>Feature sequence0001 5004 469 gene locus_tag LOCUS_00010 5004 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 5903 7363 gene locus_tag LOCUS_00020 5903 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7864 8448 gene locus_tag LOCUS_00030 7864 8448 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_00030 8849 9427 gene locus_tag LOCUS_00040 8849 9427 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_00040 9622 13455 gene locus_tag LOCUS_00050 9622 13455 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_00050 13524 15047 gene locus_tag LOCUS_00060 13524 15047 CDS product all-trans-retinol 13,14-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_00060 15049 16743 gene locus_tag LOCUS_00070 15049 16743 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_00070 16733 18040 gene locus_tag LOCUS_00080 16733 18040 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_00080 18092 19756 gene locus_tag LOCUS_00090 18092 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 20214 19822 gene locus_tag LOCUS_00100 20214 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 20484 21746 gene locus_tag LOCUS_00110 20484 21746 CDS product dehydrogenase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_00110 25852 21845 gene locus_tag LOCUS_00120 25852 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 26104 26580 gene locus_tag LOCUS_00130 26104 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 >Feature sequence0002 150 884 gene locus_tag LOCUS_00140 gene rpsB 150 884 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z4 protein_id gnl|my_center|LOCUS_00140 952 1791 gene locus_tag LOCUS_00150 gene tsf 952 1791 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_00150 1885 2595 gene locus_tag LOCUS_00160 gene pyrH 1885 2595 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_00160 2705 3268 gene locus_tag LOCUS_00170 gene frr 2705 3268 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_00170 5451 3346 gene locus_tag LOCUS_00180 5451 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_00180 6954 5593 gene locus_tag LOCUS_00190 6954 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 7506 6991 gene locus_tag LOCUS_00200 7506 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence0003 1092 3608 gene locus_tag LOCUS_00210 1092 3608 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_00210 4764 5297 gene locus_tag LOCUS_00220 4764 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 6423 6839 gene locus_tag LOCUS_00230 6423 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 8090 6873 gene locus_tag LOCUS_00240 8090 6873 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_00240 >Feature sequence0004 <1 912 gene locus_tag LOCUS_00250 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000787351.1:isocitrate lyase 1038 3281 gene locus_tag LOCUS_00260 1038 3281 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_00260 3294 4025 gene locus_tag LOCUS_00270 gene cutC 3294 4025 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 protein_id gnl|my_center|LOCUS_00270 4065 6620 gene locus_tag LOCUS_00280 4065 6620 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_00280 7992 6604 gene locus_tag LOCUS_00290 7992 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence0005 152 1072 gene locus_tag LOCUS_00300 152 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 1099 2676 gene locus_tag LOCUS_00310 1099 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 2983 4383 gene locus_tag LOCUS_00320 gene trpE 2983 4383 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_00320 4404 4994 gene locus_tag LOCUS_00330 4404 4994 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_00330 5004 5996 gene locus_tag LOCUS_00340 gene trpD 5004 5996 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_00340 5998 6816 gene locus_tag LOCUS_00350 gene trpC 5998 6816 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_00350 6806 7429 gene locus_tag LOCUS_00360 gene trpF 6806 7429 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_00360 >Feature sequence0006 487 1227 gene locus_tag LOCUS_00370 487 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 1833 1303 gene locus_tag LOCUS_00380 1833 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_00380 3338 2007 gene locus_tag LOCUS_00390 3338 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 5314 3479 gene locus_tag LOCUS_00400 5314 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 5895 6641 gene locus_tag LOCUS_00410 5895 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 6823 7869 gene locus_tag LOCUS_00420 6823 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 >Feature sequence0007 <1 955 gene locus_tag LOCUS_00430 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZG8:DNA polymerase IV 1785 958 gene locus_tag LOCUS_00440 1785 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 3612 2029 gene locus_tag LOCUS_00450 3612 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 4335 3697 gene locus_tag LOCUS_00460 4335 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 4592 6025 gene locus_tag LOCUS_00470 4592 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6043 6963 gene locus_tag LOCUS_00480 6043 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7179 7625 gene locus_tag LOCUS_00490 gene rplM 7179 7625 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA12 protein_id gnl|my_center|LOCUS_00490 >Feature sequence0008 1191 1760 gene locus_tag LOCUS_00500 1191 1760 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_00500 1781 2377 gene locus_tag LOCUS_00510 1781 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 2454 2837 gene locus_tag LOCUS_00520 2454 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3683 2871 gene locus_tag LOCUS_00530 3683 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5969 3696 gene locus_tag LOCUS_00540 5969 3696 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_00540 <7805 6155 gene locus_tag LOCUS_00550 <7805 6155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase >Feature sequence0009 619 260 gene locus_tag LOCUS_00560 619 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 1006 644 gene locus_tag LOCUS_00570 1006 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2188 1148 gene locus_tag LOCUS_00580 2188 1148 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D8 protein_id gnl|my_center|LOCUS_00580 3480 2203 gene locus_tag LOCUS_00590 gene serS 3480 2203 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_00590 3899 5584 gene locus_tag LOCUS_00600 gene rho 3899 5584 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_00600 5728 6669 gene locus_tag LOCUS_00610 5728 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 7185 6712 gene locus_tag LOCUS_00620 7185 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963491.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence0010 769 2169 gene locus_tag LOCUS_00630 769 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2838 2170 gene locus_tag LOCUS_00640 2838 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00640 3210 2842 gene locus_tag LOCUS_00650 3210 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00650 4255 3320 gene locus_tag LOCUS_00660 4255 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_00660 4520 5035 gene locus_tag LOCUS_00670 4520 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6480 5074 gene locus_tag LOCUS_00680 6480 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 <7310 6440 gene locus_tag LOCUS_00690 <7310 6440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109196.1:zinc protease note possible pseudo, frameshifted >Feature sequence0011 <1 921 gene locus_tag LOCUS_00700 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:magnesium chelatase 948 1304 gene locus_tag LOCUS_00710 948 1304 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_00710 1304 1624 gene locus_tag LOCUS_00720 1304 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 1894 2694 gene locus_tag LOCUS_00730 1894 2694 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_00730 2770 3594 gene locus_tag LOCUS_00740 2770 3594 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_00740 3642 4388 gene locus_tag LOCUS_00750 3642 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 6129 5590 gene locus_tag LOCUS_00760 6129 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 6780 6271 gene locus_tag LOCUS_00770 6780 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence0012 1241 2899 gene locus_tag LOCUS_00780 1241 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3597 2896 gene locus_tag LOCUS_00790 3597 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 5073 3625 gene locus_tag LOCUS_00800 5073 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 5642 5076 gene locus_tag LOCUS_00810 5642 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence0013 520 1719 gene locus_tag LOCUS_00820 520 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 1815 2894 gene locus_tag LOCUS_00830 1815 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 3604 2909 gene locus_tag LOCUS_00840 gene pth 3604 2909 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_00840 4315 3710 gene locus_tag LOCUS_00850 gene rplY 4315 3710 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_00850 6658 4403 gene locus_tag LOCUS_00860 6658 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence0014 2707 440 gene locus_tag LOCUS_00870 2707 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 6012 2818 gene locus_tag LOCUS_00880 6012 2818 CDS product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_00880 6096 6260 gene locus_tag LOCUS_00890 6096 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 >Feature sequence0015 <1 1048 gene locus_tag LOCUS_00900 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797797.1:N-acetylmuramoyl-L-alanine amidase 1202 2266 gene locus_tag LOCUS_00910 gene serC 1202 2266 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_00910 2416 4152 gene locus_tag LOCUS_00920 2416 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4927 4154 gene locus_tag LOCUS_00930 4927 4154 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_00930 5470 4940 gene locus_tag LOCUS_00940 gene gldD 5470 4940 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_00940 <6593 5573 gene locus_tag LOCUS_00950 <6593 5573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202475.1:hemolysin >Feature sequence0016 <1 1471 gene locus_tag LOCUS_00960 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877378.1:cryptochrome/photolyase family protein 1954 1535 gene locus_tag LOCUS_00970 1954 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4363 2039 gene locus_tag LOCUS_00980 4363 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 4619 6100 gene locus_tag LOCUS_00990 gene glpK 4619 6100 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI03 protein_id gnl|my_center|LOCUS_00990 >Feature sequence0017 1094 63 gene locus_tag LOCUS_01000 1094 63 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_01000 1591 3198 gene locus_tag LOCUS_01010 1591 3198 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_01010 3424 4701 gene locus_tag LOCUS_01020 3424 4701 CDS product endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_01020 4802 6403 gene locus_tag LOCUS_01030 gene dagA 4802 6403 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_01030 >Feature sequence0018 530 1189 gene locus_tag LOCUS_01040 530 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1202 1528 gene locus_tag LOCUS_01050 1202 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2003 1536 gene locus_tag LOCUS_01060 2003 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3964 2096 gene locus_tag LOCUS_01070 gene mutL 3964 2096 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_01070 4410 4060 gene locus_tag LOCUS_01080 4410 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5117 4410 gene locus_tag LOCUS_01090 5117 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 <6427 5200 gene locus_tag LOCUS_01100 <6427 5200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783855.1:ABC transporter ATP-binding protein >Feature sequence0019 486 31 gene locus_tag LOCUS_01110 486 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1568 573 gene locus_tag LOCUS_01120 gene murB 1568 573 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_01120 1979 1680 gene locus_tag LOCUS_01130 1979 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4618 3497 gene locus_tag LOCUS_01140 4618 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4729 5439 gene locus_tag LOCUS_01150 4729 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence0020 1269 2171 gene locus_tag LOCUS_01160 gene mvaK 1269 2171 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_01160 3361 2168 gene locus_tag LOCUS_01170 gene natB 3361 2168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_01170 4391 3480 gene locus_tag LOCUS_01180 gene natA 4391 3480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_01180 5241 4474 gene locus_tag LOCUS_01190 5241 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence0021 687 1907 gene locus_tag LOCUS_01200 687 1907 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_01200 2257 3465 gene locus_tag LOCUS_01210 2257 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3798 5051 gene locus_tag LOCUS_01220 gene hemA 3798 5051 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67314 protein_id gnl|my_center|LOCUS_01220 >Feature sequence0022 1685 1305 gene locus_tag LOCUS_01230 1685 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2021 3496 gene locus_tag LOCUS_01240 2021 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence0023 1897 1115 gene locus_tag LOCUS_01250 1897 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2955 2032 gene locus_tag LOCUS_01260 2955 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 3405 2980 gene locus_tag LOCUS_01270 3405 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3839 4717 gene locus_tag LOCUS_01280 3839 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_01280 4756 5178 gene locus_tag LOCUS_01290 4756 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01290 5178 5582 gene locus_tag LOCUS_01300 5178 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 >Feature sequence0024 463 1524 gene locus_tag LOCUS_01310 463 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 4539 1531 gene locus_tag LOCUS_01320 4539 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 4937 5602 gene locus_tag LOCUS_01330 4937 5602 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087771.1 protein_id gnl|my_center|LOCUS_01330 6174 5662 gene locus_tag LOCUS_01340 6174 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence0025 742 194 gene locus_tag LOCUS_01350 742 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 1200 1367 gene locus_tag LOCUS_01360 1200 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2765 1620 gene locus_tag LOCUS_01370 2765 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3592 2816 gene locus_tag LOCUS_01380 3592 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5472 4318 gene locus_tag LOCUS_01390 5472 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6028 5537 gene locus_tag LOCUS_01400 6028 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence0026 199 423 gene locus_tag LOCUS_01410 199 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01410 484 696 gene locus_tag LOCUS_01420 484 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01420 713 1864 gene locus_tag LOCUS_01430 713 1864 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_01430 2298 1861 gene locus_tag LOCUS_01440 2298 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_01440 3930 2560 gene locus_tag LOCUS_01450 3930 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5211 4093 gene locus_tag LOCUS_01460 gene dnaN 5211 4093 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_01460 >Feature sequence0027 485 1183 gene locus_tag LOCUS_01470 485 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 1219 2130 gene locus_tag LOCUS_01480 1219 2130 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_01480 2145 3323 gene locus_tag LOCUS_01490 gene hisC 2145 3323 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_01490 3491 4657 gene locus_tag LOCUS_01500 3491 4657 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405138.1 protein_id gnl|my_center|LOCUS_01500 4659 5132 gene locus_tag LOCUS_01510 4659 5132 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_01510 5200 5934 gene locus_tag LOCUS_01520 gene coaX 5200 5934 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XF4 protein_id gnl|my_center|LOCUS_01520 >Feature sequence0028 637 2061 gene locus_tag LOCUS_01530 637 2061 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_01530 2109 3425 gene locus_tag LOCUS_01540 2109 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 4080 3436 gene locus_tag LOCUS_01550 4080 3436 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_01550 5094 4081 gene locus_tag LOCUS_01560 5094 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence0029 1916 78 gene locus_tag LOCUS_01570 1916 78 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_01570 2322 2249 gene locus_tag LOCUS_t00010 2322 2249 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3060 2479 gene locus_tag LOCUS_01580 3060 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4263 3190 gene locus_tag LOCUS_01590 4263 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4842 4336 gene locus_tag LOCUS_01600 gene tpx 4842 4336 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_01600 >Feature sequence0030 1819 629 gene locus_tag LOCUS_01610 gene rsmB 1819 629 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_01610 1971 3263 gene locus_tag LOCUS_01620 gene rocD 1971 3263 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_01620 3988 3281 gene locus_tag LOCUS_01630 3988 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4214 4453 gene locus_tag LOCUS_01640 4214 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4674 5168 gene locus_tag LOCUS_01650 4674 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence0031 1218 76 gene locus_tag LOCUS_01660 1218 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2800 1808 gene locus_tag LOCUS_01670 2800 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3063 4358 gene locus_tag LOCUS_01680 3063 4358 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_01680 5050 4478 gene locus_tag LOCUS_01690 5050 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence0032 <1 2934 gene locus_tag LOCUS_01700 <1 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 3137 3361 gene locus_tag LOCUS_01710 3137 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4991 3411 gene locus_tag LOCUS_01720 4991 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence0033 1163 1744 gene locus_tag LOCUS_01730 1163 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 1737 2228 gene locus_tag LOCUS_01740 1737 2228 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 protein_id gnl|my_center|LOCUS_01740 3109 2246 gene locus_tag LOCUS_01750 3109 2246 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_01750 3313 3387 gene locus_tag LOCUS_t00020 3313 3387 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3909 3442 gene locus_tag LOCUS_01760 3909 3442 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HG87 protein_id gnl|my_center|LOCUS_01760 4061 4957 gene locus_tag LOCUS_01770 4061 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence0034 886 1650 gene locus_tag LOCUS_01780 886 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2470 1643 gene locus_tag LOCUS_01790 2470 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3525 2644 gene locus_tag LOCUS_01800 3525 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 5531 3522 gene locus_tag LOCUS_01810 5531 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence0035 2723 1998 gene locus_tag LOCUS_01820 2723 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5261 2730 gene locus_tag LOCUS_01830 5261 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence0036 523 119 gene locus_tag LOCUS_01840 523 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 1278 532 gene locus_tag LOCUS_01850 1278 532 CDS product N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003782.1 protein_id gnl|my_center|LOCUS_01850 1977 2318 gene locus_tag LOCUS_01860 1977 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2399 3190 gene locus_tag LOCUS_01870 2399 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3310 4212 gene locus_tag LOCUS_01880 3310 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 <5619 4253 gene locus_tag LOCUS_01890 <5619 4253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase >Feature sequence0037 2709 772 gene locus_tag LOCUS_01900 gene thrS 2709 772 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_01900 3704 4741 gene locus_tag LOCUS_01910 gene guaC 3704 4741 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFP5 protein_id gnl|my_center|LOCUS_01910 5102 4746 gene locus_tag LOCUS_01920 5102 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence0038 <1 1752 gene locus_tag LOCUS_01930 <1 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:peptidase 5061 2659 gene locus_tag LOCUS_01940 5061 2659 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_01940 >Feature sequence0039 1559 312 gene locus_tag LOCUS_01950 1559 312 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674500.1 protein_id gnl|my_center|LOCUS_01950 1685 2950 gene locus_tag LOCUS_01960 1685 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3861 2971 gene locus_tag LOCUS_01970 3861 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 3977 5056 gene locus_tag LOCUS_01980 3977 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0040 633 1169 gene locus_tag LOCUS_01990 633 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 1911 1252 gene locus_tag LOCUS_02000 1911 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2177 2869 gene locus_tag LOCUS_02010 2177 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 2908 4386 gene locus_tag LOCUS_02020 2908 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence0041 1775 450 gene locus_tag LOCUS_02030 gene murA 1775 450 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_02030 1956 2906 gene locus_tag LOCUS_02040 1956 2906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723973.1 protein_id gnl|my_center|LOCUS_02040 <5311 2910 gene locus_tag LOCUS_02050 <5311 2910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476570.1:ATPase >Feature sequence0042 540 85 gene locus_tag LOCUS_02060 540 85 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_02060 <5309 959 gene locus_tag LOCUS_02070 <5309 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence0043 <1 680 gene locus_tag LOCUS_02080 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A455:glutamate--tRNA ligase 904 1329 gene locus_tag LOCUS_02090 gene dksA 904 1329 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_02090 1586 1660 gene locus_tag LOCUS_t00030 1586 1660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1727 2128 gene locus_tag LOCUS_02100 1727 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 2188 2376 gene locus_tag LOCUS_02110 gene rpmG 2188 2376 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_02110 2379 2555 gene locus_tag LOCUS_02120 2379 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2744 3718 gene locus_tag LOCUS_02130 gene ftsY 2744 3718 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_02130 4326 3715 gene locus_tag LOCUS_02140 4326 3715 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053721.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence0044 1252 116 gene locus_tag LOCUS_02150 1252 116 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679043.1 protein_id gnl|my_center|LOCUS_02150 1753 1325 gene locus_tag LOCUS_02160 1753 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_02160 3535 2057 gene locus_tag LOCUS_02170 3535 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4770 3541 gene locus_tag LOCUS_02180 4770 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence0045 <1 1141 gene locus_tag LOCUS_02190 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761012.1:helicase 1197 1829 gene locus_tag LOCUS_02200 1197 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2506 1826 gene locus_tag LOCUS_02210 2506 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3380 2793 gene locus_tag LOCUS_02220 3380 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957050.1 protein_id gnl|my_center|LOCUS_02220 4188 3460 gene locus_tag LOCUS_02230 4188 3460 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence0046 712 987 gene locus_tag LOCUS_02240 712 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 974 1138 gene locus_tag LOCUS_02250 974 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 1241 2188 gene locus_tag LOCUS_02260 1241 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2350 3177 gene locus_tag LOCUS_02270 2350 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4586 3174 gene locus_tag LOCUS_02280 4586 3174 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_02280 4947 4630 gene locus_tag LOCUS_02290 4947 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence0047 324 1505 gene locus_tag LOCUS_02300 324 1505 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_02300 1624 2487 gene locus_tag LOCUS_02310 1624 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2648 3919 gene locus_tag LOCUS_02320 2648 3919 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_02320 4814 3930 gene locus_tag LOCUS_02330 4814 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence0048 <1 645 gene locus_tag LOCUS_02340 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857908.1:D-glycero-D-manno-heptose 1-phosphate guanosyltransferase 1788 640 gene locus_tag LOCUS_02350 1788 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 2130 2897 gene locus_tag LOCUS_02360 2130 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 2920 3300 gene locus_tag LOCUS_02370 2920 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 <5158 3302 gene locus_tag LOCUS_02380 <5158 3302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963607.1:TonB-dependent receptor >Feature sequence0049 3463 1655 gene locus_tag LOCUS_02390 gene typA 3463 1655 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_02390 3734 4216 gene locus_tag LOCUS_02400 3734 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4502 4257 gene locus_tag LOCUS_02410 4502 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence0050 3203 4189 gene locus_tag LOCUS_02420 3203 4189 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence0051 1991 2647 gene locus_tag LOCUS_02430 1991 2647 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107634.1 protein_id gnl|my_center|LOCUS_02430 2661 3683 gene locus_tag LOCUS_02440 gene thiL 2661 3683 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6J9 protein_id gnl|my_center|LOCUS_02440 3697 4152 gene locus_tag LOCUS_02450 3697 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence0052 3175 2408 gene locus_tag LOCUS_02460 3175 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4310 3186 gene locus_tag LOCUS_02470 4310 3186 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence0053 <1 1722 gene locus_tag LOCUS_02480 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:peptidase S9 2773 1724 gene locus_tag LOCUS_02490 2773 1724 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_02490 3972 2779 gene locus_tag LOCUS_02500 3972 2779 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964355.1 protein_id gnl|my_center|LOCUS_02500 4268 3996 gene locus_tag LOCUS_02510 4268 3996 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_02510 <5039 4293 gene locus_tag LOCUS_02520 <5039 4293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964361.1:ABC transporter >Feature sequence0054 1238 579 gene locus_tag LOCUS_02530 gene pcm 1238 579 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_02530 1406 2803 gene locus_tag LOCUS_02540 1406 2803 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_02540 3045 4706 gene locus_tag LOCUS_02550 gene recN 3045 4706 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_02550 >Feature sequence0055 338 1792 gene locus_tag LOCUS_02560 gene nadV 338 1792 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 protein_id gnl|my_center|LOCUS_02560 3104 1848 gene locus_tag LOCUS_02570 gene cysN 3104 1848 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_02570 4040 3138 gene locus_tag LOCUS_02580 gene cysD 4040 3138 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_02580 4737 4138 gene locus_tag LOCUS_02590 gene cysC 4737 4138 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence0056 509 1012 gene locus_tag LOCUS_02600 509 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 1104 2183 gene locus_tag LOCUS_02610 1104 2183 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_02610 3102 2170 gene locus_tag LOCUS_02620 3102 2170 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_02620 3978 3124 gene locus_tag LOCUS_02630 gene ephD 3978 3124 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence0057 <1 1572 gene locus_tag LOCUS_02640 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123785.1:phosphatase 1598 2446 gene locus_tag LOCUS_02650 1598 2446 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_02650 3821 2460 gene locus_tag LOCUS_02660 3821 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence0058 <1 3151 gene locus_tag LOCUS_02670 <1 3151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962454.1:peptidase M36 3550 3475 gene locus_tag LOCUS_t00040 3550 3475 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <4952 3944 gene locus_tag LOCUS_02680 <4952 3944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932245.1:zinc metalloendopeptidase >Feature sequence0059 276 818 gene locus_tag LOCUS_02690 276 818 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_02690 811 2373 gene locus_tag LOCUS_02700 811 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence0060 3 374 gene locus_tag LOCUS_02710 3 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1524 352 gene locus_tag LOCUS_02720 1524 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2030 2332 gene locus_tag LOCUS_02730 2030 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3583 2924 gene locus_tag LOCUS_02740 gene pdxH 3583 2924 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_02740 4751 4038 gene locus_tag LOCUS_02750 4751 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence0061 3379 2168 gene locus_tag LOCUS_02760 3379 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_02760 3921 4160 gene locus_tag LOCUS_02770 gene acpP 3921 4160 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_02770 >Feature sequence0062 2649 1303 gene locus_tag LOCUS_02780 2649 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4261 2777 gene locus_tag LOCUS_02790 4261 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence0063 3 1640 gene locus_tag LOCUS_02800 3 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2142 3470 gene locus_tag LOCUS_02810 2142 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3474 4760 gene locus_tag LOCUS_02820 3474 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence0064 >Feature sequence0065 202 1269 gene locus_tag LOCUS_02830 202 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1403 1612 gene locus_tag LOCUS_02840 1403 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1688 3100 gene locus_tag LOCUS_02850 1688 3100 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_02850 3214 4122 gene locus_tag LOCUS_02860 3214 4122 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence0066 212 1228 gene locus_tag LOCUS_02870 gene aroF1 212 1228 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_02870 1259 2497 gene locus_tag LOCUS_02880 gene aroA 1259 2497 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_02880 3303 2494 gene locus_tag LOCUS_02890 3303 2494 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690200.1 protein_id gnl|my_center|LOCUS_02890 3608 4576 gene locus_tag LOCUS_02900 3608 4576 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence0067 2522 2905 gene locus_tag LOCUS_02910 2522 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3138 3605 gene locus_tag LOCUS_02920 3138 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3872 3654 gene locus_tag LOCUS_02930 3872 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 <4825 3889 gene locus_tag LOCUS_02940 <4825 3889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759986.1:lipoprotein >Feature sequence0068 1339 146 gene locus_tag LOCUS_02950 1339 146 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_02950 2526 1330 gene locus_tag LOCUS_02960 2526 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900087.1 protein_id gnl|my_center|LOCUS_02960 4638 2539 gene locus_tag LOCUS_02970 4638 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence0069 <1 892 gene locus_tag LOCUS_02980 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha 976 1875 gene locus_tag LOCUS_02990 gene atpG 976 1875 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_02990 2020 2649 gene locus_tag LOCUS_03000 2020 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2639 2992 gene locus_tag LOCUS_03010 2639 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3451 4152 gene locus_tag LOCUS_03020 gene clpP 3451 4152 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_03020 >Feature sequence0070 332 1072 gene locus_tag LOCUS_03030 332 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_03030 1162 1533 gene locus_tag LOCUS_03040 1162 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 1647 2741 gene locus_tag LOCUS_03050 1647 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3308 4177 gene locus_tag LOCUS_03060 3308 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence0071 280 918 gene locus_tag LOCUS_03070 280 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1631 900 gene locus_tag LOCUS_03080 1631 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 3254 1725 gene locus_tag LOCUS_03090 3254 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence0072 784 1317 gene locus_tag LOCUS_03100 784 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 1344 4310 gene locus_tag LOCUS_03110 gene smc 1344 4310 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBS6 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03110 >Feature sequence0073 <1 1198 gene locus_tag LOCUS_03120 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108187.1:MATE family efflux transporter 1662 1204 gene locus_tag LOCUS_03130 1662 1204 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_03130 2527 1685 gene locus_tag LOCUS_03140 2527 1685 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_03140 2758 4404 gene locus_tag LOCUS_03150 2758 4404 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence0074 1654 665 gene locus_tag LOCUS_03160 1654 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1964 1608 gene locus_tag LOCUS_03170 1964 1608 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_03170 3227 2031 gene locus_tag LOCUS_03180 3227 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3893 3345 gene locus_tag LOCUS_03190 3893 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4546 3899 gene locus_tag LOCUS_03200 4546 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4703 4578 gene locus_tag LOCUS_03210 4703 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence0075 <1 1668 gene locus_tag LOCUS_03220 <1 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG 2072 1674 gene locus_tag LOCUS_03230 2072 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4151 2388 gene locus_tag LOCUS_03240 4151 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence0076 2328 367 gene locus_tag LOCUS_03250 2328 367 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_03250 <4694 2543 gene locus_tag LOCUS_03260 <4694 2543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence0077 2180 552 gene locus_tag LOCUS_03270 gene pyrG 2180 552 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_03270 2376 3551 gene locus_tag LOCUS_03280 2376 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3647 4186 gene locus_tag LOCUS_03290 3647 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4206 4433 gene locus_tag LOCUS_03300 4206 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence0078 613 23 gene locus_tag LOCUS_03310 613 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2002 1196 gene locus_tag LOCUS_03320 2002 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2230 4302 gene locus_tag LOCUS_03330 2230 4302 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072120.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence0079 1 570 gene locus_tag LOCUS_03340 1 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3195 616 gene locus_tag LOCUS_03350 3195 616 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_03350 3572 4249 gene locus_tag LOCUS_03360 3572 4249 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence0080 158 778 gene locus_tag LOCUS_03370 158 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 801 1622 gene locus_tag LOCUS_03380 801 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1707 2840 gene locus_tag LOCUS_03390 gene lpxB 1707 2840 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_03390 2911 3534 gene locus_tag LOCUS_03400 2911 3534 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence0081 1598 615 gene locus_tag LOCUS_03410 1598 615 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_03410 3038 1707 gene locus_tag LOCUS_03420 3038 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202114.1 protein_id gnl|my_center|LOCUS_03420 3757 3044 gene locus_tag LOCUS_03430 3757 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence0082 201 731 gene locus_tag LOCUS_03440 201 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 1855 845 gene locus_tag LOCUS_03450 1855 845 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_03450 3290 1917 gene locus_tag LOCUS_03460 3290 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3904 3359 gene locus_tag LOCUS_03470 gene rplQ 3904 3359 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A3 protein_id gnl|my_center|LOCUS_03470 <4641 3978 gene locus_tag LOCUS_03480 <4641 3978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A4A2:DNA-directed RNA polymerase subunit alpha >Feature sequence0083 3730 2009 gene locus_tag LOCUS_03490 3730 2009 CDS product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I596 protein_id gnl|my_center|LOCUS_03490 >Feature sequence0084 >Feature sequence0085 510 184 gene locus_tag LOCUS_03500 510 184 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_03500 1032 547 gene locus_tag LOCUS_03510 1032 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2458 1058 gene locus_tag LOCUS_03520 2458 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence0086 1481 381 gene locus_tag LOCUS_03530 1481 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 1682 3958 gene locus_tag LOCUS_03540 1682 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence0087 2249 1803 gene locus_tag LOCUS_03550 2249 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2932 2429 gene locus_tag LOCUS_03560 2932 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 <4511 3641 gene locus_tag LOCUS_03570 <4511 3641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963323.1:acyl-CoA dehydrogenase >Feature sequence0088 977 1999 gene locus_tag LOCUS_03580 gene recA 977 1999 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_03580 4290 2077 gene locus_tag LOCUS_03590 4290 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence0089 2311 1406 gene locus_tag LOCUS_03600 2311 1406 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_03600 3143 2433 gene locus_tag LOCUS_03610 3143 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3778 3194 gene locus_tag LOCUS_03620 3778 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence0090 <1 2942 gene locus_tag LOCUS_03630 <1 2942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase 3029 3985 gene locus_tag LOCUS_03640 3029 3985 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_03640 <4496 3990 gene locus_tag LOCUS_03650 <4496 3990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89KD9:heme A synthase >Feature sequence0091 1788 1420 gene locus_tag LOCUS_03660 1788 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2708 1953 gene locus_tag LOCUS_03670 2708 1953 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_03670 4376 2835 gene locus_tag LOCUS_03680 gene pepF 4376 2835 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence0092 <1 1144 gene locus_tag LOCUS_03690 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962704.1:tetrahydrofolate synthase 1280 3766 gene locus_tag LOCUS_03700 1280 3766 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence0093 804 1766 gene locus_tag LOCUS_03710 804 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 1937 2389 gene locus_tag LOCUS_03720 1937 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2444 3259 gene locus_tag LOCUS_03730 gene dapD 2444 3259 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_03730 4210 3317 gene locus_tag LOCUS_03740 4210 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence0094 1366 2289 gene locus_tag LOCUS_03750 1366 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2553 2897 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acttcagaggattgggattattgg 3029 3622 gene locus_tag LOCUS_03760 3029 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3636 4283 gene locus_tag LOCUS_03770 3636 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence0095 2287 1010 gene locus_tag LOCUS_03780 2287 1010 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_03780 <4404 2540 gene locus_tag LOCUS_03790 <4404 2540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:ABC transporter substrate-binding protein >Feature sequence0096 682 17 gene locus_tag LOCUS_03800 682 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 927 2705 gene locus_tag LOCUS_03810 927 2705 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_03810 3459 2782 gene locus_tag LOCUS_03820 3459 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence0097 4235 3825 gene locus_tag LOCUS_03830 4235 3825 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence0098 2243 3586 gene locus_tag LOCUS_03840 2243 3586 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence0099 2558 600 gene locus_tag LOCUS_03850 2558 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4361 2661 gene locus_tag LOCUS_03860 4361 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence0100 <1 1173 gene locus_tag LOCUS_03870 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073082.1:MFS transporter 1216 3030 gene locus_tag LOCUS_03880 1216 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3492 3100 gene locus_tag LOCUS_03890 3492 3100 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_03890 4126 3644 gene locus_tag LOCUS_03900 gene greA 4126 3644 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_03900 >Feature sequence0101 <1 1830 gene locus_tag LOCUS_03910 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870732.1:DNA methyltransferase 2522 3493 gene locus_tag LOCUS_03920 2522 3493 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence0102 1333 911 gene locus_tag LOCUS_03930 1333 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1414 2388 gene locus_tag LOCUS_03940 1414 2388 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206300.1 protein_id gnl|my_center|LOCUS_03940 3023 2604 gene locus_tag LOCUS_03950 3023 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence0103 1127 2746 gene locus_tag LOCUS_03960 1127 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2791 3501 gene locus_tag LOCUS_03970 gene truC 2791 3501 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0104 >Feature sequence0105 214 1827 gene locus_tag LOCUS_03980 gene gldM 214 1827 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_03980 1918 2790 gene locus_tag LOCUS_03990 1918 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence0106 783 22 gene locus_tag LOCUS_04000 783 22 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_04000 1105 2091 gene locus_tag LOCUS_04010 1105 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2329 3297 gene locus_tag LOCUS_04020 2329 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 >Feature sequence0107 2173 1061 gene locus_tag LOCUS_04030 2173 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2575 2246 gene locus_tag LOCUS_04040 2575 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2743 3954 gene locus_tag LOCUS_04050 gene pgk 2743 3954 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_04050 >Feature sequence0108 252 581 gene locus_tag LOCUS_04060 gene sufA 252 581 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_04060 2382 634 gene locus_tag LOCUS_04070 gene gldG 2382 634 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_04070 3188 2424 gene locus_tag LOCUS_04080 gene gldF 3188 2424 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_04080 4047 3373 gene locus_tag LOCUS_04090 4047 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence0109 45 350 gene locus_tag LOCUS_04100 45 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 981 361 gene locus_tag LOCUS_04110 981 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 1592 2791 gene locus_tag LOCUS_04120 1592 2791 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_04120 2799 4103 gene locus_tag LOCUS_04130 2799 4103 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence0110 695 129 gene locus_tag LOCUS_04140 695 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1208 2071 gene locus_tag LOCUS_04150 1208 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2272 2985 gene locus_tag LOCUS_04160 2272 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3043 3267 gene locus_tag LOCUS_04170 3043 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence0111 1903 1367 gene locus_tag LOCUS_04180 1903 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3786 2104 gene locus_tag LOCUS_04190 3786 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence0112 3840 1105 gene locus_tag LOCUS_04200 gene valS 3840 1105 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZM4 protein_id gnl|my_center|LOCUS_04200 >Feature sequence0113 836 138 gene locus_tag LOCUS_04210 836 138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_04210 1156 3060 gene locus_tag LOCUS_04220 1156 3060 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence0114 <1 725 gene locus_tag LOCUS_04230 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962912.1:organic solvent ABC transporter substrate-binding protein 1316 729 gene locus_tag LOCUS_04240 1316 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1410 2087 gene locus_tag LOCUS_04250 1410 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_04250 2174 2821 gene locus_tag LOCUS_04260 2174 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3001 3762 gene locus_tag LOCUS_04270 gene tpiA 3001 3762 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_04270 >Feature sequence0115 1898 2917 gene locus_tag LOCUS_04280 1898 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3182 3502 gene locus_tag LOCUS_04290 3182 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence0116 33 869 gene locus_tag LOCUS_04300 gene crtB 33 869 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_04300 869 2329 gene locus_tag LOCUS_04310 869 2329 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 protein_id gnl|my_center|LOCUS_04310 2319 2954 gene locus_tag LOCUS_04320 2319 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2954 3418 gene locus_tag LOCUS_04330 gene crtZ 2954 3418 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_04330 3415 4125 gene locus_tag LOCUS_04340 3415 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence0117 2124 925 gene locus_tag LOCUS_04350 2124 925 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence0118 572 817 gene locus_tag LOCUS_04360 572 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 1740 2267 gene locus_tag LOCUS_04370 1740 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence0119 796 1929 gene locus_tag LOCUS_04380 796 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2150 3331 gene locus_tag LOCUS_04390 2150 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3403 4113 gene locus_tag LOCUS_04400 3403 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence0120 >Feature sequence0121 532 2601 gene locus_tag LOCUS_04410 gene paaN 532 2601 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709127.1 protein_id gnl|my_center|LOCUS_04410 2624 3394 gene locus_tag LOCUS_04420 2624 3394 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence0122 2461 311 gene locus_tag LOCUS_04430 2461 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3335 2475 gene locus_tag LOCUS_04440 gene yegK 3335 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76395 protein_id gnl|my_center|LOCUS_04440 4024 3356 gene locus_tag LOCUS_04450 4024 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105161.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence0123 >Feature sequence0124 1462 635 gene locus_tag LOCUS_04460 1462 635 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence0125 435 2303 gene locus_tag LOCUS_04470 435 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2422 3819 gene locus_tag LOCUS_04480 2422 3819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence0126 2343 703 gene locus_tag LOCUS_04490 gene groL 2343 703 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_04490 2658 2392 gene locus_tag LOCUS_04500 gene groS 2658 2392 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_04500 >Feature sequence0127 512 102 gene locus_tag LOCUS_04510 512 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1711 878 gene locus_tag LOCUS_04520 1711 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04520 2026 1751 gene locus_tag LOCUS_04530 2026 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2797 2135 gene locus_tag LOCUS_04540 2797 2135 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_04540 3487 2912 gene locus_tag LOCUS_04550 gene pabA 3487 2912 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence0128 786 442 gene locus_tag LOCUS_04560 786 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 1565 1317 gene locus_tag LOCUS_04570 1565 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3139 1625 gene locus_tag LOCUS_04580 gene atpD 3139 1625 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_04580 >Feature sequence0129 1569 1141 gene locus_tag LOCUS_04590 1569 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2083 2523 gene locus_tag LOCUS_04600 2083 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2534 3646 gene locus_tag LOCUS_04610 gene smf 2534 3646 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_04610 4058 3648 gene locus_tag LOCUS_04620 4058 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202918.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence0130 616 17 gene locus_tag LOCUS_04630 616 17 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233023.1 protein_id gnl|my_center|LOCUS_04630 1582 704 gene locus_tag LOCUS_04640 1582 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 2147 2809 gene locus_tag LOCUS_04650 2147 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence0131 1213 449 gene locus_tag LOCUS_04660 1213 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 1885 1379 gene locus_tag LOCUS_04670 gene tpx 1885 1379 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEL7 protein_id gnl|my_center|LOCUS_04670 2368 4023 gene locus_tag LOCUS_04680 2368 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence0132 2061 1396 gene locus_tag LOCUS_04690 gene glpG 2061 1396 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_04690 2819 2112 gene locus_tag LOCUS_04700 2819 2112 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_04700 3222 2827 gene locus_tag LOCUS_04710 gene msrB 3222 2827 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence0133 1367 1777 gene locus_tag LOCUS_04720 1367 1777 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_04720 1891 2103 gene locus_tag LOCUS_04730 1891 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 2194 2454 gene locus_tag LOCUS_04740 2194 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04740 2563 3222 gene locus_tag LOCUS_04750 2563 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence0134 544 861 gene locus_tag LOCUS_04760 544 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 942 1517 gene locus_tag LOCUS_04770 942 1517 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_04770 1710 2126 gene locus_tag LOCUS_04780 1710 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3028 2141 gene locus_tag LOCUS_04790 gene folD 3028 2141 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_04790 3242 3865 gene locus_tag LOCUS_04800 gene udk 3242 3865 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59190 protein_id gnl|my_center|LOCUS_04800 >Feature sequence0135 428 967 gene locus_tag LOCUS_04810 428 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1016 1468 gene locus_tag LOCUS_04820 1016 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1529 2167 gene locus_tag LOCUS_04830 1529 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3239 3607 gene locus_tag LOCUS_04840 3239 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3775 3993 gene locus_tag LOCUS_04850 3775 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence0136 1272 790 gene locus_tag LOCUS_04860 gene cdd 1272 790 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_04860 1509 2888 gene locus_tag LOCUS_04870 1509 2888 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence0137 972 673 gene locus_tag LOCUS_04880 972 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1114 2226 gene locus_tag LOCUS_04890 1114 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2645 2337 gene locus_tag LOCUS_04900 2645 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 3049 2711 gene locus_tag LOCUS_04910 3049 2711 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870842.1 protein_id gnl|my_center|LOCUS_04910 <3989 3421 gene locus_tag LOCUS_04920 <3989 3421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767818.1:lipopolysaccharide biosynthesis protein >Feature sequence0138 570 343 gene locus_tag LOCUS_04930 570 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 697 1518 gene locus_tag LOCUS_04940 697 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 1838 2566 gene locus_tag LOCUS_04950 1838 2566 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence0139 1281 142 gene locus_tag LOCUS_04960 gene nadA 1281 142 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_04960 2781 1297 gene locus_tag LOCUS_04970 2781 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3437 2784 gene locus_tag LOCUS_04980 3437 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence0140 70 1269 gene locus_tag LOCUS_04990 70 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1290 2099 gene locus_tag LOCUS_05000 1290 2099 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_05000 2603 2115 gene locus_tag LOCUS_05010 2603 2115 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785712.1 protein_id gnl|my_center|LOCUS_05010 3856 2648 gene locus_tag LOCUS_05020 3856 2648 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969453.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence0141 2318 582 gene locus_tag LOCUS_05030 2318 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3526 2420 gene locus_tag LOCUS_05040 3526 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence0142 1455 2834 gene locus_tag LOCUS_05050 1455 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2858 3625 gene locus_tag LOCUS_05060 2858 3625 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence0143 896 549 gene locus_tag LOCUS_05070 896 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2927 990 gene locus_tag LOCUS_05080 2927 990 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_05080 3596 3042 gene locus_tag LOCUS_05090 3596 3042 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence0144 3407 48 gene locus_tag LOCUS_05100 3407 48 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence0145 <1 924 gene locus_tag LOCUS_05110 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963483.1:peptidoglycan synthetase 921 1724 gene locus_tag LOCUS_05120 gene ephD 921 1724 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_05120 2615 1755 gene locus_tag LOCUS_05130 2615 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3194 2625 gene locus_tag LOCUS_05140 3194 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 <3899 3307 gene locus_tag LOCUS_05150 <3899 3307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYR0:ribonuclease Y >Feature sequence0146 1024 2442 gene locus_tag LOCUS_05160 1024 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3207 2413 gene locus_tag LOCUS_05170 gene tatD 3207 2413 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0147 908 453 gene locus_tag LOCUS_05180 908 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1189 1914 gene locus_tag LOCUS_05190 1189 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1994 2428 gene locus_tag LOCUS_05200 gene dut 1994 2428 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_05200 2490 3491 gene locus_tag LOCUS_05210 2490 3491 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence0148 3832 1670 gene locus_tag LOCUS_05220 3832 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence0149 >Feature sequence0150 2185 1001 gene locus_tag LOCUS_05230 gene porY 2185 1001 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence0151 665 1915 gene locus_tag LOCUS_05240 665 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence0152 1404 688 gene locus_tag LOCUS_05250 1404 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2121 1696 gene locus_tag LOCUS_05260 2121 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 <3820 2123 gene locus_tag LOCUS_05270 <3820 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203288.1:membrane protein >Feature sequence0153 <1 669 gene locus_tag LOCUS_05280 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963147.1:methylcrotonoyl-CoA carboxylase 696 1553 gene locus_tag LOCUS_05290 696 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 1634 2512 gene locus_tag LOCUS_05300 gene udp 1634 2512 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_05300 3053 2667 gene locus_tag LOCUS_05310 3053 2667 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_05310 3258 3776 gene locus_tag LOCUS_05320 3258 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence0154 524 96 gene locus_tag LOCUS_05330 524 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 754 2427 gene locus_tag LOCUS_05340 754 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2550 3428 gene locus_tag LOCUS_05350 gene fabD 2550 3428 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_05350 >Feature sequence0155 261 953 gene locus_tag LOCUS_05360 261 953 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_05360 3238 1565 gene locus_tag LOCUS_05370 3238 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence0156 3278 333 gene locus_tag LOCUS_05380 3278 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence0157 855 2570 gene locus_tag LOCUS_05390 855 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2696 3061 gene locus_tag LOCUS_05400 gene panD 2696 3061 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM2 protein_id gnl|my_center|LOCUS_05400 >Feature sequence0158 508 1563 gene locus_tag LOCUS_05410 gene bioA 508 1563 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QN7 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 1597 1827 gene locus_tag LOCUS_05420 1597 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 2921 1824 gene locus_tag LOCUS_05430 2921 1824 CDS product metal-activated pyridoxal enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405150.1 protein_id gnl|my_center|LOCUS_05430 <3765 2988 gene locus_tag LOCUS_05440 <3765 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117292.1:MFS transporter >Feature sequence0159 <1 1601 gene locus_tag LOCUS_05450 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:cell envelope biogenesis protein OmpA 1849 2019 gene locus_tag LOCUS_05460 1849 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2484 2074 gene locus_tag LOCUS_05470 2484 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3299 2520 gene locus_tag LOCUS_05480 3299 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence0160 1627 689 gene locus_tag LOCUS_05490 1627 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2933 2568 gene locus_tag LOCUS_05500 2933 2568 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_05500 3564 2992 gene locus_tag LOCUS_05510 3564 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence0161 2 730 gene locus_tag LOCUS_05520 2 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1906 761 gene locus_tag LOCUS_05530 1906 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_05530 2894 1962 gene locus_tag LOCUS_05540 2894 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence0162 2096 2944 gene locus_tag LOCUS_05550 gene tktA 2096 2944 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence0163 <3742 2631 gene locus_tag LOCUS_05560 <3742 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762511.1:TonB-dependent receptor >Feature sequence0164 <1 942 gene locus_tag LOCUS_05570 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H010:tRNA N6-adenosine threonylcarbamoyltransferase 952 1503 gene locus_tag LOCUS_05580 952 1503 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 protein_id gnl|my_center|LOCUS_05580 3084 2056 gene locus_tag LOCUS_05590 3084 2056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_05590 <3729 3186 gene locus_tag LOCUS_05600 <3729 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964204.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB >Feature sequence0165 875 1288 gene locus_tag LOCUS_05610 875 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1388 2503 gene locus_tag LOCUS_05620 1388 2503 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_05620 2582 3703 gene locus_tag LOCUS_05630 gene irpA 2582 3703 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence0166 597 1115 gene locus_tag LOCUS_05640 597 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1428 1357 gene locus_tag LOCUS_t00050 1428 1357 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1949 1506 gene locus_tag LOCUS_05650 1949 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3224 1953 gene locus_tag LOCUS_05660 3224 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3416 3709 gene locus_tag LOCUS_05670 gene rpsO 3416 3709 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CEF6 protein_id gnl|my_center|LOCUS_05670 >Feature sequence0167 666 484 gene locus_tag LOCUS_05680 666 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1105 1770 gene locus_tag LOCUS_05690 gene map 1105 1770 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05690 1946 3424 gene locus_tag LOCUS_05700 1946 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence0168 580 1239 gene locus_tag LOCUS_05710 580 1239 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_05710 1236 2090 gene locus_tag LOCUS_05720 gene modC 1236 2090 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_05720 2083 2667 gene locus_tag LOCUS_05730 gene mobA 2083 2667 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM7 protein_id gnl|my_center|LOCUS_05730 2657 2896 gene locus_tag LOCUS_05740 2657 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence0169 2 193 gene locus_tag LOCUS_05750 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 203 799 gene locus_tag LOCUS_05760 gene ribE 203 799 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_05760 2357 807 gene locus_tag LOCUS_05770 gene tyrS 2357 807 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_05770 >Feature sequence0170 >Feature sequence0171 1126 233 gene locus_tag LOCUS_05780 1126 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2572 1175 gene locus_tag LOCUS_05790 2572 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3090 2680 gene locus_tag LOCUS_05800 3090 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 <3678 3118 gene locus_tag LOCUS_05810 <3678 3118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:radical SAM/Cys-rich domain protein >Feature sequence0172 218 1144 gene locus_tag LOCUS_05820 218 1144 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_05820 1367 2218 gene locus_tag LOCUS_05830 1367 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2336 3568 gene locus_tag LOCUS_05840 gene hutI 2336 3568 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_05840 >Feature sequence0173 2695 1409 gene locus_tag LOCUS_05850 gene eno 2695 1409 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37869 protein_id gnl|my_center|LOCUS_05850 3195 2806 gene locus_tag LOCUS_05860 gene yjgF 3195 2806 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence0174 971 441 gene locus_tag LOCUS_05870 971 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2483 1179 gene locus_tag LOCUS_05880 2483 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence0175 1123 683 gene locus_tag LOCUS_05890 1123 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1493 2182 gene locus_tag LOCUS_05900 1493 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence0176 861 523 gene locus_tag LOCUS_05910 861 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2244 874 gene locus_tag LOCUS_05920 gene gnfM 2244 874 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_05920 2952 2410 gene locus_tag LOCUS_05930 2952 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3566 2967 gene locus_tag LOCUS_05940 3566 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence0177 241 951 gene locus_tag LOCUS_05950 241 951 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_05950 1612 944 gene locus_tag LOCUS_05960 1612 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2798 1641 gene locus_tag LOCUS_05970 2798 1641 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence0178 852 2147 gene locus_tag LOCUS_05980 gene capL 852 2147 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0179 1803 1168 gene locus_tag LOCUS_05990 1803 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2991 1816 gene locus_tag LOCUS_06000 2991 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence0180 1868 942 gene locus_tag LOCUS_06010 1868 942 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975608.1 protein_id gnl|my_center|LOCUS_06010 3041 1896 gene locus_tag LOCUS_06020 3041 1896 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_06020 <3611 3050 gene locus_tag LOCUS_06030 <3611 3050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202693.1:glycosyl transferase >Feature sequence0181 1029 1556 gene locus_tag LOCUS_06040 1029 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1593 2612 gene locus_tag LOCUS_06050 1593 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06050 3423 2689 gene locus_tag LOCUS_06060 3423 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence0182 2612 1452 gene locus_tag LOCUS_06070 gene xseA 2612 1452 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_06070 3108 2818 gene locus_tag LOCUS_06080 3108 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence0183 224 1039 gene locus_tag LOCUS_06090 224 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1185 1775 gene locus_tag LOCUS_06100 1185 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2579 1935 gene locus_tag LOCUS_06110 2579 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3153 2635 gene locus_tag LOCUS_06120 3153 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence0184 <1 1090 gene locus_tag LOCUS_06130 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NE68:N-acetylmuramic acid 6-phosphate etherase 1280 1630 gene locus_tag LOCUS_06140 1280 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 2270 1713 gene locus_tag LOCUS_06150 2270 1713 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_06150 2504 2986 gene locus_tag LOCUS_06160 2504 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence0185 <1 977 gene locus_tag LOCUS_06170 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198286.1:monooxygenase 1016 1951 gene locus_tag LOCUS_06180 1016 1951 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_06180 1959 2957 gene locus_tag LOCUS_06190 gene galE 1959 2957 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_06190 3423 2959 gene locus_tag LOCUS_06200 3423 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence0186 2634 1177 gene locus_tag LOCUS_06210 2634 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence0187 1695 349 gene locus_tag LOCUS_06220 gene hemL 1695 349 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC8 protein_id gnl|my_center|LOCUS_06220 2104 2346 gene locus_tag LOCUS_06230 2104 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence0188 2733 1498 gene locus_tag LOCUS_06240 2733 1498 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence0189 244 654 gene locus_tag LOCUS_06250 244 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 706 1179 gene locus_tag LOCUS_06260 706 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1653 2798 gene locus_tag LOCUS_06270 1653 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence0190 1634 600 gene locus_tag LOCUS_06280 gene mreB 1634 600 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_06280 2487 1975 gene locus_tag LOCUS_06290 2487 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2835 2518 gene locus_tag LOCUS_06300 2835 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence0191 762 268 gene locus_tag LOCUS_06310 762 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1118 1396 gene locus_tag LOCUS_06320 1118 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1432 2094 gene locus_tag LOCUS_06330 1432 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3057 2185 gene locus_tag LOCUS_06340 3057 2185 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence0192 <1 717 gene locus_tag LOCUS_06350 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Z9:urocanate hydratase 1712 714 gene locus_tag LOCUS_06360 1712 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence0193 1090 11 gene locus_tag LOCUS_06370 gene fabH1 1090 11 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_06370 2263 1184 gene locus_tag LOCUS_06380 2263 1184 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence0194 1863 613 gene locus_tag LOCUS_06390 1863 613 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_06390 2010 3086 gene locus_tag LOCUS_06400 2010 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence0195 2 1585 gene locus_tag LOCUS_06410 2 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence0196 333 893 gene locus_tag LOCUS_06420 333 893 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_06420 883 2835 gene locus_tag LOCUS_06430 883 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence0197 <1 675 gene locus_tag LOCUS_06440 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI0:adenine deaminase 1765 704 gene locus_tag LOCUS_06450 1765 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1912 2457 gene locus_tag LOCUS_06460 gene ruvC 1912 2457 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0198 119 652 gene locus_tag LOCUS_06470 119 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 729 1085 gene locus_tag LOCUS_06480 729 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1106 1678 gene locus_tag LOCUS_06490 1106 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1688 2389 gene locus_tag LOCUS_06500 1688 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence0199 2859 193 gene locus_tag LOCUS_06510 2859 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence0200 1897 2691 gene locus_tag LOCUS_06520 1897 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 <3445 2778 gene locus_tag LOCUS_06530 <3445 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX80:cysteine--tRNA ligase >Feature sequence0201 >Feature sequence0202 685 2475 gene locus_tag LOCUS_06540 685 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence0203 224 484 gene locus_tag LOCUS_06550 224 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 492 1517 gene locus_tag LOCUS_06560 gene fadB5 492 1517 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_06560 2254 1523 gene locus_tag LOCUS_06570 2254 1523 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence0204 2133 982 gene locus_tag LOCUS_06580 gene dnaJ 2133 982 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_06580 2805 2185 gene locus_tag LOCUS_06590 gene grpE 2805 2185 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_06590 3403 2930 gene locus_tag LOCUS_06600 3403 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence0205 826 2034 gene locus_tag LOCUS_06610 826 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3023 2064 gene locus_tag LOCUS_06620 3023 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence0206 <1 2488 gene locus_tag LOCUS_06630 <1 2488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403927.1:alpha-ketoglutarate decarboxylase 2601 3059 gene locus_tag LOCUS_06640 2601 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0207 956 261 gene locus_tag LOCUS_06650 956 261 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_06650 1082 2563 gene locus_tag LOCUS_06660 1082 2563 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_06660 2797 3402 gene locus_tag LOCUS_06670 2797 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence0208 622 921 gene locus_tag LOCUS_06680 622 921 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_06680 963 1859 gene locus_tag LOCUS_06690 963 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence0209 1301 594 gene locus_tag LOCUS_06700 1301 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1562 2965 gene locus_tag LOCUS_06710 1562 2965 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence0210 2237 1455 gene locus_tag LOCUS_06720 gene fjo14 2237 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_06720 3012 2335 gene locus_tag LOCUS_06730 gene trmD 3012 2335 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_06730 >Feature sequence0211 <1 1008 gene locus_tag LOCUS_06740 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97J90:phosphoribosylamine--glycine ligase 1012 1584 gene locus_tag LOCUS_06750 1012 1584 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_06750 1639 3084 gene locus_tag LOCUS_06760 gene purF 1639 3084 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E460 protein_id gnl|my_center|LOCUS_06760 >Feature sequence0212 2424 1921 gene locus_tag LOCUS_06770 2424 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2919 3371 gene locus_tag LOCUS_06780 2919 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence0213 1501 2685 gene locus_tag LOCUS_06790 1501 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence0214 <1 1380 gene locus_tag LOCUS_06800 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 1525 3345 gene locus_tag LOCUS_06810 1525 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence0215 2245 1076 gene locus_tag LOCUS_06820 2245 1076 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_06820 3162 2395 gene locus_tag LOCUS_06830 gene sodA 3162 2395 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence0216 1558 722 gene locus_tag LOCUS_06840 1558 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3159 1561 gene locus_tag LOCUS_06850 3159 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence0217 77 1177 gene locus_tag LOCUS_06860 77 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1196 1696 gene locus_tag LOCUS_06870 1196 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1700 2539 gene locus_tag LOCUS_06880 gene mqnD 1700 2539 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_06880 2536 3132 gene locus_tag LOCUS_06890 2536 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence0218 <1 1368 gene locus_tag LOCUS_06900 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump 1460 2257 gene locus_tag LOCUS_06910 1460 2257 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_06910 2303 3274 gene locus_tag LOCUS_06920 2303 3274 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence0219 >Feature sequence0220 409 1239 gene locus_tag LOCUS_06930 409 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1236 1817 gene locus_tag LOCUS_06940 1236 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1821 2414 gene locus_tag LOCUS_06950 1821 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2418 2753 gene locus_tag LOCUS_06960 2418 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence0221 388 2151 gene locus_tag LOCUS_06970 gene aspS 388 2151 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_06970 >Feature sequence0222 1948 725 gene locus_tag LOCUS_06980 gene bioF-1 1948 725 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933608.1 protein_id gnl|my_center|LOCUS_06980 2132 3124 gene locus_tag LOCUS_06990 2132 3124 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence0223 <1 1284 gene locus_tag LOCUS_07000 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000433374.1:histidine kinase >Feature sequence0224 808 1140 gene locus_tag LOCUS_07010 808 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1206 2807 gene locus_tag LOCUS_07020 1206 2807 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence0225 1268 834 gene locus_tag LOCUS_07030 1268 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2709 1318 gene locus_tag LOCUS_07040 gene fjo17 2709 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence0226 410 2038 gene locus_tag LOCUS_07050 410 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2050 2793 gene locus_tag LOCUS_07060 gene pcs 2050 2793 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIM3 protein_id gnl|my_center|LOCUS_07060 >Feature sequence0227 1400 372 gene locus_tag LOCUS_07070 1400 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1708 2838 gene locus_tag LOCUS_07080 1708 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence0228 1114 572 gene locus_tag LOCUS_07090 1114 572 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_07090 1795 1217 gene locus_tag LOCUS_07100 gene tpm 1795 1217 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_07100 <3269 1805 gene locus_tag LOCUS_07110 <3269 1805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889584.1:N-glycosidase F >Feature sequence0229 2925 1750 gene locus_tag LOCUS_07120 2925 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0230 722 138 gene locus_tag LOCUS_07130 gene hisH 722 138 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_07130 1866 733 gene locus_tag LOCUS_07140 gene hisB 1866 733 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_07140 2920 1817 gene locus_tag LOCUS_07150 gene hisC 2920 1817 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE8 protein_id gnl|my_center|LOCUS_07150 >Feature sequence0231 1035 205 gene locus_tag LOCUS_07160 1035 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence0232 <3251 824 gene locus_tag LOCUS_07170 <3251 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AE8:pyruvate carboxylase >Feature sequence0233 1133 393 gene locus_tag LOCUS_07180 1133 393 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_07180 1466 2446 gene locus_tag LOCUS_07190 1466 2446 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_07190 2516 3007 gene locus_tag LOCUS_07200 2516 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence0234 257 622 gene locus_tag LOCUS_07210 257 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 627 932 gene locus_tag LOCUS_07220 627 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2033 1110 gene locus_tag LOCUS_07230 2033 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2898 2035 gene locus_tag LOCUS_07240 2898 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence0235 1316 342 gene locus_tag LOCUS_07250 1316 342 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_07250 1689 2093 gene locus_tag LOCUS_07260 1689 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2105 2698 gene locus_tag LOCUS_07270 2105 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence0236 >Feature sequence0237 992 144 gene locus_tag LOCUS_07280 gene lgt 992 144 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_07280 1534 992 gene locus_tag LOCUS_07290 1534 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1680 2378 gene locus_tag LOCUS_07300 1680 2378 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 protein_id gnl|my_center|LOCUS_07300 2623 2393 gene locus_tag LOCUS_07310 2623 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2910 2611 gene locus_tag LOCUS_07320 2910 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0238 2440 176 gene locus_tag LOCUS_07330 2440 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 <3222 2525 gene locus_tag LOCUS_07340 <3222 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MYF3:peptidyl-prolyl cis-trans isomerase >Feature sequence0239 1859 2575 gene locus_tag LOCUS_07350 1859 2575 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_07350 2588 2989 gene locus_tag LOCUS_07360 gene osmC 2588 2989 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0240 >Feature sequence0241 2528 1485 gene locus_tag LOCUS_07370 2528 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0242 1022 1594 gene locus_tag LOCUS_07380 1022 1594 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_07380 1665 2657 gene locus_tag LOCUS_07390 1665 2657 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108306.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence0243 1839 868 gene locus_tag LOCUS_07400 gene rocF 1839 868 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_07400 2020 2430 gene locus_tag LOCUS_07410 2020 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence0244 535 1716 gene locus_tag LOCUS_07420 535 1716 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25046 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0245 3025 1655 gene locus_tag LOCUS_07430 3025 1655 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence0246 83 2302 gene locus_tag LOCUS_07440 83 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence0247 <1 941 gene locus_tag LOCUS_07450 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64Z76:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1167 2057 gene locus_tag LOCUS_07460 1167 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07460 2070 2798 gene locus_tag LOCUS_07470 2070 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence0248 1289 165 gene locus_tag LOCUS_07480 gene mtnA 1289 165 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_07480 1629 1294 gene locus_tag LOCUS_07490 1629 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2100 2804 gene locus_tag LOCUS_07500 2100 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence0249 <1 854 gene locus_tag LOCUS_07510 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405022.1:T9SS C-terminal target domain-containing protein 1022 2224 gene locus_tag LOCUS_07520 1022 2224 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence0250 >Feature sequence0251 2231 552 gene locus_tag LOCUS_07530 2231 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2401 2928 gene locus_tag LOCUS_07540 2401 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence0252 <3177 1129 gene locus_tag LOCUS_07550 <3177 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405022.1:T9SS C-terminal target domain-containing protein >Feature sequence0253 3156 1339 gene locus_tag LOCUS_07560 3156 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0254 1799 411 gene locus_tag LOCUS_07570 1799 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2718 1876 gene locus_tag LOCUS_07580 gene yfhM 2718 1876 CDS product AB hydrolase superfamily protein YfhM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31581 protein_id gnl|my_center|LOCUS_07580 >Feature sequence0255 877 1926 gene locus_tag LOCUS_07590 877 1926 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_07590 2499 1921 gene locus_tag LOCUS_07600 2499 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence0256 <1 937 gene locus_tag LOCUS_07610 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC8:DNA topoisomerase (ATP-hydrolyzing) <3167 970 gene locus_tag LOCUS_07620 <3167 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase >Feature sequence0257 1690 92 gene locus_tag LOCUS_07630 1690 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence0258 >Feature sequence0259 <1 890 gene locus_tag LOCUS_07640 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89YZ6:aminomethyltransferase 1039 1482 gene locus_tag LOCUS_07650 1039 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1714 1502 gene locus_tag LOCUS_07660 1714 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence0260 1464 637 gene locus_tag LOCUS_07670 1464 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence0261 798 67 gene locus_tag LOCUS_07680 798 67 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546640.1 protein_id gnl|my_center|LOCUS_07680 1640 1080 gene locus_tag LOCUS_07690 1640 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0262 496 1026 gene locus_tag LOCUS_07700 496 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1166 1393 gene locus_tag LOCUS_07710 1166 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1390 2439 gene locus_tag LOCUS_07720 1390 2439 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1I7 protein_id gnl|my_center|LOCUS_07720 2518 3126 gene locus_tag LOCUS_07730 2518 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence0263 >Feature sequence0264 >Feature sequence0265 1373 2839 gene locus_tag LOCUS_07740 gene zwf 1373 2839 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_07740 >Feature sequence0266 2194 1310 gene locus_tag LOCUS_07750 2194 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <3099 2237 gene locus_tag LOCUS_07760 <3099 2237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584055.1:LacI family transcriptional regulator >Feature sequence0267 1007 2215 gene locus_tag LOCUS_07770 gene kpsF 1007 2215 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_07770 2212 2682 gene locus_tag LOCUS_07780 2212 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence0268 2335 1148 gene locus_tag LOCUS_07790 2335 1148 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021436.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence0269 1032 685 gene locus_tag LOCUS_07800 1032 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1637 1149 gene locus_tag LOCUS_07810 1637 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 <3078 2507 gene locus_tag LOCUS_07820 <3078 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMY2:chaperone protein HscA >Feature sequence0270 544 1014 gene locus_tag LOCUS_07830 544 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence0271 796 2421 gene locus_tag LOCUS_07840 796 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence0272 >Feature sequence0273 920 2053 gene locus_tag LOCUS_07850 gene porR 920 2053 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_07850 2162 2746 gene locus_tag LOCUS_07860 2162 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence0274 2482 2072 gene locus_tag LOCUS_07870 2482 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence0275 533 1384 gene locus_tag LOCUS_07880 gene parA 533 1384 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_07880 1551 2678 gene locus_tag LOCUS_07890 1551 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0276 <1 747 gene locus_tag LOCUS_07900 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:peptidase S41 749 1087 gene locus_tag LOCUS_07910 749 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1230 1796 gene locus_tag LOCUS_07920 1230 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2123 2368 gene locus_tag LOCUS_07930 2123 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0277 740 2410 gene locus_tag LOCUS_07940 740 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence0278 1692 988 gene locus_tag LOCUS_07950 gene cmk 1692 988 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_07950 2924 1917 gene locus_tag LOCUS_07960 2924 1917 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence0279 420 1814 gene locus_tag LOCUS_07970 420 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence0280 168 971 gene locus_tag LOCUS_07980 gene dapF 168 971 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_07980 1070 1696 gene locus_tag LOCUS_07990 1070 1696 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_07990 1703 2128 gene locus_tag LOCUS_08000 1703 2128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence0281 <1 1474 gene locus_tag LOCUS_08010 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase 1612 2280 gene locus_tag LOCUS_08020 1612 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 <3024 2286 gene locus_tag LOCUS_08030 <3024 2286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963873.1:peptidase S8 >Feature sequence0282 >Feature sequence0283 137 1450 gene locus_tag LOCUS_08040 137 1450 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_08040 2623 1457 gene locus_tag LOCUS_08050 2623 1457 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence0284 1519 593 gene locus_tag LOCUS_08060 gene hemF 1519 593 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_08060 1658 2368 gene locus_tag LOCUS_08070 1658 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 <2998 2350 gene locus_tag LOCUS_08080 <2998 2350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964090.1:inward rectifier potassium channel Irk >Feature sequence0285 >Feature sequence0286 328 1176 gene locus_tag LOCUS_08090 328 1176 CDS product curli production assembly/transport component CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869127.1 protein_id gnl|my_center|LOCUS_08090 1183 1653 gene locus_tag LOCUS_08100 1183 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1667 2569 gene locus_tag LOCUS_08110 1667 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0287 1699 716 gene locus_tag LOCUS_08120 gene pdhB 1699 716 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0288 666 1493 gene locus_tag LOCUS_08130 gene zupT 666 1493 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 protein_id gnl|my_center|LOCUS_08130 2127 1498 gene locus_tag LOCUS_08140 gene rsmG 2127 1498 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_08140 2377 2129 gene locus_tag LOCUS_08150 2377 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 <2978 2381 gene locus_tag LOCUS_08160 <2978 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000805951.1:uroporphyrinogen-III synthase >Feature sequence0289 587 1837 gene locus_tag LOCUS_08170 587 1837 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK0 protein_id gnl|my_center|LOCUS_08170 >Feature sequence0290 517 837 gene locus_tag LOCUS_08180 gene trx2 517 837 CDS product thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE49 protein_id gnl|my_center|LOCUS_08180 973 2373 gene locus_tag LOCUS_08190 973 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence0291 2696 2067 gene locus_tag LOCUS_08200 2696 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence0292 1855 950 gene locus_tag LOCUS_08210 1855 950 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence0293 <1 865 gene locus_tag LOCUS_08220 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964157.1:cell division protein FtsW 868 2232 gene locus_tag LOCUS_08230 gene murC 868 2232 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_08230 >Feature sequence0294 >Feature sequence0295 785 2449 gene locus_tag LOCUS_08240 785 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2941 2507 gene locus_tag LOCUS_08250 2941 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence0296 <1 606 gene locus_tag LOCUS_08260 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001230564.1:N-acetylneuraminate synthase 610 1782 gene locus_tag LOCUS_08270 610 1782 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_08270 1791 2426 gene locus_tag LOCUS_08280 1791 2426 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence0297 <1 1938 gene locus_tag LOCUS_08290 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797413.1:protein translocase subunit SecDF 2109 2771 gene locus_tag LOCUS_08300 2109 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence0298 209 514 gene locus_tag LOCUS_08310 209 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_08310 1978 569 gene locus_tag LOCUS_08320 1978 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence0299 <1 1145 gene locus_tag LOCUS_08330 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964414.1:aldehyde dehydrogenase 2073 1291 gene locus_tag LOCUS_08340 2073 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 <2931 2427 gene locus_tag LOCUS_08350 <2931 2427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein >Feature sequence0300 692 817 gene locus_tag LOCUS_08360 692 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1180 1617 gene locus_tag LOCUS_08370 1180 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence0301 786 169 gene locus_tag LOCUS_08380 786 169 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_08380 1114 1962 gene locus_tag LOCUS_08390 1114 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence0302 347 652 gene locus_tag LOCUS_08400 347 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1099 1371 gene locus_tag LOCUS_08410 1099 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 <2925 1415 gene locus_tag LOCUS_08420 <2925 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TA4:DNA helicase >Feature sequence0303 1520 2056 gene locus_tag LOCUS_08430 gene efp 1520 2056 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_08430 2137 2646 gene locus_tag LOCUS_08440 gene accB 2137 2646 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0304 771 523 gene locus_tag LOCUS_08450 771 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence0305 <1 639 gene locus_tag LOCUS_08460 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962928.1:hydrolase Nlp/P60 747 831 gene locus_tag LOCUS_t00060 747 831 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 931 2373 gene locus_tag LOCUS_08470 931 2373 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_08470 2540 2854 gene locus_tag LOCUS_08480 2540 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence0306 1922 1329 gene locus_tag LOCUS_08490 1922 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence0307 1731 2021 gene locus_tag LOCUS_08500 1731 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence0308 1610 2668 gene locus_tag LOCUS_08510 1610 2668 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0309 986 132 gene locus_tag LOCUS_08520 986 132 CDS product putative chaperone protein HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702669.1 protein_id gnl|my_center|LOCUS_08520 1999 1016 gene locus_tag LOCUS_08530 1999 1016 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379249.1 protein_id gnl|my_center|LOCUS_08530 2659 2084 gene locus_tag LOCUS_08540 2659 2084 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence0310 <1 2288 gene locus_tag LOCUS_08550 <1 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0311 1474 560 gene locus_tag LOCUS_08560 gene darA 1474 560 CDS product dialkylrecorsinol condensing protein DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_08560 1969 1493 gene locus_tag LOCUS_08570 1969 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2881 2126 gene locus_tag LOCUS_08580 2881 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence0312 356 2851 gene locus_tag LOCUS_08590 356 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence0313 107 757 gene locus_tag LOCUS_08600 107 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 802 1728 gene locus_tag LOCUS_08610 gene queG 802 1728 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_08610 2166 1732 gene locus_tag LOCUS_08620 2166 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0314 702 193 gene locus_tag LOCUS_08630 702 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1083 2273 gene locus_tag LOCUS_08640 1083 2273 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_08640 2270 2740 gene locus_tag LOCUS_08650 2270 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence0315 <1 794 gene locus_tag LOCUS_08660 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963231.1:DEAD/DEAH box helicase 884 1663 gene locus_tag LOCUS_08670 884 1663 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_08670 <2875 1705 gene locus_tag LOCUS_08680 <2875 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase >Feature sequence0316 >Feature sequence0317 1531 1379 gene locus_tag LOCUS_08690 1531 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 <2872 1604 gene locus_tag LOCUS_08700 <2872 1604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964161.1:penicillin-binding protein >Feature sequence0318 445 1914 gene locus_tag LOCUS_08710 445 1914 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_08710 >Feature sequence0319 300 1541 gene locus_tag LOCUS_08720 300 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_08720 2723 1611 gene locus_tag LOCUS_08730 2723 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence0320 <1 1319 gene locus_tag LOCUS_08740 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768395.1:TonB-dependent receptor 1417 2808 gene locus_tag LOCUS_08750 1417 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence0321 <1 1405 gene locus_tag LOCUS_08760 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA 1717 2514 gene locus_tag LOCUS_08770 1717 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence0322 275 1393 gene locus_tag LOCUS_08780 275 1393 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence0323 1729 740 gene locus_tag LOCUS_08790 1729 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2064 2822 gene locus_tag LOCUS_08800 gene pcbD 2064 2822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence0324 1968 1048 gene locus_tag LOCUS_08810 1968 1048 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K0 protein_id gnl|my_center|LOCUS_08810 2233 2673 gene locus_tag LOCUS_08820 2233 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence0325 1641 181 gene locus_tag LOCUS_08830 1641 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_08830 2229 1804 gene locus_tag LOCUS_08840 2229 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932954.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence0326 168 596 gene locus_tag LOCUS_08850 168 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 751 1608 gene locus_tag LOCUS_08860 751 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1813 2508 gene locus_tag LOCUS_08870 gene atoD 1813 2508 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence0327 269 126 gene locus_tag LOCUS_08880 269 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1748 396 gene locus_tag LOCUS_08890 1748 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08890 2532 1765 gene locus_tag LOCUS_08900 2532 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142330.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence0328 >Feature sequence0329 294 599 gene locus_tag LOCUS_08910 294 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1200 619 gene locus_tag LOCUS_08920 1200 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1874 1383 gene locus_tag LOCUS_08930 1874 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_08930 2477 1983 gene locus_tag LOCUS_08940 2477 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0330 707 1024 gene locus_tag LOCUS_08950 707 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1315 1476 gene locus_tag LOCUS_08960 1315 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1506 1901 gene locus_tag LOCUS_08970 1506 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08970 >Feature sequence0331 <2822 478 gene locus_tag LOCUS_08980 <2822 478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0332 <1 1129 gene locus_tag LOCUS_08990 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001166720.1:ribonuclease D <2808 1143 gene locus_tag LOCUS_09000 <2808 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964423.1:competence protein ComEC >Feature sequence0333 1800 604 gene locus_tag LOCUS_09010 1800 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09010 >Feature sequence0334 645 920 gene locus_tag LOCUS_09020 645 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 936 1133 gene locus_tag LOCUS_09030 936 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1136 1321 gene locus_tag LOCUS_09040 1136 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1367 1612 gene locus_tag LOCUS_09050 1367 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1625 1912 gene locus_tag LOCUS_09060 1625 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1991 2440 gene locus_tag LOCUS_09070 1991 2440 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence0335 3 860 gene locus_tag LOCUS_09080 gene xerC 3 860 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_09080 2292 865 gene locus_tag LOCUS_09090 2292 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2786 2370 gene locus_tag LOCUS_09100 2786 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence0336 737 282 gene locus_tag LOCUS_09110 737 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2187 748 gene locus_tag LOCUS_09120 2187 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence0337 <1 1210 gene locus_tag LOCUS_09130 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963825.1:MFS transporter 1849 1262 gene locus_tag LOCUS_09140 1849 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence0338 1148 1447 gene locus_tag LOCUS_09150 1148 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1899 2114 gene locus_tag LOCUS_09160 1899 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence0339 1870 1613 gene locus_tag LOCUS_09170 1870 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence0340 247 1125 gene locus_tag LOCUS_09180 247 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 <2776 1172 gene locus_tag LOCUS_09190 <2776 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726854.1:acetyl/propionyl-CoA carboxylase subunit alpha >Feature sequence0341 765 1925 gene locus_tag LOCUS_09200 765 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence0342 716 2155 gene locus_tag LOCUS_09210 716 2155 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0343 <1 767 gene locus_tag LOCUS_09220 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021767.1:cell surface protein 1022 2632 gene locus_tag LOCUS_09230 1022 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence0344 1604 489 gene locus_tag LOCUS_09240 gene thiH 1604 489 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_09240 1740 2390 gene locus_tag LOCUS_09250 1740 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2716 2399 gene locus_tag LOCUS_09260 2716 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence0345 <1 1259 gene locus_tag LOCUS_09270 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB2:tRNA modification GTPase MnmE 2243 1350 gene locus_tag LOCUS_09280 2243 1350 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_09280 2746 2579 gene locus_tag LOCUS_09290 2746 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence0346 858 1325 gene locus_tag LOCUS_09300 858 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2012 1326 gene locus_tag LOCUS_09310 2012 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence0347 1642 1262 gene locus_tag LOCUS_09320 1642 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 <2745 1658 gene locus_tag LOCUS_09330 <2745 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64P92:DNA primase note possible pseudo, internal stop codon >Feature sequence0348 <1 1723 gene locus_tag LOCUS_09340 <1 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016233.1:autolysin 1742 2482 gene locus_tag LOCUS_09350 1742 2482 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence0349 248 862 gene locus_tag LOCUS_09360 248 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1526 2503 gene locus_tag LOCUS_09370 1526 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence0350 <1 721 gene locus_tag LOCUS_09380 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963928.1:hydroxymethylglutaryl-CoA lyase 941 1558 gene locus_tag LOCUS_09390 941 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1552 2397 gene locus_tag LOCUS_09400 1552 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence0351 2447 1716 gene locus_tag LOCUS_09410 2447 1716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence0352 1488 1120 gene locus_tag LOCUS_09420 1488 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 <2720 1910 gene locus_tag LOCUS_09430 <2720 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor >Feature sequence0353 <1 2444 gene locus_tag LOCUS_09440 <1 2444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0354 182 258 gene locus_tag LOCUS_t00070 182 258 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 391 585 gene locus_tag LOCUS_09450 gene rpsU 391 585 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_09450 743 2320 gene locus_tag LOCUS_09460 gene prfC 743 2320 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_09460 2324 2710 gene locus_tag LOCUS_09470 2324 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence0355 382 1017 gene locus_tag LOCUS_09480 382 1017 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_09480 2016 1024 gene locus_tag LOCUS_09490 2016 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 <2718 2069 gene locus_tag LOCUS_09500 <2718 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789686.1:aminopeptidase >Feature sequence0356 943 2301 gene locus_tag LOCUS_09510 943 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0357 >Feature sequence0358 406 1314 gene locus_tag LOCUS_09520 406 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1324 1917 gene locus_tag LOCUS_09530 1324 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <2710 1998 gene locus_tag LOCUS_09540 <2710 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXG2:serine hydroxymethyltransferase >Feature sequence0359 471 94 gene locus_tag LOCUS_09550 471 94 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_09550 2094 478 gene locus_tag LOCUS_09560 gene cht1 2094 478 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_09560 2705 2220 gene locus_tag LOCUS_09570 2705 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence0360 991 2259 gene locus_tag LOCUS_09580 gene fahA 991 2259 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence0361 1320 1850 gene locus_tag LOCUS_09590 1320 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1879 2373 gene locus_tag LOCUS_09600 1879 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09600 >Feature sequence0362 >Feature sequence0363 <1 1624 gene locus_tag LOCUS_09610 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2522 2019 gene locus_tag LOCUS_09620 gene lrp 2522 2019 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45265 protein_id gnl|my_center|LOCUS_09620 >Feature sequence0364 84 251 gene locus_tag LOCUS_09630 84 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1361 255 gene locus_tag LOCUS_09640 1361 255 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_09640 1991 1386 gene locus_tag LOCUS_09650 1991 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence0365 406 1761 gene locus_tag LOCUS_09660 406 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence0366 318 1307 gene locus_tag LOCUS_09670 318 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence0367 <2683 674 gene locus_tag LOCUS_09680 <2683 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence0368 <2681 433 gene locus_tag LOCUS_09690 <2681 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256518.1:molybdopterin oxidoreductase >Feature sequence0369 <1 1749 gene locus_tag LOCUS_09700 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964554.1:gliding motility protein >Feature sequence0370 <1 539 gene locus_tag LOCUS_09710 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000466031.1:alpha-glucosidase 588 1925 gene locus_tag LOCUS_09720 588 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence0371 552 1499 gene locus_tag LOCUS_09730 552 1499 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_09730 2126 1506 gene locus_tag LOCUS_09740 2126 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2350 2520 gene locus_tag LOCUS_09750 2350 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence0372 <2665 1310 gene locus_tag LOCUS_09760 <2665 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0373 1650 1360 gene locus_tag LOCUS_09770 1650 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence0374 303 1103 gene locus_tag LOCUS_09780 303 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1212 1883 gene locus_tag LOCUS_09790 gene thiG 1212 1883 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 protein_id gnl|my_center|LOCUS_09790 >Feature sequence0375 1296 292 gene locus_tag LOCUS_09800 1296 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2447 1470 gene locus_tag LOCUS_09810 2447 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence0376 1122 451 gene locus_tag LOCUS_09820 1122 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1977 1156 gene locus_tag LOCUS_09830 1977 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence0377 683 267 gene locus_tag LOCUS_09840 683 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 695 997 gene locus_tag LOCUS_09850 695 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1784 1086 gene locus_tag LOCUS_09860 1784 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence0378 601 1965 gene locus_tag LOCUS_09870 601 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2033 2368 gene locus_tag LOCUS_09880 2033 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09880 >Feature sequence0379 <1 1281 gene locus_tag LOCUS_09890 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107669.1:RNA-binding transcriptional accessory protein 1299 1808 gene locus_tag LOCUS_09900 1299 1808 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0380 2066 1404 gene locus_tag LOCUS_09910 2066 1404 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence0381 <1 880 gene locus_tag LOCUS_09920 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8X680:3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase 915 2108 gene locus_tag LOCUS_09930 915 2108 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence0382 892 734 gene locus_tag LOCUS_09940 892 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1404 937 gene locus_tag LOCUS_09950 1404 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1972 1457 gene locus_tag LOCUS_09960 1972 1457 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964424.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence0383 516 441 gene locus_tag LOCUS_t00080 516 441 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1744 710 gene locus_tag LOCUS_09970 gene gpsA 1744 710 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_09970 >Feature sequence0384 >Feature sequence0385 1618 668 gene locus_tag LOCUS_09980 1618 668 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_09980 2582 1782 gene locus_tag LOCUS_09990 gene rsmA 2582 1782 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_09990 >Feature sequence0386 331 2031 gene locus_tag LOCUS_10000 331 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence0387 >Feature sequence0388 547 122 gene locus_tag LOCUS_10010 547 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence0389 1050 514 gene locus_tag LOCUS_10020 gene rpsP 1050 514 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_10020 1331 2497 gene locus_tag LOCUS_10030 1331 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence0390 416 2434 gene locus_tag LOCUS_10040 gene uvrB 416 2434 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T09 protein_id gnl|my_center|LOCUS_10040 >Feature sequence0391 1 120 gene locus_tag LOCUS_10050 1 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 171 725 gene locus_tag LOCUS_10060 gene rplF 171 725 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_10060 760 1128 gene locus_tag LOCUS_10070 gene rplR 760 1128 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_10070 1140 1658 gene locus_tag LOCUS_10080 gene rpsE 1140 1658 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_10080 1651 1854 gene locus_tag LOCUS_10090 gene rpmD 1651 1854 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_10090 >Feature sequence0392 >Feature sequence0393 2597 240 gene locus_tag LOCUS_10100 2597 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence0394 >Feature sequence0395 1220 453 gene locus_tag LOCUS_10110 1220 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1354 2103 gene locus_tag LOCUS_10120 1354 2103 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence0396 <1 1520 gene locus_tag LOCUS_10130 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009939247.1:exported heme receptor protein 2062 1598 gene locus_tag LOCUS_10140 gene rplI 2062 1598 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_10140 2376 2110 gene locus_tag LOCUS_10150 gene rpsR 2376 2110 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_10150 >Feature sequence0397 1546 350 gene locus_tag LOCUS_10160 gene kbl 1546 350 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_10160 <2581 1570 gene locus_tag LOCUS_10170 <2581 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962368.1:L-threonine 3-dehydrogenase >Feature sequence0398 91 1932 gene locus_tag LOCUS_10180 91 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence0399 <2569 44 gene locus_tag LOCUS_10190 <2569 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYU0:DNA-directed RNA polymerase subunit beta >Feature sequence0400 1384 2028 gene locus_tag LOCUS_10200 1384 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence0401 529 837 gene locus_tag LOCUS_10210 529 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10210 1000 1629 gene locus_tag LOCUS_10220 1000 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence0402 <1 505 gene locus_tag LOCUS_10230 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143441.1:sodium:proline symporter 1220 2422 gene locus_tag LOCUS_10240 1220 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence0403 2443 968 gene locus_tag LOCUS_10250 2443 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0404 <1 1465 gene locus_tag LOCUS_10260 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0405 <2553 813 gene locus_tag LOCUS_10270 <2553 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence0406 <1 776 gene locus_tag LOCUS_10280 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786213.1:nicotinate-nucleotide diphosphorylase (carboxylating) 776 1210 gene locus_tag LOCUS_10290 776 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_10290 1720 1857 gene locus_tag LOCUS_10300 1720 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1882 2481 gene locus_tag LOCUS_10310 1882 2481 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10310 >Feature sequence0407 2299 1145 gene locus_tag LOCUS_10320 gene bcr 2299 1145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_10320 2238 2447 gene locus_tag LOCUS_10330 2238 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0408 310 630 gene locus_tag LOCUS_10340 310 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 733 1941 gene locus_tag LOCUS_10350 733 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence0409 1722 586 gene locus_tag LOCUS_10360 1722 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1943 1674 gene locus_tag LOCUS_10370 1943 1674 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence0410 <1 548 gene locus_tag LOCUS_10380 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762028.1:50S ribosomal protein L10 683 1060 gene locus_tag LOCUS_10390 gene rplL 683 1060 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_10390 >Feature sequence0411 >Feature sequence0412 <1 723 gene locus_tag LOCUS_10400 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963090.1:acetyl-coenzyme A synthetase 958 2169 gene locus_tag LOCUS_10410 958 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0413 <2542 301 gene locus_tag LOCUS_10420 <2542 301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881269.1:serine protease >Feature sequence0414 328 792 gene locus_tag LOCUS_10430 328 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2128 803 gene locus_tag LOCUS_10440 2128 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence0415 494 1465 gene locus_tag LOCUS_10450 494 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2030 1479 gene locus_tag LOCUS_10460 2030 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence0416 221 634 gene locus_tag LOCUS_10470 221 634 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_10470 655 819 gene locus_tag LOCUS_10480 655 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1328 1849 gene locus_tag LOCUS_10490 1328 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0417 20 979 gene locus_tag LOCUS_10500 gene mauG 20 979 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_10500 1987 941 gene locus_tag LOCUS_10510 1987 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence0418 2218 1718 gene locus_tag LOCUS_10520 2218 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0419 2031 1663 gene locus_tag LOCUS_10530 2031 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10530 2526 2167 gene locus_tag LOCUS_10540 2526 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10540 >Feature sequence0420 1422 310 gene locus_tag LOCUS_10550 1422 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence0421 238 762 gene locus_tag LOCUS_10560 238 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 <2525 799 gene locus_tag LOCUS_10570 <2525 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071101.1:alkaline phosphatase >Feature sequence0422 1658 333 gene locus_tag LOCUS_10580 1658 333 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_10580 1861 1992 gene locus_tag LOCUS_10590 1861 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10590 2128 2460 gene locus_tag LOCUS_10600 2128 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10600 >Feature sequence0423 <1 2438 gene locus_tag LOCUS_10610 <1 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362020.1:protein of unknown function precursor; adhesin >Feature sequence0424 917 2407 gene locus_tag LOCUS_10620 917 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence0425 359 1036 gene locus_tag LOCUS_10630 359 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1206 2267 gene locus_tag LOCUS_10640 1206 2267 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0426 1169 120 gene locus_tag LOCUS_10650 gene hemE 1169 120 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW2 protein_id gnl|my_center|LOCUS_10650 <2509 1267 gene locus_tag LOCUS_10660 <2509 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FQ96:polyphosphate kinase >Feature sequence0427 1205 1843 gene locus_tag LOCUS_10670 1205 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0428 190 1086 gene locus_tag LOCUS_10680 190 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1244 1942 gene locus_tag LOCUS_10690 1244 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence0429 <2495 1507 gene locus_tag LOCUS_10700 <2495 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964032.1:acyl-CoA dehydrogenase >Feature sequence0430 1486 536 gene locus_tag LOCUS_10710 1486 536 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_10710 2029 2445 gene locus_tag LOCUS_10720 2029 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence0431 >Feature sequence0432 <1 1795 gene locus_tag LOCUS_10730 <1 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AAB1:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence0433 <1 761 gene locus_tag LOCUS_10740 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108019.1:ATP-dependent DNA helicase RecQ 1995 802 gene locus_tag LOCUS_10750 1995 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence0434 1540 227 gene locus_tag LOCUS_10760 gene rimO 1540 227 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_10760 1715 1789 gene locus_tag LOCUS_t00090 1715 1789 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0435 268 531 gene locus_tag LOCUS_10770 gene rpsQ 268 531 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_10770 545 910 gene locus_tag LOCUS_10780 gene rplN 545 910 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_10780 913 1245 gene locus_tag LOCUS_10790 gene rplX 913 1245 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE29 protein_id gnl|my_center|LOCUS_10790 1248 1799 gene locus_tag LOCUS_10800 gene rplE 1248 1799 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_10800 1804 2073 gene locus_tag LOCUS_10810 gene rpsN 1804 2073 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_10810 >Feature sequence0436 >Feature sequence0437 1739 1029 gene locus_tag LOCUS_10820 1739 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2311 1769 gene locus_tag LOCUS_10830 2311 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0438 140 661 gene locus_tag LOCUS_10840 140 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 658 1473 gene locus_tag LOCUS_10850 gene truA 658 1473 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV0 protein_id gnl|my_center|LOCUS_10850 >Feature sequence0439 488 715 gene locus_tag LOCUS_10860 488 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1070 729 gene locus_tag LOCUS_10870 1070 729 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_10870 1223 1423 gene locus_tag LOCUS_10880 1223 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1514 2062 gene locus_tag LOCUS_10890 1514 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence0440 618 2051 gene locus_tag LOCUS_10900 618 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence0441 >Feature sequence0442 <1 1813 gene locus_tag LOCUS_10910 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89YW6:chaperone protein DnaK 2003 2431 gene locus_tag LOCUS_10920 2003 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0443 <2423 105 gene locus_tag LOCUS_10930 <2423 105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110242.1:beta-lactam antibiotic acylase >Feature sequence0444 1142 1987 gene locus_tag LOCUS_10940 1142 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence0445 2193 841 gene locus_tag LOCUS_10950 gene norM 2193 841 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0446 578 99 gene locus_tag LOCUS_10960 578 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0447 1001 1969 gene locus_tag LOCUS_10970 1001 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence0448 >Feature sequence0449 673 23 gene locus_tag LOCUS_10980 673 23 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_10980 939 1610 gene locus_tag LOCUS_10990 939 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence0450 1392 2252 gene locus_tag LOCUS_11000 1392 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0451 810 13 gene locus_tag LOCUS_11010 810 13 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391756.1 protein_id gnl|my_center|LOCUS_11010 1228 884 gene locus_tag LOCUS_11020 1228 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1927 1328 gene locus_tag LOCUS_11030 1927 1328 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence0452 2139 889 gene locus_tag LOCUS_11040 2139 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence0453 1099 344 gene locus_tag LOCUS_11050 1099 344 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260645.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence0454 1858 1016 gene locus_tag LOCUS_11060 1858 1016 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_11060 >Feature sequence0455 615 1505 gene locus_tag LOCUS_11070 615 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244996.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence0456 1114 365 gene locus_tag LOCUS_11080 1114 365 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_11080 1408 1785 gene locus_tag LOCUS_11090 1408 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11090 1795 2157 gene locus_tag LOCUS_11100 1795 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11100 >Feature sequence0457 >Feature sequence0458 >Feature sequence0459 >Feature sequence0460 560 648 gene locus_tag LOCUS_t00100 560 648 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 741 1598 gene locus_tag LOCUS_11110 741 1598 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_11110 1628 2140 gene locus_tag LOCUS_11120 1628 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence0461 1757 1425 gene locus_tag LOCUS_11130 1757 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 <2373 1762 gene locus_tag LOCUS_11140 <2373 1762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107905.1:phosphotransferase >Feature sequence0462 >Feature sequence0463 76 423 gene locus_tag LOCUS_11150 76 423 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_11150 1845 442 gene locus_tag LOCUS_11160 gene speA 1845 442 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0464 1705 1097 gene locus_tag LOCUS_11170 1705 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2329 1820 gene locus_tag LOCUS_11180 2329 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence0465 594 1628 gene locus_tag LOCUS_11190 594 1628 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_11190 1637 2137 gene locus_tag LOCUS_11200 1637 2137 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0466 748 1209 gene locus_tag LOCUS_11210 748 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence0467 859 2160 gene locus_tag LOCUS_11220 859 2160 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence0468 >Feature sequence0469 1414 83 gene locus_tag LOCUS_11230 gene ffh 1414 83 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_11230 >Feature sequence0470 <1 707 gene locus_tag LOCUS_11240 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963509.1:mannose-1-phosphate guanylyltransferase 1734 1123 gene locus_tag LOCUS_11250 gene truA 1734 1123 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_11250 >Feature sequence0471 708 1433 gene locus_tag LOCUS_11260 708 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1938 1441 gene locus_tag LOCUS_11270 1938 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence0472 1379 162 gene locus_tag LOCUS_11280 1379 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 <2354 1467 gene locus_tag LOCUS_11290 <2354 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207107.1:potassium voltage gated channel, Shab-related subfamily, member 2 >Feature sequence0473 832 488 gene locus_tag LOCUS_11300 gene phnA 832 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 protein_id gnl|my_center|LOCUS_11300 1542 928 gene locus_tag LOCUS_11310 1542 928 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808283.1 protein_id gnl|my_center|LOCUS_11310 1938 1609 gene locus_tag LOCUS_11320 1938 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence0474 1760 6 gene locus_tag LOCUS_11330 1760 6 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence0475 <1 706 gene locus_tag LOCUS_11340 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531371.1:OmpA family lipoprotein 831 1898 gene locus_tag LOCUS_11350 831 1898 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_11350 1891 2256 gene locus_tag LOCUS_11360 1891 2256 CDS product camphor resistance protein CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence0476 <2339 714 gene locus_tag LOCUS_11370 <2339 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037525.1:phosphoesterase >Feature sequence0477 296 709 gene locus_tag LOCUS_11380 296 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 728 1192 gene locus_tag LOCUS_11390 728 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 1274 1747 gene locus_tag LOCUS_11400 1274 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0478 3 755 gene locus_tag LOCUS_11410 3 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 919 1974 gene locus_tag LOCUS_11420 919 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence0479 >Feature sequence0480 435 1724 gene locus_tag LOCUS_11430 435 1724 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_11430 2176 1721 gene locus_tag LOCUS_11440 gene dtd 2176 1721 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_11440 2331 2179 gene locus_tag LOCUS_11450 2331 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0481 1069 62 gene locus_tag LOCUS_11460 1069 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 <2330 1132 gene locus_tag LOCUS_11470 <2330 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946471.1:NAD+ synthase >Feature sequence0482 537 1076 gene locus_tag LOCUS_11480 537 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1257 1108 gene locus_tag LOCUS_11490 1257 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 <2328 1738 gene locus_tag LOCUS_11500 <2328 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYL6:endonuclease III >Feature sequence0483 391 993 gene locus_tag LOCUS_11510 391 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 1090 1464 gene locus_tag LOCUS_11520 1090 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence0484 <1 977 gene locus_tag LOCUS_11530 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123762.1:lipase >Feature sequence0485 1156 2 gene locus_tag LOCUS_11540 1156 2 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_11540 <2323 1193 gene locus_tag LOCUS_11550 <2323 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765356.1:transporter >Feature sequence0486 >Feature sequence0487 >Feature sequence0488 >Feature sequence0489 747 1373 gene locus_tag LOCUS_11560 gene arp 747 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069705.1 protein_id gnl|my_center|LOCUS_11560 1673 2281 gene locus_tag LOCUS_11570 1673 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence0490 1517 690 gene locus_tag LOCUS_11580 1517 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence0491 >Feature sequence0492 >Feature sequence0493 150 443 gene locus_tag LOCUS_11590 150 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 465 2069 gene locus_tag LOCUS_11600 465 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2304 2173 gene locus_tag LOCUS_11610 2304 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence0494 >Feature sequence0495 >Feature sequence0496 1272 490 gene locus_tag LOCUS_11620 1272 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 <2290 1383 gene locus_tag LOCUS_11630 <2290 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9UPC9:pseudouridine synthase >Feature sequence0497 1463 1714 gene locus_tag LOCUS_11640 1463 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence0498 >Feature sequence0499 >Feature sequence0500 324 623 gene locus_tag LOCUS_11650 324 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 800 997 gene locus_tag LOCUS_11660 800 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1022 1510 gene locus_tag LOCUS_11670 1022 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence0501 >Feature sequence0502 679 380 gene locus_tag LOCUS_11680 679 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 908 744 gene locus_tag LOCUS_11690 908 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0503 1423 821 gene locus_tag LOCUS_11700 gene miaE 1423 821 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_11700 <2273 1596 gene locus_tag LOCUS_11710 <2273 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZH8:dihydropteroate synthase >Feature sequence0504 155 1459 gene locus_tag LOCUS_11720 gene pabB 155 1459 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence0505 26 1441 gene locus_tag LOCUS_11730 26 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence0506 165 824 gene locus_tag LOCUS_11740 165 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_11740 920 1297 gene locus_tag LOCUS_11750 920 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1320 2222 gene locus_tag LOCUS_11760 gene era 1320 2222 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_11760 >Feature sequence0507 141 1001 gene locus_tag LOCUS_11770 141 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1002 1472 gene locus_tag LOCUS_11780 1002 1472 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_11780 <2257 1476 gene locus_tag LOCUS_11790 <2257 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918560.1:lysophospholipase >Feature sequence0508 >Feature sequence0509 1 198 gene locus_tag LOCUS_11800 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 398 1681 gene locus_tag LOCUS_11810 gene purA 398 1681 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_11810 >Feature sequence0510 <1 1064 gene locus_tag LOCUS_11820 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962586.1:DUF5103 domain-containing protein 1634 1149 gene locus_tag LOCUS_11830 1634 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_11830 1778 1862 gene locus_tag LOCUS_t00110 1778 1862 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0511 264 1043 gene locus_tag LOCUS_11840 264 1043 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_11840 <2250 1596 gene locus_tag LOCUS_11850 <2250 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW32:adenosylhomocysteinase >Feature sequence0512 <1 873 gene locus_tag LOCUS_11860 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404901.1:TonB-dependent receptor >Feature sequence0513 <1 2167 gene locus_tag LOCUS_11870 <1 2167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963704.1:DNA translocase FtsK >Feature sequence0514 >Feature sequence0515 447 1178 gene locus_tag LOCUS_11880 447 1178 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence0516 2021 1575 gene locus_tag LOCUS_11890 2021 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11890 >Feature sequence0517 >Feature sequence0518 >Feature sequence0519 1079 369 gene locus_tag LOCUS_11900 1079 369 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_11900 2074 1109 gene locus_tag LOCUS_11910 2074 1109 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence0520 2215 140 gene locus_tag LOCUS_11920 2215 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence0521 1322 564 gene locus_tag LOCUS_11930 1322 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence0522 1407 1000 gene locus_tag LOCUS_11940 1407 1000 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence0523 536 823 gene locus_tag LOCUS_11950 536 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence0524 990 2171 gene locus_tag LOCUS_11960 990 2171 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence0525 409 864 gene locus_tag LOCUS_11970 409 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 924 1373 gene locus_tag LOCUS_11980 924 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1777 1487 gene locus_tag LOCUS_11990 1777 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0526 425 670 gene locus_tag LOCUS_12000 425 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 861 2015 gene locus_tag LOCUS_12010 861 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence0527 <1 606 gene locus_tag LOCUS_12020 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920461.1:membrane protein 610 1956 gene locus_tag LOCUS_12030 gene allB 610 1956 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0528 885 1358 gene locus_tag LOCUS_12040 885 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence0529 916 161 gene locus_tag LOCUS_12050 916 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence0530 280 1158 gene locus_tag LOCUS_12060 gene rsgA 280 1158 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_12060 1266 2003 gene locus_tag LOCUS_12070 1266 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0531 >Feature sequence0532 418 125 gene locus_tag LOCUS_12080 418 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 783 508 gene locus_tag LOCUS_12090 783 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1661 864 gene locus_tag LOCUS_12100 1661 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2171 1695 gene locus_tag LOCUS_12110 2171 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence0533 341 1861 gene locus_tag LOCUS_12120 341 1861 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_12120 >Feature sequence0534 1851 682 gene locus_tag LOCUS_12130 1851 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2169 1885 gene locus_tag LOCUS_12140 2169 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence0535 1538 513 gene locus_tag LOCUS_12150 1538 513 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_12150 2154 1531 gene locus_tag LOCUS_12160 2154 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence0536 845 1873 gene locus_tag LOCUS_12170 845 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence0537 >Feature sequence0538 1543 458 gene locus_tag LOCUS_12180 1543 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence0539 2088 352 gene locus_tag LOCUS_12190 2088 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence0540 1194 1574 gene locus_tag LOCUS_12200 1194 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2044 1676 gene locus_tag LOCUS_12210 2044 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence0541 1527 88 gene locus_tag LOCUS_12220 1527 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1702 2118 gene locus_tag LOCUS_12230 1702 2118 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence0542 1526 633 gene locus_tag LOCUS_12240 1526 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0543 104 562 gene locus_tag LOCUS_12250 104 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence0544 952 134 gene locus_tag LOCUS_12260 952 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1723 986 gene locus_tag LOCUS_12270 1723 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence0545 >Feature sequence0546 <1 1917 gene locus_tag LOCUS_12280 <1 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963306.1:peptidyl-prolyl cis-trans isomerase >Feature sequence0547 130 783 gene locus_tag LOCUS_12290 130 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12290 784 936 gene locus_tag LOCUS_12300 784 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 <2163 940 gene locus_tag LOCUS_12310 <2163 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122718.1:sulfate transporter >Feature sequence0548 >Feature sequence0549 883 1821 gene locus_tag LOCUS_12320 883 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence0550 <1 1058 gene locus_tag LOCUS_12330 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790944.1:alkaline serine protease >Feature sequence0551 1020 175 gene locus_tag LOCUS_12340 1020 175 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0552 >Feature sequence0553 >Feature sequence0554 144 1913 gene locus_tag LOCUS_12350 144 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence0555 852 421 gene locus_tag LOCUS_12360 852 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence0556 2139 1132 gene locus_tag LOCUS_12370 2139 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence0557 256 768 gene locus_tag LOCUS_12380 256 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1375 770 gene locus_tag LOCUS_12390 1375 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_12390 >Feature sequence0558 >Feature sequence0559 1579 443 gene locus_tag LOCUS_12400 1579 443 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0560 1268 645 gene locus_tag LOCUS_12410 1268 645 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_12410 1577 1275 gene locus_tag LOCUS_12420 1577 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0561 <1 541 gene locus_tag LOCUS_12430 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809629.1:DEAD/DEAH box helicase 617 1309 gene locus_tag LOCUS_12440 617 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 <2133 1332 gene locus_tag LOCUS_12450 <2133 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261760.1:phosphotransferase >Feature sequence0562 1715 1095 gene locus_tag LOCUS_12460 1715 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence0563 570 337 gene locus_tag LOCUS_12470 570 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1121 912 gene locus_tag LOCUS_12480 1121 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1389 1541 gene locus_tag LOCUS_12490 1389 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0564 >Feature sequence0565 1253 828 gene locus_tag LOCUS_12500 gene ygcM 1253 828 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_12500 <2126 1411 gene locus_tag LOCUS_12510 <2126 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962802.1:acyl-CoA reductase >Feature sequence0566 >Feature sequence0567 >Feature sequence0568 3 626 gene locus_tag LOCUS_12520 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 972 679 gene locus_tag LOCUS_12530 972 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1505 1071 gene locus_tag LOCUS_12540 1505 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0569 382 783 gene locus_tag LOCUS_12550 382 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1407 793 gene locus_tag LOCUS_12560 1407 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence0570 627 884 gene locus_tag LOCUS_12570 627 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 910 1470 gene locus_tag LOCUS_12580 910 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0571 110 910 gene locus_tag LOCUS_12590 110 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1695 979 gene locus_tag LOCUS_12600 gene rprY 1695 979 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0572 >Feature sequence0573 335 1669 gene locus_tag LOCUS_12610 335 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence0574 1423 626 gene locus_tag LOCUS_12620 1423 626 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence0575 <2108 823 gene locus_tag LOCUS_12630 <2108 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence0576 2083 734 gene locus_tag LOCUS_12640 2083 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0577 <1 1689 gene locus_tag LOCUS_12650 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase >Feature sequence0578 1890 925 gene locus_tag LOCUS_12660 1890 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence0579 >Feature sequence0580 126 953 gene locus_tag LOCUS_12670 126 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1075 2076 gene locus_tag LOCUS_12680 1075 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence0581 1812 748 gene locus_tag LOCUS_12690 1812 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence0582 210 782 gene locus_tag LOCUS_12700 gene nusG 210 782 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ2 protein_id gnl|my_center|LOCUS_12700 795 1238 gene locus_tag LOCUS_12710 gene rplK 795 1238 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_12710 1357 2058 gene locus_tag LOCUS_12720 gene rplA 1357 2058 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_12720 >Feature sequence0583 <1 610 gene locus_tag LOCUS_12730 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZB9:adenylate kinase 823 1881 gene locus_tag LOCUS_12740 823 1881 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105842.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12740 >Feature sequence0584 >Feature sequence0585 792 1607 gene locus_tag LOCUS_12750 792 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence0586 <2085 320 gene locus_tag LOCUS_12760 <2085 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 >Feature sequence0587 276 1709 gene locus_tag LOCUS_12770 276 1709 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence0588 416 123 gene locus_tag LOCUS_12780 416 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1237 416 gene locus_tag LOCUS_12790 1237 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0589 <1 786 gene locus_tag LOCUS_12800 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor 797 1588 gene locus_tag LOCUS_12810 797 1588 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence0590 729 1700 gene locus_tag LOCUS_12820 729 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence0591 661 1605 gene locus_tag LOCUS_12830 661 1605 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765023.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0592 <2074 135 gene locus_tag LOCUS_12840 <2074 135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962696.1:ABC transporter >Feature sequence0593 75 1109 gene locus_tag LOCUS_12850 75 1109 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_12850 1989 1120 gene locus_tag LOCUS_12860 gene phuW 1989 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence0594 74 640 gene locus_tag LOCUS_12870 74 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1614 637 gene locus_tag LOCUS_12880 1614 637 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403071.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence0595 <2069 1530 gene locus_tag LOCUS_12890 <2069 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005489150.1:phospholipase C >Feature sequence0596 1927 1643 gene locus_tag LOCUS_12900 1927 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0597 202 1404 gene locus_tag LOCUS_12910 gene sucC 202 1404 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_12910 >Feature sequence0598 382 1803 gene locus_tag LOCUS_12920 382 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence0599 >Feature sequence0600 <2063 954 gene locus_tag LOCUS_12930 <2063 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P76081:1,2-phenylacetyl-CoA epoxidase, subunit E >Feature sequence0601 1767 526 gene locus_tag LOCUS_12940 1767 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0602 >Feature sequence0603 512 1366 gene locus_tag LOCUS_12950 gene ppiB 512 1366 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1N3 protein_id gnl|my_center|LOCUS_12950 >Feature sequence0604 <1 787 gene locus_tag LOCUS_12960 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765755.1:prevent-host-death protein >Feature sequence0605 769 29 gene locus_tag LOCUS_12970 769 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1201 794 gene locus_tag LOCUS_12980 1201 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1901 1509 gene locus_tag LOCUS_12990 1901 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence0606 487 17 gene locus_tag LOCUS_13000 487 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 715 1461 gene locus_tag LOCUS_13010 gene pcrB 715 1461 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_13010 1782 1477 gene locus_tag LOCUS_13020 1782 1477 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence0607 114 1820 gene locus_tag LOCUS_13030 114 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence0608 1412 1164 gene locus_tag LOCUS_13040 1412 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0609 1731 382 gene locus_tag LOCUS_13050 1731 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0610 1830 751 gene locus_tag LOCUS_13060 gene yqiG 1830 751 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_13060 >Feature sequence0611 168 728 gene locus_tag LOCUS_13070 168 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 <2037 763 gene locus_tag LOCUS_13080 <2037 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962827.1:Fis family transcriptional regulator >Feature sequence0612 <1 768 gene locus_tag LOCUS_13090 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005764053.1:phosphogluconate dehydratase 771 1082 gene locus_tag LOCUS_13100 771 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13100 1113 1334 gene locus_tag LOCUS_13110 1113 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 >Feature sequence0613 >Feature sequence0614 >Feature sequence0615 >Feature sequence0616 1475 597 gene locus_tag LOCUS_13120 1475 597 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence0617 3 1100 gene locus_tag LOCUS_13130 3 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1154 1594 gene locus_tag LOCUS_13140 1154 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence0618 1254 172 gene locus_tag LOCUS_13150 1254 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143082.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence0619 11 1096 gene locus_tag LOCUS_13160 11 1096 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence0620 >Feature sequence0621 1575 1946 gene locus_tag LOCUS_13170 1575 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence0622 1730 765 gene locus_tag LOCUS_13180 1730 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence0623 >Feature sequence0624 535 89 gene locus_tag LOCUS_13190 535 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1325 552 gene locus_tag LOCUS_13200 1325 552 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence0625 86 1096 gene locus_tag LOCUS_13210 86 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_13210 1609 1103 gene locus_tag LOCUS_13220 gene aroK 1609 1103 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0626 <2022 930 gene locus_tag LOCUS_13230 <2022 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NW8:peptidylprolyl isomerase >Feature sequence0627 683 1933 gene locus_tag LOCUS_13240 gene porV 683 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence0628 2017 20 gene locus_tag LOCUS_13250 2017 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0629 <1 969 gene locus_tag LOCUS_13260 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962615.1:ketol-acid reductoisomerase >Feature sequence0630 621 1430 gene locus_tag LOCUS_13270 621 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence0631 659 1240 gene locus_tag LOCUS_13280 659 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0632 >Feature sequence0633 1702 908 gene locus_tag LOCUS_13290 gene thyA 1702 908 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PV5 protein_id gnl|my_center|LOCUS_13290 >Feature sequence0634 1374 1003 gene locus_tag LOCUS_13300 1374 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1495 1665 gene locus_tag LOCUS_13310 1495 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence0635 1696 1133 gene locus_tag LOCUS_13320 1696 1133 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence0636 557 1117 gene locus_tag LOCUS_13330 gene scpB 557 1117 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF54 protein_id gnl|my_center|LOCUS_13330 <2004 1233 gene locus_tag LOCUS_13340 <2004 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NW3:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence0637 315 133 gene locus_tag LOCUS_13350 315 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 684 325 gene locus_tag LOCUS_13360 684 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13360 1709 753 gene locus_tag LOCUS_13370 1709 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0638 160 537 gene locus_tag LOCUS_13380 160 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 606 1361 gene locus_tag LOCUS_13390 606 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0639 535 266 gene locus_tag LOCUS_13400 gene rpmE 535 266 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_13400 >Feature sequence0640 <1 1232 gene locus_tag LOCUS_13410 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784445.1:ABC transporter permease 1263 1850 gene locus_tag LOCUS_13420 1263 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence0641 >Feature sequence0642 <1 1216 gene locus_tag LOCUS_13430 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001109422.1:membrane protein 1433 1879 gene locus_tag LOCUS_13440 1433 1879 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence0643 397 1224 gene locus_tag LOCUS_13450 gene prmA 397 1224 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence0644 119 1117 gene locus_tag LOCUS_13460 119 1117 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence0645 <1990 575 gene locus_tag LOCUS_13470 <1990 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650Q3:L-aspartate oxidase >Feature sequence0646 >Feature sequence0647 >Feature sequence0648 464 844 gene locus_tag LOCUS_13480 464 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13480 >Feature sequence0649 1847 69 gene locus_tag LOCUS_13490 1847 69 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence0650 931 1713 gene locus_tag LOCUS_13500 gene kdsB 931 1713 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_13500 >Feature sequence0651 >Feature sequence0652 >Feature sequence0653 >Feature sequence0654 >Feature sequence0655 >Feature sequence0656 <1 926 gene locus_tag LOCUS_13510 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038080.1:lipase >Feature sequence0657 240 641 gene locus_tag LOCUS_13520 240 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0658 69 908 gene locus_tag LOCUS_13530 69 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1175 1444 gene locus_tag LOCUS_13540 1175 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1444 1767 gene locus_tag LOCUS_13550 1444 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence0659 1018 155 gene locus_tag LOCUS_13560 1018 155 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_13560 1564 1043 gene locus_tag LOCUS_13570 gene ribH 1564 1043 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_13570 >Feature sequence0660 1808 1008 gene locus_tag LOCUS_13580 1808 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0661 <1958 1125 gene locus_tag LOCUS_13590 <1958 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWQ0:aminotransferase >Feature sequence0662 1754 795 gene locus_tag LOCUS_13600 1754 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence0663 <1 854 gene locus_tag LOCUS_13610 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A251:ribosomal RNA small subunit methyltransferase H 880 1254 gene locus_tag LOCUS_13620 880 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0664 1312 1082 gene locus_tag LOCUS_13630 1312 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence0665 >Feature sequence0666 347 54 gene locus_tag LOCUS_13640 347 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 673 1512 gene locus_tag LOCUS_13650 673 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence0667 <1 889 gene locus_tag LOCUS_13660 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XE6:4-hydroxythreonine-4-phosphate dehydrogenase >Feature sequence0668 >Feature sequence0669 >Feature sequence0670 >Feature sequence0671 <1942 520 gene locus_tag LOCUS_13670 <1942 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7W6:tricorn protease >Feature sequence0672 1770 658 gene locus_tag LOCUS_13680 1770 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0673 <1939 1422 gene locus_tag LOCUS_13690 <1939 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0M8:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence0674 <1 779 gene locus_tag LOCUS_13700 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765042.1:glycosyl transferase 783 1538 gene locus_tag LOCUS_13710 783 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence0675 >Feature sequence0676 1423 950 gene locus_tag LOCUS_13720 1423 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence0677 >Feature sequence0678 >Feature sequence0679 <1 1828 gene locus_tag LOCUS_13730 <1 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:peptidase >Feature sequence0680 >Feature sequence0681 >Feature sequence0682 <1 1167 gene locus_tag LOCUS_13740 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081919.1:B12-binding domain-containing radical SAM protein 1172 1843 gene locus_tag LOCUS_13750 1172 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence0683 <1925 1101 gene locus_tag LOCUS_13760 <1925 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S6J9:replicative DNA helicase >Feature sequence0684 <1 1882 gene locus_tag LOCUS_13770 <1 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532918.1:short-chain dehydrogenase >Feature sequence0685 <1920 814 gene locus_tag LOCUS_13780 <1920 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964144.1:epimerase >Feature sequence0686 469 927 gene locus_tag LOCUS_13790 469 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence0687 <1 1186 gene locus_tag LOCUS_13800 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MB15:nuclease SbcCD subunit C >Feature sequence0688 >Feature sequence0689 <1914 510 gene locus_tag LOCUS_13810 <1914 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:glutaryl-7-ACA acylase >Feature sequence0690 1908 112 gene locus_tag LOCUS_13820 1908 112 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13820 >Feature sequence0691 >Feature sequence0692 719 1069 gene locus_tag LOCUS_13830 719 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1151 1510 gene locus_tag LOCUS_13840 1151 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence0693 <1 870 gene locus_tag LOCUS_13850 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257503.1:glutamine--scyllo-inositol aminotransferase 872 1612 gene locus_tag LOCUS_13860 872 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence0694 >Feature sequence0695 942 1721 gene locus_tag LOCUS_13870 942 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0696 354 1577 gene locus_tag LOCUS_13880 gene ald 354 1577 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence0697 951 433 gene locus_tag LOCUS_13890 gene infC 951 433 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_13890 <1897 1263 gene locus_tag LOCUS_13900 <1897 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108949.1:outer membrane protein assembly factor >Feature sequence0698 <1 1265 gene locus_tag LOCUS_13910 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence0699 147 1814 gene locus_tag LOCUS_13920 147 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 >Feature sequence0700 123 965 gene locus_tag LOCUS_13930 gene kdsA 123 965 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE91 protein_id gnl|my_center|LOCUS_13930 1138 1764 gene locus_tag LOCUS_13940 1138 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence0701 2 892 gene locus_tag LOCUS_13950 2 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence0702 >Feature sequence0703 1017 676 gene locus_tag LOCUS_13960 1017 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1220 1633 gene locus_tag LOCUS_13970 gene yqiW 1220 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence0704 >Feature sequence0705 36 488 gene locus_tag LOCUS_13980 36 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 588 1226 gene locus_tag LOCUS_13990 588 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence0706 >Feature sequence0707 >Feature sequence0708 1464 529 gene locus_tag LOCUS_14000 gene ocd2 1464 529 CDS product ornithine cyclodeaminase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58339 protein_id gnl|my_center|LOCUS_14000 >Feature sequence0709 603 1484 gene locus_tag LOCUS_14010 603 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1698 1486 gene locus_tag LOCUS_14020 1698 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence0710 995 816 gene locus_tag LOCUS_14030 995 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 <1877 1021 gene locus_tag LOCUS_14040 <1877 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207007.1:bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB >Feature sequence0711 <1 1317 gene locus_tag LOCUS_14050 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582633.1:glycosyl hydrolase note possible pseudo, internal stop codon >Feature sequence0712 1000 260 gene locus_tag LOCUS_14060 1000 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1713 997 gene locus_tag LOCUS_14070 1713 997 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_14070 >Feature sequence0713 >Feature sequence0714 <1 972 gene locus_tag LOCUS_14080 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence0715 >Feature sequence0716 >Feature sequence0717 9 476 gene locus_tag LOCUS_14090 9 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 486 818 gene locus_tag LOCUS_14100 486 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1423 851 gene locus_tag LOCUS_14110 1423 851 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence0718 <1866 336 gene locus_tag LOCUS_14120 <1866 336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin >Feature sequence0719 2 376 gene locus_tag LOCUS_14130 2 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1074 382 gene locus_tag LOCUS_14140 1074 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1222 1617 gene locus_tag LOCUS_14150 gene ndk 1222 1617 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_14150 >Feature sequence0720 >Feature sequence0721 612 172 gene locus_tag LOCUS_14160 612 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14160 1334 627 gene locus_tag LOCUS_14170 1334 627 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_14170 >Feature sequence0722 >Feature sequence0723 >Feature sequence0724 795 211 gene locus_tag LOCUS_14180 795 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence0725 <1862 364 gene locus_tag LOCUS_14190 <1862 364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase >Feature sequence0726 900 145 gene locus_tag LOCUS_14200 900 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 <1861 1013 gene locus_tag LOCUS_14210 <1861 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964073.1:gliding motility protein GldM >Feature sequence0727 >Feature sequence0728 1683 457 gene locus_tag LOCUS_14220 gene sbcD 1683 457 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_14220 >Feature sequence0729 847 404 gene locus_tag LOCUS_14230 847 404 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence0730 >Feature sequence0731 >Feature sequence0732 1332 166 gene locus_tag LOCUS_14240 1332 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence0733 407 1294 gene locus_tag LOCUS_14250 gene lipA 407 1294 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_14250 1842 1330 gene locus_tag LOCUS_14260 1842 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence0734 >Feature sequence0735 >Feature sequence0736 >Feature sequence0737 851 378 gene locus_tag LOCUS_14270 gene fur 851 378 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_14270 <1841 950 gene locus_tag LOCUS_14280 <1841 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein >Feature sequence0738 >Feature sequence0739 1636 89 gene locus_tag LOCUS_14290 1636 89 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence0740 166 639 gene locus_tag LOCUS_14300 166 639 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 protein_id gnl|my_center|LOCUS_14300 693 1622 gene locus_tag LOCUS_14310 693 1622 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N53 protein_id gnl|my_center|LOCUS_14310 >Feature sequence0741 >Feature sequence0742 <1 928 gene locus_tag LOCUS_14320 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA 1008 1322 gene locus_tag LOCUS_14330 1008 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_14330 1734 1387 gene locus_tag LOCUS_14340 1734 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence0743 >Feature sequence0744 1654 683 gene locus_tag LOCUS_14350 1654 683 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence0745 >Feature sequence0746 >Feature sequence0747 >Feature sequence0748 >Feature sequence0749 427 1455 gene locus_tag LOCUS_14360 gene galE 427 1455 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0750 1125 127 gene locus_tag LOCUS_14370 1125 127 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence0751 >Feature sequence0752 >Feature sequence0753 1786 1007 gene locus_tag LOCUS_14380 gene dltE 1786 1007 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence0754 >Feature sequence0755 >Feature sequence0756 3 455 gene locus_tag LOCUS_14390 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1740 472 gene locus_tag LOCUS_14400 1740 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence0757 >Feature sequence0758 >Feature sequence0759 618 809 gene locus_tag LOCUS_14410 618 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 849 1253 gene locus_tag LOCUS_14420 849 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1363 1635 gene locus_tag LOCUS_14430 1363 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence0760 >Feature sequence0761 >Feature sequence0762 >Feature sequence0763 <1 1622 gene locus_tag LOCUS_14440 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964069.1:glycosyl transferase family 2 >Feature sequence0764 378 959 gene locus_tag LOCUS_14450 378 959 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_14450 971 1486 gene locus_tag LOCUS_14460 971 1486 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence0765 1558 1746 gene locus_tag LOCUS_14470 1558 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence0766 >Feature sequence0767 <1 1097 gene locus_tag LOCUS_14480 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein 1124 1786 gene locus_tag LOCUS_14490 1124 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence0768 1384 305 gene locus_tag LOCUS_14500 gene hemH 1384 305 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0769 <1786 457 gene locus_tag LOCUS_14510 <1786 457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963716.1:TonB-dependent receptor note possible pseudo, internal stop codon >Feature sequence0770 >Feature sequence0771 <1 1008 gene locus_tag LOCUS_14520 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963533.1:sugar O-acetyltransferase >Feature sequence0772 190 573 gene locus_tag LOCUS_14530 190 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 755 1162 gene locus_tag LOCUS_14540 755 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence0773 602 1600 gene locus_tag LOCUS_14550 602 1600 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence0774 734 282 gene locus_tag LOCUS_14560 734 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1345 758 gene locus_tag LOCUS_14570 1345 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence0775 >Feature sequence0776 <1756 900 gene locus_tag LOCUS_14580 <1756 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZM3:tetraacyldisaccharide 4'-kinase >Feature sequence0777 <1 1668 gene locus_tag LOCUS_14590 <1 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876085.1:histidine kinase >Feature sequence0778 <1755 545 gene locus_tag LOCUS_14600 <1755 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962821.1:helicase >Feature sequence0779 994 134 gene locus_tag LOCUS_14610 gene rmlA 994 134 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_14610 >Feature sequence0780 <1753 1027 gene locus_tag LOCUS_14620 <1753 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962359.1:uroporphyrinogen III methyltransferase >Feature sequence0781 <1 650 gene locus_tag LOCUS_14630 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963328.1:cystathionine beta-synthase 1499 711 gene locus_tag LOCUS_14640 1499 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence0782 <1 531 gene locus_tag LOCUS_14650 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A3M1:methionine--tRNA ligase 875 540 gene locus_tag LOCUS_14660 gene ytxJ 875 540 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_14660 929 1441 gene locus_tag LOCUS_14670 gene rimM 929 1441 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A682 protein_id gnl|my_center|LOCUS_14670 >Feature sequence0783 <1747 924 gene locus_tag LOCUS_14680 <1747 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5FHS3:proline iminopeptidase >Feature sequence0784 <1 890 gene locus_tag LOCUS_14690 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962506.1:electron transfer flavoprotein subunit alpha >Feature sequence0785 101 238 gene locus_tag LOCUS_14700 101 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 326 1081 gene locus_tag LOCUS_14710 326 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence0786 >Feature sequence0787 <1 865 gene locus_tag LOCUS_14720 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259329.1:molybdenum cofactor biosynthesis protein MoeB >Feature sequence0788 1025 222 gene locus_tag LOCUS_14730 gene lpxA 1025 222 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_14730 <1738 1031 gene locus_tag LOCUS_14740 <1738 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY98:3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ >Feature sequence0789 >Feature sequence0790 435 1481 gene locus_tag LOCUS_14750 435 1481 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJH8 protein_id gnl|my_center|LOCUS_14750 >Feature sequence0791 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 478 1260 gene locus_tag LOCUS_14760 478 1260 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_14760 1727 1341 gene locus_tag LOCUS_14770 1727 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence0796 <1 523 gene locus_tag LOCUS_14780 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963938.1:metallophosphatase >Feature sequence0797 >Feature sequence0798 <1 1169 gene locus_tag LOCUS_14790 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766931.1:zinc protease 1269 1499 gene locus_tag LOCUS_14800 1269 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence0799 1326 301 gene locus_tag LOCUS_14810 1326 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence0800 613 1467 gene locus_tag LOCUS_14820 gene prmC 613 1467 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0801 >Feature sequence0802 1118 393 gene locus_tag LOCUS_14830 gene legF 1118 393 CDS product CMP-N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8S7 protein_id gnl|my_center|LOCUS_14830 <1723 1121 gene locus_tag LOCUS_14840 <1723 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942612.1:nucleotidyltransferase >Feature sequence0803 >Feature sequence0804 >Feature sequence0805 <1720 395 gene locus_tag LOCUS_14850 <1720 395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42251:alkaline phosphatase D >Feature sequence0806 >Feature sequence0807 678 274 gene locus_tag LOCUS_14860 678 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1020 730 gene locus_tag LOCUS_14870 1020 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1555 1040 gene locus_tag LOCUS_14880 1555 1040 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_14880 >Feature sequence0808 536 180 gene locus_tag LOCUS_14890 536 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1595 648 gene locus_tag LOCUS_14900 gene fmt 1595 648 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_14900 >Feature sequence0809 1500 895 gene locus_tag LOCUS_14910 gene recR 1500 895 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_14910 >Feature sequence0810 >Feature sequence0811 >Feature sequence0812 377 853 gene locus_tag LOCUS_14920 377 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence0813 <1712 369 gene locus_tag LOCUS_14930 <1712 369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963575.1:TonB-dependent receptor >Feature sequence0814 >Feature sequence0815 <1 623 gene locus_tag LOCUS_14940 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H141:DNA replication and repair protein RecF note possible pseudo, internal stop codon 648 869 gene locus_tag LOCUS_14950 648 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence0816 >Feature sequence0817 620 1288 gene locus_tag LOCUS_14960 620 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence0818 >Feature sequence0819 460 852 gene locus_tag LOCUS_14970 460 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence0820 <1699 352 gene locus_tag LOCUS_14980 <1699 352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence0821 314 153 gene locus_tag LOCUS_14990 314 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1282 461 gene locus_tag LOCUS_15000 1282 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence0822 >Feature sequence0823 >Feature sequence0824 >Feature sequence0825 1603 1217 gene locus_tag LOCUS_15010 1603 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence0826 1105 1569 gene locus_tag LOCUS_15020 1105 1569 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0827 853 1239 gene locus_tag LOCUS_15030 853 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence0828 >Feature sequence0829 1453 440 gene locus_tag LOCUS_15040 1453 440 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence0830 946 1464 gene locus_tag LOCUS_15050 946 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0831 1475 1041 gene locus_tag LOCUS_15060 1475 1041 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423284.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence0832 1403 1660 gene locus_tag LOCUS_15070 1403 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence0833 >Feature sequence0834 1358 504 gene locus_tag LOCUS_15080 gene legD1 1358 504 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence0835 55 735 gene locus_tag LOCUS_15090 55 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence0836 <1679 151 gene locus_tag LOCUS_15100 <1679 151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404368.1:lysyl endopeptidase >Feature sequence0837 160 951 gene locus_tag LOCUS_15110 160 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence0838 >Feature sequence0839 92 874 gene locus_tag LOCUS_15120 92 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence0840 <1675 513 gene locus_tag LOCUS_15130 <1675 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCC4:apolipoprotein N-acyltransferase >Feature sequence0841 <1675 932 gene locus_tag LOCUS_15140 <1675 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932409.1:glucose-1-phosphate thymidylyltransferase >Feature sequence0842 48 1652 gene locus_tag LOCUS_15150 48 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0843 >Feature sequence0844 1046 270 gene locus_tag LOCUS_15160 gene sdhB 1046 270 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_15160 <1672 1082 gene locus_tag LOCUS_15170 <1672 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:succinate dehydrogenase flavoprotein subunit >Feature sequence0845 <1672 998 gene locus_tag LOCUS_15180 <1672 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963833.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence0846 1566 1243 gene locus_tag LOCUS_15190 1566 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence0847 1510 419 gene locus_tag LOCUS_15200 1510 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15200 >Feature sequence0848 1068 1214 gene locus_tag LOCUS_15210 1068 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence0849 >Feature sequence0850 384 719 gene locus_tag LOCUS_15220 384 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 776 1300 gene locus_tag LOCUS_15230 776 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence0851 >Feature sequence0852 <1 530 gene locus_tag LOCUS_15240 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368383.1:patatin family protein 982 527 gene locus_tag LOCUS_15250 982 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 <1661 1025 gene locus_tag LOCUS_15260 <1661 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963945.1:DUF4835 domain-containing protein >Feature sequence0853 751 578 gene locus_tag LOCUS_15270 751 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15270 1426 821 gene locus_tag LOCUS_15280 1426 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15280 >Feature sequence0854 >Feature sequence0855 290 1552 gene locus_tag LOCUS_15290 gene nusA 290 1552 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_15290 >Feature sequence0856 <1 683 gene locus_tag LOCUS_15300 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775225.1:copper-translocating P-type ATPase >Feature sequence0857 <1654 34 gene locus_tag LOCUS_15310 <1654 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7B9:RecBCD enzyme subunit RecB >Feature sequence0858 <1 868 gene locus_tag LOCUS_15320 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L5:dihydroorotate dehydrogenase (quinone) <1654 916 gene locus_tag LOCUS_15330 <1654 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E1A4:prolipoprotein diacylglyceryl transferase >Feature sequence0859 >Feature sequence0860 463 882 gene locus_tag LOCUS_15340 463 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1159 1521 gene locus_tag LOCUS_15350 1159 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence0861 >Feature sequence0862 273 1424 gene locus_tag LOCUS_15360 273 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence0863 >Feature sequence0864 561 1355 gene locus_tag LOCUS_15370 561 1355 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0865 410 147 gene locus_tag LOCUS_15380 410 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 488 1147 gene locus_tag LOCUS_15390 488 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1647 1144 gene locus_tag LOCUS_15400 1647 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence0866 1634 159 gene locus_tag LOCUS_15410 1634 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0867 42 392 gene locus_tag LOCUS_15420 42 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 655 1638 gene locus_tag LOCUS_15430 655 1638 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0868 >Feature sequence0869 227 571 gene locus_tag LOCUS_15440 227 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15440 >Feature sequence0870 1291 26 gene locus_tag LOCUS_15450 1291 26 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence0871 369 1580 gene locus_tag LOCUS_15460 gene argD 369 1580 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence0872 385 846 gene locus_tag LOCUS_15470 385 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence0873 <1 954 gene locus_tag LOCUS_15480 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYM2:UvrABC system protein A >Feature sequence0874 >Feature sequence0875 >Feature sequence0876 >Feature sequence0877 >Feature sequence0878 >Feature sequence0879 >Feature sequence0880 >Feature sequence0881 1214 186 gene locus_tag LOCUS_15490 1214 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence0882 <1 1364 gene locus_tag LOCUS_15500 <1 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWT7:dihydroxy-acid dehydratase >Feature sequence0883 245 1033 gene locus_tag LOCUS_15510 245 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence0884 >Feature sequence0885 106 1482 gene locus_tag LOCUS_15520 106 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence0886 128 544 gene locus_tag LOCUS_15530 128 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 544 1269 gene locus_tag LOCUS_15540 544 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence0887 >Feature sequence0888 1206 274 gene locus_tag LOCUS_15550 1206 274 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097437.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence0889 <1618 615 gene locus_tag LOCUS_15560 <1618 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:RND transporter >Feature sequence0890 >Feature sequence0891 <1 1569 gene locus_tag LOCUS_15570 <1 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence0892 1129 713 gene locus_tag LOCUS_15580 1129 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence0893 1193 492 gene locus_tag LOCUS_15590 gene phoP 1193 492 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence0894 775 245 gene locus_tag LOCUS_15600 775 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <1611 817 gene locus_tag LOCUS_15610 <1611 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257474.1:peptidase S8 >Feature sequence0895 1608 733 gene locus_tag LOCUS_15620 1608 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence0896 >Feature sequence0897 >Feature sequence0898 869 1498 gene locus_tag LOCUS_15630 869 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0899 >Feature sequence0900 >Feature sequence0901 >Feature sequence0902 >Feature sequence0903 >Feature sequence0904 >Feature sequence0905 1366 830 gene locus_tag LOCUS_15640 1366 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence0906 >Feature sequence0907 <1595 610 gene locus_tag LOCUS_15650 <1595 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A014:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence0908 <1595 1014 gene locus_tag LOCUS_15660 <1595 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964033.1:aminoacyl-histidine dipeptidase >Feature sequence0909 >Feature sequence0910 <1592 1090 gene locus_tag LOCUS_15670 <1592 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962262.1:peptidase M1 >Feature sequence0911 >Feature sequence0912 1532 867 gene locus_tag LOCUS_15680 1532 867 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence0913 <1 750 gene locus_tag LOCUS_15690 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122252.1:SWF/SNF family helicase >Feature sequence0914 1585 1418 gene locus_tag LOCUS_15700 1585 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence0915 448 1230 gene locus_tag LOCUS_15710 448 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0916 >Feature sequence0917 >Feature sequence0918 84 941 gene locus_tag LOCUS_15720 gene tatC 84 941 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_15720 >Feature sequence0919 >Feature sequence0920 >Feature sequence0921 >Feature sequence0922 <1573 1025 gene locus_tag LOCUS_15730 <1573 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963200.1:glycosyl transferase family 2 >Feature sequence0923 >Feature sequence0924 <1 1213 gene locus_tag LOCUS_15740 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089998.1:acyl-CoA dehydrogenase >Feature sequence0925 1310 255 gene locus_tag LOCUS_15750 1310 255 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence0926 <1 909 gene locus_tag LOCUS_15760 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64X21:chaperone protein ClpB >Feature sequence0927 <1559 977 gene locus_tag LOCUS_15770 <1559 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:peptidase S9 >Feature sequence0928 <1 1209 gene locus_tag LOCUS_15780 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HMD4:glycerol-3-phosphate dehydrogenase >Feature sequence0929 >Feature sequence0930 1216 218 gene locus_tag LOCUS_15790 1216 218 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence0931 <1 517 gene locus_tag LOCUS_15800 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761795.1:7-carboxy-7-deazaguanine synthase >Feature sequence0932 828 247 gene locus_tag LOCUS_15810 828 247 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_15810 1551 1096 gene locus_tag LOCUS_15820 1551 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence0933 >Feature sequence0934 606 1292 gene locus_tag LOCUS_15830 606 1292 CDS product peptidoglycan peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_714690.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence0935 <1 757 gene locus_tag LOCUS_15840 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463527.1:membrane protein >Feature sequence0936 >Feature sequence0937 453 1319 gene locus_tag LOCUS_15850 453 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1546 1328 gene locus_tag LOCUS_15860 1546 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence0938 <1 1459 gene locus_tag LOCUS_15870 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WYB1:acetate kinase >Feature sequence0939 1542 190 gene locus_tag LOCUS_15880 1542 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0940 >Feature sequence0941 >Feature sequence0942 <1542 951 gene locus_tag LOCUS_15890 <1542 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H213:5'-nucleotidase SurE >Feature sequence0943 >Feature sequence0944 <1 503 gene locus_tag LOCUS_15900 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291960.1:A/G-specific adenine glycosylase 745 1155 gene locus_tag LOCUS_15910 745 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence0945 >Feature sequence0946 >Feature sequence0947 >Feature sequence0948 1108 644 gene locus_tag LOCUS_15920 1108 644 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence0949 519 256 gene locus_tag LOCUS_15930 519 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 <1534 503 gene locus_tag LOCUS_15940 <1534 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784545.1:bifunctional aspartate kinase/homoserine dehydrogenase I >Feature sequence0950 156 869 gene locus_tag LOCUS_15950 156 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0951 105 1064 gene locus_tag LOCUS_15960 105 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0952 744 253 gene locus_tag LOCUS_15970 744 253 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_15970 1443 796 gene locus_tag LOCUS_15980 1443 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence0953 >Feature sequence0954 573 187 gene locus_tag LOCUS_15990 573 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 <1531 575 gene locus_tag LOCUS_16000 <1531 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962708.1:glutamine synthetase >Feature sequence0955 460 825 gene locus_tag LOCUS_16010 460 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence0956 1062 478 gene locus_tag LOCUS_16020 1062 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16020 >Feature sequence0957 1525 647 gene locus_tag LOCUS_16030 1525 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence0958 76 840 gene locus_tag LOCUS_16040 76 840 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_16040 <1523 996 gene locus_tag LOCUS_16050 <1523 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010538156.1:ribose-phosphate pyrophosphokinase >Feature sequence0959 >Feature sequence0960 44 859 gene locus_tag LOCUS_16060 44 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence0961 1039 761 gene locus_tag LOCUS_16070 1039 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0962 >Feature sequence0963 607 903 gene locus_tag LOCUS_16080 607 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence0964 >Feature sequence0965 2 421 gene locus_tag LOCUS_16090 2 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0966 >Feature sequence0967 >Feature sequence0968 140 862 gene locus_tag LOCUS_16100 140 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence0969 >Feature sequence0970 <1 1051 gene locus_tag LOCUS_16110 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G3XD98:histidine kinase >Feature sequence0971 >Feature sequence0972 253 855 gene locus_tag LOCUS_16120 253 855 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_16120 <1506 914 gene locus_tag LOCUS_16130 <1506 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963774.1:T9SS C-terminal target domain-containing protein >Feature sequence0973 <1505 477 gene locus_tag LOCUS_16140 <1505 477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937475.1:cation transporter >Feature sequence0974 287 718 gene locus_tag LOCUS_16150 287 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 744 1235 gene locus_tag LOCUS_16160 744 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence0975 154 936 gene locus_tag LOCUS_16170 154 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 68 511 gene locus_tag LOCUS_16180 gene hsp18 68 511 CDS product 18 kDa heat shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03928 protein_id gnl|my_center|LOCUS_16180 861 1298 gene locus_tag LOCUS_16190 861 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0979 279 1127 gene locus_tag LOCUS_16200 279 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence0980 144 494 gene locus_tag LOCUS_16210 144 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence0981 >Feature sequence0982 4 1122 gene locus_tag LOCUS_16220 4 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0983 >Feature sequence0984 >Feature sequence0985 <1 877 gene locus_tag LOCUS_16230 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CW11:deoxyribose-phosphate aldolase >Feature sequence0986 >Feature sequence0987 1182 832 gene locus_tag LOCUS_16240 gene secG 1182 832 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence0988 1016 333 gene locus_tag LOCUS_16250 1016 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0989 1238 42 gene locus_tag LOCUS_16260 1238 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence0990 1145 183 gene locus_tag LOCUS_16270 1145 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0991 159 773 gene locus_tag LOCUS_16280 159 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence0992 >Feature sequence0993 741 1 gene locus_tag LOCUS_16290 gene etfB 741 1 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence0994 >Feature sequence0995 >Feature sequence0996 1267 839 gene locus_tag LOCUS_16300 1267 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence0997 <1485 508 gene locus_tag LOCUS_16310 <1485 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:transketolase >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 <1481 598 gene locus_tag LOCUS_16320 <1481 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964133.1:TonB-dependent receptor >Feature sequence1001 <1480 950 gene locus_tag LOCUS_16330 <1480 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764535.1:DUF4837 domain-containing protein >Feature sequence1002 600 91 gene locus_tag LOCUS_16340 600 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_16340 975 1184 gene locus_tag LOCUS_16350 975 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence1003 <1 1279 gene locus_tag LOCUS_16360 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2A1:translation initiation factor IF-2 >Feature sequence1004 >Feature sequence1005 354 545 gene locus_tag LOCUS_16370 354 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence1006 >Feature sequence1007 294 809 gene locus_tag LOCUS_16380 294 809 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence1008 1282 14 gene locus_tag LOCUS_16390 1282 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence1009 288 767 gene locus_tag LOCUS_16400 288 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 <1469 772 gene locus_tag LOCUS_16410 <1469 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000433374.1:histidine kinase >Feature sequence1010 950 402 gene locus_tag LOCUS_16420 950 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence1011 1450 527 gene locus_tag LOCUS_16430 1450 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence1012 <1 1260 gene locus_tag LOCUS_16440 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257389.1:cytochrome P450 >Feature sequence1013 >Feature sequence1014 <1457 39 gene locus_tag LOCUS_16450 <1457 39 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962568.1:signal peptide peptidase SppA >Feature sequence1015 >Feature sequence1016 <1 1057 gene locus_tag LOCUS_16460 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919056.1:sulfatase >Feature sequence1017 531 869 gene locus_tag LOCUS_16470 531 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_16470 1282 878 gene locus_tag LOCUS_16480 1282 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence1018 323 1396 gene locus_tag LOCUS_16490 323 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence1019 >Feature sequence1020 224 724 gene locus_tag LOCUS_16500 224 724 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_16500 834 1307 gene locus_tag LOCUS_16510 834 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence1021 >Feature sequence1022 144 920 gene locus_tag LOCUS_16520 144 920 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765986.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence1023 1352 876 gene locus_tag LOCUS_16530 1352 876 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence1024 >Feature sequence1025 1427 546 gene locus_tag LOCUS_16540 1427 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence1026 <1 1187 gene locus_tag LOCUS_16550 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765300.1:membrane protein >Feature sequence1027 >Feature sequence1028 >Feature sequence1029 <1439 865 gene locus_tag LOCUS_16560 <1439 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:peptidase S41 >Feature sequence1030 934 188 gene locus_tag LOCUS_16570 gene gldL 934 188 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence1031 >Feature sequence1032 <1 1387 gene locus_tag LOCUS_16580 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45157:RecBCD enzyme subunit RecB >Feature sequence1033 150 767 gene locus_tag LOCUS_16590 150 767 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_16590 820 1290 gene locus_tag LOCUS_16600 820 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence1034 >Feature sequence1035 503 1366 gene locus_tag LOCUS_16610 gene hisG 503 1366 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_16610 >Feature sequence1036 >Feature sequence1037 <1426 590 gene locus_tag LOCUS_16620 <1426 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962550.1:cytochrome-c oxidase >Feature sequence1038 >Feature sequence1039 >Feature sequence1040 67 828 gene locus_tag LOCUS_16630 67 828 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_16630 <1424 825 gene locus_tag LOCUS_16640 <1424 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118092.1:multidrug transporter >Feature sequence1041 1421 558 gene locus_tag LOCUS_16650 1421 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence1042 <1421 693 gene locus_tag LOCUS_16660 <1421 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64N73:polyribonucleotide nucleotidyltransferase >Feature sequence1043 133 981 gene locus_tag LOCUS_16670 133 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence1044 >Feature sequence1045 990 442 gene locus_tag LOCUS_16680 990 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence1046 >Feature sequence1047 >Feature sequence1048 577 1239 gene locus_tag LOCUS_16690 gene sirR 577 1239 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence1049 >Feature sequence1050 997 434 gene locus_tag LOCUS_16700 997 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence1051 >Feature sequence1052 1165 395 gene locus_tag LOCUS_16710 1165 395 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45347 protein_id gnl|my_center|LOCUS_16710 >Feature sequence1053 >Feature sequence1054 >Feature sequence1055 40 903 gene locus_tag LOCUS_16720 40 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1342 989 gene locus_tag LOCUS_16730 1342 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence1056 187 339 gene locus_tag LOCUS_16740 187 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence1057 935 366 gene locus_tag LOCUS_16750 935 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence1058 271 432 gene locus_tag LOCUS_16760 271 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 582 971 gene locus_tag LOCUS_16770 582 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence1059 12 935 gene locus_tag LOCUS_16780 12 935 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence1060 11 748 gene locus_tag LOCUS_16790 11 748 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence1061 530 141 gene locus_tag LOCUS_16800 530 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence1062 <1 804 gene locus_tag LOCUS_16810 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963758.1:xylanase >Feature sequence1063 >Feature sequence1064 <1 1254 gene locus_tag LOCUS_16820 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase >Feature sequence1065 184 1380 gene locus_tag LOCUS_16830 184 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 51 1364 gene locus_tag LOCUS_16840 51 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 >Feature sequence1072 1147 299 gene locus_tag LOCUS_16850 1147 299 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089234.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence1073 460 1386 gene locus_tag LOCUS_16860 460 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence1074 1178 474 gene locus_tag LOCUS_16870 1178 474 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_16870 >Feature sequence1075 >Feature sequence1076 1183 53 gene locus_tag LOCUS_16880 1183 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 295 726 gene locus_tag LOCUS_16890 295 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence1080 36 629 gene locus_tag LOCUS_16900 36 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 803 1237 gene locus_tag LOCUS_16910 803 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence1081 <1 511 gene locus_tag LOCUS_16920 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024190.1:cell surface protein >Feature sequence1082 >Feature sequence1083 >Feature sequence1084 1076 432 gene locus_tag LOCUS_16930 1076 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence1085 <1380 193 gene locus_tag LOCUS_16940 <1380 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence1086 <1 1023 gene locus_tag LOCUS_16950 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038080.1:lipase >Feature sequence1087 536 342 gene locus_tag LOCUS_16960 536 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 <1376 711 gene locus_tag LOCUS_16970 <1376 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:sodium/solute symporter serine/threonine phosphatase >Feature sequence1088 <1 780 gene locus_tag LOCUS_16980 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase 785 1156 gene locus_tag LOCUS_16990 785 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence1089 >Feature sequence1090 >Feature sequence1091 <1369 521 gene locus_tag LOCUS_17000 <1369 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962867.1:cysteine desulfurase >Feature sequence1092 >Feature sequence1093 >Feature sequence1094 >Feature sequence1095 >Feature sequence1096 <1 1300 gene locus_tag LOCUS_17010 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence1097 3 410 gene locus_tag LOCUS_17020 3 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence1098 <1364 329 gene locus_tag LOCUS_17030 <1364 329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium transporter TrkA >Feature sequence1099 1282 737 gene locus_tag LOCUS_17040 1282 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947975.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence1100 >Feature sequence1101 >Feature sequence1102 247 993 gene locus_tag LOCUS_17050 247 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence1103 >Feature sequence1104 1008 568 gene locus_tag LOCUS_17060 1008 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence1105 <1 1216 gene locus_tag LOCUS_17070 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964422.1:tail-specific protease >Feature sequence1106 572 1063 gene locus_tag LOCUS_17080 572 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence1107 >Feature sequence1108 712 326 gene locus_tag LOCUS_17090 gene apaG 712 326 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 protein_id gnl|my_center|LOCUS_17090 <1353 724 gene locus_tag LOCUS_17100 <1353 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI8:guanylate kinase >Feature sequence1109 <1 652 gene locus_tag LOCUS_17110 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963148.1:peptidase S41 >Feature sequence1110 120 584 gene locus_tag LOCUS_17120 120 584 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_17120 589 1086 gene locus_tag LOCUS_17130 589 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence1111 >Feature sequence1112 >Feature sequence1113 146 74 gene locus_tag LOCUS_t00120 146 74 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1114 >Feature sequence1115 1015 173 gene locus_tag LOCUS_17140 1015 173 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963150.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence1116 >Feature sequence1117 >Feature sequence1118 >Feature sequence1119 458 279 gene locus_tag LOCUS_17150 458 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17150 1313 486 gene locus_tag LOCUS_17160 gene asnA 1313 486 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM4 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17160 >Feature sequence1120 >Feature sequence1121 >Feature sequence1122 >Feature sequence1123 <1338 84 gene locus_tag LOCUS_17170 <1338 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor >Feature sequence1124 210 49 gene locus_tag LOCUS_17180 210 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1105 416 gene locus_tag LOCUS_17190 1105 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence1125 <1331 139 gene locus_tag LOCUS_17200 <1331 139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405041.1:magnesium chelatase >Feature sequence1126 >Feature sequence1127 190 693 gene locus_tag LOCUS_17210 190 693 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 protein_id gnl|my_center|LOCUS_17210 690 1028 gene locus_tag LOCUS_17220 690 1028 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7M9Y6 protein_id gnl|my_center|LOCUS_17220 >Feature sequence1128 483 968 gene locus_tag LOCUS_17230 gene recX 483 968 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_17230 1304 969 gene locus_tag LOCUS_17240 gene ogt2 1304 969 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence1129 >Feature sequence1130 >Feature sequence1131 >Feature sequence1132 >Feature sequence1133 262 567 gene locus_tag LOCUS_17250 gene rplU 262 567 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR2 protein_id gnl|my_center|LOCUS_17250 621 869 gene locus_tag LOCUS_17260 gene rpmA 621 869 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR3 protein_id gnl|my_center|LOCUS_17260 960 1133 gene locus_tag LOCUS_17270 960 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17270 >Feature sequence1134 <1320 577 gene locus_tag LOCUS_17280 <1320 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963606.1:type I deoxyribonuclease HsdR >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 399 1208 gene locus_tag LOCUS_17290 399 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence1138 >Feature sequence1139 >Feature sequence1140 <1 933 gene locus_tag LOCUS_17300 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MX8:arginine--tRNA ligase >Feature sequence1141 422 219 gene locus_tag LOCUS_17310 422 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence1142 >Feature sequence1143 >Feature sequence1144 399 151 gene locus_tag LOCUS_17320 399 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 <1315 447 gene locus_tag LOCUS_17330 <1315 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786594.1:endonuclease >Feature sequence1145 >Feature sequence1146 >Feature sequence1147 170 943 gene locus_tag LOCUS_17340 170 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence1148 >Feature sequence1149 <1 780 gene locus_tag LOCUS_17350 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963365.1:ATP-dependent DNA helicase RecQ >Feature sequence1150 299 1306 gene locus_tag LOCUS_17360 gene speB 299 1306 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence1151 >Feature sequence1152 993 424 gene locus_tag LOCUS_17370 993 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence1153 >Feature sequence1154 >Feature sequence1155 201 73 gene locus_tag LOCUS_17380 201 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 750 229 gene locus_tag LOCUS_17390 gene ilvH 750 229 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_17390 1303 776 gene locus_tag LOCUS_17400 1303 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence1156 >Feature sequence1157 >Feature sequence1158 >Feature sequence1159 540 97 gene locus_tag LOCUS_17410 540 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <1301 611 gene locus_tag LOCUS_17420 <1301 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760839.1:biopolymer transporter ExbB >Feature sequence1160 <1301 382 gene locus_tag LOCUS_17430 <1301 382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87SW0:fructose-1,6-bisphosphatase class 1 >Feature sequence1161 >Feature sequence1162 >Feature sequence1163 <1299 454 gene locus_tag LOCUS_17440 <1299 454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404041.1:sodium:proton antiporter >Feature sequence1164 377 3 gene locus_tag LOCUS_17450 377 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence1165 <1 787 gene locus_tag LOCUS_17460 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O06769:neutral ceramidase >Feature sequence1166 <1298 359 gene locus_tag LOCUS_17470 <1298 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813290.1:phenylacetic acid degradation protein >Feature sequence1167 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 <1 846 gene locus_tag LOCUS_17480 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524570.1:fatty oxidation complex subunit alpha >Feature sequence1171 <1 639 gene locus_tag LOCUS_17490 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A5I1:GTPase HflX >Feature sequence1172 >Feature sequence1173 <1292 142 gene locus_tag LOCUS_17500 <1292 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038863.1:isocitrate dehydrogenase, NADP-dependent >Feature sequence1174 >Feature sequence1175 439 227 gene locus_tag LOCUS_17510 439 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1138 590 gene locus_tag LOCUS_17520 1138 590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228315.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence1176 >Feature sequence1177 436 876 gene locus_tag LOCUS_17530 436 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence1178 <1288 345 gene locus_tag LOCUS_17540 <1288 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941642.1:tail protein >Feature sequence1179 799 1245 gene locus_tag LOCUS_17550 799 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405426.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence1180 <1 928 gene locus_tag LOCUS_17560 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 >Feature sequence1181 <1 731 gene locus_tag LOCUS_17570 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106349.1:glutamate synthase >Feature sequence1182 >Feature sequence1183 740 1255 gene locus_tag LOCUS_17580 gene fldA 740 1255 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP7 protein_id gnl|my_center|LOCUS_17580 >Feature sequence1184 >Feature sequence1185 >Feature sequence1186 >Feature sequence1187 <1 1107 gene locus_tag LOCUS_17590 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H090:aminotransferase >Feature sequence1188 <1275 757 gene locus_tag LOCUS_17600 <1275 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963545.1:xenobiotic ABC transporter ATP-binding protein >Feature sequence1189 >Feature sequence1190 1188 1030 gene locus_tag LOCUS_17610 1188 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence1191 >Feature sequence1192 395 12 gene locus_tag LOCUS_17620 395 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 <1274 524 gene locus_tag LOCUS_17630 <1274 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404983.1:Na-K-Cl cotransporter >Feature sequence1193 135 563 gene locus_tag LOCUS_17640 135 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence1194 >Feature sequence1195 >Feature sequence1196 <1271 609 gene locus_tag LOCUS_17650 <1271 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964143.1:deoxyribodipyrimidine photo-lyase >Feature sequence1197 >Feature sequence1198 >Feature sequence1199 1081 320 gene locus_tag LOCUS_17660 1081 320 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence1200 <1 1260 gene locus_tag LOCUS_17670 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024173.1:cell surface protein >Feature sequence1201 >Feature sequence1202 1199 642 gene locus_tag LOCUS_17680 1199 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence1203 787 1227 gene locus_tag LOCUS_17690 787 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence1204 >Feature sequence1205 >Feature sequence1206 <1 581 gene locus_tag LOCUS_17700 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266956.1:membrane protein >Feature sequence1207 >Feature sequence1208 >Feature sequence1209 3 440 gene locus_tag LOCUS_17710 3 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence1210 <1260 488 gene locus_tag LOCUS_17720 <1260 488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H115:DNA topoisomerase 1 >Feature sequence1211 >Feature sequence1212 <1 618 gene locus_tag LOCUS_17730 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250683.1:dolichol-P-glucose synthetase <1260 639 gene locus_tag LOCUS_17740 <1260 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403426.1:histidine kinase >Feature sequence1213 >Feature sequence1214 >Feature sequence1215 >Feature sequence1216 >Feature sequence1217 <1 1100 gene locus_tag LOCUS_17750 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021764.1:surface antigen gene >Feature sequence1218 494 282 gene locus_tag LOCUS_17760 494 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 <1255 567 gene locus_tag LOCUS_17770 <1255 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2E1:ATP synthase subunit a >Feature sequence1219 >Feature sequence1220 526 149 gene locus_tag LOCUS_17780 526 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence1221 <1251 685 gene locus_tag LOCUS_17790 <1251 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963873.1:peptidase S8 >Feature sequence1222 <1 1213 gene locus_tag LOCUS_17800 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942080.1:peptide-binding protein >Feature sequence1223 <1249 649 gene locus_tag LOCUS_17810 <1249 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1G0:Holliday junction ATP-dependent DNA helicase RuvA >Feature sequence1224 >Feature sequence1225 <1 521 gene locus_tag LOCUS_17820 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583996.1:conjugative transfer protein GumN >Feature sequence1226 284 1078 gene locus_tag LOCUS_17830 284 1078 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence1227 <1247 287 gene locus_tag LOCUS_17840 <1247 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482600.1:ABC transporter substrate-binding protein >Feature sequence1228 >Feature sequence1229 915 232 gene locus_tag LOCUS_17850 915 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence1230 >Feature sequence1231 >Feature sequence1232 >Feature sequence1233 >Feature sequence1234 >Feature sequence1235 <1 978 gene locus_tag LOCUS_17860 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUJ2:phosphomethylpyrimidine synthase >Feature sequence1236 >Feature sequence1237 >Feature sequence1238 1059 454 gene locus_tag LOCUS_17870 1059 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence1239 1237 704 gene locus_tag LOCUS_17880 1237 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence1240 209 733 gene locus_tag LOCUS_17890 209 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 782 1183 gene locus_tag LOCUS_17900 782 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence1241 504 1214 gene locus_tag LOCUS_17910 gene yoxD 504 1214 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_17910 >Feature sequence1242 >Feature sequence1243 >Feature sequence1244 135 491 gene locus_tag LOCUS_17920 gene gldC 135 491 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_17920 <1233 492 gene locus_tag LOCUS_17930 <1233 492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070535.1:peptidase M6 >Feature sequence1245 >Feature sequence1246 >Feature sequence1247 >Feature sequence1248 535 858 gene locus_tag LOCUS_17940 535 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence1249 962 390 gene locus_tag LOCUS_17950 gene lspA 962 390 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_17950 >Feature sequence1250 604 1026 gene locus_tag LOCUS_17960 604 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence1251 >Feature sequence1252 >Feature sequence1253 >Feature sequence1254 >Feature sequence1255 >Feature sequence1256 >Feature sequence1257 >Feature sequence1258 118 1164 gene locus_tag LOCUS_17970 118 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence1259 738 1184 gene locus_tag LOCUS_17980 738 1184 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence1260 <1 578 gene locus_tag LOCUS_17990 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786945.1:RNA polymerase sigma factor >Feature sequence1261 <1216 157 gene locus_tag LOCUS_18000 <1216 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405022.1:T9SS C-terminal target domain-containing protein >Feature sequence1262 >Feature sequence1263 >Feature sequence1264 >Feature sequence1265 >Feature sequence1266 <1 1178 gene locus_tag LOCUS_18010 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764235.1:lytic transglycosylase >Feature sequence1267 >Feature sequence1268 697 539 gene locus_tag LOCUS_18020 697 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence1269 <1209 641 gene locus_tag LOCUS_18030 <1209 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289368.1:dehydrogenase >Feature sequence1270 311 745 gene locus_tag LOCUS_18040 311 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence1271 >Feature sequence1272 >Feature sequence1273 >Feature sequence1274 856 521 gene locus_tag LOCUS_18050 856 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence1275 <1207 179 gene locus_tag LOCUS_18060 <1207 179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071598.1:short-chain fatty acid transporter >Feature sequence1276 >Feature sequence1277 >Feature sequence1278 <1 715 gene locus_tag LOCUS_18070 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788747.1:DNA polymerase III subunit epsilon >Feature sequence1279 >Feature sequence1280 463 687 gene locus_tag LOCUS_18080 463 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18080 >Feature sequence1281 >Feature sequence1282 54 575 gene locus_tag LOCUS_18090 54 575 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence1283 <1 1129 gene locus_tag LOCUS_18100 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase >Feature sequence1284 1199 792 gene locus_tag LOCUS_18110 1199 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence1285 >Feature sequence1286 >Feature sequence1287 351 127 gene locus_tag LOCUS_18120 351 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence1288 >Feature sequence1289 <1 628 gene locus_tag LOCUS_18130 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000948912.1:FAD-binding oxidoreductase >Feature sequence1290 >Feature sequence1291 400 29 gene locus_tag LOCUS_18140 400 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1006 434 gene locus_tag LOCUS_18150 1006 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence1292 >Feature sequence1293 >Feature sequence1294 1077 625 gene locus_tag LOCUS_18160 1077 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence1295 >Feature sequence1296 >Feature sequence1297 >Feature sequence1298 >Feature sequence1299 556 119 gene locus_tag LOCUS_18170 556 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence1300 <1188 378 gene locus_tag LOCUS_18180 <1188 378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964115.1:murein transglycosylase >Feature sequence1301 >Feature sequence1302 >Feature sequence1303 >Feature sequence1304 792 442 gene locus_tag LOCUS_18190 gene rplW 792 442 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_18190 >Feature sequence1305 >Feature sequence1306 <1 605 gene locus_tag LOCUS_18200 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104727.1:serine/threonine protein phosphatase >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 <1 681 gene locus_tag LOCUS_18210 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765688.1:RNA helicase 686 886 gene locus_tag LOCUS_18220 686 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence1310 >Feature sequence1311 1 582 gene locus_tag LOCUS_18230 1 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence1312 >Feature sequence1313 1174 1101 gene locus_tag LOCUS_t00130 1174 1101 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1314 >Feature sequence1315 758 78 gene locus_tag LOCUS_18240 758 78 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_18240 >Feature sequence1316 >Feature sequence1317 >Feature sequence1318 <1170 167 gene locus_tag LOCUS_18250 <1170 167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2W0:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase >Feature sequence1319 >Feature sequence1320 270 812 gene locus_tag LOCUS_18260 270 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 >Feature sequence1324 435 1043 gene locus_tag LOCUS_18270 435 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence1325 >Feature sequence1326 <1165 539 gene locus_tag LOCUS_18280 <1165 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786352.1:ribonuclease G >Feature sequence1327 >Feature sequence1328 >Feature sequence1329 >Feature sequence1330 <1 593 gene locus_tag LOCUS_18290 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207883.1:AraC family transcriptional regulator >Feature sequence1331 >Feature sequence1332 438 142 gene locus_tag LOCUS_18300 438 142 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_18300 <1163 552 gene locus_tag LOCUS_18310 <1163 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964046.1:peptidase M23 >Feature sequence1333 >Feature sequence1334 >Feature sequence1335 <1 643 gene locus_tag LOCUS_18320 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence1336 >Feature sequence1337 >Feature sequence1338 >Feature sequence1339 >Feature sequence1340 801 433 gene locus_tag LOCUS_18330 801 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence1341 399 205 gene locus_tag LOCUS_18340 399 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence1342 904 128 gene locus_tag LOCUS_18350 904 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence1343 <1 554 gene locus_tag LOCUS_18360 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223463.1:phenylacetate-CoA oxygenase subunit PaaA 576 860 gene locus_tag LOCUS_18370 gene paaB 576 860 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence1344 >Feature sequence1345 402 43 gene locus_tag LOCUS_18380 402 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 <1148 396 gene locus_tag LOCUS_18390 <1148 396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein >Feature sequence1346 514 966 gene locus_tag LOCUS_18400 514 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence1347 1125 826 gene locus_tag LOCUS_18410 1125 826 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence1348 >Feature sequence1349 <1 528 gene locus_tag LOCUS_18420 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403347.1:glycerophosphoryl diester phosphodiesterase >Feature sequence1350 <1 1033 gene locus_tag LOCUS_18430 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036694.1:MFS transporter >Feature sequence1351 >Feature sequence1352 >Feature sequence1353 <1141 635 gene locus_tag LOCUS_18440 <1141 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964122.1:ABC transporter permease >Feature sequence1354 <1140 502 gene locus_tag LOCUS_18450 <1140 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZD2:glycine dehydrogenase (aminomethyl-transferring) >Feature sequence1355 >Feature sequence1356 480 7 gene locus_tag LOCUS_18460 480 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_18460 <1137 567 gene locus_tag LOCUS_18470 <1137 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YT3:riboflavin biosynthesis protein RibBA >Feature sequence1357 >Feature sequence1358 <1 664 gene locus_tag LOCUS_18480 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461064.1:diguanylate cyclase <1136 633 gene locus_tag LOCUS_18490 <1136 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FRG7:histidine decarboxylase >Feature sequence1359 >Feature sequence1360 >Feature sequence1361 >Feature sequence1362 >Feature sequence1363 >Feature sequence1364 >Feature sequence1365 332 1069 gene locus_tag LOCUS_18500 332 1069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122745.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence1366 444 1031 gene locus_tag LOCUS_18510 444 1031 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964176.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence1367 >Feature sequence1368 522 596 gene locus_tag LOCUS_t00140 522 596 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1369 >Feature sequence1370 >Feature sequence1371 877 557 gene locus_tag LOCUS_18520 877 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence1372 226 591 gene locus_tag LOCUS_18530 226 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence1373 <1 513 gene locus_tag LOCUS_18540 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404427.1:DNA polymerase/3'-5' exonuclease PolX <1125 500 gene locus_tag LOCUS_18550 <1125 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140720.1:hybrid sensor histidine kinase/response regulator >Feature sequence1374 436 897 gene locus_tag LOCUS_18560 436 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence1375 >Feature sequence1376 <1 1006 gene locus_tag LOCUS_18570 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392273.1:aminotransferase DegT >Feature sequence1377 361 1119 gene locus_tag LOCUS_18580 gene nqrC 361 1119 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_18580 >Feature sequence1378 >Feature sequence1379 >Feature sequence1380 >Feature sequence1381 4 891 gene locus_tag LOCUS_18590 4 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence1382 >Feature sequence1383 1118 348 gene locus_tag LOCUS_18600 gene mqnA 1118 348 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_18600 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 <1 613 gene locus_tag LOCUS_18610 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964362.1:ABC transporter ATP-binding protein >Feature sequence1387 >Feature sequence1388 >Feature sequence1389 >Feature sequence1390 <1103 416 gene locus_tag LOCUS_18620 <1103 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962301.1:acyltransferase >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 >Feature sequence1394 >Feature sequence1395 >Feature sequence1396 >Feature sequence1397 >Feature sequence1398 >Feature sequence1399 >Feature sequence1400 >Feature sequence1401 >Feature sequence1402 >Feature sequence1403 <1 673 gene locus_tag LOCUS_18630 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259615.1:glycosyl transferase family 1 >Feature sequence1404 >Feature sequence1405 >Feature sequence1406 >Feature sequence1407 >Feature sequence1408 >Feature sequence1409 <1 758 gene locus_tag LOCUS_18640 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H197:UDP-N-acetylmuramoylalanine--D-glutamate ligase >Feature sequence1410 >Feature sequence1411 >Feature sequence1412 >Feature sequence1413 >Feature sequence1414 <1 862 gene locus_tag LOCUS_18650 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760040.1:hemolysin >Feature sequence1415 >Feature sequence1416 >Feature sequence1417 1056 655 gene locus_tag LOCUS_18660 1056 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence1418 >Feature sequence1419 201 368 gene locus_tag LOCUS_18670 201 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence1420 >Feature sequence1421 >Feature sequence1422 <1 903 gene locus_tag LOCUS_18680 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272539.1:cell wall-binding protein >Feature sequence1423 >Feature sequence1424 >Feature sequence1425 >Feature sequence1426 2 595 gene locus_tag LOCUS_18690 2 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence1427 >Feature sequence1428 693 154 gene locus_tag LOCUS_18700 693 154 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence1429 >Feature sequence1430 214 477 gene locus_tag LOCUS_18710 214 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence1431 <1 609 gene locus_tag LOCUS_18720 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 725 961 gene locus_tag LOCUS_18730 725 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence1432 >Feature sequence1433 >Feature sequence1434 <1 691 gene locus_tag LOCUS_18740 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121855.1:manganese transporter >Feature sequence1435 >Feature sequence1436 815 273 gene locus_tag LOCUS_18750 815 273 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262060.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence1437 >Feature sequence1438 >Feature sequence1439 >Feature sequence1440 582 199 gene locus_tag LOCUS_18760 582 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence1441 >Feature sequence1442 609 277 gene locus_tag LOCUS_18770 609 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence1443 >Feature sequence1444 170 676 gene locus_tag LOCUS_18780 gene purE 170 676 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_18780 1064 801 gene locus_tag LOCUS_18790 1064 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence1445 >Feature sequence1446 153 659 gene locus_tag LOCUS_18800 153 659 CDS product 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809749.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence1447 >Feature sequence1448 <1 818 gene locus_tag LOCUS_18810 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403897.1:7-beta-(4-carbaxybutanamido)cephalosporanic acid acylase >Feature sequence1449 >Feature sequence1450 <1059 79 gene locus_tag LOCUS_18820 <1059 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1S4:elongation factor 4 >Feature sequence1451 <1 632 gene locus_tag LOCUS_18830 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H191:cell division protein FtsZ 698 1057 gene locus_tag LOCUS_18840 698 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence1452 >Feature sequence1453 470 976 gene locus_tag LOCUS_18850 470 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence1454 >Feature sequence1455 620 204 gene locus_tag LOCUS_18860 620 204 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125898.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence1456 >Feature sequence1457 272 532 gene locus_tag LOCUS_18870 272 532 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence1458 >Feature sequence1459 492 289 gene locus_tag LOCUS_18880 492 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence1460 >Feature sequence1461 >Feature sequence1462 >Feature sequence1463 >Feature sequence1464 >Feature sequence1465 >Feature sequence1466 974 384 gene locus_tag LOCUS_18890 gene rnhB 974 384 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_18890 >Feature sequence1467 <1 1005 gene locus_tag LOCUS_18900 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640098.1:isopenicillin-N epimerase >Feature sequence1468 2 535 gene locus_tag LOCUS_18910 2 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18910 487 945 gene locus_tag LOCUS_18920 487 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence1469 >Feature sequence1470 >Feature sequence1471 <1 766 gene locus_tag LOCUS_18930 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883676.1:8-amino-7-oxononanoate synthase >Feature sequence1472 >Feature sequence1473 >Feature sequence1474 >Feature sequence1475 >Feature sequence1476 >Feature sequence1477 >Feature sequence1478 2 934 gene locus_tag LOCUS_18940 2 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence1479 >Feature sequence1480 <1 697 gene locus_tag LOCUS_18950 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964214.1:transporter >Feature sequence1481 >Feature sequence1482 770 357 gene locus_tag LOCUS_18960 gene yuxK 770 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_18960 >Feature sequence1483 >Feature sequence1484 268 723 gene locus_tag LOCUS_18970 268 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence1485 >Feature sequence1486 <1031 108 gene locus_tag LOCUS_18980 <1031 108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964457.1:peptidase S9 >Feature sequence1487 >Feature sequence1488 358 149 gene locus_tag LOCUS_18990 358 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence1489 >Feature sequence1490 >Feature sequence1491 >Feature sequence1492 >Feature sequence1493 <1 606 gene locus_tag LOCUS_19000 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141283.1:molybdenum cofactor biosynthesis protein >Feature sequence1494 >Feature sequence1495 <1 734 gene locus_tag LOCUS_19010 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962383.1:arylformamidase >Feature sequence1496 >Feature sequence1497 <1 864 gene locus_tag LOCUS_19020 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:formate dehydrogenase >Feature sequence1498 758 387 gene locus_tag LOCUS_19030 758 387 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence1499 >Feature sequence1500 >Feature sequence1501 78 890 gene locus_tag LOCUS_19040 78 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence1502 >Feature sequence1503 >Feature sequence1504 <1 604 gene locus_tag LOCUS_19050 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140568.1:chromate transporter >Feature sequence1505 >Feature sequence1506 >Feature sequence1507 >Feature sequence1508 >Feature sequence1509 >Feature sequence1510 104 700 gene locus_tag LOCUS_19060 104 700 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933917.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence1511 >Feature sequence1512 >Feature sequence1513 >Feature sequence1514 >Feature sequence1515 693 502 gene locus_tag LOCUS_19070 693 502 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence1516 >Feature sequence1517 1006 32 gene locus_tag LOCUS_19080 1006 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence1518 >Feature sequence1519 396 55 gene locus_tag LOCUS_19090 396 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence1520 >Feature sequence1521 1003 764 gene locus_tag LOCUS_19100 1003 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence1522 >Feature sequence1523 >Feature sequence1524 >Feature sequence1525 >Feature sequence1526 >Feature sequence1527 >Feature sequence1528