene locus_tag LOCUS_34440 2936 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 3300 3578 gene locus_tag LOCUS_34450 3300 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 4478 3729 gene locus_tag LOCUS_34460 4478 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 7035 4570 gene locus_tag LOCUS_34470 7035 4570 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_34470 8678 7005 gene locus_tag LOCUS_34480 gene ilvB 8678 7005 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 protein_id gnl|my_center|LOCUS_34480 9214 8816 gene locus_tag LOCUS_34490 9214 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 9859 9326 gene locus_tag LOCUS_34500 9859 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811996.1 protein_id gnl|my_center|LOCUS_34500 10548 9850 gene locus_tag LOCUS_34510 10548 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 11302 10550 gene locus_tag LOCUS_34520 11302 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 11817 11299 gene locus_tag LOCUS_34530 11817 11299 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704154.1 protein_id gnl|my_center|LOCUS_34530 12400 11828 gene locus_tag LOCUS_34540 12400 11828 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence133 1072 191 gene locus_tag LOCUS_34550 1072 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 1568 1107 gene locus_tag LOCUS_34560 1568 1107 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020791.1 protein_id gnl|my_center|LOCUS_34560 2160 1666 gene locus_tag LOCUS_34570 2160 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2295 2222 gene locus_tag LOCUS_t00120 2295 2222 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2935 2360 gene locus_tag LOCUS_34580 gene pgsA 2935 2360 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_34580 4789 2960 gene locus_tag LOCUS_34590 gene uvrC 4789 2960 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_34590 5475 4786 gene locus_tag LOCUS_34600 5475 4786 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389613.1 protein_id gnl|my_center|LOCUS_34600 6279 5626 gene locus_tag LOCUS_34610 gene gacA 6279 5626 CDS product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52376 protein_id gnl|my_center|LOCUS_34610 7635 6460 gene locus_tag LOCUS_34620 7635 6460 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_34620 8638 7712 gene locus_tag LOCUS_34630 8638 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 9442 8927 gene locus_tag LOCUS_34640 9442 8927 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_34640 9715 10557 gene locus_tag LOCUS_34650 9715 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 10566 10910 gene locus_tag LOCUS_34660 10566 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 11779 10907 gene locus_tag LOCUS_34670 11779 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 12116 11802 gene locus_tag LOCUS_34680 12116 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 12228 12315 gene locus_tag LOCUS_t00130 12228 12315 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 509 937 gene locus_tag LOCUS_34690 509 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 1134 2003 gene locus_tag LOCUS_34700 1134 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3721 2126 gene locus_tag LOCUS_34710 3721 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 5246 3924 gene locus_tag LOCUS_34720 5246 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 6576 5617 gene locus_tag LOCUS_34730 6576 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084186.1 protein_id gnl|my_center|LOCUS_34730 6722 7174 gene locus_tag LOCUS_34740 6722 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 7410 7838 gene locus_tag LOCUS_34750 7410 7838 CDS product glyoxalase/bleomycin resistance protein/dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527755.1 protein_id gnl|my_center|LOCUS_34750 7898 8941 gene locus_tag LOCUS_34760 7898 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 9091 9381 gene locus_tag LOCUS_34770 9091 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 10538 9429 gene locus_tag LOCUS_34780 10538 9429 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_34780 11462 10776 gene locus_tag LOCUS_34790 11462 10776 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090614.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34790 11685 12467 gene locus_tag LOCUS_34800 gene fabG 11685 12467 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_34800 >Feature sequence135 1379 228 gene locus_tag LOCUS_34810 1379 228 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946367.1 protein_id gnl|my_center|LOCUS_34810 1888 1427 gene locus_tag LOCUS_34820 1888 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 2473 1946 gene locus_tag LOCUS_34830 2473 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3181 2786 gene locus_tag LOCUS_34840 3181 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 4271 3339 gene locus_tag LOCUS_34850 gene ispH 4271 3339 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_34850 4831 4334 gene locus_tag LOCUS_34860 gene lspA 4831 4334 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E3 protein_id gnl|my_center|LOCUS_34860 5839 4904 gene locus_tag LOCUS_34870 gene ribF 5839 4904 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_34870 7522 5954 gene locus_tag LOCUS_34880 7522 5954 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S92 protein_id gnl|my_center|LOCUS_34880 7686 7955 gene locus_tag LOCUS_34890 gene rpsT 7686 7955 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_34890 9127 7979 gene locus_tag LOCUS_34900 gene proB 9127 7979 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F0 protein_id gnl|my_center|LOCUS_34900 10293 9127 gene locus_tag LOCUS_34910 gene obg 10293 9127 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_34910 10682 10422 gene locus_tag LOCUS_34920 gene rpmA 10682 10422 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_34920 11001 10684 gene locus_tag LOCUS_34930 gene rplU 11001 10684 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WBD7 protein_id gnl|my_center|LOCUS_34930 11314 12288 gene locus_tag LOCUS_34940 11314 12288 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_34940 12309 12385 gene locus_tag LOCUS_t00140 12309 12385 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 253 1392 gene locus_tag LOCUS_34950 253 1392 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_34950 1389 3353 gene locus_tag LOCUS_34960 1389 3353 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_34960 4094 3555 gene locus_tag LOCUS_34970 4094 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34970 4592 4113 gene locus_tag LOCUS_34980 4592 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34980 4884 4699 gene locus_tag LOCUS_34990 4884 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 4999 7026 gene locus_tag LOCUS_35000 4999 7026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_35000 7023 8993 gene locus_tag LOCUS_35010 7023 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 11284 9365 gene locus_tag LOCUS_35020 11284 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 12369 11608 gene locus_tag LOCUS_35030 12369 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence137 783 373 gene locus_tag LOCUS_35040 783 373 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_867920.2 protein_id gnl|my_center|LOCUS_35040 945 2183 gene locus_tag LOCUS_35050 945 2183 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204051.1 protein_id gnl|my_center|LOCUS_35050 2221 3171 gene locus_tag LOCUS_35060 2221 3171 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_35060 3171 4421 gene locus_tag LOCUS_35070 3171 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 4418 5176 gene locus_tag LOCUS_35080 4418 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 5169 5885 gene locus_tag LOCUS_35090 5169 5885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067079.1 protein_id gnl|my_center|LOCUS_35090 6038 8131 gene locus_tag LOCUS_35100 6038 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 8249 9739 gene locus_tag LOCUS_35110 8249 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 9812 10657 gene locus_tag LOCUS_35120 9812 10657 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 protein_id gnl|my_center|LOCUS_35120 10751 11647 gene locus_tag LOCUS_35130 10751 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 12211 11846 gene locus_tag LOCUS_35140 12211 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence138 1423 2301 gene locus_tag LOCUS_35150 1423 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 2383 3345 gene locus_tag LOCUS_35160 2383 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 4666 3374 gene locus_tag LOCUS_35170 4666 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 4852 5994 gene locus_tag LOCUS_35180 4852 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_35180 5991 6464 gene locus_tag LOCUS_35190 5991 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 6624 8291 gene locus_tag LOCUS_35200 6624 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 8668 8447 gene locus_tag LOCUS_35210 8668 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 11264 8913 gene locus_tag LOCUS_35220 11264 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 12099 11629 gene locus_tag LOCUS_35230 12099 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence139 266 2488 gene locus_tag LOCUS_35240 266 2488 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_35240 2604 4808 gene locus_tag LOCUS_35250 2604 4808 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_35250 4814 5356 gene locus_tag LOCUS_35260 4814 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_35260 8896 5492 gene locus_tag LOCUS_35270 8896 5492 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence140 337 1482 gene locus_tag LOCUS_35280 337 1482 CDS product 5-aminoimidazole-4-carboxamide ribonucleotide transformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965740.1 protein_id gnl|my_center|LOCUS_35280 1706 1524 gene locus_tag LOCUS_35290 1706 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1873 2817 gene locus_tag LOCUS_35300 1873 2817 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_35300 3020 2859 gene locus_tag LOCUS_35310 3020 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3809 3147 gene locus_tag LOCUS_35320 3809 3147 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_35320 3902 4087 gene locus_tag LOCUS_35330 3902 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 4103 5362 gene locus_tag LOCUS_35340 gene glyA 4103 5362 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HS7 protein_id gnl|my_center|LOCUS_35340 5498 6652 gene locus_tag LOCUS_35350 5498 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 6809 7732 gene locus_tag LOCUS_35360 6809 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 8555 7833 gene locus_tag LOCUS_35370 8555 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 9070 8552 gene locus_tag LOCUS_35380 9070 8552 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECN9 protein_id gnl|my_center|LOCUS_35380 9209 10120 gene locus_tag LOCUS_35390 9209 10120 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_35390 10321 11592 gene locus_tag LOCUS_35400 10321 11592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083838.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence141 2020 77 gene locus_tag LOCUS_35410 gene mnmC 2020 77 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_35410 3077 2199 gene locus_tag LOCUS_35420 3077 2199 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_35420 3521 3099 gene locus_tag LOCUS_35430 3521 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 3950 3534 gene locus_tag LOCUS_35440 3950 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4590 4066 gene locus_tag LOCUS_35450 4590 4066 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT28 protein_id gnl|my_center|LOCUS_35450 6171 4906 gene locus_tag LOCUS_35460 6171 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 6520 7620 gene locus_tag LOCUS_35470 6520 7620 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141637.1 protein_id gnl|my_center|LOCUS_35470 7792 9870 gene locus_tag LOCUS_35480 7792 9870 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817414.1 protein_id gnl|my_center|LOCUS_35480 9867 11090 gene locus_tag LOCUS_35490 gene iscS 9867 11090 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B843 protein_id gnl|my_center|LOCUS_35490 >Feature sequence142 418 2067 gene locus_tag LOCUS_35500 418 2067 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_35500 2484 2275 gene locus_tag LOCUS_35510 2484 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 2386 3246 gene locus_tag LOCUS_35520 2386 3246 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_35520 3293 4219 gene locus_tag LOCUS_35530 3293 4219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879212.1 protein_id gnl|my_center|LOCUS_35530 4304 6256 gene locus_tag LOCUS_35540 4304 6256 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_35540 6343 7578 gene locus_tag LOCUS_35550 6343 7578 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_35550 8014 7646 gene locus_tag LOCUS_35560 8014 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 8370 8095 gene locus_tag LOCUS_35570 8370 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640268.1 protein_id gnl|my_center|LOCUS_35570 8506 8889 gene locus_tag LOCUS_35580 8506 8889 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071691.1 protein_id gnl|my_center|LOCUS_35580 8879 9865 gene locus_tag LOCUS_35590 8879 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35590 9868 10413 gene locus_tag LOCUS_35600 9868 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 10625 10780 gene locus_tag LOCUS_35610 10625 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 10832 11050 gene locus_tag LOCUS_35620 10832 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence143 1178 120 gene locus_tag LOCUS_35630 1178 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 2312 1215 gene locus_tag LOCUS_35640 2312 1215 CDS product spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_35640 3479 2370 gene locus_tag LOCUS_35650 3479 2370 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS37 protein_id gnl|my_center|LOCUS_35650 3730 3915 gene locus_tag LOCUS_35660 3730 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 6277 3863 gene locus_tag LOCUS_35670 6277 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 6473 8113 gene locus_tag LOCUS_35680 6473 8113 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_35680 8328 8987 gene locus_tag LOCUS_35690 8328 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 9841 9047 gene locus_tag LOCUS_35700 9841 9047 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_35700 11059 9863 gene locus_tag LOCUS_35710 11059 9863 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088770.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence144 1971 361 gene locus_tag LOCUS_35720 1971 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 2360 3226 gene locus_tag LOCUS_35730 2360 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 3386 4186 gene locus_tag LOCUS_35740 gene uppP 3386 4186 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 protein_id gnl|my_center|LOCUS_35740 4402 4914 gene locus_tag LOCUS_35750 4402 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 5289 5008 gene locus_tag LOCUS_35760 5289 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 5173 5832 gene locus_tag LOCUS_35770 5173 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 7005 5878 gene locus_tag LOCUS_35780 7005 5878 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_35780 8302 7076 gene locus_tag LOCUS_35790 8302 7076 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_35790 9320 8295 gene locus_tag LOCUS_35800 9320 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 9464 10684 gene locus_tag LOCUS_35810 9464 10684 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence145 186 542 gene locus_tag LOCUS_35820 186 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 1823 624 gene locus_tag LOCUS_35830 gene galK 1823 624 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q836P0 protein_id gnl|my_center|LOCUS_35830 3188 1839 gene locus_tag LOCUS_35840 gene melA 3188 1839 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986598.1 protein_id gnl|my_center|LOCUS_35840 4137 3205 gene locus_tag LOCUS_35850 gene galM 4137 3205 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_35850 4476 4234 gene locus_tag LOCUS_35860 4476 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 6733 4478 gene locus_tag LOCUS_35870 6733 4478 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_35870 7212 6733 gene locus_tag LOCUS_35880 7212 6733 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_35880 8087 7215 gene locus_tag LOCUS_35890 8087 7215 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_35890 8278 8568 gene locus_tag LOCUS_35900 8278 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 8947 8561 gene locus_tag LOCUS_35910 8947 8561 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143050.1 protein_id gnl|my_center|LOCUS_35910 9098 10939 gene locus_tag LOCUS_35920 9098 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence146 327 1121 gene locus_tag LOCUS_35930 327 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 1255 2592 gene locus_tag LOCUS_35940 1255 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2582 3676 gene locus_tag LOCUS_35950 2582 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 3702 4700 gene locus_tag LOCUS_35960 3702 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 5028 6071 gene locus_tag LOCUS_35970 5028 6071 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_35970 6214 7218 gene locus_tag LOCUS_35980 6214 7218 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_35980 8135 7215 gene locus_tag LOCUS_35990 8135 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 8491 9132 gene locus_tag LOCUS_36000 8491 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 9041 9253 gene locus_tag LOCUS_36010 9041 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 9499 10023 gene locus_tag LOCUS_36020 9499 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence147 39 932 gene locus_tag LOCUS_36030 gene nfo 39 932 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV76 protein_id gnl|my_center|LOCUS_36030 2750 942 gene locus_tag LOCUS_36040 2750 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3418 5010 gene locus_tag LOCUS_36050 3418 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 5013 5294 gene locus_tag LOCUS_36060 5013 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 5358 5537 gene locus_tag LOCUS_36070 5358 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 5573 6760 gene locus_tag LOCUS_36080 5573 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 6877 7326 gene locus_tag LOCUS_36090 6877 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_36090 7411 7878 gene locus_tag LOCUS_36100 7411 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 8338 9006 gene locus_tag LOCUS_36110 8338 9006 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_36110 9185 10297 gene locus_tag LOCUS_36120 9185 10297 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence148 240 79 gene locus_tag LOCUS_36130 240 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 586 362 gene locus_tag LOCUS_36140 586 362 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_36140 1302 586 gene locus_tag LOCUS_36150 1302 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 2061 1828 gene locus_tag LOCUS_36160 2061 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3660 2305 gene locus_tag LOCUS_36170 3660 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4470 3661 gene locus_tag LOCUS_36180 4470 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_36180 6890 4467 gene locus_tag LOCUS_36190 6890 4467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_36190 6995 7750 gene locus_tag LOCUS_36200 6995 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 8344 7763 gene locus_tag LOCUS_36210 8344 7763 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E337 protein_id gnl|my_center|LOCUS_36210 8526 8858 gene locus_tag LOCUS_36220 8526 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 8903 9169 gene locus_tag LOCUS_36230 8903 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 9514 10203 gene locus_tag LOCUS_36240 9514 10203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence149 1925 90 gene locus_tag LOCUS_36250 1925 90 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_36250 2191 1982 gene locus_tag LOCUS_36260 2191 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 2265 3665 gene locus_tag LOCUS_36270 2265 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 4036 4791 gene locus_tag LOCUS_36280 4036 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 5123 6451 gene locus_tag LOCUS_36290 gene dgoA 5123 6451 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_36290 8339 7113 gene locus_tag LOCUS_36300 8339 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 8451 8621 gene locus_tag LOCUS_36310 8451 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 9477 8623 gene locus_tag LOCUS_36320 9477 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36320 9963 9616 gene locus_tag LOCUS_36330 9963 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 10794 10165 gene locus_tag LOCUS_36340 10794 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 >Feature sequence150 2858 2058 gene locus_tag LOCUS_36350 2858 2058 CDS product putative short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45219 protein_id gnl|my_center|LOCUS_36350 3832 2993 gene locus_tag LOCUS_36360 3832 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4237 4016 gene locus_tag LOCUS_36370 4237 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 4537 4259 gene locus_tag LOCUS_36380 4537 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 5629 4568 gene locus_tag LOCUS_36390 5629 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_36390 5877 6662 gene locus_tag LOCUS_36400 5877 6662 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966749.1 protein_id gnl|my_center|LOCUS_36400 6719 6973 gene locus_tag LOCUS_36410 6719 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 6991 8541 gene locus_tag LOCUS_36420 6991 8541 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_36420 8581 10137 gene locus_tag LOCUS_36430 8581 10137 CDS product propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228470.1 protein_id gnl|my_center|LOCUS_36430 10520 10245 gene locus_tag LOCUS_36440 10520 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887084.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence151 1066 14 gene locus_tag LOCUS_36450 1066 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 1178 1372 gene locus_tag LOCUS_36460 1178 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 2211 1465 gene locus_tag LOCUS_36470 2211 1465 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_36470 3643 2282 gene locus_tag LOCUS_36480 gene manB 3643 2282 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_36480 5017 3821 gene locus_tag LOCUS_36490 5017 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 6151 5033 gene locus_tag LOCUS_36500 6151 5033 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_36500 10254 6223 gene locus_tag LOCUS_36510 10254 6223 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence152 606 91 gene locus_tag LOCUS_36520 606 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 1242 616 gene locus_tag LOCUS_36530 1242 616 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256260.1 protein_id gnl|my_center|LOCUS_36530 1695 1276 gene locus_tag LOCUS_36540 1695 1276 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_36540 3239 1767 gene locus_tag LOCUS_36550 3239 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_36550 4305 3313 gene locus_tag LOCUS_36560 4305 3313 CDS product GumN protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402916.1 protein_id gnl|my_center|LOCUS_36560 6727 4253 gene locus_tag LOCUS_36570 6727 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 7029 7763 gene locus_tag LOCUS_36580 7029 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 8466 7981 gene locus_tag LOCUS_36590 8466 7981 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_36590 9712 8570 gene locus_tag LOCUS_36600 gene ltp1 9712 8570 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_36600 10175 9744 gene locus_tag LOCUS_36610 10175 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence153 775 41 gene locus_tag LOCUS_36620 775 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 1836 901 gene locus_tag LOCUS_36630 1836 901 CDS product IroE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098699.1 protein_id gnl|my_center|LOCUS_36630 1862 2119 gene locus_tag LOCUS_36640 1862 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2116 2541 gene locus_tag LOCUS_36650 2116 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 2557 3426 gene locus_tag LOCUS_36660 2557 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 3567 3965 gene locus_tag LOCUS_36670 3567 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 4040 4483 gene locus_tag LOCUS_36680 4040 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 4805 5383 gene locus_tag LOCUS_36690 4805 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 6058 5465 gene locus_tag LOCUS_36700 6058 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 6231 6683 gene locus_tag LOCUS_36710 6231 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 7591 6767 gene locus_tag LOCUS_36720 7591 6767 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_36720 8458 7679 gene locus_tag LOCUS_36730 8458 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_36730 8642 9277 gene locus_tag LOCUS_36740 8642 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 9576 9433 gene locus_tag LOCUS_36750 9576 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 9775 9578 gene locus_tag LOCUS_36760 9775 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence154 2338 1010 gene locus_tag LOCUS_36770 2338 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3358 2402 gene locus_tag LOCUS_36780 gene moxR 3358 2402 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123485.1 protein_id gnl|my_center|LOCUS_36780 3598 3377 gene locus_tag LOCUS_36790 3598 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3830 4093 gene locus_tag LOCUS_36800 3830 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 4097 4390 gene locus_tag LOCUS_36810 4097 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 4575 4408 gene locus_tag LOCUS_36820 4575 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4993 6240 gene locus_tag LOCUS_36830 4993 6240 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_36830 6254 7411 gene locus_tag LOCUS_36840 6254 7411 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731380.1 protein_id gnl|my_center|LOCUS_36840 7519 7749 gene locus_tag LOCUS_36850 7519 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 7750 8187 gene locus_tag LOCUS_36860 7750 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 8342 8551 gene locus_tag LOCUS_36870 8342 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 8698 9786 gene locus_tag LOCUS_36880 8698 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence155 3747 679 gene locus_tag LOCUS_36890 3747 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 4520 4870 gene locus_tag LOCUS_36900 4520 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 5295 4888 gene locus_tag LOCUS_36910 5295 4888 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_36910 6008 5433 gene locus_tag LOCUS_36920 6008 5433 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191444.1 protein_id gnl|my_center|LOCUS_36920 6861 6052 gene locus_tag LOCUS_36930 6861 6052 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_36930 7020 8396 gene locus_tag LOCUS_36940 7020 8396 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_36940 8393 9169 gene locus_tag LOCUS_36950 8393 9169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence156 1643 1332 gene locus_tag LOCUS_36960 1643 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2480 2010 gene locus_tag LOCUS_36970 2480 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 3569 2487 gene locus_tag LOCUS_36980 3569 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4808 3687 gene locus_tag LOCUS_36990 4808 3687 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528359.1 protein_id gnl|my_center|LOCUS_36990 5877 4864 gene locus_tag LOCUS_37000 5877 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 5809 6009 gene locus_tag LOCUS_37010 5809 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 6022 6282 gene locus_tag LOCUS_37020 6022 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 6339 6572 gene locus_tag LOCUS_37030 6339 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 6639 7025 gene locus_tag LOCUS_37040 6639 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 7327 7614 gene locus_tag LOCUS_37050 7327 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 7654 9702 gene locus_tag LOCUS_37060 7654 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence157 464 1123 gene locus_tag LOCUS_37070 464 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 1164 1826 gene locus_tag LOCUS_37080 1164 1826 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023449.1 protein_id gnl|my_center|LOCUS_37080 2401 1859 gene locus_tag LOCUS_37090 2401 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 3843 2611 gene locus_tag LOCUS_37100 3843 2611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259659.1 protein_id gnl|my_center|LOCUS_37100 4357 3854 gene locus_tag LOCUS_37110 4357 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089069.1 protein_id gnl|my_center|LOCUS_37110 4814 6331 gene locus_tag LOCUS_37120 4814 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 6744 6367 gene locus_tag LOCUS_37130 6744 6367 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887146.1 protein_id gnl|my_center|LOCUS_37130 6980 6741 gene locus_tag LOCUS_37140 6980 6741 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THY7 protein_id gnl|my_center|LOCUS_37140 7126 8586 gene locus_tag LOCUS_37150 7126 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 8579 9001 gene locus_tag LOCUS_37160 8579 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 >Feature sequence158 1468 1543 gene locus_tag LOCUS_t00150 1468 1543 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1699 2763 gene locus_tag LOCUS_37170 1699 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3960 3112 gene locus_tag LOCUS_37180 3960 3112 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_37180 4249 5481 gene locus_tag LOCUS_37190 4249 5481 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_37190 6323 5586 gene locus_tag LOCUS_37200 6323 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 6435 6989 gene locus_tag LOCUS_37210 6435 6989 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_37210 8171 7107 gene locus_tag LOCUS_37220 8171 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 8736 8200 gene locus_tag LOCUS_37230 8736 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 9198 9282 gene locus_tag LOCUS_t00160 9198 9282 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence159 136 1011 gene locus_tag LOCUS_37240 136 1011 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_37240 2276 1086 gene locus_tag LOCUS_37250 2276 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 2632 2291 gene locus_tag LOCUS_37260 2632 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 5862 2692 gene locus_tag LOCUS_37270 5862 2692 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_37270 7286 5856 gene locus_tag LOCUS_37280 7286 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 8611 7283 gene locus_tag LOCUS_37290 8611 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence160 539 78 gene locus_tag LOCUS_37300 539 78 CDS product acetoin utilization protein AcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420573.1 protein_id gnl|my_center|LOCUS_37300 1068 3287 gene locus_tag LOCUS_37310 1068 3287 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_37310 3305 3895 gene locus_tag LOCUS_37320 3305 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3988 5133 gene locus_tag LOCUS_37330 3988 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 6506 5190 gene locus_tag LOCUS_37340 6506 5190 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037500.1 protein_id gnl|my_center|LOCUS_37340 7339 6536 gene locus_tag LOCUS_37350 7339 6536 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_37350 7501 8154 gene locus_tag LOCUS_37360 7501 8154 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_37360 8230 9033 gene locus_tag LOCUS_37370 gene uppS 8230 9033 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH15 protein_id gnl|my_center|LOCUS_37370 >Feature sequence161 1457 210 gene locus_tag LOCUS_37380 1457 210 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_37380 2387 1698 gene locus_tag LOCUS_37390 gene nnrU 2387 1698 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967675.1 protein_id gnl|my_center|LOCUS_37390 3437 2499 gene locus_tag LOCUS_37400 3437 2499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768963.1 protein_id gnl|my_center|LOCUS_37400 4294 3437 gene locus_tag LOCUS_37410 4294 3437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957795.1 protein_id gnl|my_center|LOCUS_37410 4653 4291 gene locus_tag LOCUS_37420 4653 4291 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768967.1 protein_id gnl|my_center|LOCUS_37420 5863 4784 gene locus_tag LOCUS_37430 gene murG 5863 4784 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXC4 protein_id gnl|my_center|LOCUS_37430 6581 5877 gene locus_tag LOCUS_37440 6581 5877 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_37440 7645 6578 gene locus_tag LOCUS_37450 7645 6578 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_37450 8797 7754 gene locus_tag LOCUS_37460 8797 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262404.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence162 163 1539 gene locus_tag LOCUS_37470 163 1539 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_37470 2607 1555 gene locus_tag LOCUS_37480 2607 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_37480 3728 2652 gene locus_tag LOCUS_37490 3728 2652 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_37490 4300 5055 gene locus_tag LOCUS_37500 4300 5055 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_37500 5127 6953 gene locus_tag LOCUS_37510 gene gspA 5127 6953 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_37510 6959 7648 gene locus_tag LOCUS_37520 6959 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 8609 7704 gene locus_tag LOCUS_37530 8609 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence163 118 564 gene locus_tag LOCUS_37540 118 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_37540 729 1280 gene locus_tag LOCUS_37550 729 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 1238 1411 gene locus_tag LOCUS_37560 1238 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 1605 1964 gene locus_tag LOCUS_37570 1605 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1945 2445 gene locus_tag LOCUS_37580 1945 2445 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837475.1 protein_id gnl|my_center|LOCUS_37580 2717 3358 gene locus_tag LOCUS_37590 2717 3358 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_37590 3402 3932 gene locus_tag LOCUS_37600 3402 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119352.1 protein_id gnl|my_center|LOCUS_37600 4173 4457 gene locus_tag LOCUS_37610 4173 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 4511 5293 gene locus_tag LOCUS_37620 4511 5293 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490886.1 protein_id gnl|my_center|LOCUS_37620 7684 5402 gene locus_tag LOCUS_37630 7684 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 7954 8973 gene locus_tag LOCUS_37640 7954 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence164 285 1097 gene locus_tag LOCUS_37650 285 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 1938 1141 gene locus_tag LOCUS_37660 1938 1141 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709559.1 protein_id gnl|my_center|LOCUS_37660 4303 1940 gene locus_tag LOCUS_37670 4303 1940 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_37670 4778 4296 gene locus_tag LOCUS_37680 4778 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 5268 4816 gene locus_tag LOCUS_37690 5268 4816 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706613.1 protein_id gnl|my_center|LOCUS_37690 7357 5297 gene locus_tag LOCUS_37700 7357 5297 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459357.1 protein_id gnl|my_center|LOCUS_37700 7802 8620 gene locus_tag LOCUS_37710 7802 8620 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_37710 >Feature sequence165 474 1244 gene locus_tag LOCUS_37720 474 1244 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 protein_id gnl|my_center|LOCUS_37720 1722 1333 gene locus_tag LOCUS_37730 1722 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 3535 2186 gene locus_tag LOCUS_37740 3535 2186 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_37740 3943 5190 gene locus_tag LOCUS_37750 3943 5190 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_37750 7415 5457 gene locus_tag LOCUS_37760 7415 5457 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_37760 <8755 7568 gene locus_tag LOCUS_37770 <8755 7568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073038.1:amidohydrolase >Feature sequence166 1148 210 gene locus_tag LOCUS_37780 1148 210 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067623.1 protein_id gnl|my_center|LOCUS_37780 1390 1920 gene locus_tag LOCUS_37790 1390 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2042 3280 gene locus_tag LOCUS_37800 2042 3280 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_37800 3305 4123 gene locus_tag LOCUS_37810 3305 4123 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_37810 5160 4225 gene locus_tag LOCUS_37820 gene metA 5160 4225 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC8 protein_id gnl|my_center|LOCUS_37820 5566 6804 gene locus_tag LOCUS_37830 5566 6804 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064431.1 protein_id gnl|my_center|LOCUS_37830 6875 8476 gene locus_tag LOCUS_37840 6875 8476 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_37840 >Feature sequence167 1378 92 gene locus_tag LOCUS_37850 1378 92 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_37850 2315 1623 gene locus_tag LOCUS_37860 2315 1623 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454937.1 protein_id gnl|my_center|LOCUS_37860 2488 2886 gene locus_tag LOCUS_37870 2488 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 protein_id gnl|my_center|LOCUS_37870 2964 3917 gene locus_tag LOCUS_37880 gene php 2964 3917 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHN9 protein_id gnl|my_center|LOCUS_37880 3985 4779 gene locus_tag LOCUS_37890 3985 4779 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_37890 7406 4782 gene locus_tag LOCUS_37900 7406 4782 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence168 2417 1374 gene locus_tag LOCUS_37910 2417 1374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_37910 3516 2431 gene locus_tag LOCUS_37920 3516 2431 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 protein_id gnl|my_center|LOCUS_37920 4551 3880 gene locus_tag LOCUS_37930 4551 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 6613 4673 gene locus_tag LOCUS_37940 gene atuH 6613 4673 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_37940 7957 6671 gene locus_tag LOCUS_37950 7957 6671 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_37950 >Feature sequence169 315 1247 gene locus_tag LOCUS_37960 gene oppB 315 1247 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048147.1 protein_id gnl|my_center|LOCUS_37960 1267 2688 gene locus_tag LOCUS_37970 1267 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 2699 3739 gene locus_tag LOCUS_37980 gene oppD 2699 3739 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854348.1 protein_id gnl|my_center|LOCUS_37980 3732 4703 gene locus_tag LOCUS_37990 gene oppF 3732 4703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_37990 6590 4749 gene locus_tag LOCUS_38000 6590 4749 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 protein_id gnl|my_center|LOCUS_38000 7595 6603 gene locus_tag LOCUS_38010 7595 6603 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_38010 7753 7595 gene locus_tag LOCUS_38020 7753 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence170 647 474 gene locus_tag LOCUS_38030 647 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 1713 1147 gene locus_tag LOCUS_38040 1713 1147 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_38040 2718 1858 gene locus_tag LOCUS_38050 2718 1858 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086737.1 protein_id gnl|my_center|LOCUS_38050 3624 2857 gene locus_tag LOCUS_38060 3624 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_38060 4436 3621 gene locus_tag LOCUS_38070 4436 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 4726 4502 gene locus_tag LOCUS_38080 4726 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 5369 4848 gene locus_tag LOCUS_38090 5369 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_38090 5553 6944 gene locus_tag LOCUS_38100 5553 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945948.1 protein_id gnl|my_center|LOCUS_38100 7699 6959 gene locus_tag LOCUS_38110 7699 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence171 906 127 gene locus_tag LOCUS_38120 906 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 1255 1893 gene locus_tag LOCUS_38130 1255 1893 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_38130 2055 2870 gene locus_tag LOCUS_38140 2055 2870 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887744.1 protein_id gnl|my_center|LOCUS_38140 2965 3159 gene locus_tag LOCUS_38150 2965 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 3778 4623 gene locus_tag LOCUS_38160 3778 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 5150 4632 gene locus_tag LOCUS_38170 5150 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 5497 6177 gene locus_tag LOCUS_38180 5497 6177 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_38180 6255 6647 gene locus_tag LOCUS_38190 gene tusD 6255 6647 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N3 protein_id gnl|my_center|LOCUS_38190 6644 6997 gene locus_tag LOCUS_38200 6644 6997 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707697.1 protein_id gnl|my_center|LOCUS_38200 6994 7317 gene locus_tag LOCUS_38210 gene dsrH 6994 7317 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_38210 7326 7658 gene locus_tag LOCUS_38220 gene tusE 7326 7658 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEK2 protein_id gnl|my_center|LOCUS_38220 >Feature sequence172 970 203 gene locus_tag LOCUS_38230 970 203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_38230 1743 979 gene locus_tag LOCUS_38240 1743 979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_38240 2842 1766 gene locus_tag LOCUS_38250 2842 1766 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_38250 3711 2842 gene locus_tag LOCUS_38260 3711 2842 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_38260 3854 5038 gene locus_tag LOCUS_38270 3854 5038 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_38270 6403 5027 gene locus_tag LOCUS_38280 6403 5027 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 protein_id gnl|my_center|LOCUS_38280 6607 7011 gene locus_tag LOCUS_38290 6607 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence173 571 143 gene locus_tag LOCUS_38300 571 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1774 761 gene locus_tag LOCUS_38310 1774 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 2001 2342 gene locus_tag LOCUS_38320 2001 2342 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_38320 2330 3508 gene locus_tag LOCUS_38330 2330 3508 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_38330 3834 3559 gene locus_tag LOCUS_38340 3834 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38340 4245 3859 gene locus_tag LOCUS_38350 4245 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38350 6316 4346 gene locus_tag LOCUS_38360 6316 4346 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_38360 6615 7628 gene locus_tag LOCUS_38370 6615 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 >Feature sequence174 184 1737 gene locus_tag LOCUS_38380 gene gpmI 184 1737 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_38380 1797 2975 gene locus_tag LOCUS_38390 1797 2975 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958285.1 protein_id gnl|my_center|LOCUS_38390 3009 4349 gene locus_tag LOCUS_38400 3009 4349 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_38400 4368 5171 gene locus_tag LOCUS_38410 4368 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 protein_id gnl|my_center|LOCUS_38410 5938 5189 gene locus_tag LOCUS_38420 gene hisA 5938 5189 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_38420 6554 5961 gene locus_tag LOCUS_38430 gene hisB 6554 5961 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_38430 7030 6629 gene locus_tag LOCUS_38440 7030 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 7158 7550 gene locus_tag LOCUS_38450 7158 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975801.1 protein_id gnl|my_center|LOCUS_38450 7585 7660 gene locus_tag LOCUS_t00170 7585 7660 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence175 1728 121 gene locus_tag LOCUS_38460 1728 121 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_38460 2260 3561 gene locus_tag LOCUS_38470 2260 3561 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528549.1 protein_id gnl|my_center|LOCUS_38470 3554 4567 gene locus_tag LOCUS_38480 3554 4567 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528548.1 protein_id gnl|my_center|LOCUS_38480 5515 4664 gene locus_tag LOCUS_38490 5515 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 5693 6544 gene locus_tag LOCUS_38500 5693 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 <7665 6813 gene locus_tag LOCUS_38510 <7665 6813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870966.1:dihydroorotate dehydrogenase >Feature sequence176 457 753 gene locus_tag LOCUS_38520 457 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 2740 1724 gene locus_tag LOCUS_38530 2740 1724 CDS product toxin secretion, membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074383.1 protein_id gnl|my_center|LOCUS_38530 3398 2733 gene locus_tag LOCUS_38540 3398 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 4254 5423 gene locus_tag LOCUS_38550 4254 5423 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence177 <1 717 gene locus_tag LOCUS_38560 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460500.1:beta-ketoacyl-ACP reductase 788 1660 gene locus_tag LOCUS_38570 788 1660 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_38570 1657 2448 gene locus_tag LOCUS_38580 gene gctB 1657 2448 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_38580 5605 2480 gene locus_tag LOCUS_38590 5605 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence178 780 2357 gene locus_tag LOCUS_38600 780 2357 CDS product putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702802.1 protein_id gnl|my_center|LOCUS_38600 2361 4337 gene locus_tag LOCUS_38610 2361 4337 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_38610 5433 4411 gene locus_tag LOCUS_38620 5433 4411 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900084.1 protein_id gnl|my_center|LOCUS_38620 5758 7125 gene locus_tag LOCUS_38630 5758 7125 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence179 1772 1035 gene locus_tag LOCUS_38640 1772 1035 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 protein_id gnl|my_center|LOCUS_38640 2578 1820 gene locus_tag LOCUS_38650 2578 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 3381 2599 gene locus_tag LOCUS_38660 3381 2599 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HN34 protein_id gnl|my_center|LOCUS_38660 4255 3392 gene locus_tag LOCUS_38670 gene selD 4255 3392 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_38670 4582 5250 gene locus_tag LOCUS_38680 4582 5250 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706361.1 protein_id gnl|my_center|LOCUS_38680 5391 6278 gene locus_tag LOCUS_38690 5391 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38690 6275 7429 gene locus_tag LOCUS_38700 6275 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38700 >Feature sequence180 495 1175 gene locus_tag LOCUS_38710 495 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 1344 2600 gene locus_tag LOCUS_38720 1344 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 2644 3945 gene locus_tag LOCUS_38730 2644 3945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_38730 4085 6667 gene locus_tag LOCUS_38740 4085 6667 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 protein_id gnl|my_center|LOCUS_38740 7015 7230 gene locus_tag LOCUS_38750 7015 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence181 31 106 gene locus_tag LOCUS_t00180 31 106 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 182 1012 gene locus_tag LOCUS_38760 gene kduD1 182 1012 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_38760 1412 1023 gene locus_tag LOCUS_38770 1412 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 2005 1547 gene locus_tag LOCUS_38780 2005 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2343 4058 gene locus_tag LOCUS_38790 2343 4058 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266636.1 protein_id gnl|my_center|LOCUS_38790 4073 5287 gene locus_tag LOCUS_38800 gene pilC 4073 5287 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_38800 5325 6203 gene locus_tag LOCUS_38810 gene pilD 5325 6203 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22610 protein_id gnl|my_center|LOCUS_38810 6301 6909 gene locus_tag LOCUS_38820 gene coaE 6301 6909 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_38820 >Feature sequence182 102 446 gene locus_tag LOCUS_38830 102 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 501 887 gene locus_tag LOCUS_38840 501 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 1799 960 gene locus_tag LOCUS_38850 1799 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 2997 1909 gene locus_tag LOCUS_38860 gene acd 2997 1909 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_38860 5851 3134 gene locus_tag LOCUS_38870 5851 3134 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860863.1 protein_id gnl|my_center|LOCUS_38870 6058 6447 gene locus_tag LOCUS_38880 6058 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence183 122 751 gene locus_tag LOCUS_38890 122 751 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_38890 768 1448 gene locus_tag LOCUS_38900 768 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 1445 2362 gene locus_tag LOCUS_38910 1445 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 2366 3994 gene locus_tag LOCUS_38920 2366 3994 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_38920 4094 5317 gene locus_tag LOCUS_38930 4094 5317 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878671.1 protein_id gnl|my_center|LOCUS_38930 5443 5772 gene locus_tag LOCUS_38940 5443 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence184 2382 688 gene locus_tag LOCUS_38950 gene modF 2382 688 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096900.1 protein_id gnl|my_center|LOCUS_38950 2580 5702 gene locus_tag LOCUS_38960 gene lacZ 2580 5702 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHZ6 protein_id gnl|my_center|LOCUS_38960 6226 5795 gene locus_tag LOCUS_38970 6226 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence185 1030 293 gene locus_tag LOCUS_38980 gene ccmC 1030 293 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_38980 1916 1197 gene locus_tag LOCUS_38990 gene ccmB 1916 1197 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N6 protein_id gnl|my_center|LOCUS_38990 2551 1922 gene locus_tag LOCUS_39000 gene ccmA 2551 1922 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N7 protein_id gnl|my_center|LOCUS_39000 2804 3526 gene locus_tag LOCUS_39010 2804 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_39010 4137 3499 gene locus_tag LOCUS_39020 4137 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_39020 4884 4162 gene locus_tag LOCUS_39030 4884 4162 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_39030 5833 4871 gene locus_tag LOCUS_39040 5833 4871 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_39040 5948 6025 gene locus_tag LOCUS_t00190 5948 6025 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence186 708 956 gene locus_tag LOCUS_39050 708 956 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_39050 957 1295 gene locus_tag LOCUS_39060 957 1295 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 protein_id gnl|my_center|LOCUS_39060 1354 3057 gene locus_tag LOCUS_39070 gene sopT 1354 3057 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_39070 4993 3065 gene locus_tag LOCUS_39080 gene cysNC 4993 3065 CDS product bifunctional enzyme CysN/CysC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UMW2 protein_id gnl|my_center|LOCUS_39080 5920 5012 gene locus_tag LOCUS_39090 gene cysD 5920 5012 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_39090 >Feature sequence187 131 406 gene locus_tag LOCUS_39100 131 406 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_39100 2288 561 gene locus_tag LOCUS_39110 2288 561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_39110 3379 2294 gene locus_tag LOCUS_39120 3379 2294 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_39120 4685 3384 gene locus_tag LOCUS_39130 4685 3384 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_39130 4977 5837 gene locus_tag LOCUS_39140 4977 5837 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777001.1 protein_id gnl|my_center|LOCUS_39140 >Feature sequence188 966 115 gene locus_tag LOCUS_39150 966 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLC7 protein_id gnl|my_center|LOCUS_39150 1097 2050 gene locus_tag LOCUS_39160 gene gbuA 1097 2050 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_39160 3622 2228 gene locus_tag LOCUS_39170 3622 2228 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_39170 4316 3609 gene locus_tag LOCUS_39180 4316 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106155.1 protein_id gnl|my_center|LOCUS_39180 5158 4313 gene locus_tag LOCUS_39190 5158 4313 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403318.1 protein_id gnl|my_center|LOCUS_39190 5324 5752 gene locus_tag LOCUS_39200 5324 5752 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_39200 >Feature sequence189 29 1075 gene locus_tag LOCUS_39210 29 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 2504 1056 gene locus_tag LOCUS_39220 2504 1056 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_39220 3842 2574 gene locus_tag LOCUS_39230 3842 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_39230 5237 3852 gene locus_tag LOCUS_39240 5237 3852 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_39240 5638 5234 gene locus_tag LOCUS_39250 5638 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 >Feature sequence190 1355 726 gene locus_tag LOCUS_39260 1355 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1722 3185 gene locus_tag LOCUS_39270 1722 3185 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_39270 3775 4671 gene locus_tag LOCUS_39280 3775 4671 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_39280 >Feature sequence191 1262 1540 gene locus_tag LOCUS_39290 1262 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39290 1712 2020 gene locus_tag LOCUS_39300 1712 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2005 3153 gene locus_tag LOCUS_39310 2005 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 3713 5086 gene locus_tag LOCUS_39320 gene hemL 3713 5086 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LY3 protein_id gnl|my_center|LOCUS_39320 5583 5221 gene locus_tag LOCUS_39330 gene vapc23 5583 5221 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P7A1 protein_id gnl|my_center|LOCUS_39330 >Feature sequence192 1486 155 gene locus_tag LOCUS_39340 1486 155 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037500.1 protein_id gnl|my_center|LOCUS_39340 2200 1550 gene locus_tag LOCUS_39350 gene gph 2200 1550 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_39350 2496 2206 gene locus_tag LOCUS_39360 2496 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105135.1 protein_id gnl|my_center|LOCUS_39360 3238 2639 gene locus_tag LOCUS_39370 3238 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 4084 3371 gene locus_tag LOCUS_39380 4084 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_39380 4221 5147 gene locus_tag LOCUS_39390 4221 5147 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence193 1225 1596 gene locus_tag LOCUS_39400 1225 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 1614 2576 gene locus_tag LOCUS_39410 1614 2576 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_39410 2727 4238 gene locus_tag LOCUS_39420 gene purF 2727 4238 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ7 protein_id gnl|my_center|LOCUS_39420 4270 4782 gene locus_tag LOCUS_39430 4270 4782 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_39430 4784 5077 gene locus_tag LOCUS_39440 4784 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence194 324 566 gene locus_tag LOCUS_39450 324 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 563 988 gene locus_tag LOCUS_39460 gene vapC 563 988 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMY3 protein_id gnl|my_center|LOCUS_39460 1149 937 gene locus_tag LOCUS_39470 1149 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 2067 1171 gene locus_tag LOCUS_39480 2067 1171 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_39480 2781 2272 gene locus_tag LOCUS_39490 2781 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 3158 3502 gene locus_tag LOCUS_39500 3158 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 4917 3796 gene locus_tag LOCUS_39510 4917 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 >Feature sequence195 148 375 gene locus_tag LOCUS_39520 148 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 356 496 gene locus_tag LOCUS_39530 356 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 1292 612 gene locus_tag LOCUS_39540 1292 612 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_39540 2278 4590 gene locus_tag LOCUS_39550 2278 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39550 >Feature sequence196 221 838 gene locus_tag LOCUS_39560 221 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39560 852 1610 gene locus_tag LOCUS_39570 852 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39570 1686 2723 gene locus_tag LOCUS_39580 gene hemE 1686 2723 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RV96 protein_id gnl|my_center|LOCUS_39580 3216 4460 gene locus_tag LOCUS_39590 3216 4460 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227900.1 protein_id gnl|my_center|LOCUS_39590 >Feature sequence197 259 74 gene locus_tag LOCUS_39600 259 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 879 376 gene locus_tag LOCUS_39610 879 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 1663 2274 gene locus_tag LOCUS_39620 1663 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 2903 3244 gene locus_tag LOCUS_39630 2903 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 4469 3423 gene locus_tag LOCUS_39640 4469 3423 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_39640 >Feature sequence198 339 953 gene locus_tag LOCUS_39650 339 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 1128 2168 gene locus_tag LOCUS_39660 1128 2168 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_39660 2232 2666 gene locus_tag LOCUS_39670 2232 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_39670 2714 4108 gene locus_tag LOCUS_39680 2714 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 >Feature sequence199 951 184 gene locus_tag LOCUS_39690 gene hmuV 951 184 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68877 protein_id gnl|my_center|LOCUS_39690 1979 948 gene locus_tag LOCUS_39700 1979 948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_39700 2845 1979 gene locus_tag LOCUS_39710 gene sfsA 2845 1979 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG4 protein_id gnl|my_center|LOCUS_39710 4095 2914 gene locus_tag LOCUS_39720 4095 2914 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_39720 >Feature sequence200