>Feature sequence001 942 133 gene locus_tag LOCUS_00010 942 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1175 3325 gene locus_tag LOCUS_00020 gene copA 1175 3325 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 protein_id gnl|my_center|LOCUS_00020 4364 3399 gene locus_tag LOCUS_00030 4364 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_00030 4570 4881 gene locus_tag LOCUS_00040 gene rpmE2 4570 4881 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R36 protein_id gnl|my_center|LOCUS_00040 5173 6372 gene locus_tag LOCUS_00050 5173 6372 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_00050 7489 6572 gene locus_tag LOCUS_00060 7489 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7745 14677 gene locus_tag LOCUS_00070 7745 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14693 16675 gene locus_tag LOCUS_00080 14693 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 17062 18984 gene locus_tag LOCUS_00090 gene dnaK 17062 18984 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_00090 19365 20318 gene locus_tag LOCUS_00100 19365 20318 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920985.1 protein_id gnl|my_center|LOCUS_00100 21604 20381 gene locus_tag LOCUS_00110 21604 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 22562 21609 gene locus_tag LOCUS_00120 gene pyrB 22562 21609 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_00120 23133 22594 gene locus_tag LOCUS_00130 gene pyrR1 23133 22594 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_00130 25528 23435 gene locus_tag LOCUS_00140 25528 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 26503 25682 gene locus_tag LOCUS_00150 26503 25682 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_00150 27508 26552 gene locus_tag LOCUS_00160 27508 26552 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_00160 27999 27511 gene locus_tag LOCUS_00170 27999 27511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 28234 29898 gene locus_tag LOCUS_00180 28234 29898 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64S05 protein_id gnl|my_center|LOCUS_00180 30359 29976 gene locus_tag LOCUS_00190 30359 29976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 31629 30733 gene locus_tag LOCUS_00200 31629 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 32190 32447 gene locus_tag LOCUS_00210 32190 32447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 32486 33781 gene locus_tag LOCUS_00220 32486 33781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 35199 33778 gene locus_tag LOCUS_00230 35199 33778 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963534.1 protein_id gnl|my_center|LOCUS_00230 36466 35399 gene locus_tag LOCUS_00240 36466 35399 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_00240 36425 36598 gene locus_tag LOCUS_00250 36425 36598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 38115 36679 gene locus_tag LOCUS_00260 38115 36679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 >Feature sequence002 <1 1299 gene locus_tag LOCUS_00270 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964141.1:FAD-binding protein 2078 1296 gene locus_tag LOCUS_00280 2078 1296 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 protein_id gnl|my_center|LOCUS_00280 5274 2032 gene locus_tag LOCUS_00290 5274 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 7033 11940 gene locus_tag LOCUS_00300 7033 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 11988 16199 gene locus_tag LOCUS_00310 11988 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18849 19901 gene locus_tag LOCUS_00320 18849 19901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 19908 20981 gene locus_tag LOCUS_00330 19908 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22180 30510 gene locus_tag LOCUS_00340 22180 30510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30507 31388 gene locus_tag LOCUS_00350 30507 31388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31400 32431 gene locus_tag LOCUS_00360 31400 32431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32489 33250 gene locus_tag LOCUS_00370 32489 33250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 33426 35447 gene locus_tag LOCUS_00380 33426 35447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 >Feature sequence003 15354 4123 gene locus_tag LOCUS_00390 15354 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 17150 15354 gene locus_tag LOCUS_00400 17150 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 17943 17605 gene locus_tag LOCUS_00410 17943 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 18047 18613 gene locus_tag LOCUS_00420 18047 18613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 18638 19543 gene locus_tag LOCUS_00430 18638 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 19864 22530 gene locus_tag LOCUS_00440 19864 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 24362 22566 gene locus_tag LOCUS_00450 24362 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 26143 24371 gene locus_tag LOCUS_00460 26143 24371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 26585 30136 gene locus_tag LOCUS_00470 26585 30136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 30129 31094 gene locus_tag LOCUS_00480 30129 31094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 31091 32209 gene locus_tag LOCUS_00490 31091 32209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_00490 33803 32418 gene locus_tag LOCUS_00500 33803 32418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 >Feature sequence004 1750 1421 gene locus_tag LOCUS_00510 1750 1421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_00510 2397 1747 gene locus_tag LOCUS_00520 2397 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 2583 3191 gene locus_tag LOCUS_00530 2583 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3329 4351 gene locus_tag LOCUS_00540 3329 4351 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_00540 4506 5639 gene locus_tag LOCUS_00550 gene rmlB 4506 5639 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_00550 5799 6668 gene locus_tag LOCUS_00560 gene rffH 5799 6668 CDS product glucose-1-phosphate thymidylyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61887 protein_id gnl|my_center|LOCUS_00560 6698 8503 gene locus_tag LOCUS_00570 gene sunT 6698 8503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834715.1 protein_id gnl|my_center|LOCUS_00570 8612 9955 gene locus_tag LOCUS_00580 gene capL 8612 9955 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_00580 10156 12681 gene locus_tag LOCUS_00590 10156 12681 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202650.1 protein_id gnl|my_center|LOCUS_00590 12685 13755 gene locus_tag LOCUS_00600 12685 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13911 14795 gene locus_tag LOCUS_00610 13911 14795 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 protein_id gnl|my_center|LOCUS_00610 14798 15313 gene locus_tag LOCUS_00620 14798 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 15300 16790 gene locus_tag LOCUS_00630 15300 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 16887 18191 gene locus_tag LOCUS_00640 16887 18191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 18188 18862 gene locus_tag LOCUS_00650 18188 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 19084 20193 gene locus_tag LOCUS_00660 19084 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 20190 21566 gene locus_tag LOCUS_00670 20190 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 21566 22756 gene locus_tag LOCUS_00680 21566 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 22756 23868 gene locus_tag LOCUS_00690 22756 23868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 23918 24970 gene locus_tag LOCUS_00700 23918 24970 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_00700 24979 26433 gene locus_tag LOCUS_00710 24979 26433 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_00710 26436 27365 gene locus_tag LOCUS_00720 26436 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence005 3264 1774 gene locus_tag LOCUS_00730 3264 1774 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_00730 4300 3335 gene locus_tag LOCUS_00740 4300 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 8081 4521 gene locus_tag LOCUS_00750 gene smc 8081 4521 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_00750 8162 8347 gene locus_tag LOCUS_00760 8162 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 11817 8413 gene locus_tag LOCUS_00770 11817 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12676 12137 gene locus_tag LOCUS_00780 12676 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12980 15892 gene locus_tag LOCUS_00790 12980 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 16538 15993 gene locus_tag LOCUS_00800 16538 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_00800 16750 19674 gene locus_tag LOCUS_00810 16750 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 19758 21074 gene locus_tag LOCUS_00820 19758 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 24044 21261 gene locus_tag LOCUS_00830 24044 21261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 25619 24645 gene locus_tag LOCUS_00840 25619 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence006 <1 1188 gene locus_tag LOCUS_00850 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141163.1:dehydrogenase 1940 3238 gene locus_tag LOCUS_00860 1940 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601707.1 protein_id gnl|my_center|LOCUS_00860 4458 3247 gene locus_tag LOCUS_00870 4458 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 6209 4689 gene locus_tag LOCUS_00880 6209 4689 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_00880 6359 9325 gene locus_tag LOCUS_00890 6359 9325 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_00890 9984 9493 gene locus_tag LOCUS_00900 gene msrA1 9984 9493 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK0 protein_id gnl|my_center|LOCUS_00900 10290 12035 gene locus_tag LOCUS_00910 10290 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12013 13236 gene locus_tag LOCUS_00920 gene rsmB 12013 13236 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_00920 14390 13254 gene locus_tag LOCUS_00930 gene bioA 14390 13254 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC5 protein_id gnl|my_center|LOCUS_00930 14609 15442 gene locus_tag LOCUS_00940 14609 15442 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_00940 16245 15607 gene locus_tag LOCUS_00950 16245 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804229.1 protein_id gnl|my_center|LOCUS_00950 16453 17490 gene locus_tag LOCUS_00960 gene aguA 16453 17490 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_00960 17603 19765 gene locus_tag LOCUS_00970 17603 19765 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_00970 19765 21228 gene locus_tag LOCUS_00980 19765 21228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900521.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence007 2239 644 gene locus_tag LOCUS_00990 gene lig2 2239 644 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_00990 3419 2385 gene locus_tag LOCUS_01000 3419 2385 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_01000 4447 3527 gene locus_tag LOCUS_01010 4447 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5565 4507 gene locus_tag LOCUS_01020 5565 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 6962 5649 gene locus_tag LOCUS_01030 gene mvaA 6962 5649 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_01030 8066 7029 gene locus_tag LOCUS_01040 gene fni 8066 7029 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD90 protein_id gnl|my_center|LOCUS_01040 8934 8320 gene locus_tag LOCUS_01050 8934 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 9565 9753 gene locus_tag LOCUS_01060 9565 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9774 11105 gene locus_tag LOCUS_01070 9774 11105 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_01070 11137 12546 gene locus_tag LOCUS_01080 gene gatA 11137 12546 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_01080 13408 12695 gene locus_tag LOCUS_01090 13408 12695 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933021.1 protein_id gnl|my_center|LOCUS_01090 15004 13520 gene locus_tag LOCUS_01100 15004 13520 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_01100 15765 16127 gene locus_tag LOCUS_01110 15765 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_01110 16784 16293 gene locus_tag LOCUS_01120 16784 16293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 17983 17066 gene locus_tag LOCUS_01130 17983 17066 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_01130 18894 18235 gene locus_tag LOCUS_01140 18894 18235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 19218 19793 gene locus_tag LOCUS_01150 19218 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 19904 20860 gene locus_tag LOCUS_01160 19904 20860 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence008 1181 288 gene locus_tag LOCUS_01170 1181 288 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_01170 2640 1279 gene locus_tag LOCUS_01180 2640 1279 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 protein_id gnl|my_center|LOCUS_01180 3031 5022 gene locus_tag LOCUS_01190 3031 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5147 6277 gene locus_tag LOCUS_01200 5147 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_01200 7364 6414 gene locus_tag LOCUS_01210 7364 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 7399 9189 gene locus_tag LOCUS_01220 7399 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 9564 9193 gene locus_tag LOCUS_01230 9564 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 9766 9506 gene locus_tag LOCUS_01240 9766 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 10790 9828 gene locus_tag LOCUS_01250 10790 9828 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_01250 13535 11073 gene locus_tag LOCUS_01260 13535 11073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_01260 15337 13799 gene locus_tag LOCUS_01270 gene pccB 15337 13799 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_01270 17550 15475 gene locus_tag LOCUS_01280 gene mcm3 17550 15475 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_01280 19026 17554 gene locus_tag LOCUS_01290 gene accC 19026 17554 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_01290 19989 19030 gene locus_tag LOCUS_01300 19989 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 20475 19996 gene locus_tag LOCUS_01310 gene pycA 20475 19996 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence009 1036 62 gene locus_tag LOCUS_01320 1036 62 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_01320 2911 1142 gene locus_tag LOCUS_01330 2911 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 7027 3140 gene locus_tag LOCUS_01340 gene porU 7027 3140 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_01340 7383 8393 gene locus_tag LOCUS_01350 7383 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 8711 9697 gene locus_tag LOCUS_01360 8711 9697 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_01360 9775 10308 gene locus_tag LOCUS_01370 9775 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 12434 10338 gene locus_tag LOCUS_01380 12434 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 20392 12626 gene locus_tag LOCUS_01390 20392 12626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence010 3539 2496 gene locus_tag LOCUS_01400 3539 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4999 3557 gene locus_tag LOCUS_01410 gene aslA 4999 3557 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120007.1 protein_id gnl|my_center|LOCUS_01410 7254 5299 gene locus_tag LOCUS_01420 gene gpi2 7254 5299 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_01420 7465 10464 gene locus_tag LOCUS_01430 7465 10464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970137.1 protein_id gnl|my_center|LOCUS_01430 10960 10457 gene locus_tag LOCUS_01440 10960 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 11603 11064 gene locus_tag LOCUS_01450 11603 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 13495 11705 gene locus_tag LOCUS_01460 13495 11705 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_01460 13830 15227 gene locus_tag LOCUS_01470 13830 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880783.1 protein_id gnl|my_center|LOCUS_01470 15451 17004 gene locus_tag LOCUS_01480 15451 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_01480 17329 18348 gene locus_tag LOCUS_01490 17329 18348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence011 444 372 gene locus_tag LOCUS_t00010 444 372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 714 2051 gene locus_tag LOCUS_01500 714 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 2158 3147 gene locus_tag LOCUS_01510 gene trpD 2158 3147 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_01510 3162 3998 gene locus_tag LOCUS_01520 gene trpC 3162 3998 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD6 protein_id gnl|my_center|LOCUS_01520 4179 4838 gene locus_tag LOCUS_01530 gene trpF 4179 4838 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_01530 5926 4994 gene locus_tag LOCUS_01540 gene mdh 5926 4994 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_01540 6147 7652 gene locus_tag LOCUS_01550 6147 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 9381 8272 gene locus_tag LOCUS_01560 9381 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 11904 9664 gene locus_tag LOCUS_01570 gene purL 11904 9664 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD17 protein_id gnl|my_center|LOCUS_01570 12548 12162 gene locus_tag LOCUS_01580 12548 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 12704 13462 gene locus_tag LOCUS_01590 12704 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 14436 13459 gene locus_tag LOCUS_01600 14436 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 14606 14534 gene locus_tag LOCUS_t00020 14606 14534 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15226 14636 gene locus_tag LOCUS_01610 15226 14636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 15374 16096 gene locus_tag LOCUS_01620 15374 16096 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_01620 16579 16115 gene locus_tag LOCUS_01630 16579 16115 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_01630 16874 17587 gene locus_tag LOCUS_01640 gene proC 16874 17587 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ76 protein_id gnl|my_center|LOCUS_01640 17894 19291 gene locus_tag LOCUS_01650 17894 19291 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_01650 20048 19551 gene locus_tag LOCUS_01660 20048 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence012 <1 1164 gene locus_tag LOCUS_01670 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 1151 1711 gene locus_tag LOCUS_01680 gene hpt 1151 1711 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_01680 1712 2242 gene locus_tag LOCUS_01690 1712 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 5077 2336 gene locus_tag LOCUS_01700 5077 2336 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107391.1 protein_id gnl|my_center|LOCUS_01700 5003 5221 gene locus_tag LOCUS_01710 5003 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 6667 5618 gene locus_tag LOCUS_01720 6667 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7663 7487 gene locus_tag LOCUS_01730 7663 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 9441 8242 gene locus_tag LOCUS_01740 9441 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 11038 9935 gene locus_tag LOCUS_01750 11038 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 12146 11907 gene locus_tag LOCUS_01760 12146 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 13251 12160 gene locus_tag LOCUS_01770 13251 12160 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_01770 16650 13564 gene locus_tag LOCUS_01780 16650 13564 CDS product multidrug efflux pump protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_01780 18120 16897 gene locus_tag LOCUS_01790 18120 16897 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_01790 18199 18441 gene locus_tag LOCUS_01800 18199 18441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence013 1053 1910 gene locus_tag LOCUS_01810 1053 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2221 2934 gene locus_tag LOCUS_01820 2221 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3064 7092 gene locus_tag LOCUS_01830 3064 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 7228 8688 gene locus_tag LOCUS_01840 7228 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039947.1 protein_id gnl|my_center|LOCUS_01840 8716 9927 gene locus_tag LOCUS_01850 8716 9927 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_01850 9920 11026 gene locus_tag LOCUS_01860 9920 11026 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_01860 11038 11940 gene locus_tag LOCUS_01870 11038 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11947 12834 gene locus_tag LOCUS_01880 11947 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 13362 14150 gene locus_tag LOCUS_01890 13362 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907545.1 protein_id gnl|my_center|LOCUS_01890 14398 15297 gene locus_tag LOCUS_01900 14398 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15862 15278 gene locus_tag LOCUS_01910 15862 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 17814 16366 gene locus_tag LOCUS_01920 17814 16366 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence014 3472 4317 gene locus_tag LOCUS_01930 gene rmlD 3472 4317 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_01930 6664 4439 gene locus_tag LOCUS_01940 6664 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 8555 6972 gene locus_tag LOCUS_01950 8555 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10008 9139 gene locus_tag LOCUS_01960 10008 9139 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_01960 10228 10719 gene locus_tag LOCUS_01970 10228 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 10871 13267 gene locus_tag LOCUS_01980 10871 13267 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_01980 13638 13366 gene locus_tag LOCUS_01990 13638 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 15149 13836 gene locus_tag LOCUS_02000 gene ahcY 15149 13836 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_02000 15365 15703 gene locus_tag LOCUS_02010 15365 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 15713 17008 gene locus_tag LOCUS_02020 15713 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 <18681 16986 gene locus_tag LOCUS_02030 <18681 16986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482837.1:pseudouridine synthase >Feature sequence015 1118 180 gene locus_tag LOCUS_02040 1118 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_02040 2748 1186 gene locus_tag LOCUS_02050 2748 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_02050 2832 3728 gene locus_tag LOCUS_02060 2832 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5516 3933 gene locus_tag LOCUS_02070 5516 3933 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_02070 6568 5696 gene locus_tag LOCUS_02080 gene udp 6568 5696 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_02080 6900 6565 gene locus_tag LOCUS_02090 6900 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8163 7210 gene locus_tag LOCUS_02100 gene irk 8163 7210 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_02100 8437 9090 gene locus_tag LOCUS_02110 8437 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9117 10436 gene locus_tag LOCUS_02120 9117 10436 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_02120 10655 11809 gene locus_tag LOCUS_02130 10655 11809 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_02130 11963 15475 gene locus_tag LOCUS_02140 11963 15475 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02140 15983 15684 gene locus_tag LOCUS_02150 15983 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 16630 16004 gene locus_tag LOCUS_02160 16630 16004 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_02160 17488 16769 gene locus_tag LOCUS_02170 17488 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_02170 17748 18161 gene locus_tag LOCUS_02180 17748 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 >Feature sequence016 498 343 gene locus_tag LOCUS_02190 gene rpmH 498 343 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H127 protein_id gnl|my_center|LOCUS_02190 722 3976 gene locus_tag LOCUS_02200 722 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4096 5541 gene locus_tag LOCUS_02210 gene dacB 4096 5541 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_02210 5674 6951 gene locus_tag LOCUS_02220 5674 6951 CDS product geranylgeranyl hydrogenase BchP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_02220 8145 7369 gene locus_tag LOCUS_02230 8145 7369 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_02230 9662 8379 gene locus_tag LOCUS_02240 9662 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 10513 9752 gene locus_tag LOCUS_02250 10513 9752 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_02250 11711 10608 gene locus_tag LOCUS_02260 11711 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12313 11843 gene locus_tag LOCUS_02270 12313 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 12474 13769 gene locus_tag LOCUS_02280 12474 13769 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_02280 14011 16110 gene locus_tag LOCUS_02290 14011 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 16217 17023 gene locus_tag LOCUS_02300 16217 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 18130 17123 gene locus_tag LOCUS_02310 18130 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence017 140 520 gene locus_tag LOCUS_02320 140 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_02320 680 1984 gene locus_tag LOCUS_02330 680 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3734 2127 gene locus_tag LOCUS_02340 3734 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5114 4362 gene locus_tag LOCUS_02350 5114 4362 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_02350 5249 8464 gene locus_tag LOCUS_02360 5249 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 10447 9074 gene locus_tag LOCUS_02370 gene secY 10447 9074 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_02370 10907 10461 gene locus_tag LOCUS_02380 gene rplO 10907 10461 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_02380 11200 11021 gene locus_tag LOCUS_02390 gene rpmD 11200 11021 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP02 protein_id gnl|my_center|LOCUS_02390 11817 11254 gene locus_tag LOCUS_02400 gene rpsE 11817 11254 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_02400 12177 11824 gene locus_tag LOCUS_02410 gene rplR 12177 11824 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46899 protein_id gnl|my_center|LOCUS_02410 12772 12215 gene locus_tag LOCUS_02420 gene rplF 12772 12215 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_02420 13253 12843 gene locus_tag LOCUS_02430 gene rpsH 13253 12843 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_02430 13771 13502 gene locus_tag LOCUS_02440 gene rpsN 13771 13502 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q1 protein_id gnl|my_center|LOCUS_02440 14335 13775 gene locus_tag LOCUS_02450 gene rplE 14335 13775 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q2 protein_id gnl|my_center|LOCUS_02450 14694 14335 gene locus_tag LOCUS_02460 gene rplX 14694 14335 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_02460 15133 14765 gene locus_tag LOCUS_02470 gene rplN 15133 14765 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_02470 15621 15160 gene locus_tag LOCUS_02480 15621 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 15888 15628 gene locus_tag LOCUS_02490 15888 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 16375 15956 gene locus_tag LOCUS_02500 gene rplP 16375 15956 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNZ1 protein_id gnl|my_center|LOCUS_02500 17460 16723 gene locus_tag LOCUS_02510 gene rpsC 17460 16723 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_02510 17810 17463 gene locus_tag LOCUS_02520 17810 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence018 640 50 gene locus_tag LOCUS_02530 640 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_02530 1484 795 gene locus_tag LOCUS_02540 1484 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1610 2677 gene locus_tag LOCUS_02550 gene prfA 1610 2677 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C1 protein_id gnl|my_center|LOCUS_02550 3998 2862 gene locus_tag LOCUS_02560 3998 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_02560 4895 4125 gene locus_tag LOCUS_02570 4895 4125 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_02570 6156 5065 gene locus_tag LOCUS_02580 6156 5065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064866.1 protein_id gnl|my_center|LOCUS_02580 7222 6209 gene locus_tag LOCUS_02590 7222 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_02590 7462 7262 gene locus_tag LOCUS_02600 7462 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 9087 7606 gene locus_tag LOCUS_02610 9087 7606 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_02610 9380 13765 gene locus_tag LOCUS_02620 9380 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 14045 15877 gene locus_tag LOCUS_02630 14045 15877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 15955 16911 gene locus_tag LOCUS_02640 15955 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence019 2491 824 gene locus_tag LOCUS_02650 2491 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4082 2541 gene locus_tag LOCUS_02660 4082 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 5678 4209 gene locus_tag LOCUS_02670 5678 4209 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_02670 8872 5810 gene locus_tag LOCUS_02680 8872 5810 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_02680 11991 9208 gene locus_tag LOCUS_02690 11991 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_02690 16189 12260 gene locus_tag LOCUS_02700 16189 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 16919 16305 gene locus_tag LOCUS_02710 16919 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence020 1546 2304 gene locus_tag LOCUS_02720 1546 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3755 2409 gene locus_tag LOCUS_02730 3755 2409 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_02730 5416 3965 gene locus_tag LOCUS_02740 5416 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6739 5636 gene locus_tag LOCUS_02750 gene corA 6739 5636 CDS product cobalt/magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ31 protein_id gnl|my_center|LOCUS_02750 7002 10160 gene locus_tag LOCUS_02760 7002 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11295 10288 gene locus_tag LOCUS_02770 gene nadA 11295 10288 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_02770 12693 11506 gene locus_tag LOCUS_02780 12693 11506 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_02780 13967 12903 gene locus_tag LOCUS_02790 13967 12903 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_02790 14237 14620 gene locus_tag LOCUS_02800 14237 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 14918 15955 gene locus_tag LOCUS_02810 gene cheB 14918 15955 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638170.2 protein_id gnl|my_center|LOCUS_02810 16076 16501 gene locus_tag LOCUS_02820 16076 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence021 1442 264 gene locus_tag LOCUS_02830 1442 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2531 1758 gene locus_tag LOCUS_02840 2531 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4055 2739 gene locus_tag LOCUS_02850 4055 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7105 4151 gene locus_tag LOCUS_02860 7105 4151 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_02860 10377 7345 gene locus_tag LOCUS_02870 10377 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10768 12489 gene locus_tag LOCUS_02880 10768 12489 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_02880 12584 13228 gene locus_tag LOCUS_02890 12584 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13358 14008 gene locus_tag LOCUS_02900 gene nth 13358 14008 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG97 protein_id gnl|my_center|LOCUS_02900 14141 15862 gene locus_tag LOCUS_02910 14141 15862 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_02910 16642 15878 gene locus_tag LOCUS_02920 16642 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence022 12015 10180 gene locus_tag LOCUS_02930 gene msbA 12015 10180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_02930 12520 12089 gene locus_tag LOCUS_02940 12520 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 14381 12594 gene locus_tag LOCUS_02950 14381 12594 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_02950 14547 15806 gene locus_tag LOCUS_02960 14547 15806 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_02960 16407 16036 gene locus_tag LOCUS_02970 16407 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence023 841 1839 gene locus_tag LOCUS_02980 841 1839 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942523.1 protein_id gnl|my_center|LOCUS_02980 1932 3041 gene locus_tag LOCUS_02990 gene gcvT 1932 3041 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_02990 5758 3227 gene locus_tag LOCUS_03000 5758 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5951 6556 gene locus_tag LOCUS_03010 5951 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6964 8481 gene locus_tag LOCUS_03020 gene gldJ 6964 8481 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_03020 8592 9935 gene locus_tag LOCUS_03030 gene murF 8592 9935 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_03030 11859 9913 gene locus_tag LOCUS_03040 11859 9913 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_03040 11981 12355 gene locus_tag LOCUS_03050 11981 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 12930 12340 gene locus_tag LOCUS_03060 12930 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_03060 14299 13115 gene locus_tag LOCUS_03070 14299 13115 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_03070 14441 15520 gene locus_tag LOCUS_03080 gene fjo30 14441 15520 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_03080 16457 15756 gene locus_tag LOCUS_03090 16457 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence024 3039 2212 gene locus_tag LOCUS_03100 3039 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6956 3108 gene locus_tag LOCUS_03110 6956 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 7409 6978 gene locus_tag LOCUS_03120 7409 6978 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_03120 7671 7399 gene locus_tag LOCUS_03130 7671 7399 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_03130 9636 7852 gene locus_tag LOCUS_03140 9636 7852 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_03140 10319 9636 gene locus_tag LOCUS_03150 10319 9636 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_03150 11408 10407 gene locus_tag LOCUS_03160 11408 10407 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_03160 11815 11405 gene locus_tag LOCUS_03170 11815 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 12140 11907 gene locus_tag LOCUS_03180 12140 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 12803 12294 gene locus_tag LOCUS_03190 12803 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 13478 13017 gene locus_tag LOCUS_03200 13478 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 13671 14093 gene locus_tag LOCUS_03210 13671 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_03210 14182 14412 gene locus_tag LOCUS_03220 14182 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 15327 14500 gene locus_tag LOCUS_03230 15327 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 <16501 15458 gene locus_tag LOCUS_03240 <16501 15458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208292.1:endonuclease >Feature sequence025 <1 1323 gene locus_tag LOCUS_03250 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122518.1:sulfatase 2559 1423 gene locus_tag LOCUS_03260 2559 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3158 2577 gene locus_tag LOCUS_03270 3158 2577 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03270 4103 3168 gene locus_tag LOCUS_03280 4103 3168 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_03280 5135 4662 gene locus_tag LOCUS_03290 5135 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8110 5540 gene locus_tag LOCUS_03300 8110 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 9569 8283 gene locus_tag LOCUS_03310 gene rocD 9569 8283 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_03310 9823 9745 gene locus_tag LOCUS_t00030 9823 9745 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10736 9897 gene locus_tag LOCUS_03320 10736 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 11013 12863 gene locus_tag LOCUS_03330 11013 12863 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_03330 12860 13981 gene locus_tag LOCUS_03340 gene murB 12860 13981 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_03340 14580 13960 gene locus_tag LOCUS_03350 14580 13960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 14751 16160 gene locus_tag LOCUS_03360 14751 16160 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence026 1728 448 gene locus_tag LOCUS_03370 1728 448 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974432.1 protein_id gnl|my_center|LOCUS_03370 4028 1920 gene locus_tag LOCUS_03380 4028 1920 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_03380 4300 5070 gene locus_tag LOCUS_03390 4300 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_03390 5903 5124 gene locus_tag LOCUS_03400 5903 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 6317 5988 gene locus_tag LOCUS_03410 6317 5988 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_03410 6868 6395 gene locus_tag LOCUS_03420 6868 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_03420 7027 7689 gene locus_tag LOCUS_03430 7027 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7847 8368 gene locus_tag LOCUS_03440 7847 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9836 8949 gene locus_tag LOCUS_03450 gene atpG 9836 8949 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_03450 11667 10084 gene locus_tag LOCUS_03460 gene atpA 11667 10084 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_03460 12261 11719 gene locus_tag LOCUS_03470 gene atpH 12261 11719 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 protein_id gnl|my_center|LOCUS_03470 12784 12269 gene locus_tag LOCUS_03480 gene atpF 12784 12269 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA6 protein_id gnl|my_center|LOCUS_03480 13103 12906 gene locus_tag LOCUS_03490 13103 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 14480 13185 gene locus_tag LOCUS_03500 gene atpB 14480 13185 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_03500 15326 14574 gene locus_tag LOCUS_03510 15326 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15913 15323 gene locus_tag LOCUS_03520 15913 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142575.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence027 3341 2586 gene locus_tag LOCUS_03530 3341 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4919 3735 gene locus_tag LOCUS_03540 4919 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5432 8452 gene locus_tag LOCUS_03550 5432 8452 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_03550 8557 10059 gene locus_tag LOCUS_03560 8557 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_03560 10254 13589 gene locus_tag LOCUS_03570 10254 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence028 1099 251 gene locus_tag LOCUS_03580 1099 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1671 1090 gene locus_tag LOCUS_03590 1671 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1932 2498 gene locus_tag LOCUS_03600 1932 2498 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_03600 2833 3300 gene locus_tag LOCUS_03610 2833 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4645 3305 gene locus_tag LOCUS_03620 gene argH 4645 3305 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_03620 4761 5048 gene locus_tag LOCUS_03630 4761 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5286 6491 gene locus_tag LOCUS_03640 gene splB 5286 6491 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802116.1 protein_id gnl|my_center|LOCUS_03640 7177 6503 gene locus_tag LOCUS_03650 7177 6503 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_03650 9401 7377 gene locus_tag LOCUS_03660 gene ftsH 9401 7377 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_03660 9789 9472 gene locus_tag LOCUS_03670 gene rsfS 9789 9472 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67309 protein_id gnl|my_center|LOCUS_03670 10086 10823 gene locus_tag LOCUS_03680 10086 10823 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_03680 13617 10834 gene locus_tag LOCUS_03690 13617 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 13896 15275 gene locus_tag LOCUS_03700 13896 15275 CDS product gluconate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732087.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence029 4157 3489 gene locus_tag LOCUS_03710 4157 3489 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_03710 4416 6257 gene locus_tag LOCUS_03720 4416 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6577 6912 gene locus_tag LOCUS_03730 6577 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7092 7349 gene locus_tag LOCUS_03740 7092 7349 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_03740 7590 9386 gene locus_tag LOCUS_03750 7590 9386 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_03750 9526 10524 gene locus_tag LOCUS_03760 9526 10524 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_03760 11706 10591 gene locus_tag LOCUS_03770 11706 10591 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_03770 12950 11847 gene locus_tag LOCUS_03780 12950 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 13128 14003 gene locus_tag LOCUS_03790 gene map 13128 14003 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM9 protein_id gnl|my_center|LOCUS_03790 14991 14131 gene locus_tag LOCUS_03800 14991 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence030 561 154 gene locus_tag LOCUS_03810 gene yuxK 561 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_03810 1445 597 gene locus_tag LOCUS_03820 1445 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2734 1514 gene locus_tag LOCUS_03830 2734 1514 CDS product glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_03830 3236 2727 gene locus_tag LOCUS_03840 3236 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 7057 3296 gene locus_tag LOCUS_03850 7057 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7240 8784 gene locus_tag LOCUS_03860 gene speE 7240 8784 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD1 protein_id gnl|my_center|LOCUS_03860 8784 9209 gene locus_tag LOCUS_03870 gene speH 8784 9209 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI28 protein_id gnl|my_center|LOCUS_03870 10644 9235 gene locus_tag LOCUS_03880 10644 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10755 12152 gene locus_tag LOCUS_03890 gene arsA 10755 12152 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_03890 12888 12142 gene locus_tag LOCUS_03900 12888 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 14687 13032 gene locus_tag LOCUS_03910 14687 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence031 2714 141 gene locus_tag LOCUS_03920 gene clpA 2714 141 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_03920 3085 3483 gene locus_tag LOCUS_03930 3085 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3889 4821 gene locus_tag LOCUS_03940 gene rnz 3889 4821 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZN1 protein_id gnl|my_center|LOCUS_03940 7695 4834 gene locus_tag LOCUS_03950 7695 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 7812 9071 gene locus_tag LOCUS_03960 7812 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9176 11869 gene locus_tag LOCUS_03970 gene valS 9176 11869 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_03970 14788 12044 gene locus_tag LOCUS_03980 14788 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 15436 14843 gene locus_tag LOCUS_03990 15436 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence032 1429 668 gene locus_tag LOCUS_04000 1429 668 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_04000 2988 1666 gene locus_tag LOCUS_04010 2988 1666 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_04010 6389 3150 gene locus_tag LOCUS_04020 6389 3150 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767846.1 protein_id gnl|my_center|LOCUS_04020 6909 7622 gene locus_tag LOCUS_04030 6909 7622 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_04030 7742 10063 gene locus_tag LOCUS_04040 7742 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10060 12270 gene locus_tag LOCUS_04050 10060 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12257 12610 gene locus_tag LOCUS_04060 12257 12610 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_04060 12607 13914 gene locus_tag LOCUS_04070 12607 13914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_04070 14088 15125 gene locus_tag LOCUS_04080 14088 15125 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence033 <1 532 gene locus_tag LOCUS_04090 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403240.1:formamidopyrimidine-DNA glycosylase 1629 739 gene locus_tag LOCUS_04100 1629 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2051 1632 gene locus_tag LOCUS_04110 2051 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2085 2315 gene locus_tag LOCUS_04120 2085 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2332 4284 gene locus_tag LOCUS_04130 2332 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4437 5189 gene locus_tag LOCUS_04140 4437 5189 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_04140 5846 5250 gene locus_tag LOCUS_04150 5846 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6566 5946 gene locus_tag LOCUS_04160 6566 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7443 6658 gene locus_tag LOCUS_04170 7443 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 7952 7542 gene locus_tag LOCUS_04180 7952 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8365 8057 gene locus_tag LOCUS_04190 8365 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8793 9176 gene locus_tag LOCUS_04200 8793 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 9222 11222 gene locus_tag LOCUS_04210 9222 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 11877 11254 gene locus_tag LOCUS_04220 11877 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 12587 13834 gene locus_tag LOCUS_04230 12587 13834 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y1 protein_id gnl|my_center|LOCUS_04230 14711 13875 gene locus_tag LOCUS_04240 14711 13875 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence034 1217 588 gene locus_tag LOCUS_04250 1217 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_04250 2092 1340 gene locus_tag LOCUS_04260 2092 1340 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_04260 3657 2257 gene locus_tag LOCUS_04270 gene lpdA2 3657 2257 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_04270 3896 4525 gene locus_tag LOCUS_04280 3896 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4646 5881 gene locus_tag LOCUS_04290 4646 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6398 9802 gene locus_tag LOCUS_04300 6398 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 9940 10362 gene locus_tag LOCUS_04310 9940 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 10582 12879 gene locus_tag LOCUS_04320 10582 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 13454 12969 gene locus_tag LOCUS_04330 13454 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_04330 14255 13737 gene locus_tag LOCUS_04340 14255 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence035 <1 6482 gene locus_tag LOCUS_04350 <1 6482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023163.1:cell surface protein 7564 6686 gene locus_tag LOCUS_04360 gene cysM 7564 6686 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_04360 8847 7561 gene locus_tag LOCUS_04370 8847 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9151 10014 gene locus_tag LOCUS_04380 9151 10014 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_04380 10138 11322 gene locus_tag LOCUS_04390 10138 11322 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P96 protein_id gnl|my_center|LOCUS_04390 11325 12167 gene locus_tag LOCUS_04400 gene tyrA 11325 12167 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_04400 12438 13511 gene locus_tag LOCUS_04410 12438 13511 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_04410 13975 13775 gene locus_tag LOCUS_04420 13975 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14998 14198 gene locus_tag LOCUS_04430 14998 14198 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267572.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence036 619 545 gene locus_tag LOCUS_t00040 619 545 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 754 678 gene locus_tag LOCUS_t00050 754 678 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1265 939 gene locus_tag LOCUS_04440 1265 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_04440 4021 1433 gene locus_tag LOCUS_04450 gene topA 4021 1433 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_04450 4647 4111 gene locus_tag LOCUS_04460 4647 4111 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_04460 5534 4788 gene locus_tag LOCUS_04470 5534 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6500 5541 gene locus_tag LOCUS_04480 6500 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 6623 7198 gene locus_tag LOCUS_04490 6623 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 8142 7201 gene locus_tag LOCUS_04500 8142 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 8454 9557 gene locus_tag LOCUS_04510 gene mnmA 8454 9557 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_04510 9672 11951 gene locus_tag LOCUS_04520 9672 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 12930 11917 gene locus_tag LOCUS_04530 12930 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 13225 14886 gene locus_tag LOCUS_04540 13225 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence037 <1 954 gene locus_tag LOCUS_04550 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073592.1:membrane protein 1031 1864 gene locus_tag LOCUS_04560 1031 1864 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_04560 3266 1917 gene locus_tag LOCUS_04570 3266 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4878 3331 gene locus_tag LOCUS_04580 4878 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6237 5281 gene locus_tag LOCUS_04590 6237 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12854 6333 gene locus_tag LOCUS_04600 12854 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13700 12924 gene locus_tag LOCUS_04610 13700 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence038 715 1347 gene locus_tag LOCUS_04620 715 1347 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_04620 1434 3884 gene locus_tag LOCUS_04630 gene xloA 1434 3884 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_04630 4124 4294 gene locus_tag LOCUS_04640 4124 4294 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_04640 5784 4291 gene locus_tag LOCUS_04650 5784 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6029 7432 gene locus_tag LOCUS_04660 gene sdaA 6029 7432 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_04660 7565 8296 gene locus_tag LOCUS_04670 7565 8296 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_04670 9731 8421 gene locus_tag LOCUS_04680 9731 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255207.1 protein_id gnl|my_center|LOCUS_04680 9945 10748 gene locus_tag LOCUS_04690 9945 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11300 10770 gene locus_tag LOCUS_04700 11300 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 11618 13924 gene locus_tag LOCUS_04710 11618 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence039 1294 2823 gene locus_tag LOCUS_04720 1294 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3316 3717 gene locus_tag LOCUS_04730 3316 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4549 3788 gene locus_tag LOCUS_04740 4549 3788 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887P7 protein_id gnl|my_center|LOCUS_04740 5073 4564 gene locus_tag LOCUS_04750 5073 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 6538 5183 gene locus_tag LOCUS_04760 6538 5183 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_04760 6855 7553 gene locus_tag LOCUS_04770 6855 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7572 10118 gene locus_tag LOCUS_04780 7572 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 10122 10601 gene locus_tag LOCUS_04790 10122 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 11406 12059 gene locus_tag LOCUS_04800 11406 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence040 332 1747 gene locus_tag LOCUS_04810 gene rtcB 332 1747 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_04810 2037 2792 gene locus_tag LOCUS_04820 2037 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3987 3274 gene locus_tag LOCUS_04830 3987 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence041 2431 3177 gene locus_tag LOCUS_04840 2431 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3346 4569 gene locus_tag LOCUS_04850 gene iscS 3346 4569 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_04850 4829 5242 gene locus_tag LOCUS_04860 gene iscU 4829 5242 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_04860 5373 5699 gene locus_tag LOCUS_04870 gene sufA 5373 5699 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_04870 6388 5945 gene locus_tag LOCUS_04880 gene tadA 6388 5945 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K5 protein_id gnl|my_center|LOCUS_04880 7337 6381 gene locus_tag LOCUS_04890 7337 6381 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_04890 8642 7350 gene locus_tag LOCUS_04900 gene pyrC 8642 7350 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_04900 8553 8735 gene locus_tag LOCUS_04910 8553 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 10775 8745 gene locus_tag LOCUS_04920 10775 8745 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_04920 12475 10934 gene locus_tag LOCUS_04930 12475 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence042 <1 2447 gene locus_tag LOCUS_04940 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393458.1:xanthine dehydrogenase molybdenum-binding subunit XdhA 2596 3579 gene locus_tag LOCUS_04950 2596 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530701.1 protein_id gnl|my_center|LOCUS_04950 7392 4429 gene locus_tag LOCUS_04960 7392 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7819 8796 gene locus_tag LOCUS_04970 7819 8796 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_04970 8793 9275 gene locus_tag LOCUS_04980 8793 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9272 10543 gene locus_tag LOCUS_04990 gene dctM 9272 10543 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975774.1 protein_id gnl|my_center|LOCUS_04990 11873 10668 gene locus_tag LOCUS_05000 11873 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 13213 12443 gene locus_tag LOCUS_05010 13213 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 14047 13334 gene locus_tag LOCUS_05020 gene wbbJ 14047 13334 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181527.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence043 606 827 gene locus_tag LOCUS_05030 606 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2323 974 gene locus_tag LOCUS_05040 gene rhlE 2323 974 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_05040 2588 4216 gene locus_tag LOCUS_05050 2588 4216 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_05050 4556 5425 gene locus_tag LOCUS_05060 4556 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5425 5802 gene locus_tag LOCUS_05070 5425 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963140.1 protein_id gnl|my_center|LOCUS_05070 6108 7115 gene locus_tag LOCUS_05080 6108 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9234 7246 gene locus_tag LOCUS_05090 9234 7246 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_05090 9338 9940 gene locus_tag LOCUS_05100 9338 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 12124 10046 gene locus_tag LOCUS_05110 gene ppk 12124 10046 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU07 protein_id gnl|my_center|LOCUS_05110 12240 12809 gene locus_tag LOCUS_05120 12240 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13248 14015 gene locus_tag LOCUS_05130 gene soj 13248 14015 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence044 878 369 gene locus_tag LOCUS_05140 878 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1296 865 gene locus_tag LOCUS_05150 1296 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2081 1512 gene locus_tag LOCUS_05160 2081 1512 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887F6 protein_id gnl|my_center|LOCUS_05160 2741 2403 gene locus_tag LOCUS_05170 gene hup 2741 2403 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_05170 2847 3029 gene locus_tag LOCUS_05180 2847 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3031 3315 gene locus_tag LOCUS_05190 3031 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3482 4969 gene locus_tag LOCUS_05200 3482 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5150 6223 gene locus_tag LOCUS_05210 5150 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6365 7054 gene locus_tag LOCUS_05220 6365 7054 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_05220 7310 11179 gene locus_tag LOCUS_05230 7310 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12622 11351 gene locus_tag LOCUS_05240 12622 11351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_05240 12825 13697 gene locus_tag LOCUS_05250 12825 13697 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence045 820 209 gene locus_tag LOCUS_05260 gene ribE 820 209 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_05260 3534 970 gene locus_tag LOCUS_05270 3534 970 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_05270 3867 4340 gene locus_tag LOCUS_05280 3867 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4333 5523 gene locus_tag LOCUS_05290 4333 5523 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957813.1 protein_id gnl|my_center|LOCUS_05290 5701 8967 gene locus_tag LOCUS_05300 5701 8967 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_05300 8976 9524 gene locus_tag LOCUS_05310 8976 9524 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_05310 9521 10000 gene locus_tag LOCUS_05320 9521 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10062 11438 gene locus_tag LOCUS_05330 10062 11438 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_05330 13496 11511 gene locus_tag LOCUS_05340 13496 11511 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence046 1111 347 gene locus_tag LOCUS_05350 gene lgtF 1111 347 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224973.1 protein_id gnl|my_center|LOCUS_05350 2392 1121 gene locus_tag LOCUS_05360 gene purD 2392 1121 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_05360 2992 2489 gene locus_tag LOCUS_05370 2992 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4185 3259 gene locus_tag LOCUS_05380 4185 3259 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_05380 4391 4182 gene locus_tag LOCUS_05390 4391 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5554 4505 gene locus_tag LOCUS_05400 5554 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5822 6289 gene locus_tag LOCUS_05410 5822 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6918 8708 gene locus_tag LOCUS_05420 gene lepA 6918 8708 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_05420 9499 8903 gene locus_tag LOCUS_05430 9499 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 10190 10837 gene locus_tag LOCUS_05440 10190 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 11742 11035 gene locus_tag LOCUS_05450 11742 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_05450 12082 11744 gene locus_tag LOCUS_05460 gene ytxJ 12082 11744 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_05460 12759 13700 gene locus_tag LOCUS_05470 gene pdhB 12759 13700 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence047 1337 528 gene locus_tag LOCUS_05480 1337 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1726 2217 gene locus_tag LOCUS_05490 1726 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3320 2214 gene locus_tag LOCUS_05500 3320 2214 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029877.1 protein_id gnl|my_center|LOCUS_05500 3487 4140 gene locus_tag LOCUS_05510 3487 4140 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107634.1 protein_id gnl|my_center|LOCUS_05510 6148 4601 gene locus_tag LOCUS_05520 gene gltX 6148 4601 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_05520 6551 7231 gene locus_tag LOCUS_05530 6551 7231 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_05530 7406 12976 gene locus_tag LOCUS_05540 7406 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence048 2478 919 gene locus_tag LOCUS_05550 2478 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4032 2515 gene locus_tag LOCUS_05560 4032 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 5227 4268 gene locus_tag LOCUS_05570 5227 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6285 5716 gene locus_tag LOCUS_05580 6285 5716 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_05580 6927 6454 gene locus_tag LOCUS_05590 gene rlmH 6927 6454 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA8 protein_id gnl|my_center|LOCUS_05590 6998 7822 gene locus_tag LOCUS_05600 gene prmA 6998 7822 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_05600 7962 12638 gene locus_tag LOCUS_05610 7962 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 13028 12699 gene locus_tag LOCUS_05620 13028 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 13285 13010 gene locus_tag LOCUS_05630 13285 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence049 1512 691 gene locus_tag LOCUS_05640 1512 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2562 1789 gene locus_tag LOCUS_05650 2562 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2665 3339 gene locus_tag LOCUS_05660 2665 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3393 4859 gene locus_tag LOCUS_05670 3393 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6135 5161 gene locus_tag LOCUS_05680 6135 5161 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_05680 9318 6310 gene locus_tag LOCUS_05690 9318 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 9646 12096 gene locus_tag LOCUS_05700 9646 12096 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_05700 12395 12757 gene locus_tag LOCUS_05710 12395 12757 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence050 3182 339 gene locus_tag LOCUS_05720 3182 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3390 5621 gene locus_tag LOCUS_05730 3390 5621 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_05730 5790 8738 gene locus_tag LOCUS_05740 5790 8738 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108585.1 protein_id gnl|my_center|LOCUS_05740 8832 10424 gene locus_tag LOCUS_05750 8832 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 10538 11485 gene locus_tag LOCUS_05760 10538 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence051 4190 114 gene locus_tag LOCUS_05770 4190 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4757 4266 gene locus_tag LOCUS_05780 4757 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 7397 4974 gene locus_tag LOCUS_05790 7397 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7875 8570 gene locus_tag LOCUS_05800 gene clpP 7875 8570 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_05800 8830 10110 gene locus_tag LOCUS_05810 gene clpX 8830 10110 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_05810 10363 11010 gene locus_tag LOCUS_05820 gene pdxH 10363 11010 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_05820 11780 11007 gene locus_tag LOCUS_05830 11780 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_05830 11808 12434 gene locus_tag LOCUS_05840 11808 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence052 <1 948 gene locus_tag LOCUS_05850 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405100.1:peptidase S9 1116 2138 gene locus_tag LOCUS_05860 gene apbE 1116 2138 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WC52 protein_id gnl|my_center|LOCUS_05860 2352 3260 gene locus_tag LOCUS_05870 2352 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3270 4208 gene locus_tag LOCUS_05880 gene fjo11 3270 4208 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_05880 4208 5752 gene locus_tag LOCUS_05890 4208 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5772 6656 gene locus_tag LOCUS_05900 gene nadK 5772 6656 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_05900 7069 7824 gene locus_tag LOCUS_05910 7069 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8038 9381 gene locus_tag LOCUS_05920 8038 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9580 10131 gene locus_tag LOCUS_05930 9580 10131 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_05930 10137 11825 gene locus_tag LOCUS_05940 10137 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 11905 12666 gene locus_tag LOCUS_05950 11905 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence053 953 1603 gene locus_tag LOCUS_05960 953 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4269 1744 gene locus_tag LOCUS_05970 4269 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5258 4644 gene locus_tag LOCUS_05980 5258 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5650 6525 gene locus_tag LOCUS_05990 5650 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 6537 7115 gene locus_tag LOCUS_06000 6537 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7130 7696 gene locus_tag LOCUS_06010 7130 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7825 8055 gene locus_tag LOCUS_06020 7825 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8973 8176 gene locus_tag LOCUS_06030 gene uppP 8973 8176 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 protein_id gnl|my_center|LOCUS_06030 9283 8975 gene locus_tag LOCUS_06040 9283 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 9585 10685 gene locus_tag LOCUS_06050 9585 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_06050 11705 10824 gene locus_tag LOCUS_06060 11705 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 12945 11827 gene locus_tag LOCUS_06070 12945 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence054 159 1115 gene locus_tag LOCUS_06080 159 1115 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120888.1 protein_id gnl|my_center|LOCUS_06080 1209 2516 gene locus_tag LOCUS_06090 gene rimO 1209 2516 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_06090 2565 3221 gene locus_tag LOCUS_06100 2565 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3297 3379 gene locus_tag LOCUS_t00060 3297 3379 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3498 3580 gene locus_tag LOCUS_t00070 3498 3580 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3845 5872 gene locus_tag LOCUS_06110 3845 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6288 7205 gene locus_tag LOCUS_06120 6288 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7224 8438 gene locus_tag LOCUS_06130 gene metZ 7224 8438 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_06130 10770 8578 gene locus_tag LOCUS_06140 gene dnaG 10770 8578 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0T9 protein_id gnl|my_center|LOCUS_06140 12693 11374 gene locus_tag LOCUS_06150 gene hemL2 12693 11374 CDS product glutamate-1-semialdehyde 2,1-aminomutase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817R3 protein_id gnl|my_center|LOCUS_06150 >Feature sequence055 3511 2981 gene locus_tag LOCUS_06160 3511 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3863 4363 gene locus_tag LOCUS_06170 3863 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6601 4448 gene locus_tag LOCUS_06180 6601 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7801 6689 gene locus_tag LOCUS_06190 7801 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9387 8191 gene locus_tag LOCUS_06200 9387 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11750 9804 gene locus_tag LOCUS_06210 11750 9804 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_06210 12722 11808 gene locus_tag LOCUS_06220 12722 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence056 1288 521 gene locus_tag LOCUS_06230 1288 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259650.1 protein_id gnl|my_center|LOCUS_06230 2557 1367 gene locus_tag LOCUS_06240 2557 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 6982 2900 gene locus_tag LOCUS_06250 6982 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 10232 7155 gene locus_tag LOCUS_06260 10232 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence057 3842 3372 gene locus_tag LOCUS_06270 3842 3372 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_06270 4144 5118 gene locus_tag LOCUS_06280 gene rsgA 4144 5118 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_06280 5219 6166 gene locus_tag LOCUS_06290 gene era 5219 6166 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_06290 6220 6930 gene locus_tag LOCUS_06300 6220 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7306 9141 gene locus_tag LOCUS_06310 7306 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 12423 9172 gene locus_tag LOCUS_06320 12423 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence058 1567 440 gene locus_tag LOCUS_06330 gene bioF 1567 440 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_06330 2663 1746 gene locus_tag LOCUS_06340 2663 1746 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_06340 2863 2788 gene locus_tag LOCUS_t00080 2863 2788 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3536 6655 gene locus_tag LOCUS_06350 3536 6655 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_06350 6817 8592 gene locus_tag LOCUS_06360 6817 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8698 9675 gene locus_tag LOCUS_06370 8698 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 10011 9847 gene locus_tag LOCUS_06380 10011 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 10836 10012 gene locus_tag LOCUS_06390 gene deoD 10836 10012 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_06390 12675 11035 gene locus_tag LOCUS_06400 12675 11035 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence059 281 205 gene locus_tag LOCUS_t00090 281 205 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1168 359 gene locus_tag LOCUS_06410 gene pyrF 1168 359 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_06410 6330 1312 gene locus_tag LOCUS_06420 6330 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 7639 6557 gene locus_tag LOCUS_06430 7639 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11458 7649 gene locus_tag LOCUS_06440 11458 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11602 12474 gene locus_tag LOCUS_06450 gene folD 11602 12474 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_06450 >Feature sequence060 2 2989 gene locus_tag LOCUS_06460 2 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3408 2986 gene locus_tag LOCUS_06470 3408 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3692 3405 gene locus_tag LOCUS_06480 3692 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3786 7391 gene locus_tag LOCUS_06490 3786 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_06490 7509 8267 gene locus_tag LOCUS_06500 7509 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10610 8244 gene locus_tag LOCUS_06510 10610 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10976 11779 gene locus_tag LOCUS_06520 gene truA 10976 11779 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDR7 protein_id gnl|my_center|LOCUS_06520 12290 11769 gene locus_tag LOCUS_06530 12290 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence061 1905 1297 gene locus_tag LOCUS_06540 1905 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3089 2238 gene locus_tag LOCUS_06550 3089 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3589 3419 gene locus_tag LOCUS_06560 3589 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4202 3693 gene locus_tag LOCUS_06570 4202 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5438 4374 gene locus_tag LOCUS_06580 gene queA 5438 4374 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_06580 5800 7050 gene locus_tag LOCUS_06590 5800 7050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_06590 7336 8790 gene locus_tag LOCUS_06600 7336 8790 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_06600 8988 11252 gene locus_tag LOCUS_06610 8988 11252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_06610 11968 11387 gene locus_tag LOCUS_06620 11968 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence062 <12461 5829 gene locus_tag LOCUS_06630 <12461 5829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001060462.1:MSCRAMM family adhesin SdrC >Feature sequence063 1310 309 gene locus_tag LOCUS_06640 1310 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1710 1291 gene locus_tag LOCUS_06650 1710 1291 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06650 4274 1833 gene locus_tag LOCUS_06660 4274 1833 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_06660 9574 4274 gene locus_tag LOCUS_06670 9574 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9798 10391 gene locus_tag LOCUS_06680 9798 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 11540 10464 gene locus_tag LOCUS_06690 11540 10464 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_06690 <12381 11702 gene locus_tag LOCUS_06700 <12381 11702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809059.1:4-carboxymuconolactone decarboxylase >Feature sequence064 232 1713 gene locus_tag LOCUS_06710 232 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3659 1791 gene locus_tag LOCUS_06720 3659 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5046 3856 gene locus_tag LOCUS_06730 gene porV 5046 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_06730 6383 5262 gene locus_tag LOCUS_06740 6383 5262 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_06740 6369 6599 gene locus_tag LOCUS_06750 6369 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8338 6752 gene locus_tag LOCUS_06760 gene prfC 8338 6752 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_06760 11357 8586 gene locus_tag LOCUS_06770 11357 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence065 2028 1186 gene locus_tag LOCUS_06780 2028 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3998 2028 gene locus_tag LOCUS_06790 3998 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4303 4791 gene locus_tag LOCUS_06800 4303 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4983 5987 gene locus_tag LOCUS_06810 4983 5987 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_06810 5997 6779 gene locus_tag LOCUS_06820 5997 6779 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_06820 7019 7726 gene locus_tag LOCUS_06830 7019 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 8011 9033 gene locus_tag LOCUS_06840 gene trpS 8011 9033 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43835 protein_id gnl|my_center|LOCUS_06840 9152 9337 gene locus_tag LOCUS_06850 9152 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 9346 10206 gene locus_tag LOCUS_06860 9346 10206 CDS product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 protein_id gnl|my_center|LOCUS_06860 11126 10281 gene locus_tag LOCUS_06870 11126 10281 CDS product ketoacyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence066 <1 858 gene locus_tag LOCUS_06880 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A015:bifunctional enzyme LpxC/FabZ 862 1656 gene locus_tag LOCUS_06890 gene lpxA 862 1656 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_06890 2022 2666 gene locus_tag LOCUS_06900 2022 2666 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_06900 2689 3768 gene locus_tag LOCUS_06910 2689 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3795 4394 gene locus_tag LOCUS_06920 3795 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4622 4404 gene locus_tag LOCUS_06930 4622 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5421 4915 gene locus_tag LOCUS_06940 5421 4915 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_06940 6551 5454 gene locus_tag LOCUS_06950 6551 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 6662 7522 gene locus_tag LOCUS_06960 6662 7522 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_06960 8770 7532 gene locus_tag LOCUS_06970 8770 7532 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_06970 9300 9040 gene locus_tag LOCUS_06980 9300 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 10263 9304 gene locus_tag LOCUS_06990 10263 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 10457 12076 gene locus_tag LOCUS_07000 gene pyrG 10457 12076 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence067 712 335 gene locus_tag LOCUS_07010 712 335 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_07010 1817 909 gene locus_tag LOCUS_07020 1817 909 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_07020 1973 2281 gene locus_tag LOCUS_07030 1973 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2475 2741 gene locus_tag LOCUS_07040 2475 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2920 5193 gene locus_tag LOCUS_07050 gene katG 2920 5193 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_07050 6816 5398 gene locus_tag LOCUS_07060 6816 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7515 6829 gene locus_tag LOCUS_07070 7515 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8275 7703 gene locus_tag LOCUS_07080 8275 7703 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_07080 8519 10822 gene locus_tag LOCUS_07090 gene katG 8519 10822 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNN4 protein_id gnl|my_center|LOCUS_07090 11986 10991 gene locus_tag LOCUS_07100 11986 10991 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence068 3354 31 gene locus_tag LOCUS_07110 gene treS 3354 31 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933743.1 protein_id gnl|my_center|LOCUS_07110 3690 4103 gene locus_tag LOCUS_07120 3690 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4123 5265 gene locus_tag LOCUS_07130 4123 5265 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_07130 5380 5871 gene locus_tag LOCUS_07140 gene msrA 5380 5871 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6A2 protein_id gnl|my_center|LOCUS_07140 7344 5917 gene locus_tag LOCUS_07150 7344 5917 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_07150 7472 9250 gene locus_tag LOCUS_07160 gene ndvA 7472 9250 CDS product beta-(1-->2)glucan export ATP-binding/permease protein NdvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE88 protein_id gnl|my_center|LOCUS_07160 9341 10576 gene locus_tag LOCUS_07170 9341 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 10878 10960 gene locus_tag LOCUS_t00100 10878 10960 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence069 802 197 gene locus_tag LOCUS_07180 802 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939308.1 protein_id gnl|my_center|LOCUS_07180 1429 830 gene locus_tag LOCUS_07190 1429 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2527 1604 gene locus_tag LOCUS_07200 2527 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5147 2520 gene locus_tag LOCUS_07210 5147 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6193 5183 gene locus_tag LOCUS_07220 6193 5183 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_07220 7814 6390 gene locus_tag LOCUS_07230 7814 6390 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_07230 9736 7937 gene locus_tag LOCUS_07240 9736 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_07240 11022 10030 gene locus_tag LOCUS_07250 11022 10030 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_07250 <12117 11353 gene locus_tag LOCUS_07260 <12117 11353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072214.1:cytochrome b6 >Feature sequence070 1374 2441 gene locus_tag LOCUS_07270 1374 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2441 5224 gene locus_tag LOCUS_07280 2441 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5263 10392 gene locus_tag LOCUS_07290 5263 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10631 11596 gene locus_tag LOCUS_07300 10631 11596 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence071 272 649 gene locus_tag LOCUS_07310 272 649 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L0 protein_id gnl|my_center|LOCUS_07310 2567 777 gene locus_tag LOCUS_07320 2567 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5345 2787 gene locus_tag LOCUS_07330 5345 2787 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_07330 6778 5429 gene locus_tag LOCUS_07340 gene mauG 6778 5429 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_07340 7079 8179 gene locus_tag LOCUS_07350 gene smf 7079 8179 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_07350 8457 9575 gene locus_tag LOCUS_07360 8457 9575 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence072 1836 577 gene locus_tag LOCUS_07370 1836 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2530 2027 gene locus_tag LOCUS_07380 2530 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3259 2627 gene locus_tag LOCUS_07390 3259 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4015 3515 gene locus_tag LOCUS_07400 4015 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4951 4082 gene locus_tag LOCUS_07410 4951 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8826 5074 gene locus_tag LOCUS_07420 8826 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6886 6969 gene locus_tag LOCUS_t00110 6886 6969 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11597 9252 gene locus_tag LOCUS_07430 11597 9252 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence073 5301 13 gene locus_tag LOCUS_07440 5301 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <11756 5327 gene locus_tag LOCUS_07450 <11756 5327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence074 1541 198 gene locus_tag LOCUS_07460 1541 198 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_07460 2924 1674 gene locus_tag LOCUS_07470 2924 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3861 2917 gene locus_tag LOCUS_07480 3861 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7639 3872 gene locus_tag LOCUS_07490 7639 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9107 7923 gene locus_tag LOCUS_07500 gene pgl 9107 7923 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34499 protein_id gnl|my_center|LOCUS_07500 9213 9527 gene locus_tag LOCUS_07510 9213 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9538 9825 gene locus_tag LOCUS_07520 9538 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9839 10885 gene locus_tag LOCUS_07530 gene lpxD 9839 10885 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW8 protein_id gnl|my_center|LOCUS_07530 >Feature sequence075 2230 815 gene locus_tag LOCUS_07540 2230 815 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_07540 2505 4808 gene locus_tag LOCUS_07550 2505 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5374 6201 gene locus_tag LOCUS_07560 5374 6201 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754758.1 protein_id gnl|my_center|LOCUS_07560 6380 8713 gene locus_tag LOCUS_07570 6380 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9157 8741 gene locus_tag LOCUS_07580 9157 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9589 9236 gene locus_tag LOCUS_07590 9589 9236 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438666.1 protein_id gnl|my_center|LOCUS_07590 9861 10727 gene locus_tag LOCUS_07600 gene tatC 9861 10727 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_07600 10872 11483 gene locus_tag LOCUS_07610 10872 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence076 799 1323 gene locus_tag LOCUS_07620 799 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1512 2390 gene locus_tag LOCUS_07630 1512 2390 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_07630 3432 2605 gene locus_tag LOCUS_07640 3432 2605 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_07640 3864 4784 gene locus_tag LOCUS_07650 3864 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6267 4984 gene locus_tag LOCUS_07660 gene mauG 6267 4984 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_07660 8108 6363 gene locus_tag LOCUS_07670 8108 6363 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_07670 8861 8133 gene locus_tag LOCUS_07680 8861 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 9852 8926 gene locus_tag LOCUS_07690 9852 8926 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_07690 10138 9923 gene locus_tag LOCUS_07700 10138 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 10426 11358 gene locus_tag LOCUS_07710 10426 11358 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081973.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence077 1109 234 gene locus_tag LOCUS_07720 1109 234 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_07720 1939 1163 gene locus_tag LOCUS_07730 1939 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2691 2143 gene locus_tag LOCUS_07740 gene mip 2691 2143 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 protein_id gnl|my_center|LOCUS_07740 4252 2993 gene locus_tag LOCUS_07750 gene aroA 4252 2993 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_07750 5152 4433 gene locus_tag LOCUS_07760 gene hisA 5152 4433 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_07760 6143 5271 gene locus_tag LOCUS_07770 gene sucD 6143 5271 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_07770 6546 6229 gene locus_tag LOCUS_07780 6546 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6753 7337 gene locus_tag LOCUS_07790 6753 7337 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_07790 7446 9098 gene locus_tag LOCUS_07800 7446 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 10486 9260 gene locus_tag LOCUS_07810 10486 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 11001 10537 gene locus_tag LOCUS_07820 11001 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence078 3107 3775 gene locus_tag LOCUS_07830 3107 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4051 4458 gene locus_tag LOCUS_07840 4051 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5456 4476 gene locus_tag LOCUS_07850 5456 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7829 5910 gene locus_tag LOCUS_07860 7829 5910 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_07860 8136 8729 gene locus_tag LOCUS_07870 8136 8729 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_07870 8767 9408 gene locus_tag LOCUS_07880 8767 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 9539 10411 gene locus_tag LOCUS_07890 9539 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 <11626 10552 gene locus_tag LOCUS_07900 <11626 10552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403495.1:membrane protein >Feature sequence079 <1 731 gene locus_tag LOCUS_07910 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PD6:methionyl-tRNA formyltransferase 2458 824 gene locus_tag LOCUS_07920 2458 824 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_07920 2895 5363 gene locus_tag LOCUS_07930 2895 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5741 6718 gene locus_tag LOCUS_07940 5741 6718 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_07940 6749 9079 gene locus_tag LOCUS_07950 6749 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 9084 9704 gene locus_tag LOCUS_07960 gene tmk 9084 9704 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JH6 protein_id gnl|my_center|LOCUS_07960 10078 10701 gene locus_tag LOCUS_07970 10078 10701 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_07970 11367 10708 gene locus_tag LOCUS_07980 11367 10708 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence080 4073 894 gene locus_tag LOCUS_07990 4073 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4651 4986 gene locus_tag LOCUS_08000 4651 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5276 5091 gene locus_tag LOCUS_08010 5276 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7612 5390 gene locus_tag LOCUS_08020 7612 5390 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_08020 7854 9272 gene locus_tag LOCUS_08030 7854 9272 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_08030 9300 11402 gene locus_tag LOCUS_08040 9300 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence081 660 1769 gene locus_tag LOCUS_08050 660 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1897 3246 gene locus_tag LOCUS_08060 1897 3246 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_08060 3675 4538 gene locus_tag LOCUS_08070 3675 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4634 5725 gene locus_tag LOCUS_08080 4634 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6481 5918 gene locus_tag LOCUS_08090 6481 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6927 6691 gene locus_tag LOCUS_08100 6927 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence082 165 2084 gene locus_tag LOCUS_08110 165 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3718 2081 gene locus_tag LOCUS_08120 3718 2081 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EE6 protein_id gnl|my_center|LOCUS_08120 5304 3820 gene locus_tag LOCUS_08130 5304 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_08130 6783 5347 gene locus_tag LOCUS_08140 6783 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7122 6922 gene locus_tag LOCUS_08150 7122 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 7875 7138 gene locus_tag LOCUS_08160 gene ptmA 7875 7138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_08160 8795 7878 gene locus_tag LOCUS_08170 8795 7878 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289368.1 protein_id gnl|my_center|LOCUS_08170 9517 8792 gene locus_tag LOCUS_08180 gene ptmB 9517 8792 CDS product posttranslational modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_08180 10630 9581 gene locus_tag LOCUS_08190 10630 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <11437 10817 gene locus_tag LOCUS_08200 <11437 10817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403378.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence083 7225 1967 gene locus_tag LOCUS_08210 7225 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 7843 7229 gene locus_tag LOCUS_08220 7843 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 8051 7764 gene locus_tag LOCUS_08230 8051 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 9828 8095 gene locus_tag LOCUS_08240 9828 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence084 991 2085 gene locus_tag LOCUS_08250 gene recA 991 2085 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_08250 2780 2355 gene locus_tag LOCUS_08260 2780 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4608 2944 gene locus_tag LOCUS_08270 4608 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5324 4608 gene locus_tag LOCUS_08280 5324 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 5508 6524 gene locus_tag LOCUS_08290 5508 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6500 7231 gene locus_tag LOCUS_08300 6500 7231 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_08300 8212 7355 gene locus_tag LOCUS_08310 gene ghr 8212 7355 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_08310 9221 8352 gene locus_tag LOCUS_08320 9221 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence085 <1 699 gene locus_tag LOCUS_08330 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378953.1:membrane protein 2110 833 gene locus_tag LOCUS_08340 2110 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3422 2163 gene locus_tag LOCUS_08350 3422 2163 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_08350 3997 3425 gene locus_tag LOCUS_08360 3997 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4196 4014 gene locus_tag LOCUS_08370 4196 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4931 4488 gene locus_tag LOCUS_08380 4931 4488 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_08380 5089 6204 gene locus_tag LOCUS_08390 5089 6204 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 protein_id gnl|my_center|LOCUS_08390 7219 6320 gene locus_tag LOCUS_08400 7219 6320 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_08400 8483 7317 gene locus_tag LOCUS_08410 8483 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 8667 9467 gene locus_tag LOCUS_08420 8667 9467 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_08420 11041 9599 gene locus_tag LOCUS_08430 11041 9599 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_08430 10943 11224 gene locus_tag LOCUS_08440 10943 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence086 <1 534 gene locus_tag LOCUS_08450 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964176.1:DNA-directed RNA polymerase sigma-70 factor 531 1904 gene locus_tag LOCUS_08460 531 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2710 2045 gene locus_tag LOCUS_08470 2710 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3010 3738 gene locus_tag LOCUS_08480 3010 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3917 4339 gene locus_tag LOCUS_08490 3917 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4570 6147 gene locus_tag LOCUS_08500 4570 6147 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_08500 6431 7882 gene locus_tag LOCUS_08510 6431 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_08510 9039 7864 gene locus_tag LOCUS_08520 9039 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10082 9327 gene locus_tag LOCUS_08530 10082 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_08530 10914 10126 gene locus_tag LOCUS_08540 gene ykiD 10914 10126 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CGM3 protein_id gnl|my_center|LOCUS_08540 10989 11180 gene locus_tag LOCUS_08550 10989 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence087 2669 912 gene locus_tag LOCUS_08560 2669 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5128 2903 gene locus_tag LOCUS_08570 5128 2903 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_08570 5584 6975 gene locus_tag LOCUS_08580 5584 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7030 7365 gene locus_tag LOCUS_08590 7030 7365 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_08590 7996 8337 gene locus_tag LOCUS_08600 7996 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8465 8710 gene locus_tag LOCUS_08610 8465 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 8715 9257 gene locus_tag LOCUS_08620 gene kdsC 8715 9257 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_08620 9361 11091 gene locus_tag LOCUS_08630 9361 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence088 63 521 gene locus_tag LOCUS_08640 63 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1603 746 gene locus_tag LOCUS_08650 1603 746 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140423.1 protein_id gnl|my_center|LOCUS_08650 2334 1804 gene locus_tag LOCUS_08660 2334 1804 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_08660 2553 3311 gene locus_tag LOCUS_08670 2553 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3312 4397 gene locus_tag LOCUS_08680 3312 4397 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_08680 4398 5561 gene locus_tag LOCUS_08690 4398 5561 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_08690 6134 11008 gene locus_tag LOCUS_08700 6134 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence089 <1 869 gene locus_tag LOCUS_08710 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530172.1:flagellar motor protein MotB 1850 942 gene locus_tag LOCUS_08720 gene nusB 1850 942 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_08720 2174 2686 gene locus_tag LOCUS_08730 2174 2686 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_08730 2784 3560 gene locus_tag LOCUS_08740 2784 3560 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_08740 3641 4768 gene locus_tag LOCUS_08750 3641 4768 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_08750 4881 5564 gene locus_tag LOCUS_08760 gene ung 4881 5564 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H9 protein_id gnl|my_center|LOCUS_08760 5587 6249 gene locus_tag LOCUS_08770 5587 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6262 7647 gene locus_tag LOCUS_08780 6262 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 7647 8810 gene locus_tag LOCUS_08790 7647 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 9406 9011 gene locus_tag LOCUS_08800 9406 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence090 <1 906 gene locus_tag LOCUS_08810 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 2726 1092 gene locus_tag LOCUS_08820 2726 1092 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_08820 3774 2845 gene locus_tag LOCUS_08830 3774 2845 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 protein_id gnl|my_center|LOCUS_08830 4379 3864 gene locus_tag LOCUS_08840 4379 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705686.1 protein_id gnl|my_center|LOCUS_08840 5607 4384 gene locus_tag LOCUS_08850 5607 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5707 6285 gene locus_tag LOCUS_08860 5707 6285 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_08860 8627 6450 gene locus_tag LOCUS_08870 8627 6450 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_08870 8821 9882 gene locus_tag LOCUS_08880 8821 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence091 407 8644 gene locus_tag LOCUS_08890 407 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8656 10740 gene locus_tag LOCUS_08900 8656 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence092 <1 1233 gene locus_tag LOCUS_08910 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968718.1:carbohydrate kinase 1845 1453 gene locus_tag LOCUS_08920 1845 1453 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_08920 2369 1974 gene locus_tag LOCUS_08930 2369 1974 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_08930 3277 2576 gene locus_tag LOCUS_08940 3277 2576 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_08940 3587 6394 gene locus_tag LOCUS_08950 3587 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 6436 7794 gene locus_tag LOCUS_08960 6436 7794 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212459.1 protein_id gnl|my_center|LOCUS_08960 9238 7910 gene locus_tag LOCUS_08970 gene tyrS 9238 7910 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_08970 9435 10712 gene locus_tag LOCUS_08980 9435 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence093 597 1589 gene locus_tag LOCUS_08990 597 1589 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_08990 2773 1799 gene locus_tag LOCUS_09000 gene kdsD 2773 1799 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_09000 3233 5449 gene locus_tag LOCUS_09010 3233 5449 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_09010 5718 6242 gene locus_tag LOCUS_09020 5718 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 6424 7590 gene locus_tag LOCUS_09030 6424 7590 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_09030 7686 8318 gene locus_tag LOCUS_09040 7686 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8339 9055 gene locus_tag LOCUS_09050 8339 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence094 4800 3319 gene locus_tag LOCUS_09060 4800 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6559 5147 gene locus_tag LOCUS_09070 gene ftsA 6559 5147 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_09070 7799 6987 gene locus_tag LOCUS_09080 7799 6987 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_09080 9181 7799 gene locus_tag LOCUS_09090 9181 7799 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM2 protein_id gnl|my_center|LOCUS_09090 10311 9178 gene locus_tag LOCUS_09100 gene murG 10311 9178 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM1 protein_id gnl|my_center|LOCUS_09100 <10897 10301 gene locus_tag LOCUS_09110 <10897 10301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763712.1:rod shape-determining protein RodA >Feature sequence095 89 973 gene locus_tag LOCUS_09120 89 973 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529508.1 protein_id gnl|my_center|LOCUS_09120 1293 4694 gene locus_tag LOCUS_09130 1293 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5182 8463 gene locus_tag LOCUS_09140 5182 8463 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_09140 9228 8632 gene locus_tag LOCUS_09150 9228 8632 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_09150 10092 9340 gene locus_tag LOCUS_09160 10092 9340 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096539.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence096 1225 749 gene locus_tag LOCUS_09170 1225 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2394 1228 gene locus_tag LOCUS_09180 2394 1228 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529507.1 protein_id gnl|my_center|LOCUS_09180 3530 2598 gene locus_tag LOCUS_09190 3530 2598 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_09190 5220 3496 gene locus_tag LOCUS_09200 5220 3496 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence097 126 1157 gene locus_tag LOCUS_09210 126 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1228 1605 gene locus_tag LOCUS_09220 1228 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2150 1602 gene locus_tag LOCUS_09230 2150 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2410 4110 gene locus_tag LOCUS_09240 gene pepF 2410 4110 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_09240 4209 6125 gene locus_tag LOCUS_09250 4209 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6178 6492 gene locus_tag LOCUS_09260 6178 6492 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760534.1 protein_id gnl|my_center|LOCUS_09260 8271 6667 gene locus_tag LOCUS_09270 8271 6667 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202708.1 protein_id gnl|my_center|LOCUS_09270 8617 9606 gene locus_tag LOCUS_09280 gene fabH2 8617 9606 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A137 protein_id gnl|my_center|LOCUS_09280 10540 9794 gene locus_tag LOCUS_09290 10540 9794 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence098 146 1015 gene locus_tag LOCUS_09300 146 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1109 1669 gene locus_tag LOCUS_09310 1109 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1876 3063 gene locus_tag LOCUS_09320 gene mqnE 1876 3063 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVA9 protein_id gnl|my_center|LOCUS_09320 3154 3789 gene locus_tag LOCUS_09330 gene gpm 3154 3789 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_09330 3783 4583 gene locus_tag LOCUS_09340 gene mqnA 3783 4583 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_09340 >Feature sequence099 1324 758 gene locus_tag LOCUS_09350 gene frr 1324 758 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_09350 2228 1539 gene locus_tag LOCUS_09360 2228 1539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_09360 3567 2284 gene locus_tag LOCUS_09370 gene serS 3567 2284 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_09370 4147 6390 gene locus_tag LOCUS_09380 4147 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6691 7107 gene locus_tag LOCUS_09390 6691 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7092 7430 gene locus_tag LOCUS_09400 7092 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7522 8583 gene locus_tag LOCUS_09410 gene pdhA 7522 8583 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E8 protein_id gnl|my_center|LOCUS_09410 9671 8778 gene locus_tag LOCUS_09420 9671 8778 CDS product LACX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence100 2106 739 gene locus_tag LOCUS_09430 2106 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3676 2099 gene locus_tag LOCUS_09440 3676 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4661 3699 gene locus_tag LOCUS_09450 4661 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7091 4821 gene locus_tag LOCUS_09460 7091 4821 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_09460 7858 7109 gene locus_tag LOCUS_09470 7858 7109 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_09470 9148 8030 gene locus_tag LOCUS_09480 gene gmd 9148 8030 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56872 protein_id gnl|my_center|LOCUS_09480 <10454 9163 gene locus_tag LOCUS_09490 <10454 9163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766006.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence101 630 133 gene locus_tag LOCUS_09500 630 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2044 728 gene locus_tag LOCUS_09510 2044 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2141 2800 gene locus_tag LOCUS_09520 2141 2800 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_09520 3460 2987 gene locus_tag LOCUS_09530 3460 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3646 4266 gene locus_tag LOCUS_09540 gene engB 3646 4266 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_09540 4292 6061 gene locus_tag LOCUS_09550 4292 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6385 6134 gene locus_tag LOCUS_09560 6385 6134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 protein_id gnl|my_center|LOCUS_09560 6539 7738 gene locus_tag LOCUS_09570 6539 7738 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_09570 7725 9014 gene locus_tag LOCUS_09580 7725 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027709.1 protein_id gnl|my_center|LOCUS_09580 9743 9135 gene locus_tag LOCUS_09590 9743 9135 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence102 610 2055 gene locus_tag LOCUS_09600 610 2055 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_09600 2290 3552 gene locus_tag LOCUS_09610 2290 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3549 4238 gene locus_tag LOCUS_09620 3549 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4640 4311 gene locus_tag LOCUS_09630 4640 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538054.1 protein_id gnl|my_center|LOCUS_09630 4870 5619 gene locus_tag LOCUS_09640 4870 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5606 6895 gene locus_tag LOCUS_09650 5606 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6982 8223 gene locus_tag LOCUS_09660 6982 8223 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_09660 8937 8332 gene locus_tag LOCUS_09670 gene rnhB 8937 8332 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_09670 9155 10027 gene locus_tag LOCUS_09680 9155 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence103 <1 900 gene locus_tag LOCUS_09690 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1H2:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 5493 1192 gene locus_tag LOCUS_09700 5493 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5741 6844 gene locus_tag LOCUS_09710 5741 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7091 8140 gene locus_tag LOCUS_09720 gene galM 7091 8140 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882J1 protein_id gnl|my_center|LOCUS_09720 8289 9035 gene locus_tag LOCUS_09730 8289 9035 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_09730 9757 9008 gene locus_tag LOCUS_09740 9757 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence104 397 1485 gene locus_tag LOCUS_09750 397 1485 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533198.1 protein_id gnl|my_center|LOCUS_09750 1577 2629 gene locus_tag LOCUS_09760 1577 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2808 3404 gene locus_tag LOCUS_09770 2808 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3509 3808 gene locus_tag LOCUS_09780 3509 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5161 3899 gene locus_tag LOCUS_09790 5161 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5431 6516 gene locus_tag LOCUS_09800 gene pheS 5431 6516 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_09800 7055 6873 gene locus_tag LOCUS_09810 7055 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7182 8495 gene locus_tag LOCUS_09820 7182 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence105 9612 3748 gene locus_tag LOCUS_09830 9612 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence106 830 1258 gene locus_tag LOCUS_09840 830 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1334 1969 gene locus_tag LOCUS_09850 1334 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2011 3360 gene locus_tag LOCUS_09860 gene sbcD 2011 3360 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_09860 3357 6470 gene locus_tag LOCUS_09870 gene sbcC 3357 6470 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB15 protein_id gnl|my_center|LOCUS_09870 7446 6691 gene locus_tag LOCUS_09880 7446 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7829 8203 gene locus_tag LOCUS_09890 7829 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10103 8283 gene locus_tag LOCUS_09900 10103 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence107 7081 110 gene locus_tag LOCUS_09910 7081 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 7381 9774 gene locus_tag LOCUS_09920 gene lon 7381 9774 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84348 protein_id gnl|my_center|LOCUS_09920 >Feature sequence108 898 125 gene locus_tag LOCUS_09930 898 125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_09930 1471 1046 gene locus_tag LOCUS_09940 gene aroQ 1471 1046 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_09940 3199 1622 gene locus_tag LOCUS_09950 3199 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3445 4599 gene locus_tag LOCUS_09960 3445 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5053 8019 gene locus_tag LOCUS_09970 5053 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 9014 8163 gene locus_tag LOCUS_09980 9014 8163 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_09980 9632 9072 gene locus_tag LOCUS_09990 9632 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10023 9832 gene locus_tag LOCUS_10000 10023 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence109 258 719 gene locus_tag LOCUS_10010 258 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 765 1781 gene locus_tag LOCUS_10020 765 1781 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_10020 1942 2871 gene locus_tag LOCUS_10030 1942 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3410 2991 gene locus_tag LOCUS_10040 3410 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3595 4374 gene locus_tag LOCUS_10050 3595 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_10050 8232 4594 gene locus_tag LOCUS_10060 8232 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_10060 9223 8336 gene locus_tag LOCUS_10070 9223 8336 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence110 965 39 gene locus_tag LOCUS_10080 gene mauG 965 39 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_10080 4106 1467 gene locus_tag LOCUS_10090 4106 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5085 4153 gene locus_tag LOCUS_10100 5085 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6646 5291 gene locus_tag LOCUS_10110 6646 5291 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_10110 9765 6856 gene locus_tag LOCUS_10120 9765 6856 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence111 4701 1801 gene locus_tag LOCUS_10130 4701 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141887.1 protein_id gnl|my_center|LOCUS_10130 5717 4773 gene locus_tag LOCUS_10140 5717 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6837 6070 gene locus_tag LOCUS_10150 6837 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6929 7954 gene locus_tag LOCUS_10160 6929 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404008.1 protein_id gnl|my_center|LOCUS_10160 8752 8138 gene locus_tag LOCUS_10170 gene tdk 8752 8138 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_10170 9508 9876 gene locus_tag LOCUS_10180 9508 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence112 1949 567 gene locus_tag LOCUS_10190 1949 567 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_10190 3574 2000 gene locus_tag LOCUS_10200 3574 2000 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_10200 5745 3640 gene locus_tag LOCUS_10210 5745 3640 CDS product ATP-dependent Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939301.1 protein_id gnl|my_center|LOCUS_10210 8505 5938 gene locus_tag LOCUS_10220 8505 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_10220 9150 8536 gene locus_tag LOCUS_10230 9150 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence113 91 1776 gene locus_tag LOCUS_10240 91 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1833 3755 gene locus_tag LOCUS_10250 1833 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4046 4792 gene locus_tag LOCUS_10260 4046 4792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_10260 4805 5590 gene locus_tag LOCUS_10270 4805 5590 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_10270 7283 5775 gene locus_tag LOCUS_10280 7283 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_10280 9282 7402 gene locus_tag LOCUS_10290 gene dnaK 9282 7402 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFG7 protein_id gnl|my_center|LOCUS_10290 >Feature sequence114 774 1811 gene locus_tag LOCUS_10300 774 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1921 2979 gene locus_tag LOCUS_10310 1921 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_10310 3101 4153 gene locus_tag LOCUS_10320 gene ykfB 3101 4153 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34508 protein_id gnl|my_center|LOCUS_10320 4281 5594 gene locus_tag LOCUS_10330 4281 5594 CDS product K+ transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393256.1 protein_id gnl|my_center|LOCUS_10330 5659 6564 gene locus_tag LOCUS_10340 5659 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 8202 6541 gene locus_tag LOCUS_10350 8202 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 <9729 8594 gene locus_tag LOCUS_10360 <9729 8594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein >Feature sequence115 5068 2123 gene locus_tag LOCUS_10370 5068 2123 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_10370 5445 6563 gene locus_tag LOCUS_10380 gene dnaN 5445 6563 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_10380 7469 6669 gene locus_tag LOCUS_10390 7469 6669 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 protein_id gnl|my_center|LOCUS_10390 8685 7567 gene locus_tag LOCUS_10400 8685 7567 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_10400 9444 8845 gene locus_tag LOCUS_10410 9444 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence116 2923 443 gene locus_tag LOCUS_10420 gene fecA 2923 443 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_10420 4307 2913 gene locus_tag LOCUS_10430 4307 2913 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_10430 5389 4322 gene locus_tag LOCUS_10440 gene irpA 5389 4322 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_10440 6639 5416 gene locus_tag LOCUS_10450 6639 5416 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_10450 7233 6751 gene locus_tag LOCUS_10460 7233 6751 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_10460 8260 7355 gene locus_tag LOCUS_10470 gene thyA 8260 7355 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y626 protein_id gnl|my_center|LOCUS_10470 8553 9377 gene locus_tag LOCUS_10480 8553 9377 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence117 4150 3584 gene locus_tag LOCUS_10490 4150 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6174 4912 gene locus_tag LOCUS_10500 gene cysN 6174 4912 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_10500 7193 6276 gene locus_tag LOCUS_10510 gene cysD 7193 6276 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_10510 7816 7220 gene locus_tag LOCUS_10520 gene cysC 7816 7220 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_10520 9243 8173 gene locus_tag LOCUS_10530 9243 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence118 889 425 gene locus_tag LOCUS_10540 889 425 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_10540 983 1183 gene locus_tag LOCUS_10550 983 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2110 1421 gene locus_tag LOCUS_10560 2110 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4679 2355 gene locus_tag LOCUS_10570 4679 2355 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_10570 6444 4849 gene locus_tag LOCUS_10580 6444 4849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_10580 <9557 6555 gene locus_tag LOCUS_10590 <9557 6555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405543.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence119 1033 1425 gene locus_tag LOCUS_10600 1033 1425 CDS product DUF4783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786212.1 protein_id gnl|my_center|LOCUS_10600 1890 4376 gene locus_tag LOCUS_10610 1890 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5385 4360 gene locus_tag LOCUS_10620 5385 4360 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_10620 5903 5412 gene locus_tag LOCUS_10630 5903 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6198 7631 gene locus_tag LOCUS_10640 gene trmA 6198 7631 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_10640 7609 7773 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtctaggagttttggagtct 7939 9276 gene locus_tag LOCUS_10650 7939 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence120 1844 1176 gene locus_tag LOCUS_10660 1844 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4855 1868 gene locus_tag LOCUS_10670 4855 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5234 6319 gene locus_tag LOCUS_10680 5234 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 9309 6379 gene locus_tag LOCUS_10690 9309 6379 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence121 709 1278 gene locus_tag LOCUS_10700 709 1278 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_10700 1275 1877 gene locus_tag LOCUS_10710 1275 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2030 2953 gene locus_tag LOCUS_10720 2030 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3903 3070 gene locus_tag LOCUS_10730 gene surE 3903 3070 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_10730 4217 6115 gene locus_tag LOCUS_10740 gene ogt 4217 6115 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_10740 7027 6347 gene locus_tag LOCUS_10750 7027 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7084 8565 gene locus_tag LOCUS_10760 7084 8565 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence122 <1 867 gene locus_tag LOCUS_10770 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963911.1:8-amino-7-oxononanoate synthase 1874 1011 gene locus_tag LOCUS_10780 1874 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_10780 3897 2128 gene locus_tag LOCUS_10790 3897 2128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_10790 5215 4058 gene locus_tag LOCUS_10800 5215 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 6567 5362 gene locus_tag LOCUS_10810 6567 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 6864 6601 gene locus_tag LOCUS_10820 6864 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 <9424 7287 gene locus_tag LOCUS_10830 <9424 7287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:peptidase S9 >Feature sequence123 3329 1995 gene locus_tag LOCUS_10840 gene sucB 3329 1995 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_10840 6961 3437 gene locus_tag LOCUS_10850 6961 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7689 7096 gene locus_tag LOCUS_10860 7689 7096 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_10860 8334 7846 gene locus_tag LOCUS_10870 8334 7846 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_10870 8492 8716 gene locus_tag LOCUS_10880 8492 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8966 9175 gene locus_tag LOCUS_10890 8966 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence124 1317 277 gene locus_tag LOCUS_10900 gene tas 1317 277 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_10900 1726 2304 gene locus_tag LOCUS_10910 1726 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2418 2672 gene locus_tag LOCUS_10920 2418 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2822 3874 gene locus_tag LOCUS_10930 gene pslN 2822 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_10930 4838 3843 gene locus_tag LOCUS_10940 4838 3843 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 protein_id gnl|my_center|LOCUS_10940 6292 4850 gene locus_tag LOCUS_10950 6292 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6860 6513 gene locus_tag LOCUS_10960 6860 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_10960 7656 6853 gene locus_tag LOCUS_10970 7656 6853 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_10970 7949 8893 gene locus_tag LOCUS_10980 7949 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence125 754 161 gene locus_tag LOCUS_10990 754 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1089 1907 gene locus_tag LOCUS_11000 gene pcrB 1089 1907 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_11000 2109 3989 gene locus_tag LOCUS_11010 2109 3989 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_11010 4980 4198 gene locus_tag LOCUS_11020 4980 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6291 4993 gene locus_tag LOCUS_11030 6291 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 7270 6434 gene locus_tag LOCUS_11040 7270 6434 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_11040 7577 7906 gene locus_tag LOCUS_11050 7577 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 8193 8543 gene locus_tag LOCUS_11060 gene rplS 8193 8543 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4V8 protein_id gnl|my_center|LOCUS_11060 8807 9103 gene locus_tag LOCUS_11070 8807 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence126 1486 449 gene locus_tag LOCUS_11080 gene obg 1486 449 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_11080 2107 1529 gene locus_tag LOCUS_11090 gene adk 2107 1529 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_11090 >Feature sequence127 114 1268 gene locus_tag LOCUS_11100 114 1268 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_11100 1361 2251 gene locus_tag LOCUS_11110 1361 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3431 2409 gene locus_tag LOCUS_11120 3431 2409 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence128 108 887 gene locus_tag LOCUS_11130 108 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 887 1645 gene locus_tag LOCUS_11140 gene truA 887 1645 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_11140 1739 2842 gene locus_tag LOCUS_11150 1739 2842 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829686.1 protein_id gnl|my_center|LOCUS_11150 2842 3210 gene locus_tag LOCUS_11160 2842 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4681 3155 gene locus_tag LOCUS_11170 4681 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5826 4702 gene locus_tag LOCUS_11180 5826 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6248 7057 gene locus_tag LOCUS_11190 6248 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7114 7866 gene locus_tag LOCUS_11200 gene lpxH 7114 7866 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence129 990 478 gene locus_tag LOCUS_11210 990 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947975.1 protein_id gnl|my_center|LOCUS_11210 2030 987 gene locus_tag LOCUS_11220 2030 987 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_11220 4318 2234 gene locus_tag LOCUS_11230 4318 2234 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122941.1 protein_id gnl|my_center|LOCUS_11230 5264 4581 gene locus_tag LOCUS_11240 5264 4581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_11240 6212 5598 gene locus_tag LOCUS_11250 6212 5598 CDS product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_11250 7464 6202 gene locus_tag LOCUS_11260 7464 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8293 7622 gene locus_tag LOCUS_11270 8293 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence130 1516 461 gene locus_tag LOCUS_11280 1516 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1923 2300 gene locus_tag LOCUS_11290 1923 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3393 2332 gene locus_tag LOCUS_11300 3393 2332 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_11300 3546 4541 gene locus_tag LOCUS_11310 3546 4541 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_11310 4670 5554 gene locus_tag LOCUS_11320 gene rbsK 4670 5554 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_11320 7296 5662 gene locus_tag LOCUS_11330 7296 5662 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_11330 7387 7611 gene locus_tag LOCUS_11340 7387 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 <8887 7804 gene locus_tag LOCUS_11350 <8887 7804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028818.1:membrane protein >Feature sequence131 145 2976 gene locus_tag LOCUS_11360 gene polA 145 2976 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_11360 3166 3537 gene locus_tag LOCUS_11370 3166 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3534 3992 gene locus_tag LOCUS_11380 3534 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4293 6803 gene locus_tag LOCUS_11390 4293 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6851 7147 gene locus_tag LOCUS_11400 gene pspE 6851 7147 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187969.1 protein_id gnl|my_center|LOCUS_11400 7222 8463 gene locus_tag LOCUS_11410 7222 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8869 8561 gene locus_tag LOCUS_11420 8869 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence132 628 918 gene locus_tag LOCUS_11430 628 918 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_11430 1082 2200 gene locus_tag LOCUS_11440 1082 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2277 4964 gene locus_tag LOCUS_11450 2277 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8239 5294 gene locus_tag LOCUS_11460 8239 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence133 2320 749 gene locus_tag LOCUS_11470 2320 749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_11470 5474 2397 gene locus_tag LOCUS_11480 5474 2397 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_11480 7215 5866 gene locus_tag LOCUS_11490 gene accC 7215 5866 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_11490 7904 7380 gene locus_tag LOCUS_11500 gene accB 7904 7380 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_11500 8525 7959 gene locus_tag LOCUS_11510 gene efp 8525 7959 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_11510 >Feature sequence134 113 532 gene locus_tag LOCUS_11520 113 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 786 1592 gene locus_tag LOCUS_11530 786 1592 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 protein_id gnl|my_center|LOCUS_11530 1696 2256 gene locus_tag LOCUS_11540 1696 2256 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_11540 2423 3949 gene locus_tag LOCUS_11550 2423 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_11550 3918 4856 gene locus_tag LOCUS_11560 3918 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5180 6370 gene locus_tag LOCUS_11570 5180 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 8564 6441 gene locus_tag LOCUS_11580 8564 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence135 3140 423 gene locus_tag LOCUS_11590 3140 423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_11590 4013 3153 gene locus_tag LOCUS_11600 4013 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4711 4145 gene locus_tag LOCUS_11610 4711 4145 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_11610 4931 6547 gene locus_tag LOCUS_11620 gene dagA 4931 6547 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_11620 6721 7992 gene locus_tag LOCUS_11630 6721 7992 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887610.1 protein_id gnl|my_center|LOCUS_11630 8112 8396 gene locus_tag LOCUS_11640 8112 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence136 439 1308 gene locus_tag LOCUS_11650 439 1308 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_11650 2394 1240 gene locus_tag LOCUS_11660 2394 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119847.1 protein_id gnl|my_center|LOCUS_11660 3514 2384 gene locus_tag LOCUS_11670 3514 2384 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_11670 4661 3657 gene locus_tag LOCUS_11680 4661 3657 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_11680 7100 4971 gene locus_tag LOCUS_11690 7100 4971 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFW7 protein_id gnl|my_center|LOCUS_11690 7479 7847 gene locus_tag LOCUS_11700 7479 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_11700 7878 8417 gene locus_tag LOCUS_11710 7878 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence137 2 886 gene locus_tag LOCUS_11720 2 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2158 998 gene locus_tag LOCUS_11730 gene acdA 2158 998 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45867 protein_id gnl|my_center|LOCUS_11730 2463 3083 gene locus_tag LOCUS_11740 2463 3083 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 protein_id gnl|my_center|LOCUS_11740 3158 4441 gene locus_tag LOCUS_11750 3158 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4574 5518 gene locus_tag LOCUS_11760 4574 5518 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267562.1 protein_id gnl|my_center|LOCUS_11760 5581 8682 gene locus_tag LOCUS_11770 gene acrB5 5581 8682 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence138 206 2125 gene locus_tag LOCUS_11780 gene glgB 206 2125 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_11780 4299 2272 gene locus_tag LOCUS_11790 4299 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5301 4501 gene locus_tag LOCUS_11800 5301 4501 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_11800 5444 5575 gene locus_tag LOCUS_11810 5444 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6788 5715 gene locus_tag LOCUS_11820 6788 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 <8686 7013 gene locus_tag LOCUS_11830 <8686 7013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117803.1:4-hydroxybenzoate decarboxylase >Feature sequence139 294 773 gene locus_tag LOCUS_11840 294 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 781 1572 gene locus_tag LOCUS_11850 781 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1639 2151 gene locus_tag LOCUS_11860 1639 2151 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_11860 2148 2726 gene locus_tag LOCUS_11870 2148 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 5230 2720 gene locus_tag LOCUS_11880 gene priA 5230 2720 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_11880 5352 5864 gene locus_tag LOCUS_11890 gene folA 5352 5864 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEC3 protein_id gnl|my_center|LOCUS_11890 7460 6105 gene locus_tag LOCUS_11900 7460 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence140 6178 371 gene locus_tag LOCUS_11910 6178 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6823 6314 gene locus_tag LOCUS_11920 6823 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7179 7430 gene locus_tag LOCUS_11930 7179 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7527 7919 gene locus_tag LOCUS_11940 7527 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7936 8304 gene locus_tag LOCUS_11950 7936 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence141 3166 1856 gene locus_tag LOCUS_11960 3166 1856 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_11960 6270 3235 gene locus_tag LOCUS_11970 6270 3235 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_11970 7774 6323 gene locus_tag LOCUS_11980 7774 6323 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942823.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence142 1743 445 gene locus_tag LOCUS_11990 gene gltA 1743 445 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_11990 4063 2207 gene locus_tag LOCUS_12000 4063 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4213 5157 gene locus_tag LOCUS_12010 4213 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 5597 5325 gene locus_tag LOCUS_12020 5597 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5811 6182 gene locus_tag LOCUS_12030 5811 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6547 7158 gene locus_tag LOCUS_12040 6547 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_12040 <8643 7606 gene locus_tag LOCUS_12050 <8643 7606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964422.1:tail-specific protease >Feature sequence143 <1 531 gene locus_tag LOCUS_12060 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1E4:protoheme IX farnesyltransferase 546 1166 gene locus_tag LOCUS_12070 gene ctaE 546 1166 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_12070 1260 2237 gene locus_tag LOCUS_12080 1260 2237 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_12080 2288 2710 gene locus_tag LOCUS_12090 2288 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2926 3570 gene locus_tag LOCUS_12100 2926 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3573 4181 gene locus_tag LOCUS_12110 gene yozB 3573 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_12110 4196 4456 gene locus_tag LOCUS_12120 4196 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4456 5136 gene locus_tag LOCUS_12130 4456 5136 CDS product dUMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872931.1 protein_id gnl|my_center|LOCUS_12130 5339 6001 gene locus_tag LOCUS_12140 gene nth 5339 6001 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_12140 6457 8379 gene locus_tag LOCUS_12150 6457 8379 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence144 3539 201 gene locus_tag LOCUS_12160 3539 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3883 6534 gene locus_tag LOCUS_12170 3883 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6870 8294 gene locus_tag LOCUS_12180 6870 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence145 3018 4466 gene locus_tag LOCUS_12190 3018 4466 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_12190 5723 4986 gene locus_tag LOCUS_12200 5723 4986 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 protein_id gnl|my_center|LOCUS_12200 5935 6759 gene locus_tag LOCUS_12210 5935 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6759 7955 gene locus_tag LOCUS_12220 6759 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence146 1695 6992 gene locus_tag LOCUS_12230 1695 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 7247 7912 gene locus_tag LOCUS_12240 7247 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence147 2079 1435 gene locus_tag LOCUS_12250 gene rsmG 2079 1435 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_12250 2851 2180 gene locus_tag LOCUS_12260 2851 2180 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_12260 3138 2947 gene locus_tag LOCUS_12270 3138 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4108 3449 gene locus_tag LOCUS_12280 4108 3449 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_12280 5113 4205 gene locus_tag LOCUS_12290 5113 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6035 5379 gene locus_tag LOCUS_12300 6035 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6447 7226 gene locus_tag LOCUS_12310 gene yegX 6447 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7H0 protein_id gnl|my_center|LOCUS_12310 8467 7367 gene locus_tag LOCUS_12320 gene metX 8467 7367 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES7 protein_id gnl|my_center|LOCUS_12320 >Feature sequence148 883 23 gene locus_tag LOCUS_12330 883 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1467 931 gene locus_tag LOCUS_12340 1467 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1651 1890 gene locus_tag LOCUS_12350 1651 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1887 2057 gene locus_tag LOCUS_12360 1887 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2282 2626 gene locus_tag LOCUS_12370 2282 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12370 2757 3842 gene locus_tag LOCUS_12380 2757 3842 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_12380 4201 3983 gene locus_tag LOCUS_12390 4201 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4091 5437 gene locus_tag LOCUS_12400 4091 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6878 5502 gene locus_tag LOCUS_12410 6878 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8273 6990 gene locus_tag LOCUS_12420 8273 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence149 3110 234 gene locus_tag LOCUS_12430 3110 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 6567 3529 gene locus_tag LOCUS_12440 6567 3529 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_12440 8297 6579 gene locus_tag LOCUS_12450 8297 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence150 2055 1132 gene locus_tag LOCUS_12460 2055 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2903 2301 gene locus_tag LOCUS_12470 gene actD 2903 2301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_12470 4448 2910 gene locus_tag LOCUS_12480 gene actC 4448 2910 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_12480 8019 4636 gene locus_tag LOCUS_12490 8019 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence151 3713 1173 gene locus_tag LOCUS_12500 3713 1173 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404583.1 protein_id gnl|my_center|LOCUS_12500 4604 3861 gene locus_tag LOCUS_12510 gene uppS 4604 3861 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 protein_id gnl|my_center|LOCUS_12510 5142 5744 gene locus_tag LOCUS_12520 5142 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5741 6520 gene locus_tag LOCUS_12530 5741 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6675 8327 gene locus_tag LOCUS_12540 gene ade 6675 8327 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S006 protein_id gnl|my_center|LOCUS_12540 >Feature sequence152 122 898 gene locus_tag LOCUS_12550 122 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2937 1006 gene locus_tag LOCUS_12560 2937 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3106 3723 gene locus_tag LOCUS_12570 3106 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3947 5653 gene locus_tag LOCUS_12580 3947 5653 CDS product dynamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_12580 5756 7411 gene locus_tag LOCUS_12590 5756 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7482 8279 gene locus_tag LOCUS_12600 gene pcbD 7482 8279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence153 1298 2731 gene locus_tag LOCUS_12610 1298 2731 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 protein_id gnl|my_center|LOCUS_12610 2789 3775 gene locus_tag LOCUS_12620 2789 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_12620 3772 4524 gene locus_tag LOCUS_12630 3772 4524 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267692.1 protein_id gnl|my_center|LOCUS_12630 5933 5199 gene locus_tag LOCUS_12640 5933 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8338 6119 gene locus_tag LOCUS_12650 8338 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence154 <1 712 gene locus_tag LOCUS_12660 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974188.1:glycosyl transferase 727 2409 gene locus_tag LOCUS_12670 727 2409 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_12670 2406 3245 gene locus_tag LOCUS_12680 2406 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3260 4702 gene locus_tag LOCUS_12690 3260 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_12690 4863 6050 gene locus_tag LOCUS_12700 4863 6050 CDS product poly(glycerol-phosphate) alpha-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118864.1 protein_id gnl|my_center|LOCUS_12700 6050 7126 gene locus_tag LOCUS_12710 6050 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7546 8151 gene locus_tag LOCUS_12720 7546 8151 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence155 <1 504 gene locus_tag LOCUS_12730 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759605.1:CDP-diacylglycerol--serine O-phosphatidyltransferase 505 756 gene locus_tag LOCUS_12740 gene purS 505 756 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB02 protein_id gnl|my_center|LOCUS_12740 1024 1434 gene locus_tag LOCUS_12750 1024 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1618 1971 gene locus_tag LOCUS_12760 1618 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2395 3504 gene locus_tag LOCUS_12770 2395 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4131 3670 gene locus_tag LOCUS_12780 gene smpB 4131 3670 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_12780 4719 4300 gene locus_tag LOCUS_12790 4719 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5301 4888 gene locus_tag LOCUS_12800 gene yqiW 5301 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_12800 5462 5851 gene locus_tag LOCUS_12810 5462 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 6014 6895 gene locus_tag LOCUS_12820 6014 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_12820 7108 8049 gene locus_tag LOCUS_12830 7108 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence156 1716 127 gene locus_tag LOCUS_12840 1716 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2257 2069 gene locus_tag LOCUS_12850 gene rpsU 2257 2069 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_12850 3601 2546 gene locus_tag LOCUS_12860 gene phoR 3601 2546 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_12860 4288 3605 gene locus_tag LOCUS_12870 gene phoP 4288 3605 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_12870 4389 4886 gene locus_tag LOCUS_12880 gene sixA 4389 4886 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_12880 4890 5210 gene locus_tag LOCUS_12890 4890 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5358 7097 gene locus_tag LOCUS_12900 5358 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 7799 7098 gene locus_tag LOCUS_12910 7799 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404527.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence157 549 220 gene locus_tag LOCUS_12920 549 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12920 604 1806 gene locus_tag LOCUS_12930 604 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1933 3411 gene locus_tag LOCUS_12940 1933 3411 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_12940 3616 5754 gene locus_tag LOCUS_12950 gene recG 3616 5754 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U7 protein_id gnl|my_center|LOCUS_12950 5980 6588 gene locus_tag LOCUS_12960 gene hisI 5980 6588 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z7 protein_id gnl|my_center|LOCUS_12960 6651 7097 gene locus_tag LOCUS_12970 6651 7097 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_12970 7994 7248 gene locus_tag LOCUS_12980 7994 7248 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence158 243 2048 gene locus_tag LOCUS_12990 gene typA 243 2048 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_12990 3501 2230 gene locus_tag LOCUS_13000 3501 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3909 6554 gene locus_tag LOCUS_13010 3909 6554 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_13010 8057 6702 gene locus_tag LOCUS_13020 gene tilS 8057 6702 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_13020 >Feature sequence159 465 91 gene locus_tag LOCUS_13030 465 91 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_13030 503 1663 gene locus_tag LOCUS_13040 gene ydcM 503 1663 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 protein_id gnl|my_center|LOCUS_13040 1723 2442 gene locus_tag LOCUS_13050 gene pdxJ 1723 2442 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V814 protein_id gnl|my_center|LOCUS_13050 4172 2826 gene locus_tag LOCUS_13060 gene hisS 4172 2826 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_13060 5707 4331 gene locus_tag LOCUS_13070 5707 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6674 5844 gene locus_tag LOCUS_13080 6674 5844 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence160 1233 529 gene locus_tag LOCUS_13090 gene purQ 1233 529 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_13090 1512 1285 gene locus_tag LOCUS_13100 1512 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2579 1527 gene locus_tag LOCUS_13110 2579 1527 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_13110 3707 2679 gene locus_tag LOCUS_13120 gene ykfB 3707 2679 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_13120 3832 4959 gene locus_tag LOCUS_13130 3832 4959 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887230.1 protein_id gnl|my_center|LOCUS_13130 5248 6021 gene locus_tag LOCUS_13140 5248 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 6246 6944 gene locus_tag LOCUS_13150 6246 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence161 515 961 gene locus_tag LOCUS_13160 515 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2021 1086 gene locus_tag LOCUS_13170 2021 1086 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069735.1 protein_id gnl|my_center|LOCUS_13170 2380 2784 gene locus_tag LOCUS_13180 2380 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2994 5015 gene locus_tag LOCUS_13190 gene mutL 2994 5015 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_13190 5194 6057 gene locus_tag LOCUS_13200 5194 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 6515 6063 gene locus_tag LOCUS_13210 gene dtd 6515 6063 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_13210 7175 6612 gene locus_tag LOCUS_13220 7175 6612 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_13220 7892 7206 gene locus_tag LOCUS_13230 7892 7206 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence162 341 1084 gene locus_tag LOCUS_13240 341 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1821 3155 gene locus_tag LOCUS_13250 1821 3155 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_13250 3500 5578 gene locus_tag LOCUS_13260 3500 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6007 7695 gene locus_tag LOCUS_13270 6007 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence163 2023 785 gene locus_tag LOCUS_13280 2023 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2251 3237 gene locus_tag LOCUS_13290 2251 3237 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_13290 3381 3995 gene locus_tag LOCUS_13300 3381 3995 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_13300 4778 4152 gene locus_tag LOCUS_13310 4778 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4851 6209 gene locus_tag LOCUS_13320 4851 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_13320 6400 7719 gene locus_tag LOCUS_13330 6400 7719 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence164 401 961 gene locus_tag LOCUS_13340 401 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 969 1709 gene locus_tag LOCUS_13350 969 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1739 3844 gene locus_tag LOCUS_13360 1739 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 4281 6782 gene locus_tag LOCUS_13370 4281 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_13370 6873 7697 gene locus_tag LOCUS_13380 6873 7697 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence165 512 1252 gene locus_tag LOCUS_13390 512 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1257 2270 gene locus_tag LOCUS_13400 1257 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2291 3457 gene locus_tag LOCUS_13410 2291 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4499 3699 gene locus_tag LOCUS_13420 gene dapF 4499 3699 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_13420 4766 4503 gene locus_tag LOCUS_13430 4766 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5585 4878 gene locus_tag LOCUS_13440 5585 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 7522 5585 gene locus_tag LOCUS_13450 7522 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932716.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence166 1 2373 gene locus_tag LOCUS_13460 1 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3645 2689 gene locus_tag LOCUS_13470 3645 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4812 3775 gene locus_tag LOCUS_13480 4812 3775 CDS product ring canal kelch-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639451.2 protein_id gnl|my_center|LOCUS_13480 7955 4974 gene locus_tag LOCUS_13490 7955 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence167 <1 5044 gene locus_tag LOCUS_13500 <1 5044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 5131 5799 gene locus_tag LOCUS_13510 5131 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6960 5974 gene locus_tag LOCUS_13520 6960 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7231 7611 gene locus_tag LOCUS_13530 7231 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence168 1161 2483 gene locus_tag LOCUS_13540 1161 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3173 2520 gene locus_tag LOCUS_13550 3173 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3522 3328 gene locus_tag LOCUS_13560 3522 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4046 3468 gene locus_tag LOCUS_13570 4046 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 4251 6332 gene locus_tag LOCUS_13580 4251 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6608 6462 gene locus_tag LOCUS_13590 6608 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence169 938 285 gene locus_tag LOCUS_13600 gene lolD 938 285 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_13600 1816 953 gene locus_tag LOCUS_13610 gene purU 1816 953 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_13610 2091 2732 gene locus_tag LOCUS_13620 2091 2732 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_13620 2910 6065 gene locus_tag LOCUS_13630 2910 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 6142 7059 gene locus_tag LOCUS_13640 gene nucA 6142 7059 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence170 2271 136 gene locus_tag LOCUS_13650 gene fusA 2271 136 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A474 protein_id gnl|my_center|LOCUS_13650 2820 2431 gene locus_tag LOCUS_13660 gene rpsG 2820 2431 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK5 protein_id gnl|my_center|LOCUS_13660 3398 3024 gene locus_tag LOCUS_13670 gene rpsL 3398 3024 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG52 protein_id gnl|my_center|LOCUS_13670 3591 4079 gene locus_tag LOCUS_13680 3591 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6317 4194 gene locus_tag LOCUS_13690 6317 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7364 6390 gene locus_tag LOCUS_13700 gene ftsY 7364 6390 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_13700 >Feature sequence171 424 167 gene locus_tag LOCUS_13710 424 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1395 439 gene locus_tag LOCUS_13720 1395 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1853 2197 gene locus_tag LOCUS_13730 1853 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2979 2344 gene locus_tag LOCUS_13740 gene lspA 2979 2344 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_13740 3459 3091 gene locus_tag LOCUS_13750 3459 3091 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_13750 3858 4325 gene locus_tag LOCUS_13760 3858 4325 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_13760 4483 6126 gene locus_tag LOCUS_13770 4483 6126 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_13770 6334 7056 gene locus_tag LOCUS_13780 gene radC 6334 7056 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_13780 <7932 7267 gene locus_tag LOCUS_13790 <7932 7267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase >Feature sequence172 1130 162 gene locus_tag LOCUS_13800 1130 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053466.1 protein_id gnl|my_center|LOCUS_13800 1963 1259 gene locus_tag LOCUS_13810 1963 1259 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140297.1 protein_id gnl|my_center|LOCUS_13810 3073 2099 gene locus_tag LOCUS_13820 3073 2099 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700826.1 protein_id gnl|my_center|LOCUS_13820 4307 3432 gene locus_tag LOCUS_13830 4307 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4897 4304 gene locus_tag LOCUS_13840 4897 4304 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_13840 5082 5750 gene locus_tag LOCUS_13850 5082 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7153 5810 gene locus_tag LOCUS_13860 7153 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence173 488 1642 gene locus_tag LOCUS_13870 488 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1743 4409 gene locus_tag LOCUS_13880 1743 4409 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_13880 6427 4490 gene locus_tag LOCUS_13890 6427 4490 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence174 184 774 gene locus_tag LOCUS_13900 184 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1435 761 gene locus_tag LOCUS_13910 1435 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1497 1961 gene locus_tag LOCUS_13920 1497 1961 CDS product 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809749.1 protein_id gnl|my_center|LOCUS_13920 1997 3484 gene locus_tag LOCUS_13930 1997 3484 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_13930 5631 4363 gene locus_tag LOCUS_13940 gene nqrF 5631 4363 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_13940 6376 5768 gene locus_tag LOCUS_13950 gene nqrE 6376 5768 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHJ7 protein_id gnl|my_center|LOCUS_13950 7285 6539 gene locus_tag LOCUS_13960 gene nqrD 7285 6539 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_13960 <7887 7351 gene locus_tag LOCUS_13970 <7887 7351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64UR9:Na(+)-translocating NADH-quinone reductase subunit C >Feature sequence175 1065 541 gene locus_tag LOCUS_13980 1065 541 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RW28 protein_id gnl|my_center|LOCUS_13980 1411 2403 gene locus_tag LOCUS_13990 1411 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2602 2919 gene locus_tag LOCUS_14000 2602 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2900 3406 gene locus_tag LOCUS_14010 2900 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3497 4186 gene locus_tag LOCUS_14020 3497 4186 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_14020 4297 5229 gene locus_tag LOCUS_14030 4297 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5241 5579 gene locus_tag LOCUS_14040 5241 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5734 6573 gene locus_tag LOCUS_14050 gene prmC 5734 6573 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_14050 6653 7459 gene locus_tag LOCUS_14060 6653 7459 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence176 7 1410 gene locus_tag LOCUS_14070 7 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1410 2951 gene locus_tag LOCUS_14080 1410 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2976 4670 gene locus_tag LOCUS_14090 gene ggt 2976 4670 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_14090 6309 4795 gene locus_tag LOCUS_14100 6309 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6476 7354 gene locus_tag LOCUS_14110 gene rimK 6476 7354 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFE0 protein_id gnl|my_center|LOCUS_14110 >Feature sequence177 2994 2626 gene locus_tag LOCUS_14120 2994 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5068 3296 gene locus_tag LOCUS_14130 gene aspS 5068 3296 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_14130 5222 6277 gene locus_tag LOCUS_14140 5222 6277 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_14140 <7779 6222 gene locus_tag LOCUS_14150 <7779 6222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3W8:isocitrate dehydrogenase kinase/phosphatase >Feature sequence178 1238 2758 gene locus_tag LOCUS_14160 1238 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3060 2848 gene locus_tag LOCUS_14170 3060 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4205 3219 gene locus_tag LOCUS_14180 4205 3219 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_14180 4456 5235 gene locus_tag LOCUS_14190 4456 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404562.1 protein_id gnl|my_center|LOCUS_14190 6117 5392 gene locus_tag LOCUS_14200 6117 5392 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_14200 7280 6114 gene locus_tag LOCUS_14210 7280 6114 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence179 624 1865 gene locus_tag LOCUS_14220 624 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2704 1862 gene locus_tag LOCUS_14230 gene mqnD 2704 1862 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_14230 2858 3562 gene locus_tag LOCUS_14240 2858 3562 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_14240 3718 5379 gene locus_tag LOCUS_14250 gene glnS 3718 5379 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_14250 5888 5469 gene locus_tag LOCUS_14260 5888 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6208 5888 gene locus_tag LOCUS_14270 6208 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6648 7514 gene locus_tag LOCUS_14280 6648 7514 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence180 175 5 gene locus_tag LOCUS_14290 175 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 519 5375 gene locus_tag LOCUS_14300 519 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 7588 5456 gene locus_tag LOCUS_14310 7588 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence181 231 1304 gene locus_tag LOCUS_14320 gene aroB 231 1304 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_14320 1565 2998 gene locus_tag LOCUS_14330 1565 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2999 3448 gene locus_tag LOCUS_14340 2999 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4823 3630 gene locus_tag LOCUS_14350 4823 3630 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FW28 protein_id gnl|my_center|LOCUS_14350 4932 6188 gene locus_tag LOCUS_14360 gene metK 4932 6188 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_14360 7219 6398 gene locus_tag LOCUS_14370 7219 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence182 <1 2283 gene locus_tag LOCUS_14380 <1 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein 2398 3297 gene locus_tag LOCUS_14390 2398 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5839 3425 gene locus_tag LOCUS_14400 5839 3425 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942995.1 protein_id gnl|my_center|LOCUS_14400 6108 7283 gene locus_tag LOCUS_14410 6108 7283 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405081.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence183 259 186 gene locus_tag LOCUS_t00120 259 186 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 301 1854 gene locus_tag LOCUS_14420 301 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2875 1940 gene locus_tag LOCUS_14430 gene ydjE 2875 1940 CDS product putative sugar kinase YdjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34768 protein_id gnl|my_center|LOCUS_14430 2977 4644 gene locus_tag LOCUS_14440 2977 4644 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218596.1 protein_id gnl|my_center|LOCUS_14440 5224 4727 gene locus_tag LOCUS_14450 5224 4727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763232.1 protein_id gnl|my_center|LOCUS_14450 7292 5208 gene locus_tag LOCUS_14460 7292 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence184 66 1556 gene locus_tag LOCUS_14470 gene rpoN 66 1556 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_14470 1755 2576 gene locus_tag LOCUS_14480 gene panB 1755 2576 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_14480 2677 3696 gene locus_tag LOCUS_14490 2677 3696 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_14490 3704 5095 gene locus_tag LOCUS_14500 gene pepA 3704 5095 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJQ9 protein_id gnl|my_center|LOCUS_14500 5312 6544 gene locus_tag LOCUS_14510 5312 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence185 3752 3012 gene locus_tag LOCUS_14520 3752 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4285 3749 gene locus_tag LOCUS_14530 4285 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4614 5501 gene locus_tag LOCUS_14540 4614 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_14540 5677 6831 gene locus_tag LOCUS_14550 5677 6831 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence186 1113 442 gene locus_tag LOCUS_14560 gene yceI 1113 442 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_14560 2735 1314 gene locus_tag LOCUS_14570 gene gndA 2735 1314 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_14570 4441 2849 gene locus_tag LOCUS_14580 4441 2849 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_14580 6027 4789 gene locus_tag LOCUS_14590 6027 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence187 2453 1908 gene locus_tag LOCUS_14600 2453 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2616 2984 gene locus_tag LOCUS_14610 2616 2984 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_14610 3045 3842 gene locus_tag LOCUS_14620 3045 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4157 6364 gene locus_tag LOCUS_14630 4157 6364 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_14630 6545 7324 gene locus_tag LOCUS_14640 6545 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259457.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence188 <1 1029 gene locus_tag LOCUS_14650 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004666649.1:integrase 1147 1884 gene locus_tag LOCUS_14660 1147 1884 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_14660 2896 2222 gene locus_tag LOCUS_14670 2896 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4109 3345 gene locus_tag LOCUS_14680 4109 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5743 4199 gene locus_tag LOCUS_14690 5743 4199 CDS product putative transposase y4bL/y4kJ/y4tB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55379 protein_id gnl|my_center|LOCUS_14690 5898 7382 gene locus_tag LOCUS_14700 5898 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence189 1967 327 gene locus_tag LOCUS_14710 1967 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5217 2065 gene locus_tag LOCUS_14720 5217 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_14720 5466 6095 gene locus_tag LOCUS_14730 gene yceI 5466 6095 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_14730 6718 6227 gene locus_tag LOCUS_14740 6718 6227 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_14740 7318 6722 gene locus_tag LOCUS_14750 7318 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence190 521 757 gene locus_tag LOCUS_14760 521 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 779 1288 gene locus_tag LOCUS_14770 779 1288 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_14770 2258 1320 gene locus_tag LOCUS_14780 2258 1320 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119904.1 protein_id gnl|my_center|LOCUS_14780 2380 3165 gene locus_tag LOCUS_14790 2380 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4325 3162 gene locus_tag LOCUS_14800 4325 3162 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_14800 5433 4318 gene locus_tag LOCUS_14810 5433 4318 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 protein_id gnl|my_center|LOCUS_14810 6201 5464 gene locus_tag LOCUS_14820 6201 5464 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_14820 7043 6237 gene locus_tag LOCUS_14830 gene troA 7043 6237 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence191 >Feature sequence192 2356 1133 gene locus_tag LOCUS_14840 2356 1133 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_14840 4946 2538 gene locus_tag LOCUS_14850 4946 2538 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_14850 6155 5052 gene locus_tag LOCUS_14860 6155 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 7477 6533 gene locus_tag LOCUS_14870 7477 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence193 248 1561 gene locus_tag LOCUS_14880 gene murA 248 1561 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A681 protein_id gnl|my_center|LOCUS_14880 3760 1745 gene locus_tag LOCUS_14890 3760 1745 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404049.1 protein_id gnl|my_center|LOCUS_14890 4768 3962 gene locus_tag LOCUS_14900 4768 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5196 4867 gene locus_tag LOCUS_14910 5196 4867 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_14910 <7451 5346 gene locus_tag LOCUS_14920 <7451 5346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963704.1:DNA translocase FtsK >Feature sequence194 1209 454 gene locus_tag LOCUS_14930 1209 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2993 1284 gene locus_tag LOCUS_14940 2993 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3560 3165 gene locus_tag LOCUS_14950 3560 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5708 3663 gene locus_tag LOCUS_14960 gene ptrB 5708 3663 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_14960 5850 6980 gene locus_tag LOCUS_14970 5850 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence195 2 331 gene locus_tag LOCUS_14980 2 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 444 2900 gene locus_tag LOCUS_14990 444 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3576 3112 gene locus_tag LOCUS_15000 3576 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3753 4679 gene locus_tag LOCUS_15010 3753 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_15010 4679 4984 gene locus_tag LOCUS_15020 4679 4984 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_15020 5938 5069 gene locus_tag LOCUS_15030 gene ubiA 5938 5069 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_15030 6792 5938 gene locus_tag LOCUS_15040 6792 5938 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence196 531 1553 gene locus_tag LOCUS_15050 531 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1659 3611 gene locus_tag LOCUS_15060 1659 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3741 4334 gene locus_tag LOCUS_15070 3741 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4437 5387 gene locus_tag LOCUS_15080 gene astE 4437 5387 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XDZ0 protein_id gnl|my_center|LOCUS_15080 5391 5972 gene locus_tag LOCUS_15090 gene nadD 5391 5972 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_15090 >Feature sequence197 1607 2413 gene locus_tag LOCUS_15100 1607 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2535 2975 gene locus_tag LOCUS_15110 2535 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2965 4209 gene locus_tag LOCUS_15120 gene ald 2965 4209 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_15120 4481 5917 gene locus_tag LOCUS_15130 4481 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6019 6705 gene locus_tag LOCUS_15140 6019 6705 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259246.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence198 2 1210 gene locus_tag LOCUS_15150 2 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2617 1406 gene locus_tag LOCUS_15160 2617 1406 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228257.1 protein_id gnl|my_center|LOCUS_15160 3044 3694 gene locus_tag LOCUS_15170 3044 3694 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_15170 3685 5352 gene locus_tag LOCUS_15180 gene treA 3685 5352 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I165 protein_id gnl|my_center|LOCUS_15180 <7355 5693 gene locus_tag LOCUS_15190 <7355 5693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119973.1:sodium/glucose cotransporter >Feature sequence199 326 1660 gene locus_tag LOCUS_15200 gene lysC 326 1660 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_15200 2242 1811 gene locus_tag LOCUS_15210 2242 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3818 2661 gene locus_tag LOCUS_15220 gene dnaJ 3818 2661 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_15220 4573 3923 gene locus_tag LOCUS_15230 gene grpE 4573 3923 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_15230 4745 5581 gene locus_tag LOCUS_15240 4745 5581 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_15240 6321 5578 gene locus_tag LOCUS_15250 6321 5578 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_15250 6390 6881 gene locus_tag LOCUS_15260 6390 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338413.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence200 555 64 gene locus_tag LOCUS_15270 555 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1371 571 gene locus_tag LOCUS_15280 1371 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_15280 2322 1483 gene locus_tag LOCUS_15290 2322 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2952 2374 gene locus_tag LOCUS_15300 2952 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3399 4922 gene locus_tag LOCUS_15310 gene crtI 3399 4922 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_15310 4915 5751 gene locus_tag LOCUS_15320 gene crtB 4915 5751 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_15320 5875 6573 gene locus_tag LOCUS_15330 5875 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence201 4445 771 gene locus_tag LOCUS_15340 4445 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4899 5918 gene locus_tag LOCUS_15350 4899 5918 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_15350 7185 6007 gene locus_tag LOCUS_15360 7185 6007 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence202 259 2145 gene locus_tag LOCUS_15370 gene treZ 259 2145 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AJ6 protein_id gnl|my_center|LOCUS_15370 2145 4373 gene locus_tag LOCUS_15380 2145 4373 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096570.1 protein_id gnl|my_center|LOCUS_15380 4537 6186 gene locus_tag LOCUS_15390 4537 6186 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_15390 7100 6312 gene locus_tag LOCUS_15400 7100 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence203 950 258 gene locus_tag LOCUS_15410 950 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2100 1246 gene locus_tag LOCUS_15420 2100 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3161 2313 gene locus_tag LOCUS_15430 3161 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3355 4269 gene locus_tag LOCUS_15440 gene natA 3355 4269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_15440 4437 5768 gene locus_tag LOCUS_15450 gene natB 4437 5768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_15450 6380 6186 gene locus_tag LOCUS_15460 6380 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6585 6382 gene locus_tag LOCUS_15470 6585 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence204 518 1297 gene locus_tag LOCUS_15480 gene crt 518 1297 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_15480 1458 2489 gene locus_tag LOCUS_15490 gene fjo19 1458 2489 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_15490 2495 3409 gene locus_tag LOCUS_15500 2495 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3613 4134 gene locus_tag LOCUS_15510 gene ribH 3613 4134 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_15510 5148 4324 gene locus_tag LOCUS_15520 5148 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 5196 5822 gene locus_tag LOCUS_15530 5196 5822 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593893.1 protein_id gnl|my_center|LOCUS_15530 5819 7084 gene locus_tag LOCUS_15540 5819 7084 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence205 552 145 gene locus_tag LOCUS_15550 552 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 912 553 gene locus_tag LOCUS_15560 912 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2290 1241 gene locus_tag LOCUS_15570 2290 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5212 2615 gene locus_tag LOCUS_15580 5212 2615 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403616.1 protein_id gnl|my_center|LOCUS_15580 5669 6868 gene locus_tag LOCUS_15590 5669 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 6956 7180 gene locus_tag LOCUS_15600 6956 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence206 2077 1637 gene locus_tag LOCUS_15610 2077 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2734 2096 gene locus_tag LOCUS_15620 2734 2096 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_15620 2959 4677 gene locus_tag LOCUS_15630 2959 4677 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_15630 5399 4674 gene locus_tag LOCUS_15640 5399 4674 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V2 protein_id gnl|my_center|LOCUS_15640 5633 6082 gene locus_tag LOCUS_15650 5633 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6116 7201 gene locus_tag LOCUS_15660 6116 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence207 <1 1174 gene locus_tag LOCUS_15670 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:alpha/beta hydrolase 2062 1259 gene locus_tag LOCUS_15680 2062 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2265 2062 gene locus_tag LOCUS_15690 2265 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2947 2567 gene locus_tag LOCUS_15700 2947 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3603 2935 gene locus_tag LOCUS_15710 3603 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4284 3829 gene locus_tag LOCUS_15720 4284 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5878 4331 gene locus_tag LOCUS_15730 5878 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence208 234 590 gene locus_tag LOCUS_15740 234 590 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_15740 1428 664 gene locus_tag LOCUS_15750 gene sdhB 1428 664 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_15750 3463 1535 gene locus_tag LOCUS_15760 gene sdhA 3463 1535 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933916.1 protein_id gnl|my_center|LOCUS_15760 4294 3572 gene locus_tag LOCUS_15770 gene sdhC 4294 3572 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_15770 4498 4956 gene locus_tag LOCUS_15780 4498 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5758 5258 gene locus_tag LOCUS_15790 5758 5258 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496869.1 protein_id gnl|my_center|LOCUS_15790 6406 5807 gene locus_tag LOCUS_15800 6406 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 <7264 6525 gene locus_tag LOCUS_15810 <7264 6525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64QU2:60 kDa chaperonin >Feature sequence209 529 738 gene locus_tag LOCUS_15820 529 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 864 1568 gene locus_tag LOCUS_15830 864 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1619 2116 gene locus_tag LOCUS_15840 1619 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2132 3373 gene locus_tag LOCUS_15850 2132 3373 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_15850 4477 3302 gene locus_tag LOCUS_15860 4477 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 5070 4525 gene locus_tag LOCUS_15870 5070 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5140 5847 gene locus_tag LOCUS_15880 5140 5847 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_15880 5989 7239 gene locus_tag LOCUS_15890 gene putA 5989 7239 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence210 2263 221 gene locus_tag LOCUS_15900 2263 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3803 2328 gene locus_tag LOCUS_15910 gene gatB 3803 2328 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AV5 protein_id gnl|my_center|LOCUS_15910 4219 3956 gene locus_tag LOCUS_15920 4219 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5627 4446 gene locus_tag LOCUS_15930 gene porR 5627 4446 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_15930 5890 6852 gene locus_tag LOCUS_15940 gene purC 5890 6852 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_15940 7234 7052 gene locus_tag LOCUS_15950 7234 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence211 4324 149 gene locus_tag LOCUS_15960 4324 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6544 5504 gene locus_tag LOCUS_15970 6544 5504 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence212 <1 697 gene locus_tag LOCUS_15980 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763546.1:cell envelope biogenesis protein TonB 939 7043 gene locus_tag LOCUS_15990 939 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence213 4199 3588 gene locus_tag LOCUS_16000 4199 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_16000 5622 4390 gene locus_tag LOCUS_16010 5622 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5894 6655 gene locus_tag LOCUS_16020 5894 6655 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence214 624 160 gene locus_tag LOCUS_16030 624 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 854 1939 gene locus_tag LOCUS_16040 854 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5685 2098 gene locus_tag LOCUS_16050 gene dnaE 5685 2098 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_16050 5967 6494 gene locus_tag LOCUS_16060 5967 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence215 294 1721 gene locus_tag LOCUS_16070 294 1721 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_16070 2946 1864 gene locus_tag LOCUS_16080 2946 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3310 4164 gene locus_tag LOCUS_16090 3310 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_16090 4249 6405 gene locus_tag LOCUS_16100 gene yyaL 4249 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37512 protein_id gnl|my_center|LOCUS_16100 >Feature sequence216 2095 2859 gene locus_tag LOCUS_16110 2095 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2997 4271 gene locus_tag LOCUS_16120 gene proA 2997 4271 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE9 protein_id gnl|my_center|LOCUS_16120 5394 4786 gene locus_tag LOCUS_16130 5394 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_16130 6476 5679 gene locus_tag LOCUS_16140 6476 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence217 <1 2364 gene locus_tag LOCUS_16150 <1 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MI38:DNA helicase 2364 2933 gene locus_tag LOCUS_16160 2364 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2993 3679 gene locus_tag LOCUS_16170 2993 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4151 3873 gene locus_tag LOCUS_16180 4151 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4275 4895 gene locus_tag LOCUS_16190 4275 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4892 5383 gene locus_tag LOCUS_16200 4892 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5386 6306 gene locus_tag LOCUS_16210 5386 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6856 6263 gene locus_tag LOCUS_16220 6856 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence218 1 1362 gene locus_tag LOCUS_16230 1 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1657 2127 gene locus_tag LOCUS_16240 gene rimP 1657 2127 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJX5 protein_id gnl|my_center|LOCUS_16240 2131 3366 gene locus_tag LOCUS_16250 gene nusA 2131 3366 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_16250 4511 6631 gene locus_tag LOCUS_16260 4511 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence219 1660 287 gene locus_tag LOCUS_16270 1660 287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_16270 2426 1641 gene locus_tag LOCUS_16280 gene coaX 2426 1641 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_16280 4140 2614 gene locus_tag LOCUS_16290 gene purH 4140 2614 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_16290 5360 4458 gene locus_tag LOCUS_16300 5360 4458 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919885.1 protein_id gnl|my_center|LOCUS_16300 <7056 5433 gene locus_tag LOCUS_16310 <7056 5433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786690.1:ABC-F family ATPase >Feature sequence220 1649 333 gene locus_tag LOCUS_16320 1649 333 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_16320 2001 4799 gene locus_tag LOCUS_16330 2001 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4813 6444 gene locus_tag LOCUS_16340 4813 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_16340 6540 6767 gene locus_tag LOCUS_16350 6540 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence221 2598 2068 gene locus_tag LOCUS_16360 2598 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404141.1 protein_id gnl|my_center|LOCUS_16360 2735 3367 gene locus_tag LOCUS_16370 2735 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4021 4392 gene locus_tag LOCUS_16380 4021 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 5437 4658 gene locus_tag LOCUS_16390 5437 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5585 6085 gene locus_tag LOCUS_16400 5585 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence222 794 402 gene locus_tag LOCUS_16410 794 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3905 987 gene locus_tag LOCUS_16420 3905 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6419 4086 gene locus_tag LOCUS_16430 6419 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence223 550 3219 gene locus_tag LOCUS_16440 550 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4049 3216 gene locus_tag LOCUS_16450 4049 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5269 4181 gene locus_tag LOCUS_16460 5269 4181 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_16460 6733 5513 gene locus_tag LOCUS_16470 6733 5513 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966332.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence224 468 1958 gene locus_tag LOCUS_16480 468 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2210 3568 gene locus_tag LOCUS_16490 2210 3568 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_16490 4303 3668 gene locus_tag LOCUS_16500 4303 3668 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_16500 4585 6147 gene locus_tag LOCUS_16510 4585 6147 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_16510 6837 6256 gene locus_tag LOCUS_16520 6837 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence225 1456 3105 gene locus_tag LOCUS_16530 1456 3105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_16530 3098 4477 gene locus_tag LOCUS_16540 3098 4477 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_16540 4678 6138 gene locus_tag LOCUS_16550 4678 6138 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_16550 6296 6724 gene locus_tag LOCUS_16560 6296 6724 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence226 <1 788 gene locus_tag LOCUS_16570 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887610.1:GMC oxidoreductase 1502 921 gene locus_tag LOCUS_16580 1502 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1774 3705 gene locus_tag LOCUS_16590 1774 3705 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_16590 4608 3841 gene locus_tag LOCUS_16600 gene scpA 4608 3841 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_16600 5132 4611 gene locus_tag LOCUS_16610 5132 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_16610 6114 5275 gene locus_tag LOCUS_16620 6114 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_16620 6404 6330 gene locus_tag LOCUS_t00130 6404 6330 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6579 6504 gene locus_tag LOCUS_t00140 6579 6504 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6678 6605 gene locus_tag LOCUS_t00150 6678 6605 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence227 1062 379 gene locus_tag LOCUS_16630 1062 379 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_16630 1573 1142 gene locus_tag LOCUS_16640 1573 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1779 4211 gene locus_tag LOCUS_16650 1779 4211 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_16650 4625 4335 gene locus_tag LOCUS_16660 4625 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897856.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence228 142 2667 gene locus_tag LOCUS_16670 gene mrcA 142 2667 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_16670 2832 3440 gene locus_tag LOCUS_16680 2832 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3560 4225 gene locus_tag LOCUS_16690 gene rsmI 3560 4225 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_16690 4309 4956 gene locus_tag LOCUS_16700 4309 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 5318 4908 gene locus_tag LOCUS_16710 5318 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_16710 5574 6107 gene locus_tag LOCUS_16720 5574 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 6176 6781 gene locus_tag LOCUS_16730 6176 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence229 177 1490 gene locus_tag LOCUS_16740 gene xylA 177 1490 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_16740 2598 1714 gene locus_tag LOCUS_16750 gene rlmF 2598 1714 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV5 protein_id gnl|my_center|LOCUS_16750 2670 3134 gene locus_tag LOCUS_16760 2670 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4459 3110 gene locus_tag LOCUS_16770 gene rmuC 4459 3110 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_16770 4857 6758 gene locus_tag LOCUS_16780 4857 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence230 >Feature sequence231 <1 1081 gene locus_tag LOCUS_16790 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001131758.1:gluconate transporter 1140 1916 gene locus_tag LOCUS_16800 1140 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2303 3256 gene locus_tag LOCUS_16810 2303 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence232 181 465 gene locus_tag LOCUS_16820 181 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 444 776 gene locus_tag LOCUS_16830 444 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 906 1190 gene locus_tag LOCUS_16840 906 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1169 1507 gene locus_tag LOCUS_16850 1169 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1520 2011 gene locus_tag LOCUS_16860 1520 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531769.1 protein_id gnl|my_center|LOCUS_16860 2018 3076 gene locus_tag LOCUS_16870 gene hisC 2018 3076 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_16870 3139 4275 gene locus_tag LOCUS_16880 gene hisB 3139 4275 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_16880 4386 4976 gene locus_tag LOCUS_16890 gene hisH 4386 4976 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RT0 protein_id gnl|my_center|LOCUS_16890 5402 4977 gene locus_tag LOCUS_16900 5402 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5590 5399 gene locus_tag LOCUS_16910 5590 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence233 1644 3056 gene locus_tag LOCUS_16920 1644 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3571 3798 gene locus_tag LOCUS_16930 3571 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4220 3807 gene locus_tag LOCUS_16940 4220 3807 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR1 protein_id gnl|my_center|LOCUS_16940 4675 6036 gene locus_tag LOCUS_16950 4675 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_16950 <6786 6143 gene locus_tag LOCUS_16960 <6786 6143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L3:inosine-5'-monophosphate dehydrogenase >Feature sequence234 1646 4597 gene locus_tag LOCUS_16970 1646 4597 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_16970 5953 4688 gene locus_tag LOCUS_16980 5953 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6506 6054 gene locus_tag LOCUS_16990 6506 6054 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence235 4703 3720 gene locus_tag LOCUS_17000 4703 3720 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XR4 protein_id gnl|my_center|LOCUS_17000 4772 5788 gene locus_tag LOCUS_17010 4772 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence236 2737 1409 gene locus_tag LOCUS_17020 2737 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3302 2730 gene locus_tag LOCUS_17030 3302 2730 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_17030 3506 4630 gene locus_tag LOCUS_17040 gene xynA 3506 4630 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_17040 >Feature sequence237 <1 865 gene locus_tag LOCUS_17050 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108596.1:sodium:solute symporter 923 2095 gene locus_tag LOCUS_17060 923 2095 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 protein_id gnl|my_center|LOCUS_17060 2214 3347 gene locus_tag LOCUS_17070 2214 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4977 3454 gene locus_tag LOCUS_17080 4977 3454 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_17080 5792 5130 gene locus_tag LOCUS_17090 5792 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6171 5842 gene locus_tag LOCUS_17100 6171 5842 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence238 269 880 gene locus_tag LOCUS_17110 269 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2404 1124 gene locus_tag LOCUS_17120 2404 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_17120 5258 2625 gene locus_tag LOCUS_17130 5258 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence239 408 4640 gene locus_tag LOCUS_17140 408 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4645 6345 gene locus_tag LOCUS_17150 4645 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence240 1534 428 gene locus_tag LOCUS_17160 1534 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_17160 2082 1531 gene locus_tag LOCUS_17170 2082 1531 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_17170 2762 2139 gene locus_tag LOCUS_17180 2762 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2992 6354 gene locus_tag LOCUS_17190 2992 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence241 1165 638 gene locus_tag LOCUS_17200 1165 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence242 1136 384 gene locus_tag LOCUS_17210 1136 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_17210 1561 1241 gene locus_tag LOCUS_17220 1561 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3152 1788 gene locus_tag LOCUS_17230 3152 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3402 5327 gene locus_tag LOCUS_17240 3402 5327 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_17240 5324 6409 gene locus_tag LOCUS_17250 5324 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence243 2217 3326 gene locus_tag LOCUS_17260 2217 3326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_17260 3923 4447 gene locus_tag LOCUS_17270 3923 4447 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_17270 4566 5690 gene locus_tag LOCUS_17280 4566 5690 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_17280 5900 6412 gene locus_tag LOCUS_17290 gene ssb 5900 6412 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66849 protein_id gnl|my_center|LOCUS_17290 >Feature sequence244 1746 2747 gene locus_tag LOCUS_17300 1746 2747 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_17300 2843 3700 gene locus_tag LOCUS_17310 2843 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3707 5173 gene locus_tag LOCUS_17320 3707 5173 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_17320 5971 5336 gene locus_tag LOCUS_17330 5971 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence245 1058 576 gene locus_tag LOCUS_17340 gene lrp 1058 576 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647640.1 protein_id gnl|my_center|LOCUS_17340 2572 1151 gene locus_tag LOCUS_17350 2572 1151 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_17350 2786 2565 gene locus_tag LOCUS_17360 2786 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3110 3496 gene locus_tag LOCUS_17370 3110 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3547 4629 gene locus_tag LOCUS_17380 gene aroC 3547 4629 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_17380 <6556 4760 gene locus_tag LOCUS_17390 <6556 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962266.1:endothelin-converting protein >Feature sequence246 1218 496 gene locus_tag LOCUS_17400 1218 496 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_17400 2336 1302 gene locus_tag LOCUS_17410 gene hemE 2336 1302 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_17410 2576 3487 gene locus_tag LOCUS_17420 gene kduI 2576 3487 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYS8 protein_id gnl|my_center|LOCUS_17420 3497 4264 gene locus_tag LOCUS_17430 3497 4264 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_17430 4581 4354 gene locus_tag LOCUS_17440 4581 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4462 5346 gene locus_tag LOCUS_17450 4462 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 <6553 5441 gene locus_tag LOCUS_17460 <6553 5441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650A0:mannonate dehydratase >Feature sequence247 2688 1066 gene locus_tag LOCUS_17470 2688 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2938 3357 gene locus_tag LOCUS_17480 2938 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3609 3962 gene locus_tag LOCUS_17490 3609 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4022 6304 gene locus_tag LOCUS_17500 gene glgX 4022 6304 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D2 protein_id gnl|my_center|LOCUS_17500 >Feature sequence248 383 823 gene locus_tag LOCUS_17510 383 823 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_17510 900 3173 gene locus_tag LOCUS_17520 900 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3323 4792 gene locus_tag LOCUS_17530 3323 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5969 4767 gene locus_tag LOCUS_17540 5969 4767 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence249 2009 561 gene locus_tag LOCUS_17550 2009 561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_17550 2595 2119 gene locus_tag LOCUS_17560 2595 2119 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_17560 3007 2579 gene locus_tag LOCUS_17570 3007 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2993 3148 gene locus_tag LOCUS_17580 2993 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5226 3145 gene locus_tag LOCUS_17590 gene ppk 5226 3145 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S51 protein_id gnl|my_center|LOCUS_17590 >Feature sequence250 192 830 gene locus_tag LOCUS_17600 192 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1751 858 gene locus_tag LOCUS_17610 1751 858 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_17610 1864 2430 gene locus_tag LOCUS_17620 1864 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5567 2517 gene locus_tag LOCUS_17630 5567 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence251 <1 622 gene locus_tag LOCUS_17640 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406744.1:RNA polymerase sigma factor SigX 634 930 gene locus_tag LOCUS_17650 634 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1036 1884 gene locus_tag LOCUS_17660 1036 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2033 3043 gene locus_tag LOCUS_17670 2033 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_17670 3104 3178 gene locus_tag LOCUS_t00160 3104 3178 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4317 3355 gene locus_tag LOCUS_17680 4317 3355 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_17680 >Feature sequence252 <1 969 gene locus_tag LOCUS_17690 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968596.1:oxidoreductase 2056 1109 gene locus_tag LOCUS_17700 2056 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2327 2800 gene locus_tag LOCUS_17710 2327 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2797 3813 gene locus_tag LOCUS_17720 2797 3813 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_17720 3813 6161 gene locus_tag LOCUS_17730 3813 6161 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036291.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence253 645 839 gene locus_tag LOCUS_17740 gene rpmI 645 839 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55874 protein_id gnl|my_center|LOCUS_17740 1011 1355 gene locus_tag LOCUS_17750 gene rplT 1011 1355 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_17750 2044 1619 gene locus_tag LOCUS_17760 2044 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2511 2230 gene locus_tag LOCUS_17770 2511 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5633 2517 gene locus_tag LOCUS_17780 5633 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5853 6350 gene locus_tag LOCUS_17790 5853 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence254 1763 285 gene locus_tag LOCUS_17800 gene gltD 1763 285 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_17800 6421 1874 gene locus_tag LOCUS_17810 gene gltB 6421 1874 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence255 2367 1033 gene locus_tag LOCUS_17820 2367 1033 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_17820 3368 2430 gene locus_tag LOCUS_17830 gene thrB 3368 2430 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_17830 5827 3368 gene locus_tag LOCUS_17840 gene thrA 5827 3368 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence256 1319 150 gene locus_tag LOCUS_17850 1319 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_17850 2550 1564 gene locus_tag LOCUS_17860 gene pfkA 2550 1564 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_17860 3517 2669 gene locus_tag LOCUS_17870 3517 2669 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_17870 3698 4705 gene locus_tag LOCUS_17880 3698 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 5753 4950 gene locus_tag LOCUS_17890 5753 4950 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302068.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence257 1134 373 gene locus_tag LOCUS_17900 gene rsmA 1134 373 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_17900 1193 2158 gene locus_tag LOCUS_17910 1193 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3003 2266 gene locus_tag LOCUS_17920 3003 2266 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121486.1 protein_id gnl|my_center|LOCUS_17920 3275 3565 gene locus_tag LOCUS_17930 3275 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3594 3833 gene locus_tag LOCUS_17940 3594 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4130 3846 gene locus_tag LOCUS_17950 4130 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence258 364 1785 gene locus_tag LOCUS_17960 364 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1793 2815 gene locus_tag LOCUS_17970 gene pam 1793 2815 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_17970 4112 2859 gene locus_tag LOCUS_17980 4112 2859 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 protein_id gnl|my_center|LOCUS_17980 5831 4299 gene locus_tag LOCUS_17990 5831 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence259 676 1857 gene locus_tag LOCUS_18000 676 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_18000 3526 2129 gene locus_tag LOCUS_18010 3526 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3860 5659 gene locus_tag LOCUS_18020 3860 5659 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence260 373 125 gene locus_tag LOCUS_18030 373 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18030 818 348 gene locus_tag LOCUS_18040 818 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18040 1022 1258 gene locus_tag LOCUS_18050 1022 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1653 3446 gene locus_tag LOCUS_18060 1653 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5440 3911 gene locus_tag LOCUS_18070 5440 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence261 1551 667 gene locus_tag LOCUS_18080 1551 667 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532295.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18080 1731 1561 gene locus_tag LOCUS_18090 1731 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1864 3300 gene locus_tag LOCUS_18100 1864 3300 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084170.1 protein_id gnl|my_center|LOCUS_18100 4977 3412 gene locus_tag LOCUS_18110 4977 3412 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202267.1 protein_id gnl|my_center|LOCUS_18110 5831 5142 gene locus_tag LOCUS_18120 5831 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence262 3323 774 gene locus_tag LOCUS_18130 gene hsdM-1 3323 774 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_18130 4265 3510 gene locus_tag LOCUS_18140 4265 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258579.1 protein_id gnl|my_center|LOCUS_18140 4711 4319 gene locus_tag LOCUS_18150 4711 4319 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_18150 4776 5465 gene locus_tag LOCUS_18160 4776 5465 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence263 1364 42 gene locus_tag LOCUS_18170 1364 42 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_18170 4792 1592 gene locus_tag LOCUS_18180 4792 1592 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967876.1 protein_id gnl|my_center|LOCUS_18180 5959 4802 gene locus_tag LOCUS_18190 5959 4802 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263725.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence264 2197 773 gene locus_tag LOCUS_18200 2197 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2848 2447 gene locus_tag LOCUS_18210 2848 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 3404 2862 gene locus_tag LOCUS_18220 3404 2862 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_18220 4204 3452 gene locus_tag LOCUS_18230 gene lipB 4204 3452 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_18230 5299 4313 gene locus_tag LOCUS_18240 5299 4313 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_18240 <6118 5319 gene locus_tag LOCUS_18250 <6118 5319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036927.1:9-O-acetylesterase >Feature sequence265 480 1511 gene locus_tag LOCUS_18260 480 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1564 2349 gene locus_tag LOCUS_18270 1564 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2893 5445 gene locus_tag LOCUS_18280 2893 5445 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence266 1537 1004 gene locus_tag LOCUS_18290 1537 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_18290 3808 1880 gene locus_tag LOCUS_18300 gene thrS 3808 1880 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_18300 3952 4359 gene locus_tag LOCUS_18310 3952 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5929 4529 gene locus_tag LOCUS_18320 5929 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence267 832 149 gene locus_tag LOCUS_18330 832 149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_18330 1003 1992 gene locus_tag LOCUS_18340 1003 1992 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731488.1 protein_id gnl|my_center|LOCUS_18340 3760 1982 gene locus_tag LOCUS_18350 3760 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4441 5493 gene locus_tag LOCUS_18360 4441 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence268 187 1308 gene locus_tag LOCUS_18370 187 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_18370 1497 2309 gene locus_tag LOCUS_18380 1497 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2433 2930 gene locus_tag LOCUS_18390 2433 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2920 3153 gene locus_tag LOCUS_18400 2920 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3399 5006 gene locus_tag LOCUS_18410 3399 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 6012 5149 gene locus_tag LOCUS_18420 gene fbp 6012 5149 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_18420 >Feature sequence269 2 424 gene locus_tag LOCUS_18430 gene ndk 2 424 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_18430 597 1508 gene locus_tag LOCUS_18440 597 1508 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_18440 2459 1476 gene locus_tag LOCUS_18450 2459 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3840 2470 gene locus_tag LOCUS_18460 3840 2470 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_18460 5293 3833 gene locus_tag LOCUS_18470 gene miaB 5293 3833 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZF8 protein_id gnl|my_center|LOCUS_18470 >Feature sequence270 144 635 gene locus_tag LOCUS_18480 144 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1476 805 gene locus_tag LOCUS_18490 gene trmD 1476 805 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_18490 2026 1544 gene locus_tag LOCUS_18500 2026 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2335 3747 gene locus_tag LOCUS_18510 2335 3747 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_18510 3983 5659 gene locus_tag LOCUS_18520 3983 5659 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence271 2719 3648 gene locus_tag LOCUS_18530 2719 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3880 4506 gene locus_tag LOCUS_18540 3880 4506 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence272 <1 2280 gene locus_tag LOCUS_18550 <1 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 2800 4068 gene locus_tag LOCUS_18560 2800 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4145 4942 gene locus_tag LOCUS_18570 4145 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4935 5648 gene locus_tag LOCUS_18580 4935 5648 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence273 >Feature sequence274 733 260 gene locus_tag LOCUS_18590 gene greA 733 260 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_18590 2014 959 gene locus_tag LOCUS_18600 2014 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence275 1615 401 gene locus_tag LOCUS_18610 1615 401 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_18610 2757 1612 gene locus_tag LOCUS_18620 2757 1612 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942618.1 protein_id gnl|my_center|LOCUS_18620 2979 4100 gene locus_tag LOCUS_18630 2979 4100 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_18630 4097 4795 gene locus_tag LOCUS_18640 4097 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096013.1 protein_id gnl|my_center|LOCUS_18640 4792 5484 gene locus_tag LOCUS_18650 4792 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence276 2511 628 gene locus_tag LOCUS_18660 2511 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence277 <1 723 gene locus_tag LOCUS_18670 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704857.1:polyphosphate glucokinase 938 1963 gene locus_tag LOCUS_18680 938 1963 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_18680 2142 2945 gene locus_tag LOCUS_18690 2142 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3128 4861 gene locus_tag LOCUS_18700 3128 4861 CDS product aerotolerance-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993033.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence278 1750 524 gene locus_tag LOCUS_18710 1750 524 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_18710 1733 1888 gene locus_tag LOCUS_18720 1733 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2113 2871 gene locus_tag LOCUS_18730 2113 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2871 4106 gene locus_tag LOCUS_18740 2871 4106 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_18740 4106 4960 gene locus_tag LOCUS_18750 4106 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5019 5231 gene locus_tag LOCUS_18760 5019 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence279 <1 5610 gene locus_tag LOCUS_18770 <1 5610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA >Feature sequence280 202 867 gene locus_tag LOCUS_18780 202 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 907 3039 gene locus_tag LOCUS_18790 gene metG 907 3039 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_18790 3198 3620 gene locus_tag LOCUS_18800 3198 3620 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_18800 5204 3753 gene locus_tag LOCUS_18810 5204 3753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence281 <1 991 gene locus_tag LOCUS_18820 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:transporter 1229 1633 gene locus_tag LOCUS_18830 1229 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1638 3734 gene locus_tag LOCUS_18840 1638 3734 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBQ0 protein_id gnl|my_center|LOCUS_18840 3748 4092 gene locus_tag LOCUS_18850 3748 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence282 <1 2482 gene locus_tag LOCUS_18860 <1 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964117.1:membrane protein 2753 4042 gene locus_tag LOCUS_18870 gene glyA 2753 4042 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S7 protein_id gnl|my_center|LOCUS_18870 4783 4199 gene locus_tag LOCUS_18880 4783 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807752.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence283 1887 442 gene locus_tag LOCUS_18890 1887 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405359.1 protein_id gnl|my_center|LOCUS_18890 4746 1930 gene locus_tag LOCUS_18900 4746 1930 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405358.1 protein_id gnl|my_center|LOCUS_18900 <5739 5050 gene locus_tag LOCUS_18910 <5739 5050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404427.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence284 617 1627 gene locus_tag LOCUS_18920 617 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2092 1760 gene locus_tag LOCUS_18930 2092 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5119 2357 gene locus_tag LOCUS_18940 5119 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence285 <1 2402 gene locus_tag LOCUS_18950 <1 2402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2G8:ribonuclease R 2579 3091 gene locus_tag LOCUS_18960 2579 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3478 3993 gene locus_tag LOCUS_18970 3478 3993 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_18970 4047 4628 gene locus_tag LOCUS_18980 4047 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 4704 5552 gene locus_tag LOCUS_18990 gene murI 4704 5552 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC9 protein_id gnl|my_center|LOCUS_18990 >Feature sequence286 277 1698 gene locus_tag LOCUS_19000 277 1698 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_19000 2638 1763 gene locus_tag LOCUS_19010 2638 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2722 3120 gene locus_tag LOCUS_19020 2722 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3269 3835 gene locus_tag LOCUS_19030 3269 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3843 4562 gene locus_tag LOCUS_19040 3843 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4552 5721 gene locus_tag LOCUS_19050 4552 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence287 465 3551 gene locus_tag LOCUS_19060 465 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 4227 3688 gene locus_tag LOCUS_19070 4227 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence288 294 641 gene locus_tag LOCUS_19080 gene panD 294 641 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y603 protein_id gnl|my_center|LOCUS_19080 776 1285 gene locus_tag LOCUS_19090 776 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2532 1399 gene locus_tag LOCUS_19100 gene dinP 2532 1399 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_19100 3204 2788 gene locus_tag LOCUS_19110 3204 2788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_19110 3364 4893 gene locus_tag LOCUS_19120 3364 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4974 5600 gene locus_tag LOCUS_19130 4974 5600 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence289 <1 1725 gene locus_tag LOCUS_19140 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405560.1:SusC/RagA family TonB-linked outer membrane protein 1842 3293 gene locus_tag LOCUS_19150 1842 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_19150 3549 4835 gene locus_tag LOCUS_19160 3549 4835 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_19160 4843 5181 gene locus_tag LOCUS_19170 gene csaA 4843 5181 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence290 335 2236 gene locus_tag LOCUS_19180 gene yidC 335 2236 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA76 protein_id gnl|my_center|LOCUS_19180 2429 3304 gene locus_tag LOCUS_19190 2429 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3543 5225 gene locus_tag LOCUS_19200 3543 5225 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence291 <1 1527 gene locus_tag LOCUS_19210 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:transketolase 2036 2112 gene locus_tag LOCUS_t00170 2036 2112 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2465 5413 gene locus_tag LOCUS_19220 2465 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence292 1776 259 gene locus_tag LOCUS_19230 1776 259 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709645.1 protein_id gnl|my_center|LOCUS_19230 3346 1868 gene locus_tag LOCUS_19240 3346 1868 CDS product methanogenesis marker 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_19240 4184 3336 gene locus_tag LOCUS_19250 4184 3336 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223525.1 protein_id gnl|my_center|LOCUS_19250 5455 4361 gene locus_tag LOCUS_19260 5455 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence293 225 4 gene locus_tag LOCUS_19270 225 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 395 1204 gene locus_tag LOCUS_19280 gene mvaB 395 1204 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_19280 2550 1312 gene locus_tag LOCUS_19290 2550 1312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_19290 2843 3472 gene locus_tag LOCUS_19300 2843 3472 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_19300 3868 3479 gene locus_tag LOCUS_19310 3868 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4167 4537 gene locus_tag LOCUS_tm00010 4167 4537 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5348 5175 gene locus_tag LOCUS_19320 5348 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence294 1876 233 gene locus_tag LOCUS_19330 1876 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3055 2144 gene locus_tag LOCUS_19340 3055 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4066 3068 gene locus_tag LOCUS_19350 4066 3068 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_19350 4497 4231 gene locus_tag LOCUS_19360 4497 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence295 >Feature sequence296 1554 955 gene locus_tag LOCUS_19370 1554 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2899 1547 gene locus_tag LOCUS_19380 2899 1547 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_19380 3611 3009 gene locus_tag LOCUS_19390 3611 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 4228 5430 gene locus_tag LOCUS_19400 4228 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence297 <1 751 gene locus_tag LOCUS_19410 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H103:GTPase Der 839 2098 gene locus_tag LOCUS_19420 839 2098 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_19420 2091 2711 gene locus_tag LOCUS_19430 2091 2711 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HD0 protein_id gnl|my_center|LOCUS_19430 2855 4192 gene locus_tag LOCUS_19440 2855 4192 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_19440 5396 4323 gene locus_tag LOCUS_19450 5396 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence298 1739 336 gene locus_tag LOCUS_19460 gene lpdA1 1739 336 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_19460 3293 1962 gene locus_tag LOCUS_19470 3293 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4474 3326 gene locus_tag LOCUS_19480 4474 3326 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_19480 5447 4980 gene locus_tag LOCUS_19490 5447 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence299 3473 933 gene locus_tag LOCUS_19500 3473 933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_19500 4524 3484 gene locus_tag LOCUS_19510 gene gpsA 4524 3484 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 protein_id gnl|my_center|LOCUS_19510 5079 4699 gene locus_tag LOCUS_19520 5079 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence300 1111 2553 gene locus_tag LOCUS_19530 1111 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4059 2671 gene locus_tag LOCUS_19540 gene galA 4059 2671 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 protein_id gnl|my_center|LOCUS_19540 4137 4724 gene locus_tag LOCUS_19550 4137 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence301 459 992 gene locus_tag LOCUS_19560 459 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1179 2450 gene locus_tag LOCUS_19570 1179 2450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_19570 4014 2566 gene locus_tag LOCUS_19580 gene cry 4014 2566 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_19580 5218 4166 gene locus_tag LOCUS_19590 gene des 5218 4166 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34653 protein_id gnl|my_center|LOCUS_19590 >Feature sequence302 884 1834 gene locus_tag LOCUS_19600 884 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2928 1810 gene locus_tag LOCUS_19610 gene rlmG 2928 1810 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSE2 protein_id gnl|my_center|LOCUS_19610 3868 2996 gene locus_tag LOCUS_19620 3868 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4652 3948 gene locus_tag LOCUS_19630 4652 3948 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_19630 <5484 4857 gene locus_tag LOCUS_19640 <5484 4857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250274.1:glycosyl transferase >Feature sequence303 488 1402 gene locus_tag LOCUS_19650 gene xerD 488 1402 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_19650 1907 2896 gene locus_tag LOCUS_19660 1907 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 3123 3050 gene locus_tag LOCUS_t00180 3123 3050 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3468 4901 gene locus_tag LOCUS_19670 gene pykA 3468 4901 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_19670 >Feature sequence304 1220 132 gene locus_tag LOCUS_19680 gene holA 1220 132 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_19680 1554 2780 gene locus_tag LOCUS_19690 1554 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3021 3686 gene locus_tag LOCUS_19700 3021 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4232 3828 gene locus_tag LOCUS_19710 4232 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 <5466 4320 gene locus_tag LOCUS_19720 <5466 4320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963881.1:aspartate aminotransferase family protein >Feature sequence305 257 1675 gene locus_tag LOCUS_19730 257 1675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_19730 1675 1836 gene locus_tag LOCUS_19740 1675 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence306 <1 4339 gene locus_tag LOCUS_19750 <1 4339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence307 <1 900 gene locus_tag LOCUS_19760 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122516.1:peptidylglycine monooxygenase 1066 2148 gene locus_tag LOCUS_19770 1066 2148 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_19770 4576 2303 gene locus_tag LOCUS_19780 gene acn 4576 2303 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_19780 <5441 4802 gene locus_tag LOCUS_19790 <5441 4802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964039.1:coenzyme A pyrophosphatase >Feature sequence308 2725 1478 gene locus_tag LOCUS_19800 2725 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2961 3257 gene locus_tag LOCUS_19810 2961 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 3244 3684 gene locus_tag LOCUS_19820 3244 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3853 4176 gene locus_tag LOCUS_19830 3853 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5358 4225 gene locus_tag LOCUS_19840 5358 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378843.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence309 928 449 gene locus_tag LOCUS_19850 928 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1358 1855 gene locus_tag LOCUS_19860 1358 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3338 1980 gene locus_tag LOCUS_19870 gene purB 3338 1980 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_19870 3353 3874 gene locus_tag LOCUS_19880 3353 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence310 1452 913 gene locus_tag LOCUS_19890 1452 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1663 4500 gene locus_tag LOCUS_19900 gene carB 1663 4500 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_19900 >Feature sequence311 >Feature sequence312 18 1859 gene locus_tag LOCUS_19910 18 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_19910 4465 2000 gene locus_tag LOCUS_19920 4465 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence313 986 27 gene locus_tag LOCUS_19930 gene etfA 986 27 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_19930 1779 1036 gene locus_tag LOCUS_19940 gene etfB 1779 1036 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_19940 2289 2005 gene locus_tag LOCUS_19950 2289 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3652 2522 gene locus_tag LOCUS_19960 3652 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 4222 5043 gene locus_tag LOCUS_19970 4222 5043 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence314 696 1508 gene locus_tag LOCUS_19980 696 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2840 1656 gene locus_tag LOCUS_19990 2840 1656 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_19990 5046 3025 gene locus_tag LOCUS_20000 5046 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence315 <1 607 gene locus_tag LOCUS_20010 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228215.1:MBL fold hydrolase 1218 634 gene locus_tag LOCUS_20020 gene folE 1218 634 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P85 protein_id gnl|my_center|LOCUS_20020 1651 1226 gene locus_tag LOCUS_20030 1651 1226 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_20030 2329 1754 gene locus_tag LOCUS_20040 2329 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2499 2960 gene locus_tag LOCUS_20050 2499 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3517 2957 gene locus_tag LOCUS_20060 3517 2957 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_20060 >Feature sequence316 472 1518 gene locus_tag LOCUS_20070 472 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1775 2215 gene locus_tag LOCUS_20080 1775 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2202 2429 gene locus_tag LOCUS_20090 2202 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2444 2872 gene locus_tag LOCUS_20100 2444 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2869 3714 gene locus_tag LOCUS_20110 2869 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 3975 4325 gene locus_tag LOCUS_20120 3975 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence317 118 2937 gene locus_tag LOCUS_20130 118 2937 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_20130 3026 4678 gene locus_tag LOCUS_20140 3026 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence318 427 2541 gene locus_tag LOCUS_20150 427 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2882 3598 gene locus_tag LOCUS_20160 2882 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 3605 4786 gene locus_tag LOCUS_20170 3605 4786 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence319 1143 616 gene locus_tag LOCUS_20180 1143 616 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_20180 1331 1131 gene locus_tag LOCUS_20190 1331 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 1278 2180 gene locus_tag LOCUS_20200 1278 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3392 2295 gene locus_tag LOCUS_20210 gene mvaD 3392 2295 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_20210 <5292 3564 gene locus_tag LOCUS_20220 <5292 3564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase >Feature sequence320 175 978 gene locus_tag LOCUS_20230 175 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1026 2264 gene locus_tag LOCUS_20240 1026 2264 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_20240 2887 2405 gene locus_tag LOCUS_20250 2887 2405 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837135.1 protein_id gnl|my_center|LOCUS_20250 3812 3000 gene locus_tag LOCUS_20260 3812 3000 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_20260 5138 4005 gene locus_tag LOCUS_20270 gene tgt 5138 4005 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9I0 protein_id gnl|my_center|LOCUS_20270 >Feature sequence321 1636 548 gene locus_tag LOCUS_20280 gene prfB 1636 548 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SP0 protein_id gnl|my_center|LOCUS_20280 2444 1785 gene locus_tag LOCUS_20290 2444 1785 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_20290 3372 2794 gene locus_tag LOCUS_20300 3372 2794 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_20300 3463 3681 gene locus_tag LOCUS_20310 3463 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 4063 3890 gene locus_tag LOCUS_20320 4063 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4390 4202 gene locus_tag LOCUS_20330 gene rpmG 4390 4202 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_20330 4702 4454 gene locus_tag LOCUS_20340 gene rpmB 4702 4454 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY93 protein_id gnl|my_center|LOCUS_20340 4924 4848 gene locus_tag LOCUS_t00190 4924 4848 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence322 3127 3456 gene locus_tag LOCUS_20350 3127 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3519 3911 gene locus_tag LOCUS_20360 3519 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4083 4628 gene locus_tag LOCUS_20370 4083 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5074 4763 gene locus_tag LOCUS_20380 5074 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence323 762 1595 gene locus_tag LOCUS_20390 762 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1994 2617 gene locus_tag LOCUS_20400 1994 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4912 2846 gene locus_tag LOCUS_20410 4912 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence324 192 2048 gene locus_tag LOCUS_20420 192 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 4108 2213 gene locus_tag LOCUS_20430 gene msbA 4108 2213 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_20430 4334 5050 gene locus_tag LOCUS_20440 4334 5050 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence325 1626 2867 gene locus_tag LOCUS_20450 1626 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3018 4181 gene locus_tag LOCUS_20460 gene hmgA 3018 4181 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_20460 4946 4344 gene locus_tag LOCUS_20470 4946 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence326 707 1294 gene locus_tag LOCUS_20480 707 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_20480 1769 1356 gene locus_tag LOCUS_20490 1769 1356 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889423.1 protein_id gnl|my_center|LOCUS_20490 2350 1769 gene locus_tag LOCUS_20500 2350 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_20500 2844 2638 gene locus_tag LOCUS_20510 2844 2638 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_20510 3053 3688 gene locus_tag LOCUS_20520 3053 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4834 3803 gene locus_tag LOCUS_20530 4834 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence327 1510 209 gene locus_tag LOCUS_20540 1510 209 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_20540 2510 1503 gene locus_tag LOCUS_20550 2510 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 2731 3597 gene locus_tag LOCUS_20560 gene mvaK 2731 3597 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence328 72 479 gene locus_tag LOCUS_20570 72 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 557 2212 gene locus_tag LOCUS_20580 557 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2226 3023 gene locus_tag LOCUS_20590 gene dapB 2226 3023 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_20590 3076 3975 gene locus_tag LOCUS_20600 3076 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence329 <1 1229 gene locus_tag LOCUS_20610 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107367.1:transcriptional regulator 1325 2773 gene locus_tag LOCUS_20620 1325 2773 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250416.1 protein_id gnl|my_center|LOCUS_20620 4021 2813 gene locus_tag LOCUS_20630 4021 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence330 322 1014 gene locus_tag LOCUS_20640 322 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2207 1191 gene locus_tag LOCUS_20650 2207 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4723 2429 gene locus_tag LOCUS_20660 4723 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence331 <1 1416 gene locus_tag LOCUS_20670 <1 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004114264.1:ATPase 2883 1501 gene locus_tag LOCUS_20680 2883 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 4316 2895 gene locus_tag LOCUS_20690 gene bfmBB 4316 2895 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_20690 <5166 4487 gene locus_tag LOCUS_20700 <5166 4487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A998:CinA-like protein >Feature sequence332 300 989 gene locus_tag LOCUS_20710 gene pyrH 300 989 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_20710 1220 1765 gene locus_tag LOCUS_20720 1220 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1827 2903 gene locus_tag LOCUS_20730 1827 2903 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_20730 3351 3037 gene locus_tag LOCUS_20740 3351 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4555 3329 gene locus_tag LOCUS_20750 gene recF 4555 3329 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_20750 >Feature sequence333 756 169 gene locus_tag LOCUS_20760 756 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1532 912 gene locus_tag LOCUS_20770 1532 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3927 1657 gene locus_tag LOCUS_20780 gene mrcA 3927 1657 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_20780 <5145 4168 gene locus_tag LOCUS_20790 <5145 4168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K440:beta-glucosidase >Feature sequence334 268 1008 gene locus_tag LOCUS_20800 gene trmB 268 1008 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_20800 2799 1591 gene locus_tag LOCUS_20810 2799 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_20810 3094 4932 gene locus_tag LOCUS_20820 3094 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence335 184 1008 gene locus_tag LOCUS_20830 184 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2070 1033 gene locus_tag LOCUS_20840 2070 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2195 3391 gene locus_tag LOCUS_20850 2195 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 <5139 3616 gene locus_tag LOCUS_20860 <5139 3616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403653.1:mechanosensitive ion channel protein MscS >Feature sequence336 1405 356 gene locus_tag LOCUS_20870 gene dinB2 1405 356 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_20870 1868 1431 gene locus_tag LOCUS_20880 1868 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3117 2128 gene locus_tag LOCUS_20890 3117 2128 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_20890 3961 4038 gene locus_tag LOCUS_t00200 3961 4038 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4641 4366 gene locus_tag LOCUS_20900 gene rpsO 4641 4366 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHN4 protein_id gnl|my_center|LOCUS_20900 >Feature sequence337 2242 1031 gene locus_tag LOCUS_20910 gene hflX 2242 1031 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 protein_id gnl|my_center|LOCUS_20910 3414 2446 gene locus_tag LOCUS_20920 3414 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_20920 4798 3395 gene locus_tag LOCUS_20930 4798 3395 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence338 2545 356 gene locus_tag LOCUS_20940 2545 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2966 3526 gene locus_tag LOCUS_20950 2966 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 4221 4952 gene locus_tag LOCUS_20960 4221 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence339 691 1416 gene locus_tag LOCUS_20970 691 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1624 4806 gene locus_tag LOCUS_20980 1624 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence340 792 2156 gene locus_tag LOCUS_20990 792 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2328 3083 gene locus_tag LOCUS_21000 2328 3083 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_21000 3122 3382 gene locus_tag LOCUS_21010 3122 3382 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_21010 3404 4108 gene locus_tag LOCUS_21020 3404 4108 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_21020 4114 4779 gene locus_tag LOCUS_21030 4114 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence341 <1 508 gene locus_tag LOCUS_21040 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108010.1:ATPase AAA 728 3550 gene locus_tag LOCUS_21050 728 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5030 3774 gene locus_tag LOCUS_21060 5030 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence342 2475 1741 gene locus_tag LOCUS_21070 2475 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3273 2515 gene locus_tag LOCUS_21080 3273 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3905 3333 gene locus_tag LOCUS_21090 3905 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_21090 3985 5028 gene locus_tag LOCUS_21100 3985 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence343 657 1058 gene locus_tag LOCUS_21110 657 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_21110 2405 1203 gene locus_tag LOCUS_21120 2405 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3082 2648 gene locus_tag LOCUS_21130 3082 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 <5098 3275 gene locus_tag LOCUS_21140 <5098 3275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963281.1:peptidase M23 >Feature sequence344 435 755 gene locus_tag LOCUS_21150 435 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1761 943 gene locus_tag LOCUS_21160 1761 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2799 1963 gene locus_tag LOCUS_21170 2799 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4671 2806 gene locus_tag LOCUS_21180 4671 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence345 3766 2549 gene locus_tag LOCUS_21190 gene pgk 3766 2549 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_21190 <5053 4030 gene locus_tag LOCUS_21200 <5053 4030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D4Z2:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence346 4798 374 gene locus_tag LOCUS_21210 4798 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence347 873 94 gene locus_tag LOCUS_21220 873 94 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_21220 1231 2499 gene locus_tag LOCUS_21230 gene purA 1231 2499 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_21230 2508 2933 gene locus_tag LOCUS_21240 2508 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2915 3253 gene locus_tag LOCUS_21250 2915 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4318 3272 gene locus_tag LOCUS_21260 gene thiL 4318 3272 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_21260 <5029 4483 gene locus_tag LOCUS_21270 <5029 4483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583690.1:rhomboid family intramembrane serine protease >Feature sequence348 497 18 gene locus_tag LOCUS_21280 gene mraZ 497 18 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88V75 protein_id gnl|my_center|LOCUS_21280 1762 1154 gene locus_tag LOCUS_21290 1762 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence349 288 1385 gene locus_tag LOCUS_21300 288 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_21300 1387 1845 gene locus_tag LOCUS_21310 1387 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1877 2413 gene locus_tag LOCUS_21320 1877 2413 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351212.1 protein_id gnl|my_center|LOCUS_21320 2506 3846 gene locus_tag LOCUS_21330 gene ffh 2506 3846 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_21330 4092 4814 gene locus_tag LOCUS_21340 4092 4814 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence350 1907 243 gene locus_tag LOCUS_21350 1907 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2960 1944 gene locus_tag LOCUS_21360 2960 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 3529 2957 gene locus_tag LOCUS_21370 3529 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4164 3916 gene locus_tag LOCUS_21380 4164 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4647 4174 gene locus_tag LOCUS_21390 4647 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence351 2068 677 gene locus_tag LOCUS_21400 2068 677 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_21400 3283 2105 gene locus_tag LOCUS_21410 3283 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4673 3342 gene locus_tag LOCUS_21420 4673 3342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764773.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence352 211 864 gene locus_tag LOCUS_21430 211 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence353 764 1882 gene locus_tag LOCUS_21440 764 1882 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480279.1 protein_id gnl|my_center|LOCUS_21440 2160 2011 gene locus_tag LOCUS_21450 2160 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2525 2139 gene locus_tag LOCUS_21460 2525 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 3125 2538 gene locus_tag LOCUS_21470 3125 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 3503 4084 gene locus_tag LOCUS_21480 3503 4084 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence354 787 380 gene locus_tag LOCUS_21490 787 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1071 784 gene locus_tag LOCUS_21500 1071 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1555 1097 gene locus_tag LOCUS_21510 1555 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1730 4000 gene locus_tag LOCUS_21520 1730 4000 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_21520 4148 4564 gene locus_tag LOCUS_21530 4148 4564 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889046.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence355 389 712 gene locus_tag LOCUS_21540 389 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 926 851 gene locus_tag LOCUS_t00210 926 851 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1218 2462 gene locus_tag LOCUS_21550 1218 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2604 4232 gene locus_tag LOCUS_21560 gene pruA 2604 4232 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence356 4378 2591 gene locus_tag LOCUS_21570 4378 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence357 552 3389 gene locus_tag LOCUS_21580 552 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4054 3434 gene locus_tag LOCUS_21590 4054 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 4331 4780 gene locus_tag LOCUS_21600 4331 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence358 783 2234 gene locus_tag LOCUS_21610 gene aslA 783 2234 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_21610 2272 3204 gene locus_tag LOCUS_21620 2272 3204 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_21620 3357 3629 gene locus_tag LOCUS_21630 3357 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4913 4170 gene locus_tag LOCUS_21640 4913 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence359 <1 594 gene locus_tag LOCUS_21650 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RYU8:dephospho-CoA kinase 595 1728 gene locus_tag LOCUS_21660 595 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030365.1 protein_id gnl|my_center|LOCUS_21660 1735 2484 gene locus_tag LOCUS_21670 1735 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence360 1024 461 gene locus_tag LOCUS_21680 1024 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121484.1 protein_id gnl|my_center|LOCUS_21680 2466 1102 gene locus_tag LOCUS_21690 2466 1102 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_21690 2769 3698 gene locus_tag LOCUS_21700 2769 3698 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence361 3860 696 gene locus_tag LOCUS_21710 3860 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4687 4151 gene locus_tag LOCUS_21720 gene ybcL 4687 4151 CDS product kinase inhibitor Raf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence362 1 1368 gene locus_tag LOCUS_21730 1 1368 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_21730 1799 1452 gene locus_tag LOCUS_21740 1799 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1870 2853 gene locus_tag LOCUS_21750 1870 2853 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_21750 2923 3318 gene locus_tag LOCUS_21760 2923 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3677 3423 gene locus_tag LOCUS_21770 3677 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4097 4819 gene locus_tag LOCUS_21780 4097 4819 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_21780 >Feature sequence363 <1 732 gene locus_tag LOCUS_21790 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257684.1:restriction endonuclease 758 1402 gene locus_tag LOCUS_21800 758 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1412 2470 gene locus_tag LOCUS_21810 1412 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_21810 2947 2711 gene locus_tag LOCUS_21820 2947 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2870 4051 gene locus_tag LOCUS_21830 2870 4051 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_21830 4026 4694 gene locus_tag LOCUS_21840 4026 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence364 4508 3309 gene locus_tag LOCUS_21850 4508 3309 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence365 218 1102 gene locus_tag LOCUS_21860 218 1102 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_21860 2906 1110 gene locus_tag LOCUS_21870 2906 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3101 3847 gene locus_tag LOCUS_21880 3101 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence366 <1 2398 gene locus_tag LOCUS_21890 <1 2398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 3432 2515 gene locus_tag LOCUS_21900 3432 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 3457 4437 gene locus_tag LOCUS_21910 3457 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence367 91 1278 gene locus_tag LOCUS_21920 91 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1250 2434 gene locus_tag LOCUS_21930 gene ribBA 1250 2434 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_21930 3509 3883 gene locus_tag LOCUS_21940 3509 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4775 4044 gene locus_tag LOCUS_21950 4775 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence368 658 2430 gene locus_tag LOCUS_21960 gene egl2 658 2430 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H9L4N3 protein_id gnl|my_center|LOCUS_21960 2650 2871 gene locus_tag LOCUS_21970 2650 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2915 4426 gene locus_tag LOCUS_21980 2915 4426 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence369 1110 1760 gene locus_tag LOCUS_21990 1110 1760 CDS product putative iron dependent transcriptional repressor FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703841.1 protein_id gnl|my_center|LOCUS_21990 1955 3487 gene locus_tag LOCUS_22000 1955 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3506 4282 gene locus_tag LOCUS_22010 3506 4282 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186027.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence370 939 79 gene locus_tag LOCUS_22020 gene lgt 939 79 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_22020 2393 999 gene locus_tag LOCUS_22030 2393 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_22030 3400 2402 gene locus_tag LOCUS_22040 gene batA 3400 2402 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_22040 4525 3401 gene locus_tag LOCUS_22050 4525 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence371 1467 214 gene locus_tag LOCUS_22060 1467 214 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_22060 2341 1517 gene locus_tag LOCUS_22070 2341 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2948 2367 gene locus_tag LOCUS_22080 2948 2367 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_22080 3200 3631 gene locus_tag LOCUS_22090 3200 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3672 4106 gene locus_tag LOCUS_22100 3672 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 <4768 4237 gene locus_tag LOCUS_22110 <4768 4237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897004.1:TetR family transcriptional regulator >Feature sequence372 2392 125 gene locus_tag LOCUS_22120 gene pnp 2392 125 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_22120 3027 4475 gene locus_tag LOCUS_22130 3027 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence373 1831 2505 gene locus_tag LOCUS_22140 1831 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2612 3640 gene locus_tag LOCUS_22150 gene ansA 2612 3640 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_22150 4269 3775 gene locus_tag LOCUS_22160 gene recX 4269 3775 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D6 protein_id gnl|my_center|LOCUS_22160 >Feature sequence374 622 1233 gene locus_tag LOCUS_22170 622 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1349 3313 gene locus_tag LOCUS_22180 gene gyrB 1349 3313 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_22180 3396 3653 gene locus_tag LOCUS_22190 3396 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4096 4476 gene locus_tag LOCUS_22200 4096 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence375 1011 2063 gene locus_tag LOCUS_22210 gene pip3 1011 2063 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_22210 2668 2108 gene locus_tag LOCUS_22220 2668 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3306 2827 gene locus_tag LOCUS_22230 gene crtZ 3306 2827 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_22230 <4710 3607 gene locus_tag LOCUS_22240 <4710 3607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404901.1:TonB-dependent receptor >Feature sequence376 <1 1767 gene locus_tag LOCUS_22250 <1 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765424.1:aminopeptidase 2376 1867 gene locus_tag LOCUS_22260 2376 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2713 3204 gene locus_tag LOCUS_22270 2713 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 protein_id gnl|my_center|LOCUS_22270 3758 3210 gene locus_tag LOCUS_22280 3758 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence377 1488 277 gene locus_tag LOCUS_22290 1488 277 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_22290 2071 1577 gene locus_tag LOCUS_22300 2071 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2129 2596 gene locus_tag LOCUS_22310 2129 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229066.1 protein_id gnl|my_center|LOCUS_22310 2764 4290 gene locus_tag LOCUS_22320 2764 4290 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence378 <1 972 gene locus_tag LOCUS_22330 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XQ7:GMP synthase [glutamine-hydrolyzing] 1076 2584 gene locus_tag LOCUS_22340 1076 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 3269 4165 gene locus_tag LOCUS_22350 3269 4165 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence379 101 685 gene locus_tag LOCUS_22360 101 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1418 840 gene locus_tag LOCUS_22370 1418 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1661 3577 gene locus_tag LOCUS_22380 1661 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 <4667 3966 gene locus_tag LOCUS_22390 <4667 3966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962929.1:acetyl-CoA acetyltransferase >Feature sequence380 1546 251 gene locus_tag LOCUS_22400 gene araT1 1546 251 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UN65 protein_id gnl|my_center|LOCUS_22400 1863 3362 gene locus_tag LOCUS_22410 1863 3362 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_22410 4087 3449 gene locus_tag LOCUS_22420 4087 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence381 1515 121 gene locus_tag LOCUS_22430 gene leuC 1515 121 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_22430 4308 1762 gene locus_tag LOCUS_22440 4308 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4323 4511 gene locus_tag LOCUS_22450 4323 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence382 402 674 gene locus_tag LOCUS_22460 402 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 784 1017 gene locus_tag LOCUS_22470 784 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1014 1373 gene locus_tag LOCUS_22480 1014 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1414 2178 gene locus_tag LOCUS_22490 1414 2178 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_22490 2358 3578 gene locus_tag LOCUS_22500 2358 3578 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence383 <1 1965 gene locus_tag LOCUS_22510 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765900.1:cell envelope biogenesis protein OmpA 2177 4357 gene locus_tag LOCUS_22520 2177 4357 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence384 1281 244 gene locus_tag LOCUS_22530 1281 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1548 1958 gene locus_tag LOCUS_22540 gene mscL 1548 1958 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFE0 protein_id gnl|my_center|LOCUS_22540 3058 2039 gene locus_tag LOCUS_22550 3058 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3991 3122 gene locus_tag LOCUS_22560 3991 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence385 2122 764 gene locus_tag LOCUS_22570 2122 764 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S152 protein_id gnl|my_center|LOCUS_22570 2516 3115 gene locus_tag LOCUS_22580 gene recR 2516 3115 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_22580 4385 3291 gene locus_tag LOCUS_22590 4385 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence386 4370 2916 gene locus_tag LOCUS_22600 4370 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence387 1110 343 gene locus_tag LOCUS_22610 1110 343 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_22610 1397 4276 gene locus_tag LOCUS_22620 1397 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence388 997 65 gene locus_tag LOCUS_22630 997 65 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_22630 1204 3813 gene locus_tag LOCUS_22640 1204 3813 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108585.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence389 869 1600 gene locus_tag LOCUS_22650 869 1600 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_22650 2005 2709 gene locus_tag LOCUS_22660 2005 2709 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_22660 2713 4347 gene locus_tag LOCUS_22670 2713 4347 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence390 860 414 gene locus_tag LOCUS_22680 860 414 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 protein_id gnl|my_center|LOCUS_22680 1172 2299 gene locus_tag LOCUS_22690 1172 2299 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067002.1 protein_id gnl|my_center|LOCUS_22690 4308 2425 gene locus_tag LOCUS_22700 4308 2425 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence391 1280 72 gene locus_tag LOCUS_22710 1280 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 4354 1379 gene locus_tag LOCUS_22720 4354 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence392 2804 639 gene locus_tag LOCUS_22730 2804 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 4254 2983 gene locus_tag LOCUS_22740 4254 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence393 817 125 gene locus_tag LOCUS_22750 817 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122422.1 protein_id gnl|my_center|LOCUS_22750 1033 4194 gene locus_tag LOCUS_22760 gene lacZ 1033 4194 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_22760 4198 4317 gene locus_tag LOCUS_22770 4198 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 4552 4337 gene locus_tag LOCUS_22780 4552 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence394 532 915 gene locus_tag LOCUS_22790 532 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 912 1676 gene locus_tag LOCUS_22800 912 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2707 1796 gene locus_tag LOCUS_22810 2707 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120245.1 protein_id gnl|my_center|LOCUS_22810 3065 4237 gene locus_tag LOCUS_22820 3065 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence395 3130 1019 gene locus_tag LOCUS_22830 3130 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 <4512 3334 gene locus_tag LOCUS_22840 <4512 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 >Feature sequence396 1350 325 gene locus_tag LOCUS_22850 1350 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2794 1757 gene locus_tag LOCUS_22860 2794 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107601.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence397 813 1163 gene locus_tag LOCUS_22870 813 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1160 2131 gene locus_tag LOCUS_22880 1160 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 3480 3989 gene locus_tag LOCUS_22890 3480 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence398 575 1786 gene locus_tag LOCUS_22900 575 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2126 2986 gene locus_tag LOCUS_22910 gene tktA 2126 2986 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_22910 3111 4076 gene locus_tag LOCUS_22920 gene tktC 3111 4076 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence399 4045 2954 gene locus_tag LOCUS_22930 4045 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_22930 4187 4363 gene locus_tag LOCUS_22940 4187 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence400 827 657 gene locus_tag LOCUS_22950 827 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 969 1886 gene locus_tag LOCUS_22960 969 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1883 2560 gene locus_tag LOCUS_22970 gene natA 1883 2560 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895282.1 protein_id gnl|my_center|LOCUS_22970 3857 2562 gene locus_tag LOCUS_22980 3857 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence401 260 619 gene locus_tag LOCUS_22990 260 619 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120601.1 protein_id gnl|my_center|LOCUS_22990 2463 835 gene locus_tag LOCUS_23000 2463 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 4076 2631 gene locus_tag LOCUS_23010 4076 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence402 1953 2867 gene locus_tag LOCUS_23020 gene gldA 1953 2867 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_23020 3007 3663 gene locus_tag LOCUS_23030 3007 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3670 4401 gene locus_tag LOCUS_23040 3670 4401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence403 1276 1007 gene locus_tag LOCUS_23050 1276 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1627 1295 gene locus_tag LOCUS_23060 1627 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2059 3348 gene locus_tag LOCUS_23070 gene cysD 2059 3348 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_23070 3783 4256 gene locus_tag LOCUS_23080 3783 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence404 >Feature sequence405 2641 62 gene locus_tag LOCUS_23090 gene gyrA 2641 62 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_23090 3700 3038 gene locus_tag LOCUS_23100 3700 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence406 1859 6 gene locus_tag LOCUS_23110 1859 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4147 1856 gene locus_tag LOCUS_23120 4147 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence407 377 1423 gene locus_tag LOCUS_23130 377 1423 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_23130 1969 3285 gene locus_tag LOCUS_23140 gene ilvA 1969 3285 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGL1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence408 546 1079 gene locus_tag LOCUS_23150 546 1079 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_23150 1279 2163 gene locus_tag LOCUS_23160 1279 2163 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_23160 2163 2978 gene locus_tag LOCUS_23170 2163 2978 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK7 protein_id gnl|my_center|LOCUS_23170 3308 3943 gene locus_tag LOCUS_23180 3308 3943 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence409 1470 2426 gene locus_tag LOCUS_23190 1470 2426 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_23190 2680 3126 gene locus_tag LOCUS_23200 2680 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3041 3526 gene locus_tag LOCUS_23210 3041 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 3783 3532 gene locus_tag LOCUS_23220 3783 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence410 888 565 gene locus_tag LOCUS_23230 888 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3932 2043 gene locus_tag LOCUS_23240 gene htpG 3932 2043 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_23240 >Feature sequence411 747 163 gene locus_tag LOCUS_23250 747 163 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_23250 1339 806 gene locus_tag LOCUS_23260 1339 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1637 2077 gene locus_tag LOCUS_23270 gene rplM 1637 2077 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70974 protein_id gnl|my_center|LOCUS_23270 2292 2681 gene locus_tag LOCUS_23280 gene rplI1 2292 2681 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH8 protein_id gnl|my_center|LOCUS_23280 2834 3580 gene locus_tag LOCUS_23290 gene rpsB 2834 3580 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z4 protein_id gnl|my_center|LOCUS_23290 >Feature sequence412 1205 816 gene locus_tag LOCUS_23300 1205 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1456 2358 gene locus_tag LOCUS_23310 1456 2358 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_23310 2431 2952 gene locus_tag LOCUS_23320 2431 2952 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_23320 3887 3021 gene locus_tag LOCUS_23330 3887 3021 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence413 110 1999 gene locus_tag LOCUS_23340 110 1999 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_23340 2153 2749 gene locus_tag LOCUS_23350 gene gldD 2153 2749 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence414 1556 489 gene locus_tag LOCUS_23360 gene ltaE 1556 489 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_23360 2341 1766 gene locus_tag LOCUS_23370 gene msrA 2341 1766 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_23370 2527 3714 gene locus_tag LOCUS_23380 2527 3714 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_23380 3711 3944 gene locus_tag LOCUS_23390 3711 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence415 913 2106 gene locus_tag LOCUS_23400 913 2106 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_23400 2096 2653 gene locus_tag LOCUS_23410 2096 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 3906 2668 gene locus_tag LOCUS_23420 3906 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence416 <1 1953 gene locus_tag LOCUS_23430 <1 1953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T09:UvrABC system protein B >Feature sequence417 <1 1741 gene locus_tag LOCUS_23440 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107156.1:thiol:disulfide interchange protein DsbD 3246 1873 gene locus_tag LOCUS_23450 3246 1873 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_23450 4257 3517 gene locus_tag LOCUS_23460 gene rprY 4257 3517 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence418 1740 892 gene locus_tag LOCUS_23470 1740 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1816 2193 gene locus_tag LOCUS_23480 1816 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence419 1174 2202 gene locus_tag LOCUS_23490 1174 2202 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_23490 2957 2310 gene locus_tag LOCUS_23500 2957 2310 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_23500 3123 3947 gene locus_tag LOCUS_23510 3123 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4279 4133 gene locus_tag LOCUS_23520 4279 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence420 3288 3674 gene locus_tag LOCUS_23530 3288 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence421 1164 1592 gene locus_tag LOCUS_23540 1164 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1677 2231 gene locus_tag LOCUS_23550 1677 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3154 2333 gene locus_tag LOCUS_23560 3154 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3633 3223 gene locus_tag LOCUS_23570 3633 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 4001 4074 gene locus_tag LOCUS_t00220 4001 4074 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4100 4175 gene locus_tag LOCUS_t00230 4100 4175 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence422 1707 850 gene locus_tag LOCUS_23580 gene accD 1707 850 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_23580 1962 2864 gene locus_tag LOCUS_23590 1962 2864 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_23590 3089 4018 gene locus_tag LOCUS_23600 3089 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence423 1165 560 gene locus_tag LOCUS_23610 gene sodA 1165 560 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_23610 >Feature sequence424 830 1960 gene locus_tag LOCUS_23620 830 1960 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_23620 2080 3477 gene locus_tag LOCUS_23630 gene speA 2080 3477 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_23630 >Feature sequence425 1044 124 gene locus_tag LOCUS_23640 1044 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1378 1061 gene locus_tag LOCUS_23650 1378 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1839 1378 gene locus_tag LOCUS_23660 1839 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1989 2537 gene locus_tag LOCUS_23670 gene aroK 1989 2537 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_23670 2572 3951 gene locus_tag LOCUS_23680 2572 3951 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence426 266 1033 gene locus_tag LOCUS_23690 266 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_23690 1065 1751 gene locus_tag LOCUS_23700 1065 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1866 2603 gene locus_tag LOCUS_23710 1866 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence427 3579 55 gene locus_tag LOCUS_23720 gene pyc 3579 55 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE8 protein_id gnl|my_center|LOCUS_23720 >Feature sequence428 230 144 gene locus_tag LOCUS_t00240 230 144 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 439 1536 gene locus_tag LOCUS_23730 439 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1597 2328 gene locus_tag LOCUS_23740 gene atoD 1597 2328 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_23740 2376 3032 gene locus_tag LOCUS_23750 gene atoA 2376 3032 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_23750 3709 3233 gene locus_tag LOCUS_23760 3709 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence429 462 1457 gene locus_tag LOCUS_23770 462 1457 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028345.1 protein_id gnl|my_center|LOCUS_23770 1607 2374 gene locus_tag LOCUS_23780 1607 2374 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_23780 3583 2444 gene locus_tag LOCUS_23790 3583 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence430 <1 1660 gene locus_tag LOCUS_23800 <1 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator 1735 2148 gene locus_tag LOCUS_23810 1735 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2692 2282 gene locus_tag LOCUS_23820 gene osmC 2692 2282 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_23820 3902 2856 gene locus_tag LOCUS_23830 3902 2856 CDS product moaA/nifB/pqqE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919207.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence431 1171 176 gene locus_tag LOCUS_23840 1171 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence432 627 265 gene locus_tag LOCUS_23850 627 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1508 795 gene locus_tag LOCUS_23860 1508 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2959 1604 gene locus_tag LOCUS_23870 2959 1604 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence433 625 1290 gene locus_tag LOCUS_23880 gene tal 625 1290 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R94 protein_id gnl|my_center|LOCUS_23880 1401 1760 gene locus_tag LOCUS_23890 1401 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1763 2266 gene locus_tag LOCUS_23900 1763 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2368 2895 gene locus_tag LOCUS_23910 2368 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3468 3394 gene locus_tag LOCUS_t00250 3468 3394 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence434 2109 190 gene locus_tag LOCUS_23920 gene acsA 2109 190 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_23920 3827 2325 gene locus_tag LOCUS_23930 gene cry 3827 2325 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence435 1674 943 gene locus_tag LOCUS_23940 gene poxF 1674 943 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639315.2 protein_id gnl|my_center|LOCUS_23940 1928 1686 gene locus_tag LOCUS_23950 1928 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23950 2642 1956 gene locus_tag LOCUS_23960 2642 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23960 >Feature sequence436 >Feature sequence437 1744 2853 gene locus_tag LOCUS_23970 1744 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence438 1219 395 gene locus_tag LOCUS_23980 1219 395 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109194.1 protein_id gnl|my_center|LOCUS_23980 1412 2284 gene locus_tag LOCUS_23990 gene panC 1412 2284 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_23990 3375 2479 gene locus_tag LOCUS_24000 3375 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3534 3701 gene locus_tag LOCUS_24010 3534 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence439 >Feature sequence440 2790 2488 gene locus_tag LOCUS_24020 2790 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence441 <1 2394 gene locus_tag LOCUS_24030 <1 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0E1:tricorn protease 2647 3189 gene locus_tag LOCUS_24040 2647 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3211 3879 gene locus_tag LOCUS_24050 3211 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence442 799 413 gene locus_tag LOCUS_24060 799 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 3386 837 gene locus_tag LOCUS_24070 3386 837 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence443 182 3010 gene locus_tag LOCUS_24080 182 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3093 3926 gene locus_tag LOCUS_24090 3093 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence444 1216 341 gene locus_tag LOCUS_24100 1216 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1525 2418 gene locus_tag LOCUS_24110 1525 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3044 2523 gene locus_tag LOCUS_24120 3044 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 3145 2996 gene locus_tag LOCUS_24130 3145 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 3347 3955 gene locus_tag LOCUS_24140 3347 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence445 2425 2500 gene locus_tag LOCUS_t00260 2425 2500 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence446 125 2074 gene locus_tag LOCUS_24150 125 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2945 2085 gene locus_tag LOCUS_24160 2945 2085 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_24160 3943 3083 gene locus_tag LOCUS_24170 3943 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence447 377 1825 gene locus_tag LOCUS_24180 377 1825 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92U88 protein_id gnl|my_center|LOCUS_24180 1822 2856 gene locus_tag LOCUS_24190 1822 2856 CDS product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_24190 2998 3735 gene locus_tag LOCUS_24200 gene lytT 2998 3735 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814J1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence448 <1 927 gene locus_tag LOCUS_24210 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031087.1:transcriptional regulator 964 1731 gene locus_tag LOCUS_24220 964 1731 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 protein_id gnl|my_center|LOCUS_24220 3613 1847 gene locus_tag LOCUS_24230 3613 1847 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence449 >Feature sequence450 423 3254 gene locus_tag LOCUS_24240 423 3254 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_24240 3922 3407 gene locus_tag LOCUS_24250 3922 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence451 1935 3551 gene locus_tag LOCUS_24260 1935 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3911 3705 gene locus_tag LOCUS_24270 3911 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence452 3548 2142 gene locus_tag LOCUS_24280 3548 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence453 3482 1911 gene locus_tag LOCUS_24290 3482 1911 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence454 <1 735 gene locus_tag LOCUS_24300 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948683.1:peptidase 757 2316 gene locus_tag LOCUS_24310 gene sglT 757 2316 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_24310 <3877 2446 gene locus_tag LOCUS_24320 <3877 2446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876107.1:histidine kinase >Feature sequence455 1120 785 gene locus_tag LOCUS_24330 1120 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2258 1269 gene locus_tag LOCUS_24340 2258 1269 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_24340 2465 3610 gene locus_tag LOCUS_24350 2465 3610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108000.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence456 >Feature sequence457 <3869 1265 gene locus_tag LOCUS_24360 <3869 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence458 346 1368 gene locus_tag LOCUS_24370 346 1368 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_24370 2601 1501 gene locus_tag LOCUS_24380 2601 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence459 3522 1711 gene locus_tag LOCUS_24390 3522 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence460 613 353 gene locus_tag LOCUS_24400 613 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1275 625 gene locus_tag LOCUS_24410 1275 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1623 2318 gene locus_tag LOCUS_24420 1623 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 3605 2427 gene locus_tag LOCUS_24430 gene rnd 3605 2427 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L8 protein_id gnl|my_center|LOCUS_24430 >Feature sequence461 898 125 gene locus_tag LOCUS_24440 898 125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_24440 1202 2755 gene locus_tag LOCUS_24450 1202 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence462 <1 718 gene locus_tag LOCUS_24460 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64QA1:phosphatidate cytidylyltransferase 843 1463 gene locus_tag LOCUS_24470 843 1463 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764620.1 protein_id gnl|my_center|LOCUS_24470 2210 1539 gene locus_tag LOCUS_24480 2210 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24480 2380 3174 gene locus_tag LOCUS_24490 2380 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence463 598 822 gene locus_tag LOCUS_24500 598 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 819 1742 gene locus_tag LOCUS_24510 gene acdS 819 1742 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_24510 2992 1739 gene locus_tag LOCUS_24520 2992 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3652 3032 gene locus_tag LOCUS_24530 3652 3032 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966541.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence464 1384 713 gene locus_tag LOCUS_24540 1384 713 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_24540 3451 1517 gene locus_tag LOCUS_24550 3451 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence465 386 1828 gene locus_tag LOCUS_24560 386 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250828.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence466 <3786 1962 gene locus_tag LOCUS_24570 <3786 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104036.1:glucoamylase >Feature sequence467 2230 2024 gene locus_tag LOCUS_24580 2230 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2338 3156 gene locus_tag LOCUS_24590 2338 3156 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_24590 3682 3230 gene locus_tag LOCUS_24600 3682 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence468 1913 1104 gene locus_tag LOCUS_24610 1913 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2418 2107 gene locus_tag LOCUS_24620 gene hupA 2418 2107 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_24620 2760 3554 gene locus_tag LOCUS_24630 2760 3554 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence469 1084 212 gene locus_tag LOCUS_24640 1084 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2631 1111 gene locus_tag LOCUS_24650 2631 1111 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_24650 3707 2655 gene locus_tag LOCUS_24660 3707 2655 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence470 2048 210 gene locus_tag LOCUS_24670 gene glmS 2048 210 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_24670 3711 2320 gene locus_tag LOCUS_24680 3711 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence471 945 2207 gene locus_tag LOCUS_24690 945 2207 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_24690 2395 3513 gene locus_tag LOCUS_24700 2395 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence472 2711 3616 gene locus_tag LOCUS_24710 2711 3616 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence473 1256 201 gene locus_tag LOCUS_24720 1256 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2296 1286 gene locus_tag LOCUS_24730 2296 1286 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_24730 3075 3545 gene locus_tag LOCUS_24740 3075 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence474 188 643 gene locus_tag LOCUS_24750 188 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1203 778 gene locus_tag LOCUS_24760 1203 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1340 2551 gene locus_tag LOCUS_24770 1340 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2625 3284 gene locus_tag LOCUS_24780 2625 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3407 3727 gene locus_tag LOCUS_24790 gene ogt2 3407 3727 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence475 199 2115 gene locus_tag LOCUS_24800 199 2115 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337464.1 protein_id gnl|my_center|LOCUS_24800 3443 2238 gene locus_tag LOCUS_24810 gene aspC1 3443 2238 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_24810 >Feature sequence476 1416 2330 gene locus_tag LOCUS_24820 gene lipA 1416 2330 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_24820 >Feature sequence477 1071 379 gene locus_tag LOCUS_24830 1071 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1173 3497 gene locus_tag LOCUS_24840 gene mur/alr 1173 3497 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence478 1797 730 gene locus_tag LOCUS_24850 gene ilvK 1797 730 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_24850 1886 2341 gene locus_tag LOCUS_24860 1886 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2417 3160 gene locus_tag LOCUS_24870 2417 3160 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974443.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence479 53 1267 gene locus_tag LOCUS_24880 53 1267 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 protein_id gnl|my_center|LOCUS_24880 1375 3591 gene locus_tag LOCUS_24890 1375 3591 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence480 181 2022 gene locus_tag LOCUS_24900 181 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2271 2996 gene locus_tag LOCUS_24910 2271 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3018 3473 gene locus_tag LOCUS_24920 3018 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence481 <1 557 gene locus_tag LOCUS_24930 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWG7:demethylmenaquinone methyltransferase 602 1270 gene locus_tag LOCUS_24940 602 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2185 1421 gene locus_tag LOCUS_24950 gene tpiA 2185 1421 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_24950 3364 2357 gene locus_tag LOCUS_24960 gene bioB 3364 2357 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_24960 >Feature sequence482 1615 2562 gene locus_tag LOCUS_24970 1615 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence483 934 3021 gene locus_tag LOCUS_24980 934 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_24980 3076 3624 gene locus_tag LOCUS_24990 3076 3624 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence484 1076 348 gene locus_tag LOCUS_25000 1076 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1580 1269 gene locus_tag LOCUS_25010 1580 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 3310 1781 gene locus_tag LOCUS_25020 gene pcd 3310 1781 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence485 <1 556 gene locus_tag LOCUS_25030 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784454.1:5'-nucleotidase 685 1599 gene locus_tag LOCUS_25040 685 1599 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_25040 2025 3470 gene locus_tag LOCUS_25050 gene dnaA 2025 3470 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_25050 >Feature sequence486 209 1495 gene locus_tag LOCUS_25060 209 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1633 2472 gene locus_tag LOCUS_25070 1633 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2483 3037 gene locus_tag LOCUS_25080 2483 3037 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence487 1375 296 gene locus_tag LOCUS_25090 1375 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1701 3305 gene locus_tag LOCUS_25100 1701 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25100 >Feature sequence488 <1 658 gene locus_tag LOCUS_25110 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786305.1:sensor histidine kinase 2546 666 gene locus_tag LOCUS_25120 2546 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence489 400 1698 gene locus_tag LOCUS_25130 gene gcdH 400 1698 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_25130 1871 2101 gene locus_tag LOCUS_25140 1871 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2103 2456 gene locus_tag LOCUS_25150 2103 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2525 3376 gene locus_tag LOCUS_25160 2525 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence490 590 255 gene locus_tag LOCUS_25170 590 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 825 1040 gene locus_tag LOCUS_25180 825 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1296 2252 gene locus_tag LOCUS_25190 1296 2252 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_25190 2270 2905 gene locus_tag LOCUS_25200 gene queE 2270 2905 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC0 protein_id gnl|my_center|LOCUS_25200 >Feature sequence491 215 1174 gene locus_tag LOCUS_25210 215 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703674.1 protein_id gnl|my_center|LOCUS_25210 1449 2084 gene locus_tag LOCUS_25220 1449 2084 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_25220 >Feature sequence492 >Feature sequence493 >Feature sequence494 236 1486 gene locus_tag LOCUS_25230 236 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1575 2582 gene locus_tag LOCUS_25240 1575 2582 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405243.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence495 <1 1777 gene locus_tag LOCUS_25250 <1 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963618.1:TonB-dependent receptor 3133 1892 gene locus_tag LOCUS_25260 3133 1892 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence496 714 277 gene locus_tag LOCUS_25270 714 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 886 2220 gene locus_tag LOCUS_25280 886 2220 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_25280 2232 3557 gene locus_tag LOCUS_25290 2232 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence497 >Feature sequence498 2164 197 gene locus_tag LOCUS_25300 gene parE 2164 197 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_25300 3599 2355 gene locus_tag LOCUS_25310 3599 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence499 2578 1088 gene locus_tag LOCUS_25320 2578 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence500 666 1619 gene locus_tag LOCUS_25330 gene apaH 666 1619 CDS product diadenosine tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_25330 2632 1748 gene locus_tag LOCUS_25340 gene hemC 2632 1748 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA83 protein_id gnl|my_center|LOCUS_25340 2843 2652 gene locus_tag LOCUS_25350 2843 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3414 2836 gene locus_tag LOCUS_25360 3414 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence501 2383 995 gene locus_tag LOCUS_25370 2383 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <3538 2385 gene locus_tag LOCUS_25380 <3538 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963159.1:deoxyribodipyrimidine photo-lyase >Feature sequence502 2517 1048 gene locus_tag LOCUS_25390 2517 1048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_25390 <3520 2567 gene locus_tag LOCUS_25400 <3520 2567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence503 382 504 gene locus_tag LOCUS_25410 382 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 489 1469 gene locus_tag LOCUS_25420 489 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1573 2313 gene locus_tag LOCUS_25430 gene lptB 1573 2313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_25430 2948 2445 gene locus_tag LOCUS_25440 2948 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence504 1106 285 gene locus_tag LOCUS_25450 1106 285 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_25450 1545 2402 gene locus_tag LOCUS_25460 1545 2402 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence505 3313 1352 gene locus_tag LOCUS_25470 3313 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence506 831 1433 gene locus_tag LOCUS_25480 831 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1651 2307 gene locus_tag LOCUS_25490 1651 2307 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254056.1 protein_id gnl|my_center|LOCUS_25490 2571 3356 gene locus_tag LOCUS_25500 2571 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence507 >Feature sequence508 >Feature sequence509 2251 584 gene locus_tag LOCUS_25510 2251 584 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence510 351 2309 gene locus_tag LOCUS_25520 351 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2331 3233 gene locus_tag LOCUS_25530 2331 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence511 1288 230 gene locus_tag LOCUS_25540 gene serC 1288 230 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_25540 1475 2956 gene locus_tag LOCUS_25550 1475 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence512 1687 647 gene locus_tag LOCUS_25560 1687 647 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_25560 1893 3086 gene locus_tag LOCUS_25570 1893 3086 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence513 1786 296 gene locus_tag LOCUS_25580 gene glpK 1786 296 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHZ9 protein_id gnl|my_center|LOCUS_25580 >Feature sequence514 421 2859 gene locus_tag LOCUS_25590 421 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence515 2115 226 gene locus_tag LOCUS_25600 gene purF 2115 226 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_25600 3052 2651 gene locus_tag LOCUS_25610 3052 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence516 174 716 gene locus_tag LOCUS_25620 174 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1778 981 gene locus_tag LOCUS_25630 1778 981 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_25630 2012 2452 gene locus_tag LOCUS_25640 2012 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_25640 <3394 2713 gene locus_tag LOCUS_25650 <3394 2713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204968.1:aminotransferase >Feature sequence517 1 207 gene locus_tag LOCUS_25660 1 207 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_25660 416 1447 gene locus_tag LOCUS_25670 416 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1444 2130 gene locus_tag LOCUS_25680 1444 2130 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_25680 3040 2132 gene locus_tag LOCUS_25690 3040 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence518 1353 526 gene locus_tag LOCUS_25700 1353 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1612 2379 gene locus_tag LOCUS_25710 1612 2379 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_25710 2382 3155 gene locus_tag LOCUS_25720 2382 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence519 327 1346 gene locus_tag LOCUS_25730 327 1346 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_25730 1343 2287 gene locus_tag LOCUS_25740 1343 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2284 3120 gene locus_tag LOCUS_25750 2284 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence520 2831 459 gene locus_tag LOCUS_25760 2831 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence521 584 922 gene locus_tag LOCUS_25770 584 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1176 2720 gene locus_tag LOCUS_25780 gene hsdM 1176 2720 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence522 337 1416 gene locus_tag LOCUS_25790 337 1416 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_25790 1761 1543 gene locus_tag LOCUS_25800 1761 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2012 1755 gene locus_tag LOCUS_25810 2012 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 2290 2469 gene locus_tag LOCUS_25820 2290 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence523 868 1917 gene locus_tag LOCUS_25830 868 1917 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_25830 2293 3351 gene locus_tag LOCUS_25840 2293 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence524 895 1722 gene locus_tag LOCUS_25850 gene gluQ 895 1722 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY0 protein_id gnl|my_center|LOCUS_25850 1913 2236 gene locus_tag LOCUS_25860 1913 2236 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_25860 2633 2313 gene locus_tag LOCUS_25870 2633 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence525 <3347 2828 gene locus_tag LOCUS_25880 <3347 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391836.1:integrase >Feature sequence526 400 2688 gene locus_tag LOCUS_25890 400 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence527 1678 491 gene locus_tag LOCUS_25900 1678 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3049 1787 gene locus_tag LOCUS_25910 3049 1787 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_25910 >Feature sequence528 360 2699 gene locus_tag LOCUS_25920 360 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 3248 2826 gene locus_tag LOCUS_25930 3248 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence529 >Feature sequence530 <1 1617 gene locus_tag LOCUS_25940 <1 1617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64X21:chaperone protein ClpB >Feature sequence531 19 498 gene locus_tag LOCUS_25950 gene mraZ 19 498 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88V75 protein_id gnl|my_center|LOCUS_25950 504 1427 gene locus_tag LOCUS_25960 gene rsmH 504 1427 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_25960 1559 1861 gene locus_tag LOCUS_25970 1559 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence532 944 363 gene locus_tag LOCUS_25980 944 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 1106 2311 gene locus_tag LOCUS_25990 gene sucC 1106 2311 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_25990 3123 2404 gene locus_tag LOCUS_26000 3123 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence533 1472 204 gene locus_tag LOCUS_26010 1472 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2778 1657 gene locus_tag LOCUS_26020 2778 1657 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_26020 3199 2846 gene locus_tag LOCUS_26030 3199 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence534 692 42 gene locus_tag LOCUS_26040 gene psd 692 42 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_26040 1064 1849 gene locus_tag LOCUS_26050 1064 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2940 2374 gene locus_tag LOCUS_26060 2940 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence535 1561 938 gene locus_tag LOCUS_26070 1561 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 3122 1767 gene locus_tag LOCUS_26080 3122 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence536 1601 663 gene locus_tag LOCUS_26090 gene argF' 1601 663 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_26090 1963 1604 gene locus_tag LOCUS_26100 1963 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2202 1960 gene locus_tag LOCUS_26110 2202 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2593 2309 gene locus_tag LOCUS_26120 2593 2309 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709097.1 protein_id gnl|my_center|LOCUS_26120 <3263 2590 gene locus_tag LOCUS_26130 <3263 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762695.1:acetylornithine aminotransferase >Feature sequence537 882 169 gene locus_tag LOCUS_26140 882 169 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_26140 2475 1009 gene locus_tag LOCUS_26150 2475 1009 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence538 <1 607 gene locus_tag LOCUS_26160 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A123:peptidylprolyl isomerase 2681 744 gene locus_tag LOCUS_26170 2681 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 <3245 2678 gene locus_tag LOCUS_26180 <3245 2678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229183.1:hydrolase >Feature sequence539 2199 868 gene locus_tag LOCUS_26190 2199 868 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_26190 <3240 2323 gene locus_tag LOCUS_26200 <3240 2323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964564.1:epimerase >Feature sequence540 1216 521 gene locus_tag LOCUS_26210 1216 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1611 2789 gene locus_tag LOCUS_26220 1611 2789 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence541 >Feature sequence542 2937 2143 gene locus_tag LOCUS_26230 2937 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence543 <3196 242 gene locus_tag LOCUS_26240 <3196 242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase >Feature sequence544 334 885 gene locus_tag LOCUS_26250 334 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1055 2140 gene locus_tag LOCUS_26260 1055 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2363 2656 gene locus_tag LOCUS_26270 2363 2656 CDS product barnase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537736.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence545 853 473 gene locus_tag LOCUS_26280 853 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence546 2895 496 gene locus_tag LOCUS_26290 2895 496 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence547 1913 255 gene locus_tag LOCUS_26300 1913 255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087024.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence548 1000 149 gene locus_tag LOCUS_26310 1000 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1584 1144 gene locus_tag LOCUS_26320 1584 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_26320 2171 1584 gene locus_tag LOCUS_26330 2171 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_26330 <3171 2178 gene locus_tag LOCUS_26340 <3171 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37895:putative GTPase >Feature sequence549 270 1301 gene locus_tag LOCUS_26350 270 1301 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_26350 1671 2762 gene locus_tag LOCUS_26360 gene gnl 1671 2762 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence550 590 2146 gene locus_tag LOCUS_26370 gene porX 590 2146 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_26370 2556 2230 gene locus_tag LOCUS_26380 2556 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2825 2550 gene locus_tag LOCUS_26390 2825 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence551 319 1260 gene locus_tag LOCUS_26400 319 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1542 1712 gene locus_tag LOCUS_26410 1542 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1825 2817 gene locus_tag LOCUS_26420 1825 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence552 >Feature sequence553 <1 840 gene locus_tag LOCUS_26430 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CPL6:endonuclease MutS2 2054 975 gene locus_tag LOCUS_26440 2054 975 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence554 <1 671 gene locus_tag LOCUS_26450 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963126.1:phosphohydrolase 661 1467 gene locus_tag LOCUS_26460 gene fdhD 661 1467 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_26460 3147 1978 gene locus_tag LOCUS_26470 gene mqnC 3147 1978 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727U7 protein_id gnl|my_center|LOCUS_26470 >Feature sequence555 361 1272 gene locus_tag LOCUS_26480 361 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1438 1977 gene locus_tag LOCUS_26490 1438 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3003 2125 gene locus_tag LOCUS_26500 3003 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence556 2680 1361 gene locus_tag LOCUS_26510 2680 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence557 <1 1883 gene locus_tag LOCUS_26520 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403516.1:histidine kinase 1887 2639 gene locus_tag LOCUS_26530 1887 2639 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_26530 2981 2896 gene locus_tag LOCUS_t00270 2981 2896 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence558 783 91 gene locus_tag LOCUS_26540 783 91 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085219.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence559 223 690 gene locus_tag LOCUS_26550 223 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 949 1344 gene locus_tag LOCUS_26560 gene apaG 949 1344 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 protein_id gnl|my_center|LOCUS_26560 2384 1488 gene locus_tag LOCUS_26570 2384 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_26570 <3138 2561 gene locus_tag LOCUS_26580 <3138 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121652.1:cytochrome c >Feature sequence560 506 1636 gene locus_tag LOCUS_26590 gene fahA 506 1636 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405078.1 protein_id gnl|my_center|LOCUS_26590 1728 2693 gene locus_tag LOCUS_26600 1728 2693 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence561 1205 387 gene locus_tag LOCUS_26610 1205 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2350 1355 gene locus_tag LOCUS_26620 2350 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence562 1201 545 gene locus_tag LOCUS_26630 1201 545 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_26630 1405 2223 gene locus_tag LOCUS_26640 1405 2223 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_26640 2419 2506 gene locus_tag LOCUS_t00280 2419 2506 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence563 864 268 gene locus_tag LOCUS_26650 864 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1017 1181 gene locus_tag LOCUS_26660 1017 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1228 1533 gene locus_tag LOCUS_26670 1228 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1792 2985 gene locus_tag LOCUS_26680 1792 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence564 218 147 gene locus_tag LOCUS_t00290 218 147 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1983 415 gene locus_tag LOCUS_26690 1983 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3102 2131 gene locus_tag LOCUS_26700 3102 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence565 266 508 gene locus_tag LOCUS_26710 266 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 571 1212 gene locus_tag LOCUS_26720 571 1212 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707508.1 protein_id gnl|my_center|LOCUS_26720 2159 1302 gene locus_tag LOCUS_26730 2159 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 protein_id gnl|my_center|LOCUS_26730 2845 2138 gene locus_tag LOCUS_26740 2845 2138 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence566 >Feature sequence567 >Feature sequence568 <1 1466 gene locus_tag LOCUS_26750 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121872.1:sodium:solute symporter 1688 2905 gene locus_tag LOCUS_26760 1688 2905 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence569 232 2 gene locus_tag LOCUS_26770 232 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1366 320 gene locus_tag LOCUS_26780 1366 320 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_26780 2792 1353 gene locus_tag LOCUS_26790 gene uxaC 2792 1353 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TY9 protein_id gnl|my_center|LOCUS_26790 >Feature sequence570 1509 307 gene locus_tag LOCUS_26800 1509 307 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_26800 2096 1506 gene locus_tag LOCUS_26810 gene gmhA 2096 1506 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ4 protein_id gnl|my_center|LOCUS_26810 <3070 2348 gene locus_tag LOCUS_26820 <3070 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405119.1:glycosyl transferase >Feature sequence571 >Feature sequence572 637 2553 gene locus_tag LOCUS_26830 637 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence573 1128 2765 gene locus_tag LOCUS_26840 1128 2765 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence574 3036 1213 gene locus_tag LOCUS_26850 gene uvrC 3036 1213 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_26850 >Feature sequence575 38 1189 gene locus_tag LOCUS_26860 38 1189 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_26860 >Feature sequence576 3012 1216 gene locus_tag LOCUS_26870 gene lnt 3012 1216 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_26870 >Feature sequence577 599 201 gene locus_tag LOCUS_26880 599 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 798 2519 gene locus_tag LOCUS_26890 798 2519 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence578 >Feature sequence579 >Feature sequence580 157 699 gene locus_tag LOCUS_26900 157 699 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267269.1 protein_id gnl|my_center|LOCUS_26900 1971 889 gene locus_tag LOCUS_26910 1971 889 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence581 >Feature sequence582 1156 2301 gene locus_tag LOCUS_26920 1156 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence583 >Feature sequence584 731 2086 gene locus_tag LOCUS_26930 731 2086 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_26930 <3007 2120 gene locus_tag LOCUS_26940 <3007 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702332.1:putative formate dehydrogenase, A chain >Feature sequence585 <1 632 gene locus_tag LOCUS_26950 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267786.1:quinoprotein 1868 795 gene locus_tag LOCUS_26960 1868 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2234 2488 gene locus_tag LOCUS_26970 2234 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence586 71 1870 gene locus_tag LOCUS_26980 71 1870 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889509.1 protein_id gnl|my_center|LOCUS_26980 2783 1998 gene locus_tag LOCUS_26990 2783 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence587 <1 573 gene locus_tag LOCUS_27000 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVP3:ferrochelatase >Feature sequence588 704 1186 gene locus_tag LOCUS_27010 704 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1190 2404 gene locus_tag LOCUS_27020 1190 2404 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence589 1916 627 gene locus_tag LOCUS_27030 gene xapH 1916 627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_27030 2755 1931 gene locus_tag LOCUS_27040 2755 1931 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_27040 >Feature sequence590 1471 56 gene locus_tag LOCUS_27050 1471 56 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_27050 1666 2832 gene locus_tag LOCUS_27060 1666 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence591 438 2927 gene locus_tag LOCUS_27070 438 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence592 >Feature sequence593 402 773 gene locus_tag LOCUS_27080 gene rbfA 402 773 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF9 protein_id gnl|my_center|LOCUS_27080 853 1632 gene locus_tag LOCUS_27090 853 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence594 580 2553 gene locus_tag LOCUS_27100 580 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence595 2362 662 gene locus_tag LOCUS_27110 2362 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 2952 2359 gene locus_tag LOCUS_27120 2952 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence596 411 1559 gene locus_tag LOCUS_27130 411 1559 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence597 548 1630 gene locus_tag LOCUS_27140 548 1630 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence598 1735 2493 gene locus_tag LOCUS_27150 1735 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence599 637 188 gene locus_tag LOCUS_27160 637 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 1761 697 gene locus_tag LOCUS_27170 1761 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2402 1800 gene locus_tag LOCUS_27180 gene pnuT 2402 1800 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_27180 <2948 2405 gene locus_tag LOCUS_27190 <2948 2405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZV6:phosphoribosylglycinamide formyltransferase >Feature sequence600 <1 1024 gene locus_tag LOCUS_27200 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV9:ATP synthase subunit beta 1140 1451 gene locus_tag LOCUS_27210 1140 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2494 1691 gene locus_tag LOCUS_27220 2494 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence601 214 615 gene locus_tag LOCUS_27230 214 615 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence602 <1 2334 gene locus_tag LOCUS_27240 <1 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205999.1:type I restriction endonuclease >Feature sequence603 480 2798 gene locus_tag LOCUS_27250 480 2798 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA4 protein_id gnl|my_center|LOCUS_27250 >Feature sequence604 7 2457 gene locus_tag LOCUS_27260 7 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence605 1419 172 gene locus_tag LOCUS_27270 1419 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2443 1430 gene locus_tag LOCUS_27280 2443 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence606 666 286 gene locus_tag LOCUS_27290 666 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_27290 990 1859 gene locus_tag LOCUS_27300 990 1859 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_27300 1981 2508 gene locus_tag LOCUS_27310 1981 2508 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence607 >Feature sequence608 590 363 gene locus_tag LOCUS_27320 590 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123642.1 protein_id gnl|my_center|LOCUS_27320 922 1647 gene locus_tag LOCUS_27330 gene glpF 922 1647 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_27330 1736 2725 gene locus_tag LOCUS_27340 1736 2725 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766897.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence609 1025 414 gene locus_tag LOCUS_27350 1025 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1408 1755 gene locus_tag LOCUS_27360 gene fdx1 1408 1755 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_27360 2533 1835 gene locus_tag LOCUS_27370 2533 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence610 <1 1215 gene locus_tag LOCUS_27380 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA 1681 2319 gene locus_tag LOCUS_27390 gene deoC 1681 2319 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44430 protein_id gnl|my_center|LOCUS_27390 2337 2744 gene locus_tag LOCUS_27400 2337 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence611 488 991 gene locus_tag LOCUS_27410 488 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence612 148 1077 gene locus_tag LOCUS_27420 148 1077 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_27420 1318 2814 gene locus_tag LOCUS_27430 1318 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence613 194 961 gene locus_tag LOCUS_27440 194 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1955 1089 gene locus_tag LOCUS_27450 1955 1089 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_27450 2693 2220 gene locus_tag LOCUS_27460 2693 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence614 1381 377 gene locus_tag LOCUS_27470 1381 377 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_27470 2586 1582 gene locus_tag LOCUS_27480 2586 1582 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence615 <1 1287 gene locus_tag LOCUS_27490 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase 1491 2468 gene locus_tag LOCUS_27500 gene moaA 1491 2468 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL2 protein_id gnl|my_center|LOCUS_27500 >Feature sequence616 <1 522 gene locus_tag LOCUS_27510 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L5:dihydroorotate dehydrogenase (quinone) 787 1461 gene locus_tag LOCUS_27520 787 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence617 809 135 gene locus_tag LOCUS_27530 809 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence618 >Feature sequence619 1821 289 gene locus_tag LOCUS_27540 gene zwf 1821 289 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL52 protein_id gnl|my_center|LOCUS_27540 2015 2458 gene locus_tag LOCUS_27550 gene rpiB 2015 2458 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120716.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence620 2085 496 gene locus_tag LOCUS_27560 2085 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 <2834 2235 gene locus_tag LOCUS_27570 <2834 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963825.1:MFS transporter >Feature sequence621 395 1057 gene locus_tag LOCUS_27580 395 1057 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence622 182 1186 gene locus_tag LOCUS_27590 gene galE 182 1186 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_27590 1580 1302 gene locus_tag LOCUS_27600 1580 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1848 2720 gene locus_tag LOCUS_27610 1848 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_810921.2 protein_id gnl|my_center|LOCUS_27610 >Feature sequence623 259 963 gene locus_tag LOCUS_27620 259 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 967 1842 gene locus_tag LOCUS_27630 967 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 <2828 1910 gene locus_tag LOCUS_27640 <2828 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor >Feature sequence624 1899 427 gene locus_tag LOCUS_27650 1899 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence625 377 1279 gene locus_tag LOCUS_27660 gene miaA 377 1279 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_27660 2563 1361 gene locus_tag LOCUS_27670 2563 1361 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence626 <1 2242 gene locus_tag LOCUS_27680 <1 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein >Feature sequence627 217 1902 gene locus_tag LOCUS_27690 217 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence628 38 532 gene locus_tag LOCUS_27700 38 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 722 2164 gene locus_tag LOCUS_27710 722 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2214 2471 gene locus_tag LOCUS_27720 2214 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence629 1516 392 gene locus_tag LOCUS_27730 gene hppD 1516 392 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_27730 1732 2769 gene locus_tag LOCUS_27740 1732 2769 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028250.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence630 <1 1038 gene locus_tag LOCUS_27750 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202936.1:aminotransferase 1035 1730 gene locus_tag LOCUS_27760 1035 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104776.1 protein_id gnl|my_center|LOCUS_27760 1741 2433 gene locus_tag LOCUS_27770 1741 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence631 >Feature sequence632 >Feature sequence633 <1 710 gene locus_tag LOCUS_27780 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002556922.1:membrane protein 1029 2108 gene locus_tag LOCUS_27790 1029 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence634 <2780 171 gene locus_tag LOCUS_27800 <2780 171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence635 2778 1996 gene locus_tag LOCUS_27810 2778 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence636 1250 558 gene locus_tag LOCUS_27820 1250 558 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRQ0 protein_id gnl|my_center|LOCUS_27820 >Feature sequence637 <1 555 gene locus_tag LOCUS_27830 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775503.1:AraC family transcriptional regulator 1687 716 gene locus_tag LOCUS_27840 1687 716 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence638 253 2451 gene locus_tag LOCUS_27850 253 2451 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence639 >Feature sequence640 705 1571 gene locus_tag LOCUS_27860 705 1571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_27860 1744 2745 gene locus_tag LOCUS_27870 gene ycjY 1744 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243943.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence641 1990 239 gene locus_tag LOCUS_27880 1990 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence642 611 189 gene locus_tag LOCUS_27890 611 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1042 608 gene locus_tag LOCUS_27900 1042 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 1984 1208 gene locus_tag LOCUS_27910 1984 1208 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence643 1950 511 gene locus_tag LOCUS_27920 gene trpE 1950 511 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_27920 <2739 2224 gene locus_tag LOCUS_27930 <2739 2224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A3CR19:arginine--tRNA ligase >Feature sequence644 <1 153 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attccaaaaggaccaattcaagc 962 417 gene locus_tag LOCUS_27940 962 417 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886884.1 protein_id gnl|my_center|LOCUS_27940 1341 2054 gene locus_tag LOCUS_27950 1341 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 <2735 2169 gene locus_tag LOCUS_27960 <2735 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225339.1:monoamine oxidase >Feature sequence645 911 2587 gene locus_tag LOCUS_27970 911 2587 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence646 >Feature sequence647 1040 240 gene locus_tag LOCUS_27980 1040 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 1290 2288 gene locus_tag LOCUS_27990 1290 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122465.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence648 >Feature sequence649 1088 849 gene locus_tag LOCUS_28000 gene acpP 1088 849 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_28000 >Feature sequence650 707 985 gene locus_tag LOCUS_28010 707 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 982 1308 gene locus_tag LOCUS_28020 982 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1727 1431 gene locus_tag LOCUS_28030 1727 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2548 2045 gene locus_tag LOCUS_28040 2548 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28040 >Feature sequence651 1817 555 gene locus_tag LOCUS_28050 gene cysN 1817 555 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_28050 <2704 1918 gene locus_tag LOCUS_28060 <2704 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S508:sulfate adenylyltransferase >Feature sequence652 900 1913 gene locus_tag LOCUS_28070 gene tsaD 900 1913 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_28070 >Feature sequence653 562 194 gene locus_tag LOCUS_28080 562 194 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268409.1 protein_id gnl|my_center|LOCUS_28080 668 1930 gene locus_tag LOCUS_28090 668 1930 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence654 1021 167 gene locus_tag LOCUS_28100 1021 167 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_28100 2182 1031 gene locus_tag LOCUS_28110 2182 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence655 >Feature sequence656 1357 1734 gene locus_tag LOCUS_28120 1357 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2302 1922 gene locus_tag LOCUS_28130 2302 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence657 <1 1368 gene locus_tag LOCUS_28140 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H199:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1358 2623 gene locus_tag LOCUS_28150 gene mraY 1358 2623 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_28150 >Feature sequence658 1617 967 gene locus_tag LOCUS_28160 1617 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1685 2620 gene locus_tag LOCUS_28170 gene serA 1685 2620 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence659 636 487 gene locus_tag LOCUS_28180 636 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence660 <1 2139 gene locus_tag LOCUS_28190 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64R17:UvrABC system protein A >Feature sequence661 1198 668 gene locus_tag LOCUS_28200 1198 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2356 1382 gene locus_tag LOCUS_28210 gene accA 2356 1382 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG09 protein_id gnl|my_center|LOCUS_28210 >Feature sequence662 507 1871 gene locus_tag LOCUS_28220 507 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_28220 2495 2091 gene locus_tag LOCUS_28230 2495 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence663 36 671 gene locus_tag LOCUS_28240 gene pth 36 671 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_28240 <2606 811 gene locus_tag LOCUS_28250 <2606 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919507.1:GMC family oxidoreductase >Feature sequence664 >Feature sequence665 1817 729 gene locus_tag LOCUS_28260 1817 729 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_28260 <2593 2004 gene locus_tag LOCUS_28270 <2593 2004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XYF1:orotate phosphoribosyltransferase >Feature sequence666 2017 1211 gene locus_tag LOCUS_28280 2017 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence667 >Feature sequence668 <1 1089 gene locus_tag LOCUS_28290 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZC2:N5-carboxyaminoimidazole ribonucleotide synthase 2293 1157 gene locus_tag LOCUS_28300 gene purA 2293 1157 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLS1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence669 2242 1064 gene locus_tag LOCUS_28310 2242 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence670 1657 2529 gene locus_tag LOCUS_28320 1657 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence671 983 690 gene locus_tag LOCUS_28330 983 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2052 988 gene locus_tag LOCUS_28340 gene rlmN 2052 988 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_28340 >Feature sequence672 537 172 gene locus_tag LOCUS_28350 537 172 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45083 protein_id gnl|my_center|LOCUS_28350 1829 603 gene locus_tag LOCUS_28360 gene pepT 1829 603 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_28360 >Feature sequence673 832 1917 gene locus_tag LOCUS_28370 832 1917 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence674 <1 945 gene locus_tag LOCUS_28380 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762996.1:thiol:disulfide interchange protein 1005 1556 gene locus_tag LOCUS_28390 1005 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence675 600 1778 gene locus_tag LOCUS_28400 600 1778 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_28400 1795 2388 gene locus_tag LOCUS_28410 1795 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence676 1731 175 gene locus_tag LOCUS_28420 1731 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1985 2323 gene locus_tag LOCUS_28430 gene glnB 1985 2323 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence677 325 1383 gene locus_tag LOCUS_28440 325 1383 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_28440 2387 1611 gene locus_tag LOCUS_28450 2387 1611 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence678 1204 218 gene locus_tag LOCUS_28460 gene hemB 1204 218 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403773.1 protein_id gnl|my_center|LOCUS_28460 2109 1354 gene locus_tag LOCUS_28470 gene hisF 2109 1354 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z6 protein_id gnl|my_center|LOCUS_28470 >Feature sequence679 128 1408 gene locus_tag LOCUS_28480 128 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2497 1580 gene locus_tag LOCUS_28490 2497 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence680 370 2295 gene locus_tag LOCUS_28500 370 2295 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence681 403 1989 gene locus_tag LOCUS_28510 403 1989 CDS product reverse transcriptase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence682 1330 572 gene locus_tag LOCUS_28520 1330 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_28520 2079 1576 gene locus_tag LOCUS_28530 2079 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence683 644 1993 gene locus_tag LOCUS_28540 644 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence684 1980 385 gene locus_tag LOCUS_28550 1980 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence685 3 1481 gene locus_tag LOCUS_28560 3 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2174 1659 gene locus_tag LOCUS_28570 2174 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence686 366 809 gene locus_tag LOCUS_28580 366 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 954 1460 gene locus_tag LOCUS_28590 954 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1609 2148 gene locus_tag LOCUS_28600 1609 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence687 317 147 gene locus_tag LOCUS_28610 317 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 770 330 gene locus_tag LOCUS_28620 770 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1063 770 gene locus_tag LOCUS_28630 1063 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2124 1135 gene locus_tag LOCUS_28640 2124 1135 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence688 1942 95 gene locus_tag LOCUS_28650 1942 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence689 2050 119 gene locus_tag LOCUS_28660 gene glgE 2050 119 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 protein_id gnl|my_center|LOCUS_28660 >Feature sequence690 1485 742 gene locus_tag LOCUS_28670 gene rnc 1485 742 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_28670 <2428 1585 gene locus_tag LOCUS_28680 <2428 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2E7:3-oxoacyl-[acyl-carrier-protein] synthase 2 >Feature sequence691 79 774 gene locus_tag LOCUS_28690 79 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence692 441 31 gene locus_tag LOCUS_28700 441 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 855 1508 gene locus_tag LOCUS_28710 855 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 1725 2210 gene locus_tag LOCUS_28720 1725 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence693 36 299 gene locus_tag LOCUS_28730 36 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 410 922 gene locus_tag LOCUS_28740 gene slyD 410 922 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase SlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNX6 protein_id gnl|my_center|LOCUS_28740 >Feature sequence694 68 141 gene locus_tag LOCUS_t00300 68 141 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1141 254 gene locus_tag LOCUS_28750 1141 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402862.1 protein_id gnl|my_center|LOCUS_28750 1945 1316 gene locus_tag LOCUS_28760 1945 1316 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403872.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence695 364 1386 gene locus_tag LOCUS_28770 gene argC 364 1386 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_28770 >Feature sequence696 987 2132 gene locus_tag LOCUS_28780 987 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence697 1234 2004 gene locus_tag LOCUS_28790 gene argB 1234 2004 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_28790 >Feature sequence698 <1 1227 gene locus_tag LOCUS_28800 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875622.1:restriction endonuclease subunit R 1233 1973 gene locus_tag LOCUS_28810 1233 1973 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_28810 2393 2211 gene locus_tag LOCUS_28820 2393 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence699 1575 211 gene locus_tag LOCUS_28830 1575 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence700 >Feature sequence701 >Feature sequence702 <2363 789 gene locus_tag LOCUS_28840 <2363 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVT6:ferrous iron transport protein B >Feature sequence703 <1 1453 gene locus_tag LOCUS_28850 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107414.1:helicase >Feature sequence704 >Feature sequence705 781 323 gene locus_tag LOCUS_28860 781 323 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_28860 986 2137 gene locus_tag LOCUS_28870 986 2137 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence706 2128 359 gene locus_tag LOCUS_28880 2128 359 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence707 244 1218 gene locus_tag LOCUS_28890 244 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706538.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence708 136 738 gene locus_tag LOCUS_28900 136 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1716 877 gene locus_tag LOCUS_28910 1716 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence709 1893 505 gene locus_tag LOCUS_28920 gene nqrB 1893 505 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_28920 >Feature sequence710 109 738 gene locus_tag LOCUS_28930 109 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence711 519 1751 gene locus_tag LOCUS_28940 gene kynU 519 1751 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_28940 >Feature sequence712 1710 337 gene locus_tag LOCUS_28950 1710 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence713 2002 368 gene locus_tag LOCUS_28960 2002 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence714 2133 397 gene locus_tag LOCUS_28970 2133 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence715 <2304 588 gene locus_tag LOCUS_28980 <2304 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter >Feature sequence716 1875 847 gene locus_tag LOCUS_28990 gene spsE 1875 847 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence717 >Feature sequence718 >Feature sequence719 632 420 gene locus_tag LOCUS_29000 632 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 688 900 gene locus_tag LOCUS_29010 688 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence720 652 1971 gene locus_tag LOCUS_29020 652 1971 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence721 1408 68 gene locus_tag LOCUS_29030 1408 68 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence722 >Feature sequence723 <1 805 gene locus_tag LOCUS_29040 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119473.1:transcriptional regulator 1015 1368 gene locus_tag LOCUS_29050 1015 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2224 1490 gene locus_tag LOCUS_29060 2224 1490 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence724 >Feature sequence725 >Feature sequence726 1989 460 gene locus_tag LOCUS_29070 1989 460 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_29070 >Feature sequence727 >Feature sequence728 494 1696 gene locus_tag LOCUS_29080 gene trpB 494 1696 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence729 384 995 gene locus_tag LOCUS_29090 384 995 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_29090 985 1845 gene locus_tag LOCUS_29100 985 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence730 >Feature sequence731 >Feature sequence732 1502 549 gene locus_tag LOCUS_29110 1502 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 <2198 1602 gene locus_tag LOCUS_29120 <2198 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97N13:dCTP deaminase >Feature sequence733 236 1465 gene locus_tag LOCUS_29130 gene citC 236 1465 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCT9 protein_id gnl|my_center|LOCUS_29130 >Feature sequence734 2008 875 gene locus_tag LOCUS_29140 gene degP 2008 875 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence735 2069 684 gene locus_tag LOCUS_29150 2069 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence736 >Feature sequence737 139 465 gene locus_tag LOCUS_29160 139 465 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence738 582 73 gene locus_tag LOCUS_29170 582 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1758 1204 gene locus_tag LOCUS_29180 1758 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533904.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence739 <1 594 gene locus_tag LOCUS_29190 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117778.1:rhomboid family intramembrane serine protease 742 1839 gene locus_tag LOCUS_29200 gene ychF 742 1839 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_29200 >Feature sequence740 226 567 gene locus_tag LOCUS_29210 226 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 696 878 gene locus_tag LOCUS_29220 696 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence741 <1 736 gene locus_tag LOCUS_29230 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496681.1:uroporphyrinogen-III C-methyltransferase 809 1672 gene locus_tag LOCUS_29240 809 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence742 >Feature sequence743 1409 2005 gene locus_tag LOCUS_29250 gene cysC 1409 2005 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence744 >Feature sequence745 670 329 gene locus_tag LOCUS_29260 670 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 804 1619 gene locus_tag LOCUS_29270 804 1619 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY42 protein_id gnl|my_center|LOCUS_29270 >Feature sequence746 <1 900 gene locus_tag LOCUS_29280 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035425.1:dimethylhistidine N-methyltransferase 1850 897 gene locus_tag LOCUS_29290 1850 897 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence747 1016 270 gene locus_tag LOCUS_29300 1016 270 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7V8 protein_id gnl|my_center|LOCUS_29300 1786 1157 gene locus_tag LOCUS_29310 1786 1157 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence748 1152 244 gene locus_tag LOCUS_29320 1152 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence749 709 251 gene locus_tag LOCUS_29330 709 251 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 protein_id gnl|my_center|LOCUS_29330 883 1725 gene locus_tag LOCUS_29340 883 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence750 566 1999 gene locus_tag LOCUS_29350 gene asnS 566 1999 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_29350 >Feature sequence751 421 1887 gene locus_tag LOCUS_29360 421 1887 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence752 3 182 gene locus_tag LOCUS_29370 3 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1803 358 gene locus_tag LOCUS_29380 1803 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence753 150 560 gene locus_tag LOCUS_29390 150 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_29390 <2101 568 gene locus_tag LOCUS_29400 <2101 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404969.1:peptidase M14 >Feature sequence754 341 2032 gene locus_tag LOCUS_29410 341 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence755 1099 215 gene locus_tag LOCUS_29420 1099 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 1971 1393 gene locus_tag LOCUS_29430 1971 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence756 1122 1952 gene locus_tag LOCUS_29440 1122 1952 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence757 473 342 gene locus_tag LOCUS_29450 473 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 472 1068 gene locus_tag LOCUS_29460 472 1068 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence758 <1 1135 gene locus_tag LOCUS_29470 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:magnesium chelatase <2081 1575 gene locus_tag LOCUS_29480 <2081 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403679.1:nucleoside-diphosphate sugar epimerase >Feature sequence759 1673 435 gene locus_tag LOCUS_29490 1673 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence760 829 1557 gene locus_tag LOCUS_29500 829 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence761 742 416 gene locus_tag LOCUS_29510 742 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1249 776 gene locus_tag LOCUS_29520 1249 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence762 <1 1314 gene locus_tag LOCUS_29530 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122710.1:MFS transporter 1495 1860 gene locus_tag LOCUS_29540 1495 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence763 1161 175 gene locus_tag LOCUS_29550 1161 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1274 1876 gene locus_tag LOCUS_29560 gene ruvC 1274 1876 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_29560 >Feature sequence764 544 990 gene locus_tag LOCUS_29570 544 990 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048563.1 protein_id gnl|my_center|LOCUS_29570 1124 1741 gene locus_tag LOCUS_29580 gene bioD 1124 1741 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_29580 >Feature sequence765 >Feature sequence766 470 1294 gene locus_tag LOCUS_29590 470 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1359 1901 gene locus_tag LOCUS_29600 1359 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence767 461 126 gene locus_tag LOCUS_29610 461 126 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326562.1 protein_id gnl|my_center|LOCUS_29610 604 1833 gene locus_tag LOCUS_29620 604 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2036 1914 gene locus_tag LOCUS_29630 2036 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence768 569 339 gene locus_tag LOCUS_29640 gene rpmF 569 339 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_29640 1186 608 gene locus_tag LOCUS_29650 1186 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence769 3 626 gene locus_tag LOCUS_29660 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 1389 616 gene locus_tag LOCUS_29670 1389 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1431 1976 gene locus_tag LOCUS_29680 1431 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence770 1569 109 gene locus_tag LOCUS_29690 1569 109 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence771 832 203 gene locus_tag LOCUS_29700 832 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence772 <1 1387 gene locus_tag LOCUS_29710 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F3B7:beta-glucosidase >Feature sequence773 684 1196 gene locus_tag LOCUS_29720 684 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1313 1873 gene locus_tag LOCUS_29730 1313 1873 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence774 <1 1008 gene locus_tag LOCUS_29740 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6K1:tetraacyldisaccharide 4'-kinase >Feature sequence775 304 999 gene locus_tag LOCUS_29750 304 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence776 1047 754 gene locus_tag LOCUS_29760 1047 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence777 27 512 gene locus_tag LOCUS_29770 gene moaC 27 512 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBW9 protein_id gnl|my_center|LOCUS_29770 505 1548 gene locus_tag LOCUS_29780 gene moeZ 505 1548 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence778 811 1527 gene locus_tag LOCUS_29790 gene pcs 811 1527 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIM3 protein_id gnl|my_center|LOCUS_29790 >Feature sequence779 <1 777 gene locus_tag LOCUS_29800 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence780 714 331 gene locus_tag LOCUS_29810 714 331 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 protein_id gnl|my_center|LOCUS_29810 965 699 gene locus_tag LOCUS_29820 965 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence781 460 1188 gene locus_tag LOCUS_29830 460 1188 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence782 822 16 gene locus_tag LOCUS_29840 822 16 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_29840 1028 1777 gene locus_tag LOCUS_29850 1028 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259458.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence783 65 1051 gene locus_tag LOCUS_29860 65 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence784 <1 964 gene locus_tag LOCUS_29870 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964416.1:beta-ketoacyl synthase <1904 1160 gene locus_tag LOCUS_29880 <1904 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962779.1:membrane protein >Feature sequence785 344 724 gene locus_tag LOCUS_29890 344 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 842 1747 gene locus_tag LOCUS_29900 gene hemF 842 1747 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEK3 protein_id gnl|my_center|LOCUS_29900 >Feature sequence786 >Feature sequence787 1089 238 gene locus_tag LOCUS_29910 1089 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence788 257 730 gene locus_tag LOCUS_29920 257 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 776 1420 gene locus_tag LOCUS_29930 gene pcm 776 1420 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence789 <1873 1073 gene locus_tag LOCUS_29940 <1873 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813226.1:glycosyl transferase family 2 >Feature sequence790 >Feature sequence791 216 1067 gene locus_tag LOCUS_29950 216 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1603 1070 gene locus_tag LOCUS_29960 gene rmlC 1603 1070 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence792 <1837 1153 gene locus_tag LOCUS_29970 <1837 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962397.1:succinylglutamate desuccinylase >Feature sequence793 >Feature sequence794 <1830 469 gene locus_tag LOCUS_29980 <1830 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_639573.2:polysaccharide deacetylase >Feature sequence795 >Feature sequence796 >Feature sequence797 364 1149 gene locus_tag LOCUS_29990 364 1149 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_29990 1394 1657 gene locus_tag LOCUS_30000 gene groS 1394 1657 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AL5 protein_id gnl|my_center|LOCUS_30000 >Feature sequence798 <1 1615 gene locus_tag LOCUS_30010 <1 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZB5:glycine--tRNA ligase >Feature sequence799 >Feature sequence800 >Feature sequence801 >Feature sequence802 188 30 gene locus_tag LOCUS_30020 188 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1541 228 gene locus_tag LOCUS_30030 1541 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30030 >Feature sequence803 >Feature sequence804 >Feature sequence805 228 473 gene locus_tag LOCUS_30040 228 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 470 955 gene locus_tag LOCUS_30050 470 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_30050 <1749 945 gene locus_tag LOCUS_30060 <1749 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723235.1:bifunctional folylpolyglutamate synthase/dihydrofolate synthase >Feature sequence806 1706 627 gene locus_tag LOCUS_30070 1706 627 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence807 >Feature sequence808 819 1325 gene locus_tag LOCUS_30080 gene greB 819 1325 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZD6 protein_id gnl|my_center|LOCUS_30080 >Feature sequence809 261 1388 gene locus_tag LOCUS_30090 gene lpxB 261 1388 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence810 226 1446 gene locus_tag LOCUS_30100 226 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence811 96 929 gene locus_tag LOCUS_30110 96 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence812 626 1465 gene locus_tag LOCUS_30120 626 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence813 >Feature sequence814 208 441 gene locus_tag LOCUS_30130 208 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence815 1 216 gene locus_tag LOCUS_30140 1 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 <1671 292 gene locus_tag LOCUS_30150 <1671 292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962476.1:alpha-amylase >Feature sequence816 >Feature sequence817 >Feature sequence818 1443 457 gene locus_tag LOCUS_30160 1443 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002660364.1 protein_id gnl|my_center|LOCUS_30160 >Feature sequence819 1046 108 gene locus_tag LOCUS_30170 gene trxB1 1046 108 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence820 1555 734 gene locus_tag LOCUS_30180 1555 734 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence821 >Feature sequence822 638 823 gene locus_tag LOCUS_30190 638 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30190 >Feature sequence823 990 106 gene locus_tag LOCUS_30200 gene ada 990 106 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence824 <1 891 gene locus_tag LOCUS_30210 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762240.1:myo-inositol-1-phosphate synthase >Feature sequence825 >Feature sequence826 >Feature sequence827 >Feature sequence828 >Feature sequence829 140 583 gene locus_tag LOCUS_30220 140 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence830 1 942 gene locus_tag LOCUS_30230 1 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence831 >Feature sequence832 >Feature sequence833 <1 934 gene locus_tag LOCUS_30240 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6M0:3-isopropylmalate dehydrogenase >Feature sequence834 >Feature sequence835 1403 69 gene locus_tag LOCUS_30250 1403 69 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_30250