>Feature sequence001 363 1433 gene locus_tag LOCUS_00010 363 1433 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_00010 1561 2001 gene locus_tag LOCUS_00020 1561 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2099 3355 gene locus_tag LOCUS_00030 2099 3355 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266394.1 protein_id gnl|my_center|LOCUS_00030 4552 3332 gene locus_tag LOCUS_00040 gene fabF 4552 3332 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_00040 5284 4553 gene locus_tag LOCUS_00050 gene fabG 5284 4553 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266390.1 protein_id gnl|my_center|LOCUS_00050 5767 5324 gene locus_tag LOCUS_00060 5767 5324 CDS product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 protein_id gnl|my_center|LOCUS_00060 6941 5760 gene locus_tag LOCUS_00070 6941 5760 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 protein_id gnl|my_center|LOCUS_00070 7497 6925 gene locus_tag LOCUS_00080 7497 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9767 7497 gene locus_tag LOCUS_00090 9767 7497 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_00090 10347 9748 gene locus_tag LOCUS_00100 10347 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10757 10344 gene locus_tag LOCUS_00110 10757 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099162.1 protein_id gnl|my_center|LOCUS_00110 12300 10750 gene locus_tag LOCUS_00120 12300 10750 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074028.1 protein_id gnl|my_center|LOCUS_00120 13217 12297 gene locus_tag LOCUS_00130 13217 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 13950 13207 gene locus_tag LOCUS_00140 13950 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00140 15632 13947 gene locus_tag LOCUS_00150 15632 13947 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105310.1 protein_id gnl|my_center|LOCUS_00150 16188 15619 gene locus_tag LOCUS_00160 16188 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 protein_id gnl|my_center|LOCUS_00160 16436 16185 gene locus_tag LOCUS_00170 gene acpP 16436 16185 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9B5 protein_id gnl|my_center|LOCUS_00170 16711 16433 gene locus_tag LOCUS_00180 16711 16433 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316688.1 protein_id gnl|my_center|LOCUS_00180 17475 16708 gene locus_tag LOCUS_00190 17475 16708 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765436.1 protein_id gnl|my_center|LOCUS_00190 18077 17472 gene locus_tag LOCUS_00200 18077 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18625 19173 gene locus_tag LOCUS_00210 18625 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19202 20041 gene locus_tag LOCUS_00220 19202 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20448 20083 gene locus_tag LOCUS_00230 20448 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21315 20611 gene locus_tag LOCUS_00240 21315 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22232 21579 gene locus_tag LOCUS_00250 22232 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22735 22259 gene locus_tag LOCUS_00260 22735 22259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 >Feature sequence002 1941 358 gene locus_tag LOCUS_00270 gene prfC 1941 358 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WH1 protein_id gnl|my_center|LOCUS_00270 2562 3416 gene locus_tag LOCUS_00280 2562 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 3489 4760 gene locus_tag LOCUS_00290 gene roxS 3489 4760 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_00290 4753 5301 gene locus_tag LOCUS_00300 4753 5301 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_00300 5950 5291 gene locus_tag LOCUS_00310 gene lipB 5950 5291 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 protein_id gnl|my_center|LOCUS_00310 6220 5951 gene locus_tag LOCUS_00320 6220 5951 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_00320 7383 6220 gene locus_tag LOCUS_00330 gene dacC 7383 6220 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_00330 8244 7462 gene locus_tag LOCUS_00340 gene rlpA 8244 7462 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF4 protein_id gnl|my_center|LOCUS_00340 9215 8241 gene locus_tag LOCUS_00350 gene sltB1 9215 8241 CDS product soluble lytic transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_00350 10425 9289 gene locus_tag LOCUS_00360 gene rodA 10425 9289 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_00360 12271 10418 gene locus_tag LOCUS_00370 12271 10418 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_00370 12743 12273 gene locus_tag LOCUS_00380 gene rlmH 12743 12273 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_00380 13100 12750 gene locus_tag LOCUS_00390 gene rsfS 13100 12750 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_00390 13774 13112 gene locus_tag LOCUS_00400 gene nadD 13774 13112 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 protein_id gnl|my_center|LOCUS_00400 15033 13771 gene locus_tag LOCUS_00410 gene proA 15033 13771 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_00410 15225 15428 gene locus_tag LOCUS_00420 15225 15428 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396478.1 protein_id gnl|my_center|LOCUS_00420 15580 16056 gene locus_tag LOCUS_00430 gene bfrB 15580 16056 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_00430 >Feature sequence003 857 15 gene locus_tag LOCUS_00440 857 15 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189208.1 protein_id gnl|my_center|LOCUS_00440 1132 2586 gene locus_tag LOCUS_00450 1132 2586 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_00450 2603 3457 gene locus_tag LOCUS_00460 2603 3457 CDS product thiazole biosynthesis protein ThiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021037.1 protein_id gnl|my_center|LOCUS_00460 3489 4487 gene locus_tag LOCUS_00470 3489 4487 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550651.1 protein_id gnl|my_center|LOCUS_00470 5339 4557 gene locus_tag LOCUS_00480 5339 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5724 5521 gene locus_tag LOCUS_00490 5724 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5993 6868 gene locus_tag LOCUS_00500 5993 6868 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 protein_id gnl|my_center|LOCUS_00500 6999 7826 gene locus_tag LOCUS_00510 gene caiD 6999 7826 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787370.1 protein_id gnl|my_center|LOCUS_00510 7819 9108 gene locus_tag LOCUS_00520 7819 9108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_00520 9575 10924 gene locus_tag LOCUS_00530 9575 10924 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_00530 10914 11348 gene locus_tag LOCUS_00540 10914 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 11341 12750 gene locus_tag LOCUS_00550 11341 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_00550 >Feature sequence004 479 2293 gene locus_tag LOCUS_00560 gene edd 479 2293 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_00560 2347 3282 gene locus_tag LOCUS_00570 gene glk 2347 3282 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPL9 protein_id gnl|my_center|LOCUS_00570 3996 3298 gene locus_tag LOCUS_00580 3996 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4470 4207 gene locus_tag LOCUS_00590 4470 4207 CDS product DUF5062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_00590 5898 4543 gene locus_tag LOCUS_00600 5898 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_00600 6525 5914 gene locus_tag LOCUS_00610 6525 5914 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRU0 protein_id gnl|my_center|LOCUS_00610 6936 6532 gene locus_tag LOCUS_00620 6936 6532 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_00620 7474 6947 gene locus_tag LOCUS_00630 7474 6947 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_00630 8864 7476 gene locus_tag LOCUS_00640 8864 7476 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_00640 9652 8864 gene locus_tag LOCUS_00650 9652 8864 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_00650 10399 9896 gene locus_tag LOCUS_00660 10399 9896 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS5 protein_id gnl|my_center|LOCUS_00660 11199 10405 gene locus_tag LOCUS_00670 gene thyA 11199 10405 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB24 protein_id gnl|my_center|LOCUS_00670 12086 11220 gene locus_tag LOCUS_00680 gene lgt 12086 11220 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL3 protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 3394 1979 gene locus_tag LOCUS_00690 gene uxaC 3394 1979 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F4 protein_id gnl|my_center|LOCUS_00690 4333 3488 gene locus_tag LOCUS_00700 gene hexR 4333 3488 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072455.1 protein_id gnl|my_center|LOCUS_00700 4574 5203 gene locus_tag LOCUS_00710 4574 5203 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_00710 5206 6228 gene locus_tag LOCUS_00720 gene gapA 5206 6228 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_00720 6225 7226 gene locus_tag LOCUS_00730 gene gap 6225 7226 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46795 protein_id gnl|my_center|LOCUS_00730 7235 9874 gene locus_tag LOCUS_00740 gene ppc 7235 9874 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI20 protein_id gnl|my_center|LOCUS_00740 11043 9898 gene locus_tag LOCUS_00750 11043 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 11252 11028 gene locus_tag LOCUS_00760 11252 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 12131 11397 gene locus_tag LOCUS_00770 gene cpxR 12131 11397 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence006 <1 591 gene locus_tag LOCUS_00780 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A7J4:acetyltransferase component of pyruvate dehydrogenase complex 750 1565 gene locus_tag LOCUS_00790 750 1565 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704528.1 protein_id gnl|my_center|LOCUS_00790 3833 1641 gene locus_tag LOCUS_00800 3833 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4804 3992 gene locus_tag LOCUS_00810 4804 3992 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098468.1 protein_id gnl|my_center|LOCUS_00810 5817 4807 gene locus_tag LOCUS_00820 5817 4807 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_00820 7455 5848 gene locus_tag LOCUS_00830 7455 5848 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_00830 8849 7452 gene locus_tag LOCUS_00840 8849 7452 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_00840 10012 8870 gene locus_tag LOCUS_00850 10012 8870 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 protein_id gnl|my_center|LOCUS_00850 10457 10023 gene locus_tag LOCUS_00860 10457 10023 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 protein_id gnl|my_center|LOCUS_00860 10579 11010 gene locus_tag LOCUS_00870 10579 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 11106 11933 gene locus_tag LOCUS_00880 11106 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence007 1544 2401 gene locus_tag LOCUS_00890 1544 2401 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_00890 2508 3962 gene locus_tag LOCUS_00900 2508 3962 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_00900 4613 4023 gene locus_tag LOCUS_00910 gene msrA 4613 4023 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_00910 4605 4817 gene locus_tag LOCUS_00920 4605 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4865 5992 gene locus_tag LOCUS_00930 4865 5992 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731378.1 protein_id gnl|my_center|LOCUS_00930 7298 6051 gene locus_tag LOCUS_00940 7298 6051 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224422.1 protein_id gnl|my_center|LOCUS_00940 8490 7378 gene locus_tag LOCUS_00950 8490 7378 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_00950 8718 9074 gene locus_tag LOCUS_00960 8718 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_00960 9558 9088 gene locus_tag LOCUS_00970 9558 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 9852 10790 gene locus_tag LOCUS_00980 9852 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 11806 10826 gene locus_tag LOCUS_00990 11806 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence008 3586 2534 gene locus_tag LOCUS_01000 3586 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_01000 3992 6415 gene locus_tag LOCUS_01010 gene bfeA 3992 6415 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_01010 7247 6609 gene locus_tag LOCUS_01020 gene crp 7247 6609 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614181.1 protein_id gnl|my_center|LOCUS_01020 7613 8209 gene locus_tag LOCUS_01030 7613 8209 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_01030 9636 8227 gene locus_tag LOCUS_01040 9636 8227 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence009 1437 418 gene locus_tag LOCUS_01050 1437 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2070 1528 gene locus_tag LOCUS_01060 2070 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_01060 2304 2996 gene locus_tag LOCUS_01070 2304 2996 CDS product protein YebE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705529.1 protein_id gnl|my_center|LOCUS_01070 3949 3017 gene locus_tag LOCUS_01080 3949 3017 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_01080 5227 3974 gene locus_tag LOCUS_01090 gene nhaA 5227 3974 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG3 protein_id gnl|my_center|LOCUS_01090 5605 6765 gene locus_tag LOCUS_01100 gene purK 5605 6765 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_01100 6765 7259 gene locus_tag LOCUS_01110 6765 7259 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_01110 7256 8245 gene locus_tag LOCUS_01120 7256 8245 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_01120 8242 8538 gene locus_tag LOCUS_01130 8242 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8675 9022 gene locus_tag LOCUS_01140 8675 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 9247 10275 gene locus_tag LOCUS_01150 9247 10275 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932944.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence010 1305 793 gene locus_tag LOCUS_01160 gene pilV 1305 793 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704648.1 protein_id gnl|my_center|LOCUS_01160 1909 1340 gene locus_tag LOCUS_01170 1909 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2992 2039 gene locus_tag LOCUS_01180 gene ispH 2992 2039 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_01180 3466 3011 gene locus_tag LOCUS_01190 3466 3011 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_01190 3963 3463 gene locus_tag LOCUS_01200 gene lspA 3963 3463 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_01200 6763 3956 gene locus_tag LOCUS_01210 gene ileS 6763 3956 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 protein_id gnl|my_center|LOCUS_01210 7602 6760 gene locus_tag LOCUS_01220 7602 6760 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNS3 protein_id gnl|my_center|LOCUS_01220 9345 7747 gene locus_tag LOCUS_01230 gene murJ 9345 7747 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_01230 10015 9401 gene locus_tag LOCUS_01240 gene nudF 10015 9401 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262653.1 protein_id gnl|my_center|LOCUS_01240 11033 10020 gene locus_tag LOCUS_01250 gene pyrB 11033 10020 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence011 204 680 gene locus_tag LOCUS_01260 204 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 898 1077 gene locus_tag LOCUS_01270 898 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3075 1099 gene locus_tag LOCUS_01280 3075 1099 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_01280 3344 4318 gene locus_tag LOCUS_01290 3344 4318 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_01290 4707 4333 gene locus_tag LOCUS_01300 4707 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5293 4718 gene locus_tag LOCUS_01310 5293 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 5435 6400 gene locus_tag LOCUS_01320 5435 6400 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815477.1 protein_id gnl|my_center|LOCUS_01320 6478 8619 gene locus_tag LOCUS_01330 gene exaA 6478 8619 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_01330 9819 8722 gene locus_tag LOCUS_01340 9819 8722 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_01340 9968 10810 gene locus_tag LOCUS_01350 gene pecI 9968 10810 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206432.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence012 85 867 gene locus_tag LOCUS_01360 85 867 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_01360 870 1649 gene locus_tag LOCUS_01370 870 1649 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_01370 1646 2644 gene locus_tag LOCUS_01380 1646 2644 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_01380 2662 3336 gene locus_tag LOCUS_01390 2662 3336 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_01390 3355 4152 gene locus_tag LOCUS_01400 3355 4152 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_01400 4145 5230 gene locus_tag LOCUS_01410 4145 5230 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 protein_id gnl|my_center|LOCUS_01410 5331 5627 gene locus_tag LOCUS_01420 5331 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5633 7090 gene locus_tag LOCUS_01430 5633 7090 CDS product putative acid-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703051.1 protein_id gnl|my_center|LOCUS_01430 7087 8637 gene locus_tag LOCUS_01440 7087 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8714 9886 gene locus_tag LOCUS_01450 8714 9886 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_01450 9892 10518 gene locus_tag LOCUS_01460 9892 10518 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence013 <1 1503 gene locus_tag LOCUS_01470 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090998.1:long-chain acyl-CoA synthetase 1616 2386 gene locus_tag LOCUS_01480 gene kduD 1616 2386 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_01480 2390 3169 gene locus_tag LOCUS_01490 gene bdhA 2390 3169 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_01490 3162 4511 gene locus_tag LOCUS_01500 3162 4511 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_01500 4553 5578 gene locus_tag LOCUS_01510 4553 5578 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_01510 5618 6604 gene locus_tag LOCUS_01520 5618 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6785 9124 gene locus_tag LOCUS_01530 6785 9124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918074.1 protein_id gnl|my_center|LOCUS_01530 9254 9883 gene locus_tag LOCUS_01540 9254 9883 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_01540 10202 10417 gene locus_tag LOCUS_01550 10202 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence014 <1 901 gene locus_tag LOCUS_01560 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UF01:N-acetylglucosamine-6-phosphate deacetylase 980 2662 gene locus_tag LOCUS_01570 980 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3507 2659 gene locus_tag LOCUS_01580 3507 2659 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615949.1 protein_id gnl|my_center|LOCUS_01580 3759 4142 gene locus_tag LOCUS_01590 3759 4142 CDS product putative 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701963.1 protein_id gnl|my_center|LOCUS_01590 4214 5182 gene locus_tag LOCUS_01600 gene moxR 4214 5182 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122329.1 protein_id gnl|my_center|LOCUS_01600 5188 6141 gene locus_tag LOCUS_01610 5188 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122330.1 protein_id gnl|my_center|LOCUS_01610 6142 6639 gene locus_tag LOCUS_01620 6142 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262015.1 protein_id gnl|my_center|LOCUS_01620 6632 7669 gene locus_tag LOCUS_01630 6632 7669 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262014.1 protein_id gnl|my_center|LOCUS_01630 7659 9263 gene locus_tag LOCUS_01640 7659 9263 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262013.1 protein_id gnl|my_center|LOCUS_01640 9260 10576 gene locus_tag LOCUS_01650 9260 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence015 185 1186 gene locus_tag LOCUS_01660 185 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2391 1522 gene locus_tag LOCUS_01670 2391 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 2856 3455 gene locus_tag LOCUS_01680 2856 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4519 3956 gene locus_tag LOCUS_01690 gene fimT 4519 3956 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_01690 5125 4664 gene locus_tag LOCUS_01700 5125 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 8549 5145 gene locus_tag LOCUS_01710 8549 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 8987 8574 gene locus_tag LOCUS_01720 8987 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 10084 9086 gene locus_tag LOCUS_01730 gene pilW 10084 9086 CDS product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence016 736 239 gene locus_tag LOCUS_01740 736 239 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122012.1 protein_id gnl|my_center|LOCUS_01740 883 1584 gene locus_tag LOCUS_01750 883 1584 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_01750 1587 2357 gene locus_tag LOCUS_01760 1587 2357 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_01760 2470 3261 gene locus_tag LOCUS_01770 2470 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3261 4400 gene locus_tag LOCUS_01780 3261 4400 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266912.1 protein_id gnl|my_center|LOCUS_01780 4388 5158 gene locus_tag LOCUS_01790 4388 5158 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_01790 6209 5217 gene locus_tag LOCUS_01800 gene oprF 6209 5217 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382460.1 protein_id gnl|my_center|LOCUS_01800 6742 6359 gene locus_tag LOCUS_01810 6742 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 7445 6747 gene locus_tag LOCUS_01820 7445 6747 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 protein_id gnl|my_center|LOCUS_01820 8514 7474 gene locus_tag LOCUS_01830 8514 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_01830 8656 9705 gene locus_tag LOCUS_01840 gene purM 8656 9705 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_01840 9717 10349 gene locus_tag LOCUS_01850 gene purN 9717 10349 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ91 protein_id gnl|my_center|LOCUS_01850 >Feature sequence017 344 72 gene locus_tag LOCUS_01860 344 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 1524 565 gene locus_tag LOCUS_01870 1524 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 2147 1881 gene locus_tag LOCUS_01880 2147 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4119 2398 gene locus_tag LOCUS_01890 4119 2398 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_01890 4331 6409 gene locus_tag LOCUS_01900 4331 6409 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_01900 6790 6464 gene locus_tag LOCUS_01910 6790 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01910 7012 6824 gene locus_tag LOCUS_01920 7012 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 7133 7546 gene locus_tag LOCUS_01930 7133 7546 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_01930 7647 8033 gene locus_tag LOCUS_01940 7647 8033 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481322.1 protein_id gnl|my_center|LOCUS_01940 8905 8030 gene locus_tag LOCUS_01950 8905 8030 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_01950 9013 9360 gene locus_tag LOCUS_01960 9013 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 9491 10195 gene locus_tag LOCUS_01970 9491 10195 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701583.1 protein_id gnl|my_center|LOCUS_01970 >Feature sequence018 1101 799 gene locus_tag LOCUS_01980 1101 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2203 1154 gene locus_tag LOCUS_01990 2203 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 2643 2269 gene locus_tag LOCUS_02000 2643 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2805 2975 gene locus_tag LOCUS_02010 2805 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4866 3013 gene locus_tag LOCUS_02020 4866 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_02020 5041 5355 gene locus_tag LOCUS_02030 5041 5355 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707324.1 protein_id gnl|my_center|LOCUS_02030 6394 5375 gene locus_tag LOCUS_02040 gene hmd 6394 5375 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_02040 6688 7734 gene locus_tag LOCUS_02050 6688 7734 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528610.1 protein_id gnl|my_center|LOCUS_02050 <9969 8055 gene locus_tag LOCUS_02060 <9969 8055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919836.1:TonB-dependent receptor >Feature sequence019 1 1152 gene locus_tag LOCUS_02070 1 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2637 1210 gene locus_tag LOCUS_02080 2637 1210 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968998.1 protein_id gnl|my_center|LOCUS_02080 2801 5074 gene locus_tag LOCUS_02090 2801 5074 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261974.1 protein_id gnl|my_center|LOCUS_02090 5836 5144 gene locus_tag LOCUS_02100 5836 5144 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 protein_id gnl|my_center|LOCUS_02100 6138 6689 gene locus_tag LOCUS_02110 6138 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7632 6760 gene locus_tag LOCUS_02120 7632 6760 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_02120 7730 9340 gene locus_tag LOCUS_02130 7730 9340 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_02130 9406 9801 gene locus_tag LOCUS_02140 9406 9801 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225309.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence020 1556 657 gene locus_tag LOCUS_02150 1556 657 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_02150 2688 1582 gene locus_tag LOCUS_02160 2688 1582 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_02160 3294 2692 gene locus_tag LOCUS_02170 3294 2692 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_02170 4478 3291 gene locus_tag LOCUS_02180 4478 3291 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_02180 4884 4480 gene locus_tag LOCUS_02190 4884 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 5864 4881 gene locus_tag LOCUS_02200 5864 4881 CDS product putative 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701337.1 protein_id gnl|my_center|LOCUS_02200 7101 5914 gene locus_tag LOCUS_02210 7101 5914 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701958.1 protein_id gnl|my_center|LOCUS_02210 8218 7193 gene locus_tag LOCUS_02220 8218 7193 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_02220 9561 8218 gene locus_tag LOCUS_02230 gene acd 9561 8218 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228933.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence021 144 1547 gene locus_tag LOCUS_02240 gene argH 144 1547 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B94 protein_id gnl|my_center|LOCUS_02240 1806 3062 gene locus_tag LOCUS_02250 gene lysA 1806 3062 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B7 protein_id gnl|my_center|LOCUS_02250 3310 4140 gene locus_tag LOCUS_02260 gene dapF 3310 4140 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B09 protein_id gnl|my_center|LOCUS_02260 4137 4835 gene locus_tag LOCUS_02270 4137 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_02270 4828 5736 gene locus_tag LOCUS_02280 gene xerC 4828 5736 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B4 protein_id gnl|my_center|LOCUS_02280 5740 6459 gene locus_tag LOCUS_02290 5740 6459 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_02290 6885 6547 gene locus_tag LOCUS_02300 gene glnK 6885 6547 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_02300 8268 7033 gene locus_tag LOCUS_02310 gene amtB 8268 7033 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_02310 8633 8295 gene locus_tag LOCUS_02320 gene glnK 8633 8295 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_02320 9409 8666 gene locus_tag LOCUS_02330 9409 8666 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence022 3328 911 gene locus_tag LOCUS_02340 3328 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3506 4306 gene locus_tag LOCUS_02350 3506 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_02350 4395 5159 gene locus_tag LOCUS_02360 4395 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_02360 6118 5156 gene locus_tag LOCUS_02370 6118 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65010 protein_id gnl|my_center|LOCUS_02370 7122 6187 gene locus_tag LOCUS_02380 7122 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061414.1 protein_id gnl|my_center|LOCUS_02380 8621 7122 gene locus_tag LOCUS_02390 8621 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_02390 8921 9385 gene locus_tag LOCUS_02400 8921 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence023 1 465 gene locus_tag LOCUS_02410 1 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 471 914 gene locus_tag LOCUS_02420 471 914 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_02420 993 1376 gene locus_tag LOCUS_02430 993 1376 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083819.1 protein_id gnl|my_center|LOCUS_02430 1538 2593 gene locus_tag LOCUS_02440 1538 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2652 3500 gene locus_tag LOCUS_02450 2652 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4754 3570 gene locus_tag LOCUS_02460 4754 3570 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZU6 protein_id gnl|my_center|LOCUS_02460 6038 4761 gene locus_tag LOCUS_02470 6038 4761 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_02470 6210 7985 gene locus_tag LOCUS_02480 6210 7985 CDS product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence024 <1 679 gene locus_tag LOCUS_02490 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919833.1:acetyl-CoA acetyltransferase 1026 2630 gene locus_tag LOCUS_02500 gene aceA 1026 2630 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_02500 3793 2786 gene locus_tag LOCUS_02510 3793 2786 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_02510 5898 3880 gene locus_tag LOCUS_02520 5898 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_02520 6129 5977 gene locus_tag LOCUS_02530 6129 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6439 6152 gene locus_tag LOCUS_02540 6439 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6643 7044 gene locus_tag LOCUS_02550 6643 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8513 7134 gene locus_tag LOCUS_02560 8513 7134 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_02560 <9564 8506 gene locus_tag LOCUS_02570 <9564 8506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWM4:DNA polymerase IV >Feature sequence025 121 1302 gene locus_tag LOCUS_02580 121 1302 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_02580 1317 2432 gene locus_tag LOCUS_02590 1317 2432 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_02590 3423 2434 gene locus_tag LOCUS_02600 3423 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5686 3584 gene locus_tag LOCUS_02610 5686 3584 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_02610 6015 5725 gene locus_tag LOCUS_02620 6015 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 6646 6143 gene locus_tag LOCUS_02630 6646 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 7569 6826 gene locus_tag LOCUS_02640 7569 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 8064 7603 gene locus_tag LOCUS_02650 8064 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 9110 8145 gene locus_tag LOCUS_02660 9110 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence026 <1 1345 gene locus_tag LOCUS_02670 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZXW8:glutamyl-tRNA reductase 1358 2446 gene locus_tag LOCUS_02680 gene prfA 1358 2446 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C1 protein_id gnl|my_center|LOCUS_02680 2449 3315 gene locus_tag LOCUS_02690 gene prmC 2449 3315 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC8 protein_id gnl|my_center|LOCUS_02690 3309 4058 gene locus_tag LOCUS_02700 gene moeB 3309 4058 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_02700 5391 4030 gene locus_tag LOCUS_02710 5391 4030 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_02710 5574 6818 gene locus_tag LOCUS_02720 gene rhlB 5574 6818 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_02720 7558 6815 gene locus_tag LOCUS_02730 gene cysZ 7558 6815 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED68 protein_id gnl|my_center|LOCUS_02730 7806 8387 gene locus_tag LOCUS_02740 7806 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_02740 8905 8615 gene locus_tag LOCUS_02750 8905 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence027 <1 653 gene locus_tag LOCUS_02760 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZK8:Na(+)-translocating NADH-quinone reductase subunit C 655 1317 gene locus_tag LOCUS_02770 gene nqrD 655 1317 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_02770 1318 1926 gene locus_tag LOCUS_02780 gene nqrE 1318 1926 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_02780 1973 3196 gene locus_tag LOCUS_02790 gene nqrF 1973 3196 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_02790 3228 4226 gene locus_tag LOCUS_02800 3228 4226 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL2 protein_id gnl|my_center|LOCUS_02800 4287 4469 gene locus_tag LOCUS_02810 4287 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_02810 4473 5726 gene locus_tag LOCUS_02820 4473 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_02820 5719 6414 gene locus_tag LOCUS_02830 gene lolD 5719 6414 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884I3 protein_id gnl|my_center|LOCUS_02830 6411 7652 gene locus_tag LOCUS_02840 6411 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_02840 8118 7591 gene locus_tag LOCUS_02850 8118 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence028 <1 939 gene locus_tag LOCUS_02860 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140040.1:propionyl-CoA synthetase 2781 943 gene locus_tag LOCUS_02870 2781 943 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_02870 3933 2923 gene locus_tag LOCUS_02880 3933 2923 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_02880 4068 4826 gene locus_tag LOCUS_02890 4068 4826 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_02890 5079 5903 gene locus_tag LOCUS_02900 5079 5903 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIL3 protein_id gnl|my_center|LOCUS_02900 5906 7138 gene locus_tag LOCUS_02910 5906 7138 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_02910 7128 8882 gene locus_tag LOCUS_02920 7128 8882 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence029 75 1253 gene locus_tag LOCUS_02930 75 1253 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_02930 1400 2377 gene locus_tag LOCUS_02940 1400 2377 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_02940 2637 2413 gene locus_tag LOCUS_02950 2637 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 3474 2674 gene locus_tag LOCUS_02960 3474 2674 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_02960 4930 3734 gene locus_tag LOCUS_02970 4930 3734 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_02970 6070 4970 gene locus_tag LOCUS_02980 6070 4970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_02980 6359 6063 gene locus_tag LOCUS_02990 6359 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6457 7587 gene locus_tag LOCUS_03000 gene carA 6457 7587 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence030 868 404 gene locus_tag LOCUS_03010 gene ogt 868 404 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP06 protein_id gnl|my_center|LOCUS_03010 2138 849 gene locus_tag LOCUS_03020 2138 849 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_03020 2412 3056 gene locus_tag LOCUS_03030 2412 3056 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_03030 3066 3254 gene locus_tag LOCUS_03040 3066 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3952 3251 gene locus_tag LOCUS_03050 3952 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_03050 5611 3977 gene locus_tag LOCUS_03060 5611 3977 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_03060 6429 5614 gene locus_tag LOCUS_03070 6429 5614 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_03070 6781 6431 gene locus_tag LOCUS_03080 6781 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7620 6913 gene locus_tag LOCUS_03090 7620 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 8819 7911 gene locus_tag LOCUS_03100 gene liuE 8819 7911 CDS product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 protein_id gnl|my_center|LOCUS_03100 >Feature sequence031 319 161 gene locus_tag LOCUS_03110 319 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1795 440 gene locus_tag LOCUS_03120 gene pntB 1795 440 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIW3 protein_id gnl|my_center|LOCUS_03120 2085 1798 gene locus_tag LOCUS_03130 2085 1798 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_03130 3229 2087 gene locus_tag LOCUS_03140 gene pntA 3229 2087 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_03140 4081 3428 gene locus_tag LOCUS_03150 gene chrR 4081 3428 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_03150 4667 4086 gene locus_tag LOCUS_03160 4667 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4850 6130 gene locus_tag LOCUS_03170 4850 6130 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_03170 6127 6870 gene locus_tag LOCUS_03180 6127 6870 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 protein_id gnl|my_center|LOCUS_03180 7081 6797 gene locus_tag LOCUS_03190 7081 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6965 8173 gene locus_tag LOCUS_03200 gene cfa 6965 8173 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 protein_id gnl|my_center|LOCUS_03200 8175 8696 gene locus_tag LOCUS_03210 8175 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073245.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence032 252 2297 gene locus_tag LOCUS_03220 252 2297 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190808.1 protein_id gnl|my_center|LOCUS_03220 2578 2339 gene locus_tag LOCUS_03230 2578 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3243 2641 gene locus_tag LOCUS_03240 3243 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_03240 4585 3257 gene locus_tag LOCUS_03250 4585 3257 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_03250 5066 4647 gene locus_tag LOCUS_03260 5066 4647 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_03260 5218 6111 gene locus_tag LOCUS_03270 5218 6111 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_03270 7226 6138 gene locus_tag LOCUS_03280 7226 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7131 7463 gene locus_tag LOCUS_03290 7131 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7348 8349 gene locus_tag LOCUS_03300 7348 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence033 1849 479 gene locus_tag LOCUS_03310 1849 479 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919101.1 protein_id gnl|my_center|LOCUS_03310 2216 1851 gene locus_tag LOCUS_03320 2216 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2490 4466 gene locus_tag LOCUS_03330 2490 4466 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_03330 4473 6524 gene locus_tag LOCUS_03340 4473 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461379.1 protein_id gnl|my_center|LOCUS_03340 7015 6548 gene locus_tag LOCUS_03350 gene mmyY 7015 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039529.1 protein_id gnl|my_center|LOCUS_03350 7905 7030 gene locus_tag LOCUS_03360 7905 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 <8568 7906 gene locus_tag LOCUS_03370 <8568 7906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407279.1:lipase >Feature sequence034 490 843 gene locus_tag LOCUS_03380 490 843 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ38 protein_id gnl|my_center|LOCUS_03380 843 1451 gene locus_tag LOCUS_03390 gene wrbA 843 1451 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_03390 1448 1807 gene locus_tag LOCUS_03400 1448 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1800 3647 gene locus_tag LOCUS_03410 gene sppA 1800 3647 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNJ6 protein_id gnl|my_center|LOCUS_03410 3650 4216 gene locus_tag LOCUS_03420 3650 4216 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FZ69 protein_id gnl|my_center|LOCUS_03420 4209 4571 gene locus_tag LOCUS_03430 4209 4571 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_03430 7729 4562 gene locus_tag LOCUS_03440 7729 4562 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_03440 8529 7726 gene locus_tag LOCUS_03450 8529 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence035 144 548 gene locus_tag LOCUS_03460 144 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 936 556 gene locus_tag LOCUS_03470 936 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 1117 2568 gene locus_tag LOCUS_03480 1117 2568 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143678.1 protein_id gnl|my_center|LOCUS_03480 2783 4639 gene locus_tag LOCUS_03490 2783 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 4802 5485 gene locus_tag LOCUS_03500 4802 5485 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_03500 5691 5969 gene locus_tag LOCUS_03510 5691 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 6020 6988 gene locus_tag LOCUS_03520 6020 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 7942 7025 gene locus_tag LOCUS_03530 7942 7025 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_03530 8071 8385 gene locus_tag LOCUS_03540 8071 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence036 2157 1039 gene locus_tag LOCUS_03550 gene recF 2157 1039 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK1 protein_id gnl|my_center|LOCUS_03550 3302 2199 gene locus_tag LOCUS_03560 3302 2199 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_03560 4859 3375 gene locus_tag LOCUS_03570 gene dnaA 4859 3375 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK3 protein_id gnl|my_center|LOCUS_03570 5682 6050 gene locus_tag LOCUS_03580 gene rnpA 5682 6050 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_03580 6286 8010 gene locus_tag LOCUS_03590 gene yidC 6286 8010 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_03590 >Feature sequence037 483 1472 gene locus_tag LOCUS_03600 483 1472 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_03600 2311 1493 gene locus_tag LOCUS_03610 2311 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2507 3079 gene locus_tag LOCUS_03620 2507 3079 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969958.1 protein_id gnl|my_center|LOCUS_03620 3285 5231 gene locus_tag LOCUS_03630 3285 5231 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_03630 5277 6077 gene locus_tag LOCUS_03640 5277 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6449 6078 gene locus_tag LOCUS_03650 6449 6078 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 protein_id gnl|my_center|LOCUS_03650 6611 6910 gene locus_tag LOCUS_03660 6611 6910 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975757.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence038 726 283 gene locus_tag LOCUS_03670 726 283 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228575.1 protein_id gnl|my_center|LOCUS_03670 1978 719 gene locus_tag LOCUS_03680 1978 719 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR57 protein_id gnl|my_center|LOCUS_03680 2934 1975 gene locus_tag LOCUS_03690 gene glcE 2934 1975 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_03690 4138 2924 gene locus_tag LOCUS_03700 gene glcD 4138 2924 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_03700 4494 5849 gene locus_tag LOCUS_03710 gene gor 4494 5849 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812173.1 protein_id gnl|my_center|LOCUS_03710 5849 6598 gene locus_tag LOCUS_03720 5849 6598 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_03720 6667 7617 gene locus_tag LOCUS_03730 6667 7617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence039 1300 2631 gene locus_tag LOCUS_03740 gene dinF 1300 2631 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262808.1 protein_id gnl|my_center|LOCUS_03740 2682 3338 gene locus_tag LOCUS_03750 2682 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3555 3319 gene locus_tag LOCUS_03760 3555 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4391 3555 gene locus_tag LOCUS_03770 gene aroE 4391 3555 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B50 protein_id gnl|my_center|LOCUS_03770 5302 4388 gene locus_tag LOCUS_03780 gene hemF 5302 4388 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_03780 5941 5375 gene locus_tag LOCUS_03790 gene tsaC 5941 5375 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500S6 protein_id gnl|my_center|LOCUS_03790 7137 6052 gene locus_tag LOCUS_03800 7137 6052 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence040 2895 3512 gene locus_tag LOCUS_03810 2895 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4579 3509 gene locus_tag LOCUS_03820 4579 3509 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_03820 4822 4583 gene locus_tag LOCUS_03830 4822 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104594.1 protein_id gnl|my_center|LOCUS_03830 7052 4854 gene locus_tag LOCUS_03840 gene ndh 7052 4854 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_03840 <8171 7049 gene locus_tag LOCUS_03850 <8171 7049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYK5:tRNA 2-selenouridine synthase >Feature sequence041 2647 3318 gene locus_tag LOCUS_03860 2647 3318 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_03860 4564 3650 gene locus_tag LOCUS_03870 4564 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 5312 6223 gene locus_tag LOCUS_03880 5312 6223 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061271.1 protein_id gnl|my_center|LOCUS_03880 6776 6516 gene locus_tag LOCUS_03890 6776 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 6900 7064 gene locus_tag LOCUS_03900 6900 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence042 1028 351 gene locus_tag LOCUS_03910 1028 351 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_03910 3640 1169 gene locus_tag LOCUS_03920 3640 1169 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_03920 4427 3750 gene locus_tag LOCUS_03930 4427 3750 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_03930 5626 4490 gene locus_tag LOCUS_03940 5626 4490 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224294.1 protein_id gnl|my_center|LOCUS_03940 6828 5641 gene locus_tag LOCUS_03950 6828 5641 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_03950 7051 7485 gene locus_tag LOCUS_03960 7051 7485 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence043 297 1430 gene locus_tag LOCUS_03970 297 1430 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_03970 1561 2790 gene locus_tag LOCUS_03980 1561 2790 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_03980 2809 4170 gene locus_tag LOCUS_03990 2809 4170 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_03990 4240 5268 gene locus_tag LOCUS_04000 4240 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5746 5315 gene locus_tag LOCUS_04010 5746 5315 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_04010 7075 5765 gene locus_tag LOCUS_04020 7075 5765 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477129.1 protein_id gnl|my_center|LOCUS_04020 <7870 7065 gene locus_tag LOCUS_04030 <7870 7065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206633.1:ABC transporter >Feature sequence044 1084 116 gene locus_tag LOCUS_04040 1084 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2243 1218 gene locus_tag LOCUS_04050 2243 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3593 2262 gene locus_tag LOCUS_04060 3593 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4804 3623 gene locus_tag LOCUS_04070 4804 3623 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_04070 6219 4882 gene locus_tag LOCUS_04080 gene hemL 6219 4882 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887443.1 protein_id gnl|my_center|LOCUS_04080 7040 6333 gene locus_tag LOCUS_04090 7040 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7529 7197 gene locus_tag LOCUS_04100 7529 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence045 <1 964 gene locus_tag LOCUS_04110 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZT63:aspartate-semialdehyde dehydrogenase 1100 3685 gene locus_tag LOCUS_04120 gene fimV 1100 3685 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_04120 3678 4553 gene locus_tag LOCUS_04130 gene truA 3678 4553 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSU2 protein_id gnl|my_center|LOCUS_04130 4650 5267 gene locus_tag LOCUS_04140 gene trpF 4650 5267 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW1 protein_id gnl|my_center|LOCUS_04140 5272 6501 gene locus_tag LOCUS_04150 gene trpB 5272 6501 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_04150 6498 7322 gene locus_tag LOCUS_04160 gene trpA 6498 7322 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_04160 >Feature sequence046 560 1321 gene locus_tag LOCUS_04170 560 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3257 1437 gene locus_tag LOCUS_04180 3257 1437 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072291.1 protein_id gnl|my_center|LOCUS_04180 3736 5508 gene locus_tag LOCUS_04190 3736 5508 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_04190 5538 6248 gene locus_tag LOCUS_04200 5538 6248 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 protein_id gnl|my_center|LOCUS_04200 6754 6263 gene locus_tag LOCUS_04210 gene smpB 6754 6263 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_04210 >Feature sequence047 1334 378 gene locus_tag LOCUS_04220 1334 378 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_04220 2013 1387 gene locus_tag LOCUS_04230 2013 1387 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_04230 2843 2010 gene locus_tag LOCUS_04240 2843 2010 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_04240 2891 3493 gene locus_tag LOCUS_04250 2891 3493 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885M2 protein_id gnl|my_center|LOCUS_04250 3508 3807 gene locus_tag LOCUS_04260 3508 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707245.1 protein_id gnl|my_center|LOCUS_04260 3833 4516 gene locus_tag LOCUS_04270 3833 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4542 5099 gene locus_tag LOCUS_04280 gene ppiA 4542 5099 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XT6 protein_id gnl|my_center|LOCUS_04280 5096 5875 gene locus_tag LOCUS_04290 gene pdxJ 5096 5875 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_04290 5975 6637 gene locus_tag LOCUS_04300 gene rluA 5975 6637 CDS product ribosomal large subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIK1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence048 <1 925 gene locus_tag LOCUS_04310 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403123.1:ABC transporter permease 928 1710 gene locus_tag LOCUS_04320 928 1710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_04320 1707 2678 gene locus_tag LOCUS_04330 1707 2678 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_04330 2682 3287 gene locus_tag LOCUS_04340 2682 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4189 3284 gene locus_tag LOCUS_04350 4189 3284 CDS product putative lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700832.1 protein_id gnl|my_center|LOCUS_04350 4706 4362 gene locus_tag LOCUS_04360 4706 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5656 4799 gene locus_tag LOCUS_04370 5656 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7307 5640 gene locus_tag LOCUS_04380 gene gspA 7307 5640 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence049 258 52 gene locus_tag LOCUS_04390 258 52 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_04390 1890 577 gene locus_tag LOCUS_04400 gene rhlE 1890 577 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS5 protein_id gnl|my_center|LOCUS_04400 2333 2007 gene locus_tag LOCUS_04410 gene ndoA 2333 2007 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 protein_id gnl|my_center|LOCUS_04410 3741 2341 gene locus_tag LOCUS_04420 3741 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3890 4420 gene locus_tag LOCUS_04430 3890 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 4427 4948 gene locus_tag LOCUS_04440 4427 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 protein_id gnl|my_center|LOCUS_04440 5802 4969 gene locus_tag LOCUS_04450 5802 4969 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083715.1 protein_id gnl|my_center|LOCUS_04450 6039 6785 gene locus_tag LOCUS_04460 6039 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence050 2154 1501 gene locus_tag LOCUS_04470 2154 1501 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_04470 2431 3852 gene locus_tag LOCUS_04480 2431 3852 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_04480 5228 4398 gene locus_tag LOCUS_04490 5228 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5299 6369 gene locus_tag LOCUS_04500 5299 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence051 1493 3067 gene locus_tag LOCUS_04510 gene betT 1493 3067 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262867.1 protein_id gnl|my_center|LOCUS_04510 3080 3631 gene locus_tag LOCUS_04520 3080 3631 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_04520 3715 3900 gene locus_tag LOCUS_04530 3715 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4260 5324 gene locus_tag LOCUS_04540 4260 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6321 5332 gene locus_tag LOCUS_04550 6321 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6577 6918 gene locus_tag LOCUS_04560 6577 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7189 6977 gene locus_tag LOCUS_04570 7189 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence052 2872 218 gene locus_tag LOCUS_04580 2872 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4156 2891 gene locus_tag LOCUS_04590 4156 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4429 7149 gene locus_tag LOCUS_04600 4429 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence053 418 1788 gene locus_tag LOCUS_04610 gene lysA 418 1788 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIR2 protein_id gnl|my_center|LOCUS_04610 1802 2611 gene locus_tag LOCUS_04620 1802 2611 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_04620 2631 3119 gene locus_tag LOCUS_04630 2631 3119 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 protein_id gnl|my_center|LOCUS_04630 3188 5035 gene locus_tag LOCUS_04640 3188 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_04640 5118 6146 gene locus_tag LOCUS_04650 5118 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence054 265 1497 gene locus_tag LOCUS_04660 265 1497 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_04660 1521 2633 gene locus_tag LOCUS_04670 1521 2633 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_04670 2634 4154 gene locus_tag LOCUS_04680 2634 4154 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462727.1 protein_id gnl|my_center|LOCUS_04680 4172 5305 gene locus_tag LOCUS_04690 4172 5305 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457950.1 protein_id gnl|my_center|LOCUS_04690 5295 6356 gene locus_tag LOCUS_04700 5295 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 6356 6787 gene locus_tag LOCUS_04710 6356 6787 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970503.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence055 1020 64 gene locus_tag LOCUS_04720 1020 64 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_04720 2228 1020 gene locus_tag LOCUS_04730 gene czcC 2228 1020 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_04730 3464 3057 gene locus_tag LOCUS_04740 3464 3057 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425026.1 protein_id gnl|my_center|LOCUS_04740 4377 5897 gene locus_tag LOCUS_04750 4377 5897 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_04750 5915 6670 gene locus_tag LOCUS_04760 5915 6670 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence056 377 1033 gene locus_tag LOCUS_04770 377 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 1033 1743 gene locus_tag LOCUS_04780 1033 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2031 1840 gene locus_tag LOCUS_04790 2031 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2294 2100 gene locus_tag LOCUS_04800 2294 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2683 2312 gene locus_tag LOCUS_04810 2683 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2930 3169 gene locus_tag LOCUS_04820 2930 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3051 3293 gene locus_tag LOCUS_04830 3051 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3290 4993 gene locus_tag LOCUS_04840 gene ureC 3290 4993 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VP0 protein_id gnl|my_center|LOCUS_04840 5115 5468 gene locus_tag LOCUS_04850 5115 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5449 6120 gene locus_tag LOCUS_04860 gene ureF 5449 6120 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRU7 protein_id gnl|my_center|LOCUS_04860 6160 6795 gene locus_tag LOCUS_04870 gene ureG 6160 6795 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E731 protein_id gnl|my_center|LOCUS_04870 >Feature sequence057 469 29 gene locus_tag LOCUS_04880 469 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1454 471 gene locus_tag LOCUS_04890 1454 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2236 1454 gene locus_tag LOCUS_04900 2236 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 2461 3582 gene locus_tag LOCUS_04910 2461 3582 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_04910 3586 4812 gene locus_tag LOCUS_04920 3586 4812 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_04920 4957 6063 gene locus_tag LOCUS_04930 4957 6063 CDS product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 protein_id gnl|my_center|LOCUS_04930 <7203 6091 gene locus_tag LOCUS_04940 <7203 6091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031081.1:serine hydrolase >Feature sequence058 722 1333 gene locus_tag LOCUS_04950 722 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1336 2025 gene locus_tag LOCUS_04960 1336 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2058 3113 gene locus_tag LOCUS_04970 2058 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119080.1 protein_id gnl|my_center|LOCUS_04970 3123 4577 gene locus_tag LOCUS_04980 3123 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4574 5044 gene locus_tag LOCUS_04990 4574 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5083 6093 gene locus_tag LOCUS_05000 5083 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 6086 7075 gene locus_tag LOCUS_05010 6086 7075 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence059 139 1122 gene locus_tag LOCUS_05020 gene ispB 139 1122 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_05020 1156 2784 gene locus_tag LOCUS_05030 gene pgi 1156 2784 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_05030 4127 2781 gene locus_tag LOCUS_05040 gene manB 4127 2781 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_05040 4960 4127 gene locus_tag LOCUS_05050 gene galU 4960 4127 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_05050 6409 4997 gene locus_tag LOCUS_05060 gene xanB 6409 4997 CDS product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 protein_id gnl|my_center|LOCUS_05060 6570 7085 gene locus_tag LOCUS_05070 gene fabA 6570 7085 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV9 protein_id gnl|my_center|LOCUS_05070 >Feature sequence060 1608 430 gene locus_tag LOCUS_05080 1608 430 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_05080 2043 1612 gene locus_tag LOCUS_05090 2043 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701369.1 protein_id gnl|my_center|LOCUS_05090 3031 2063 gene locus_tag LOCUS_05100 3031 2063 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 protein_id gnl|my_center|LOCUS_05100 3261 4625 gene locus_tag LOCUS_05110 3261 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4851 4654 gene locus_tag LOCUS_05120 4851 4654 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933047.1 protein_id gnl|my_center|LOCUS_05120 5302 4898 gene locus_tag LOCUS_05130 5302 4898 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 protein_id gnl|my_center|LOCUS_05130 5606 5367 gene locus_tag LOCUS_05140 5606 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 6152 5811 gene locus_tag LOCUS_05150 6152 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6997 6260 gene locus_tag LOCUS_05160 6997 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence061 <1 654 gene locus_tag LOCUS_05170 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707798.1:aspartate aminotransferase family protein 1957 647 gene locus_tag LOCUS_05180 1957 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3300 2056 gene locus_tag LOCUS_05190 3300 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721110.1 protein_id gnl|my_center|LOCUS_05190 4186 3293 gene locus_tag LOCUS_05200 4186 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4356 5477 gene locus_tag LOCUS_05210 4356 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_05210 5503 6549 gene locus_tag LOCUS_05220 5503 6549 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_05220 6574 6837 gene locus_tag LOCUS_05230 6574 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence062 684 1385 gene locus_tag LOCUS_05240 gene folE 684 1385 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E4 protein_id gnl|my_center|LOCUS_05240 1480 2901 gene locus_tag LOCUS_05250 1480 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4907 2910 gene locus_tag LOCUS_05260 4907 2910 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096766.1 protein_id gnl|my_center|LOCUS_05260 6683 5001 gene locus_tag LOCUS_05270 6683 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence063 <1 794 gene locus_tag LOCUS_05280 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZAR7:isocitrate dehydrogenase kinase/phosphatase 799 1344 gene locus_tag LOCUS_05290 799 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2192 1341 gene locus_tag LOCUS_05300 gene tesB 2192 1341 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 protein_id gnl|my_center|LOCUS_05300 3517 2234 gene locus_tag LOCUS_05310 3517 2234 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_05310 4191 3616 gene locus_tag LOCUS_05320 gene tag 4191 3616 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_05320 4217 5008 gene locus_tag LOCUS_05330 4217 5008 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_05330 5341 5054 gene locus_tag LOCUS_05340 5341 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6991 5615 gene locus_tag LOCUS_05350 6991 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence064 804 337 gene locus_tag LOCUS_05360 804 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701361.1 protein_id gnl|my_center|LOCUS_05360 1071 1829 gene locus_tag LOCUS_05370 1071 1829 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_05370 2464 1850 gene locus_tag LOCUS_05380 gene cynT 2464 1850 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_05380 3538 2627 gene locus_tag LOCUS_05390 3538 2627 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704360.1 protein_id gnl|my_center|LOCUS_05390 4454 3546 gene locus_tag LOCUS_05400 4454 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4697 6370 gene locus_tag LOCUS_05410 gene leuA-2 4697 6370 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_05410 6817 6506 gene locus_tag LOCUS_05420 6817 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence065 522 1178 gene locus_tag LOCUS_05430 522 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1209 1637 gene locus_tag LOCUS_05440 1209 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3056 1830 gene locus_tag LOCUS_05450 3056 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3865 3311 gene locus_tag LOCUS_05460 3865 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4188 5336 gene locus_tag LOCUS_05470 gene rlmD 4188 5336 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ3 protein_id gnl|my_center|LOCUS_05470 5369 6049 gene locus_tag LOCUS_05480 gene yugP 5369 6049 CDS product putative membrane protease YugP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05248 protein_id gnl|my_center|LOCUS_05480 >Feature sequence066 3110 717 gene locus_tag LOCUS_05490 3110 717 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX2 protein_id gnl|my_center|LOCUS_05490 4233 3097 gene locus_tag LOCUS_05500 gene ackA 4233 3097 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC99 protein_id gnl|my_center|LOCUS_05500 <6976 4930 gene locus_tag LOCUS_05510 <6976 4930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114997.1:TonB-dependent receptor >Feature sequence067 1470 184 gene locus_tag LOCUS_05520 1470 184 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_05520 2507 1500 gene locus_tag LOCUS_05530 gene lipA 2507 1500 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_05530 3471 2542 gene locus_tag LOCUS_05540 3471 2542 CDS product taurine catabolism dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808787.1 protein_id gnl|my_center|LOCUS_05540 4280 3510 gene locus_tag LOCUS_05550 4280 3510 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_05550 5219 4308 gene locus_tag LOCUS_05560 5219 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 <6960 5424 gene locus_tag LOCUS_05570 <6960 5424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454668.1:potassium transporter TrkA >Feature sequence068 1733 543 gene locus_tag LOCUS_05580 1733 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2275 1877 gene locus_tag LOCUS_05590 2275 1877 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_05590 2511 2272 gene locus_tag LOCUS_05600 2511 2272 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_05600 3466 2633 gene locus_tag LOCUS_05610 3466 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4823 3495 gene locus_tag LOCUS_05620 4823 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6188 4956 gene locus_tag LOCUS_05630 6188 4956 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190171.1 protein_id gnl|my_center|LOCUS_05630 6824 6294 gene locus_tag LOCUS_05640 6824 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence069 1008 310 gene locus_tag LOCUS_05650 1008 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2114 1005 gene locus_tag LOCUS_05660 2114 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2213 3070 gene locus_tag LOCUS_05670 2213 3070 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNY3 protein_id gnl|my_center|LOCUS_05670 3073 4536 gene locus_tag LOCUS_05680 3073 4536 CDS product putative aldehyde dehydrogenase AldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701960.1 protein_id gnl|my_center|LOCUS_05680 4533 5303 gene locus_tag LOCUS_05690 4533 5303 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN40 protein_id gnl|my_center|LOCUS_05690 5313 5651 gene locus_tag LOCUS_05700 gene fdx 5313 5651 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_05700 5742 6392 gene locus_tag LOCUS_05710 5742 6392 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence070 1689 583 gene locus_tag LOCUS_05720 1689 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1833 3575 gene locus_tag LOCUS_05730 1833 3575 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_05730 5277 3664 gene locus_tag LOCUS_05740 5277 3664 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_05740 6828 5374 gene locus_tag LOCUS_05750 gene hapE 6828 5374 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence071 851 375 gene locus_tag LOCUS_05760 851 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1222 1007 gene locus_tag LOCUS_05770 1222 1007 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_05770 4086 1321 gene locus_tag LOCUS_05780 gene valS 4086 1321 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI0 protein_id gnl|my_center|LOCUS_05780 4552 4133 gene locus_tag LOCUS_05790 gene holC 4552 4133 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_05790 6047 4554 gene locus_tag LOCUS_05800 gene pepA 6047 4554 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_05800 6567 6118 gene locus_tag LOCUS_05810 6567 6118 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence072 1347 307 gene locus_tag LOCUS_05820 1347 307 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267675.1 protein_id gnl|my_center|LOCUS_05820 1289 1507 gene locus_tag LOCUS_05830 1289 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1500 1952 gene locus_tag LOCUS_05840 1500 1952 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 protein_id gnl|my_center|LOCUS_05840 2365 1997 gene locus_tag LOCUS_05850 2365 1997 CDS product NTF2 superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265790.1 protein_id gnl|my_center|LOCUS_05850 3410 2406 gene locus_tag LOCUS_05860 3410 2406 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_05860 5655 3427 gene locus_tag LOCUS_05870 5655 3427 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084346.1 protein_id gnl|my_center|LOCUS_05870 6145 5648 gene locus_tag LOCUS_05880 6145 5648 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence073 <1 711 gene locus_tag LOCUS_05890 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZVY8:3-deoxy-manno-octulosonate cytidylyltransferase 751 1767 gene locus_tag LOCUS_05900 gene murB 751 1767 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_05900 1788 3701 gene locus_tag LOCUS_05910 gene uvrC 1788 3701 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_05910 3704 4270 gene locus_tag LOCUS_05920 gene pgsA 3704 4270 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104334.1 protein_id gnl|my_center|LOCUS_05920 4346 4419 gene locus_tag LOCUS_t00010 4346 4419 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6387 5365 gene locus_tag LOCUS_05930 6387 5365 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence074 <1 1353 gene locus_tag LOCUS_05940 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HT80:DNA polymerase I 2045 1365 gene locus_tag LOCUS_05950 gene engB 2045 1365 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT0 protein_id gnl|my_center|LOCUS_05950 2131 2427 gene locus_tag LOCUS_05960 gene scyA 2131 2427 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_05960 2471 3103 gene locus_tag LOCUS_05970 gene cc4 2471 3103 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_05970 3120 3752 gene locus_tag LOCUS_05980 gene dsbA 3120 3752 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_05980 4808 3804 gene locus_tag LOCUS_05990 gene cysK 4808 3804 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_05990 6032 4848 gene locus_tag LOCUS_06000 6032 4848 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_06000 <6683 6092 gene locus_tag LOCUS_06010 <6683 6092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225354.1:short-chain dehydrogenase >Feature sequence075 543 1718 gene locus_tag LOCUS_06020 543 1718 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_06020 2482 1703 gene locus_tag LOCUS_06030 gene yjfH 2482 1703 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_06030 3402 2482 gene locus_tag LOCUS_06040 3402 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3633 4850 gene locus_tag LOCUS_06050 gene amt-1 3633 4850 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_06050 4828 5106 gene locus_tag LOCUS_06060 4828 5106 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_06060 5537 5103 gene locus_tag LOCUS_06070 5537 5103 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 protein_id gnl|my_center|LOCUS_06070 5636 6082 gene locus_tag LOCUS_06080 5636 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence076 80 397 gene locus_tag LOCUS_06090 80 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 457 756 gene locus_tag LOCUS_06100 457 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 817 1386 gene locus_tag LOCUS_06110 817 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2243 2677 gene locus_tag LOCUS_06120 gene zntR 2243 2677 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 protein_id gnl|my_center|LOCUS_06120 2670 4976 gene locus_tag LOCUS_06130 2670 4976 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_06130 4989 5354 gene locus_tag LOCUS_06140 4989 5354 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 protein_id gnl|my_center|LOCUS_06140 5359 5685 gene locus_tag LOCUS_06150 5359 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5678 6331 gene locus_tag LOCUS_06160 5678 6331 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence077 69 593 gene locus_tag LOCUS_06170 69 593 CDS product 2,4'-dihydroxyacetophenone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479856.1 protein_id gnl|my_center|LOCUS_06170 1141 779 gene locus_tag LOCUS_06180 1141 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1172 1402 gene locus_tag LOCUS_06190 1172 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1549 2355 gene locus_tag LOCUS_06200 1549 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2352 2519 gene locus_tag LOCUS_06210 2352 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2655 3866 gene locus_tag LOCUS_06220 2655 3866 CDS product dipeptidyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896739.1 protein_id gnl|my_center|LOCUS_06220 5520 5314 gene locus_tag LOCUS_06230 5520 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 <6586 5537 gene locus_tag LOCUS_06240 <6586 5537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000340970.1:DUF4209 domain-containing protein >Feature sequence078 12 2186 gene locus_tag LOCUS_06250 gene glnN 12 2186 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_06250 3699 2323 gene locus_tag LOCUS_06260 3699 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_06260 4029 4883 gene locus_tag LOCUS_06270 4029 4883 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_06270 5020 6309 gene locus_tag LOCUS_06280 5020 6309 CDS product putative lipase/esterase/beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704734.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence079 239 526 gene locus_tag LOCUS_06290 239 526 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_06290 1119 1508 gene locus_tag LOCUS_06300 1119 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1655 2080 gene locus_tag LOCUS_06310 1655 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3247 2096 gene locus_tag LOCUS_06320 gene yjiB 3247 2096 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_06320 3629 3252 gene locus_tag LOCUS_06330 3629 3252 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_06330 3789 4493 gene locus_tag LOCUS_06340 gene oprG 3789 4493 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_06340 4961 4539 gene locus_tag LOCUS_06350 4961 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5401 5060 gene locus_tag LOCUS_06360 5401 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6571 5576 gene locus_tag LOCUS_06370 gene mhpE 6571 5576 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6H7 protein_id gnl|my_center|LOCUS_06370 >Feature sequence080 2318 1680 gene locus_tag LOCUS_06380 2318 1680 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_06380 3061 2315 gene locus_tag LOCUS_06390 3061 2315 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 protein_id gnl|my_center|LOCUS_06390 4189 3239 gene locus_tag LOCUS_06400 4189 3239 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_06400 5177 4209 gene locus_tag LOCUS_06410 5177 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6201 5209 gene locus_tag LOCUS_06420 6201 5209 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence081 <1 630 gene locus_tag LOCUS_06430 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYB5:electron transport complex subunit E 1048 623 gene locus_tag LOCUS_06440 1048 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1494 1039 gene locus_tag LOCUS_06450 1494 1039 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_06450 2236 1499 gene locus_tag LOCUS_06460 2236 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3052 2240 gene locus_tag LOCUS_06470 3052 2240 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204069.1 protein_id gnl|my_center|LOCUS_06470 <6468 3145 gene locus_tag LOCUS_06480 <6468 3145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638281.2:glycosyl transferase family protein >Feature sequence082 <1 1364 gene locus_tag LOCUS_06490 <1 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083824.1:amidohydrolase 1377 2147 gene locus_tag LOCUS_06500 1377 2147 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_06500 2325 4622 gene locus_tag LOCUS_06510 2325 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4893 6077 gene locus_tag LOCUS_06520 4893 6077 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence083 52 453 gene locus_tag LOCUS_06530 52 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 859 647 gene locus_tag LOCUS_06540 859 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2011 1292 gene locus_tag LOCUS_06550 2011 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2721 2149 gene locus_tag LOCUS_06560 2721 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4679 2736 gene locus_tag LOCUS_06570 4679 2736 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 protein_id gnl|my_center|LOCUS_06570 4899 5591 gene locus_tag LOCUS_06580 4899 5591 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence084 567 731 gene locus_tag LOCUS_06590 567 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 719 1015 gene locus_tag LOCUS_06600 719 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06600 1050 1634 gene locus_tag LOCUS_06610 gene azoR 1050 1634 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK44 protein_id gnl|my_center|LOCUS_06610 2158 1754 gene locus_tag LOCUS_06620 2158 1754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367306.1 protein_id gnl|my_center|LOCUS_06620 2504 3508 gene locus_tag LOCUS_06630 2504 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3797 5614 gene locus_tag LOCUS_06640 gene atuH 3797 5614 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_06640 5750 5998 gene locus_tag LOCUS_06650 5750 5998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence085 563 1957 gene locus_tag LOCUS_06660 563 1957 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_06660 4374 2056 gene locus_tag LOCUS_06670 4374 2056 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_06670 <6368 4520 gene locus_tag LOCUS_06680 <6368 4520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B >Feature sequence086 2504 342 gene locus_tag LOCUS_06690 2504 342 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_06690 2886 4892 gene locus_tag LOCUS_06700 gene fyuA 2886 4892 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_06700 5640 5296 gene locus_tag LOCUS_06710 5640 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence087 1357 128 gene locus_tag LOCUS_06720 1357 128 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269265.1 protein_id gnl|my_center|LOCUS_06720 1469 2866 gene locus_tag LOCUS_06730 1469 2866 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105412.1 protein_id gnl|my_center|LOCUS_06730 3580 2873 gene locus_tag LOCUS_06740 gene rpiA 3580 2873 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_06740 3683 5200 gene locus_tag LOCUS_06750 gene ilvA1 3683 5200 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_06750 5825 5520 gene locus_tag LOCUS_06760 5825 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence088 543 2438 gene locus_tag LOCUS_06770 gene prlC 543 2438 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_06770 3321 2443 gene locus_tag LOCUS_06780 3321 2443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256670.1 protein_id gnl|my_center|LOCUS_06780 4476 3373 gene locus_tag LOCUS_06790 4476 3373 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_06790 5448 4486 gene locus_tag LOCUS_06800 5448 4486 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence089 <1 843 gene locus_tag LOCUS_06810 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TNF2:aminotransferase 1615 830 gene locus_tag LOCUS_06820 1615 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2181 1582 gene locus_tag LOCUS_06830 gene pnuT 2181 1582 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_06830 4302 2197 gene locus_tag LOCUS_06840 4302 2197 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_06840 4546 5688 gene locus_tag LOCUS_06850 4546 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence090 1199 1972 gene locus_tag LOCUS_06860 1199 1972 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831L9 protein_id gnl|my_center|LOCUS_06860 1993 2718 gene locus_tag LOCUS_06870 1993 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3233 4042 gene locus_tag LOCUS_06880 3233 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4282 5061 gene locus_tag LOCUS_06890 4282 5061 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807005.1 protein_id gnl|my_center|LOCUS_06890 <6257 5137 gene locus_tag LOCUS_06900 <6257 5137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975430.1:acyltransferase >Feature sequence091 595 20 gene locus_tag LOCUS_06910 595 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037855.1 protein_id gnl|my_center|LOCUS_06910 1643 606 gene locus_tag LOCUS_06920 1643 606 CDS product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_06920 2870 1650 gene locus_tag LOCUS_06930 gene mct 2870 1650 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 protein_id gnl|my_center|LOCUS_06930 4546 2873 gene locus_tag LOCUS_06940 gene caiA 4546 2873 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_06940 4849 5841 gene locus_tag LOCUS_06950 gene dusA 4849 5841 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_06950 >Feature sequence092 1330 341 gene locus_tag LOCUS_06960 1330 341 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_06960 1527 3311 gene locus_tag LOCUS_06970 gene fabY 1527 3311 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_06970 3409 3831 gene locus_tag LOCUS_06980 3409 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3914 4435 gene locus_tag LOCUS_06990 3914 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4435 5256 gene locus_tag LOCUS_07000 4435 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5332 5895 gene locus_tag LOCUS_07010 5332 5895 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence093 <1 809 gene locus_tag LOCUS_07020 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083150.1:helix-turn-helix transcriptional regulator 966 2081 gene locus_tag LOCUS_07030 966 2081 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_07030 2097 3341 gene locus_tag LOCUS_07040 2097 3341 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_07040 3501 4607 gene locus_tag LOCUS_07050 gene aguA 3501 4607 CDS product putative agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLK2 protein_id gnl|my_center|LOCUS_07050 4609 5793 gene locus_tag LOCUS_07060 4609 5793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113817.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence094 947 1843 gene locus_tag LOCUS_07070 947 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 2226 1888 gene locus_tag LOCUS_07080 2226 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2944 2273 gene locus_tag LOCUS_07090 2944 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5205 2959 gene locus_tag LOCUS_07100 5205 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227803.1 protein_id gnl|my_center|LOCUS_07100 6188 5208 gene locus_tag LOCUS_07110 6188 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence095 923 243 gene locus_tag LOCUS_07120 gene gph2 923 243 CDS product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 protein_id gnl|my_center|LOCUS_07120 1633 920 gene locus_tag LOCUS_07130 gene ubiG 1633 920 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ90 protein_id gnl|my_center|LOCUS_07130 2994 1639 gene locus_tag LOCUS_07140 2994 1639 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 protein_id gnl|my_center|LOCUS_07140 3067 5646 gene locus_tag LOCUS_07150 gene gyrA 3067 5646 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ93 protein_id gnl|my_center|LOCUS_07150 >Feature sequence096 502 1797 gene locus_tag LOCUS_07160 502 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1810 4836 gene locus_tag LOCUS_07170 1810 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07170 >Feature sequence097 1265 516 gene locus_tag LOCUS_07180 1265 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2026 1265 gene locus_tag LOCUS_07190 2026 1265 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085812.1 protein_id gnl|my_center|LOCUS_07190 2174 3412 gene locus_tag LOCUS_07200 gene yjiB 2174 3412 CDS product putative cytochrome P450 YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34374 protein_id gnl|my_center|LOCUS_07200 3483 4313 gene locus_tag LOCUS_07210 3483 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4346 5362 gene locus_tag LOCUS_07220 4346 5362 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence098 1041 1235 gene locus_tag LOCUS_07230 1041 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1938 1252 gene locus_tag LOCUS_07240 1938 1252 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819924.1 protein_id gnl|my_center|LOCUS_07240 2139 1957 gene locus_tag LOCUS_07250 2139 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2086 2496 gene locus_tag LOCUS_07260 2086 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083733.1 protein_id gnl|my_center|LOCUS_07260 2965 2510 gene locus_tag LOCUS_07270 2965 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222821.1 protein_id gnl|my_center|LOCUS_07270 3833 3081 gene locus_tag LOCUS_07280 3833 3081 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_07280 5007 4000 gene locus_tag LOCUS_07290 5007 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 5208 5753 gene locus_tag LOCUS_07300 5208 5753 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence099 1545 1021 gene locus_tag LOCUS_07310 1545 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1847 2281 gene locus_tag LOCUS_07320 1847 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3276 2410 gene locus_tag LOCUS_07330 3276 2410 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 protein_id gnl|my_center|LOCUS_07330 4936 3329 gene locus_tag LOCUS_07340 4936 3329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393806.1 protein_id gnl|my_center|LOCUS_07340 <6036 4923 gene locus_tag LOCUS_07350 <6036 4923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704335.1:hemolysin D >Feature sequence100 508 1755 gene locus_tag LOCUS_07360 508 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1992 2498 gene locus_tag LOCUS_07370 1992 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2547 3833 gene locus_tag LOCUS_07380 2547 3833 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_07380 3830 4495 gene locus_tag LOCUS_07390 3830 4495 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_07390 5234 4581 gene locus_tag LOCUS_07400 5234 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5732 5250 gene locus_tag LOCUS_07410 5732 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence101 1272 460 gene locus_tag LOCUS_07420 1272 460 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_07420 2269 1325 gene locus_tag LOCUS_07430 2269 1325 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481319.1 protein_id gnl|my_center|LOCUS_07430 2632 4527 gene locus_tag LOCUS_07440 2632 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <5980 4580 gene locus_tag LOCUS_07450 <5980 4580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WKC1:putative diacyglycerol O-acyltransferase >Feature sequence102 <1 1351 gene locus_tag LOCUS_07460 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225314.1:D-glutamate deacylase 1520 1894 gene locus_tag LOCUS_07470 1520 1894 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_07470 5105 1929 gene locus_tag LOCUS_07480 5105 1929 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230278.2 protein_id gnl|my_center|LOCUS_07480 <5974 5102 gene locus_tag LOCUS_07490 <5974 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479099.1:hemolysin D >Feature sequence103 <1 535 gene locus_tag LOCUS_07500 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8XB41:tRNA modification GTPase MnmE 971 2854 gene locus_tag LOCUS_07510 gene mnmG 971 2854 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_07510 2847 3533 gene locus_tag LOCUS_07520 gene rsmG 2847 3533 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL14 protein_id gnl|my_center|LOCUS_07520 3502 4326 gene locus_tag LOCUS_07530 gene parA 3502 4326 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_07530 4326 5207 gene locus_tag LOCUS_07540 4326 5207 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_07540 5433 5218 gene locus_tag LOCUS_07550 5433 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence104 1063 1299 gene locus_tag LOCUS_07560 1063 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1348 1548 gene locus_tag LOCUS_07570 1348 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1538 2611 gene locus_tag LOCUS_07580 gene mtnA 1538 2611 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3T6 protein_id gnl|my_center|LOCUS_07580 2841 2617 gene locus_tag LOCUS_07590 2841 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4830 2920 gene locus_tag LOCUS_07600 4830 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5229 5014 gene locus_tag LOCUS_07610 5229 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence105 1 1953 gene locus_tag LOCUS_07620 1 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_07620 2312 3232 gene locus_tag LOCUS_07630 2312 3232 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_07630 3308 3538 gene locus_tag LOCUS_07640 3308 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3680 4039 gene locus_tag LOCUS_07650 3680 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4912 4136 gene locus_tag LOCUS_07660 4912 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 <5965 5168 gene locus_tag LOCUS_07670 <5965 5168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458987.1:3'(2'),5'-bisphosphate nucleotidase CysQ >Feature sequence106 250 1881 gene locus_tag LOCUS_07680 250 1881 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_07680 2349 2681 gene locus_tag LOCUS_07690 2349 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3038 3664 gene locus_tag LOCUS_07700 3038 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5035 3677 gene locus_tag LOCUS_07710 5035 3677 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 protein_id gnl|my_center|LOCUS_07710 <5963 5078 gene locus_tag LOCUS_07720 <5963 5078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R0Z8:ribonuclease Z >Feature sequence107 <1 2797 gene locus_tag LOCUS_07730 <1 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114615.1:serine/threonine protein kinase 2848 5178 gene locus_tag LOCUS_07740 2848 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence108 1730 636 gene locus_tag LOCUS_07750 1730 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2631 1747 gene locus_tag LOCUS_07760 gene ctaB 2631 1747 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_07760 2959 3837 gene locus_tag LOCUS_07770 2959 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4412 3891 gene locus_tag LOCUS_07780 4412 3891 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J6 protein_id gnl|my_center|LOCUS_07780 <5883 4415 gene locus_tag LOCUS_07790 <5883 4415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933414.1:receptor >Feature sequence109 458 1237 gene locus_tag LOCUS_07800 458 1237 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707378.1 protein_id gnl|my_center|LOCUS_07800 2002 1262 gene locus_tag LOCUS_07810 2002 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2693 2076 gene locus_tag LOCUS_07820 2693 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_07820 4551 2902 gene locus_tag LOCUS_07830 gene groL 4551 2902 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_07830 4897 4607 gene locus_tag LOCUS_07840 gene groS 4897 4607 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30720 protein_id gnl|my_center|LOCUS_07840 5558 5112 gene locus_tag LOCUS_07850 5558 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence110 <1 1020 gene locus_tag LOCUS_07860 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87ZB5:DNA topoisomerase 1 1080 1328 gene locus_tag LOCUS_07870 1080 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315798.1 protein_id gnl|my_center|LOCUS_07870 1975 1373 gene locus_tag LOCUS_07880 gene lexA 1975 1373 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ16 protein_id gnl|my_center|LOCUS_07880 2387 2070 gene locus_tag LOCUS_07890 2387 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2678 3418 gene locus_tag LOCUS_07900 2678 3418 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_07900 4433 3381 gene locus_tag LOCUS_07910 4433 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 <5867 4430 gene locus_tag LOCUS_07920 <5867 4430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q884J1:transcription-repair-coupling factor >Feature sequence111 997 2046 gene locus_tag LOCUS_07930 997 2046 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 protein_id gnl|my_center|LOCUS_07930 2309 3844 gene locus_tag LOCUS_07940 2309 3844 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_07940 3922 4317 gene locus_tag LOCUS_07950 3922 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5036 4314 gene locus_tag LOCUS_07960 5036 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence112 3012 2068 gene locus_tag LOCUS_07970 3012 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4581 3220 gene locus_tag LOCUS_07980 4581 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_07980 >Feature sequence113 538 1332 gene locus_tag LOCUS_07990 538 1332 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706605.1 protein_id gnl|my_center|LOCUS_07990 4464 1384 gene locus_tag LOCUS_08000 gene dnaE2 4464 1384 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_08000 5506 4544 gene locus_tag LOCUS_08010 5506 4544 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841995.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence114 743 1372 gene locus_tag LOCUS_08020 743 1372 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085691.1 protein_id gnl|my_center|LOCUS_08020 1454 3634 gene locus_tag LOCUS_08030 1454 3634 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence115 <1 2853 gene locus_tag LOCUS_08040 <1 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403109.1:multidrug transporter AcrB 4452 2893 gene locus_tag LOCUS_08050 4452 2893 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_08050 4622 5017 gene locus_tag LOCUS_08060 4622 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence116 592 1101 gene locus_tag LOCUS_08070 592 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08070 1094 2710 gene locus_tag LOCUS_08080 1094 2710 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881538.1 protein_id gnl|my_center|LOCUS_08080 2707 3273 gene locus_tag LOCUS_08090 2707 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3277 3840 gene locus_tag LOCUS_08100 3277 3840 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_08100 4582 3857 gene locus_tag LOCUS_08110 4582 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_08110 4506 5645 gene locus_tag LOCUS_08120 4506 5645 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence117 534 1739 gene locus_tag LOCUS_08130 534 1739 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence118 711 283 gene locus_tag LOCUS_08140 gene pilE 711 283 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_08140 1121 2836 gene locus_tag LOCUS_08150 gene pilB 1121 2836 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_08150 2840 4060 gene locus_tag LOCUS_08160 gene pilC 2840 4060 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_08160 4070 4960 gene locus_tag LOCUS_08170 gene gspO 4070 4960 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPV9 protein_id gnl|my_center|LOCUS_08170 4957 5556 gene locus_tag LOCUS_08180 gene coaE 4957 5556 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_08180 >Feature sequence119 835 95 gene locus_tag LOCUS_08190 835 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 893 1864 gene locus_tag LOCUS_08200 893 1864 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391367.1 protein_id gnl|my_center|LOCUS_08200 1890 2282 gene locus_tag LOCUS_08210 1890 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_08210 2305 2754 gene locus_tag LOCUS_08220 2305 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461146.1 protein_id gnl|my_center|LOCUS_08220 2776 3807 gene locus_tag LOCUS_08230 2776 3807 CDS product putative epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704492.1 protein_id gnl|my_center|LOCUS_08230 4331 3858 gene locus_tag LOCUS_08240 4331 3858 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410960.1 protein_id gnl|my_center|LOCUS_08240 <5633 4433 gene locus_tag LOCUS_08250 <5633 4433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919676.1:TonB-dependent receptor >Feature sequence120 1114 155 gene locus_tag LOCUS_08260 1114 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2665 1292 gene locus_tag LOCUS_08270 2665 1292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202170.1 protein_id gnl|my_center|LOCUS_08270 3800 2802 gene locus_tag LOCUS_08280 3800 2802 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_08280 4554 4087 gene locus_tag LOCUS_08290 4554 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257463.1 protein_id gnl|my_center|LOCUS_08290 4883 5461 gene locus_tag LOCUS_08300 4883 5461 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLR2 protein_id gnl|my_center|LOCUS_08300 >Feature sequence121 <1 2014 gene locus_tag LOCUS_08310 <1 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072947.1:xanthine dehydrogenase 2149 2808 gene locus_tag LOCUS_08320 2149 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2917 4182 gene locus_tag LOCUS_08330 2917 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 <5608 4188 gene locus_tag LOCUS_08340 <5608 4188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106322.1:9-hexadecenoic acid cis-trans isomerase >Feature sequence122 <1 2146 gene locus_tag LOCUS_08350 <1 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92TA4:malate synthase G 3049 2195 gene locus_tag LOCUS_08360 3049 2195 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_08360 4961 3057 gene locus_tag LOCUS_08370 4961 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence123 1142 399 gene locus_tag LOCUS_08380 1142 399 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_08380 2497 1283 gene locus_tag LOCUS_08390 2497 1283 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730847.1 protein_id gnl|my_center|LOCUS_08390 3123 2494 gene locus_tag LOCUS_08400 3123 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3263 4474 gene locus_tag LOCUS_08410 3263 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 4487 5446 gene locus_tag LOCUS_08420 4487 5446 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728250.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence124 134 1309 gene locus_tag LOCUS_08430 134 1309 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_08430 2571 1306 gene locus_tag LOCUS_08440 2571 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2649 3536 gene locus_tag LOCUS_08450 2649 3536 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_08450 3537 3968 gene locus_tag LOCUS_08460 3537 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 4507 4001 gene locus_tag LOCUS_08470 gene greB 4507 4001 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_08470 4622 5404 gene locus_tag LOCUS_08480 4622 5404 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence125 473 832 gene locus_tag LOCUS_08490 473 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1258 851 gene locus_tag LOCUS_08500 1258 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1364 2842 gene locus_tag LOCUS_08510 1364 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3631 2864 gene locus_tag LOCUS_08520 3631 2864 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_08520 3879 3628 gene locus_tag LOCUS_08530 3879 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4397 3876 gene locus_tag LOCUS_08540 4397 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08540 5239 4394 gene locus_tag LOCUS_08550 5239 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5556 5236 gene locus_tag LOCUS_08560 5556 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence126 360 1820 gene locus_tag LOCUS_08570 360 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2208 3110 gene locus_tag LOCUS_08580 2208 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3196 5211 gene locus_tag LOCUS_08590 3196 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence127 <1 900 gene locus_tag LOCUS_08600 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883980.1:alanine glycine permease 928 2181 gene locus_tag LOCUS_08610 928 2181 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730899.1 protein_id gnl|my_center|LOCUS_08610 2332 4608 gene locus_tag LOCUS_08620 2332 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_08620 5459 4755 gene locus_tag LOCUS_08630 gene ompW 5459 4755 CDS product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347172.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence128 1671 355 gene locus_tag LOCUS_08640 gene capL 1671 355 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_08640 1855 3927 gene locus_tag LOCUS_08650 1855 3927 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_08650 3924 5282 gene locus_tag LOCUS_08660 3924 5282 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence129 1618 2652 gene locus_tag LOCUS_08670 gene hrcA 1618 2652 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_08670 2879 3493 gene locus_tag LOCUS_08680 gene grpE 2879 3493 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH40 protein_id gnl|my_center|LOCUS_08680 >Feature sequence130 <1 1267 gene locus_tag LOCUS_08690 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114997.1:TonB-dependent receptor 1383 2219 gene locus_tag LOCUS_08700 1383 2219 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103243.1 protein_id gnl|my_center|LOCUS_08700 2344 3396 gene locus_tag LOCUS_08710 2344 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4007 3408 gene locus_tag LOCUS_08720 4007 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4193 4513 gene locus_tag LOCUS_08730 4193 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence131 1584 208 gene locus_tag LOCUS_08740 1584 208 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368025.1 protein_id gnl|my_center|LOCUS_08740 2109 1690 gene locus_tag LOCUS_08750 2109 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2561 2106 gene locus_tag LOCUS_08760 2561 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3124 2558 gene locus_tag LOCUS_08770 3124 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3195 4139 gene locus_tag LOCUS_08780 gene rssA 3195 4139 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_08780 4186 5400 gene locus_tag LOCUS_08790 4186 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence132 1000 170 gene locus_tag LOCUS_08800 gene cpdA 1000 170 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_08800 1512 997 gene locus_tag LOCUS_08810 1512 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_08810 1777 3153 gene locus_tag LOCUS_08820 1777 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_08820 3219 3836 gene locus_tag LOCUS_08830 3219 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 protein_id gnl|my_center|LOCUS_08830 4920 3847 gene locus_tag LOCUS_08840 4920 3847 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence133 453 1097 gene locus_tag LOCUS_08850 gene coq7 453 1097 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z8 protein_id gnl|my_center|LOCUS_08850 1535 1110 gene locus_tag LOCUS_08860 1535 1110 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_08860 1664 2296 gene locus_tag LOCUS_08870 gene vfr 1664 2296 CDS product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 protein_id gnl|my_center|LOCUS_08870 3093 2293 gene locus_tag LOCUS_08880 gene trpC 3093 2293 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML3 protein_id gnl|my_center|LOCUS_08880 4130 3090 gene locus_tag LOCUS_08890 gene trpD 4130 3090 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A04 protein_id gnl|my_center|LOCUS_08890 4736 4143 gene locus_tag LOCUS_08900 4736 4143 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_08900 <5388 4738 gene locus_tag LOCUS_08910 <5388 4738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007244435.1:anthranilate synthase component I >Feature sequence134 436 3318 gene locus_tag LOCUS_08920 gene fdsA 436 3318 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_08920 3315 3530 gene locus_tag LOCUS_08930 3315 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3872 3558 gene locus_tag LOCUS_08940 3872 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4813 3869 gene locus_tag LOCUS_08950 gene cbpA 4813 3869 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VN8 protein_id gnl|my_center|LOCUS_08950 >Feature sequence135 1600 2808 gene locus_tag LOCUS_08960 1600 2808 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 protein_id gnl|my_center|LOCUS_08960 2855 3139 gene locus_tag LOCUS_08970 2855 3139 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAI8 protein_id gnl|my_center|LOCUS_08970 3341 4528 gene locus_tag LOCUS_08980 3341 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704906.1 protein_id gnl|my_center|LOCUS_08980 4541 5143 gene locus_tag LOCUS_08990 4541 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence136 <1 2254 gene locus_tag LOCUS_09000 <1 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921290.1:TonB-dependent receptor 3323 2373 gene locus_tag LOCUS_09010 3323 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_09010 4393 3329 gene locus_tag LOCUS_09020 gene fba 4393 3329 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_09020 <5366 4489 gene locus_tag LOCUS_09030 <5366 4489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGD3:phosphoglycerate kinase >Feature sequence137 <1 816 gene locus_tag LOCUS_09040 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704440.1:heme biosynthesis operon protein HemX 820 2034 gene locus_tag LOCUS_09050 820 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_09050 3681 2065 gene locus_tag LOCUS_09060 3681 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5224 3743 gene locus_tag LOCUS_09070 gene ubiD 5224 3743 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV3 protein_id gnl|my_center|LOCUS_09070 >Feature sequence138 <1 1133 gene locus_tag LOCUS_09080 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263886.1:AI-2E family transporter 1137 1808 gene locus_tag LOCUS_09090 1137 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106538.1 protein_id gnl|my_center|LOCUS_09090 3328 1805 gene locus_tag LOCUS_09100 3328 1805 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 protein_id gnl|my_center|LOCUS_09100 4125 3400 gene locus_tag LOCUS_09110 4125 3400 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089892.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence139 <1 644 gene locus_tag LOCUS_09120 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267152.1:aminodeoxychorismate lyase 669 1316 gene locus_tag LOCUS_09130 gene tmk 669 1316 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YH1 protein_id gnl|my_center|LOCUS_09130 1310 2299 gene locus_tag LOCUS_09140 gene holB 1310 2299 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_09140 2293 2679 gene locus_tag LOCUS_09150 gene pilZ 2293 2679 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_09150 2959 3993 gene locus_tag LOCUS_09160 2959 3993 CDS product hyaluronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_09160 4149 4233 gene locus_tag LOCUS_t00020 4149 4233 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence140 1646 855 gene locus_tag LOCUS_09170 gene fabG 1646 855 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_09170 2876 1686 gene locus_tag LOCUS_09180 2876 1686 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_09180 4055 2898 gene locus_tag LOCUS_09190 gene acd 4055 2898 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_09190 4983 4075 gene locus_tag LOCUS_09200 4983 4075 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_09200 5310 5029 gene locus_tag LOCUS_09210 5310 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence141 951 1148 gene locus_tag LOCUS_09220 951 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1401 2807 gene locus_tag LOCUS_09230 gene glnA 1401 2807 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 protein_id gnl|my_center|LOCUS_09230 2931 3431 gene locus_tag LOCUS_09240 2931 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456803.1 protein_id gnl|my_center|LOCUS_09240 3704 4792 gene locus_tag LOCUS_09250 gene ntrB 3704 4792 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence142 1502 300 gene locus_tag LOCUS_09260 1502 300 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_09260 1878 1486 gene locus_tag LOCUS_09270 gene gcvH 1878 1486 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_09270 3203 1992 gene locus_tag LOCUS_09280 3203 1992 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_09280 4446 3190 gene locus_tag LOCUS_09290 gene ubiH 4446 3190 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_09290 5009 4446 gene locus_tag LOCUS_09300 5009 4446 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 protein_id gnl|my_center|LOCUS_09300 >Feature sequence143 <1 2069 gene locus_tag LOCUS_09310 <1 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114997.1:TonB-dependent receptor 2390 4288 gene locus_tag LOCUS_09320 2390 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence144 <1 1312 gene locus_tag LOCUS_09330 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142694.1:ring-hydroxylating oxygenase subunit alpha 2485 1346 gene locus_tag LOCUS_09340 2485 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389970.1 protein_id gnl|my_center|LOCUS_09340 3368 2478 gene locus_tag LOCUS_09350 3368 2478 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_09350 5003 3522 gene locus_tag LOCUS_09360 5003 3522 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728258.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence145 1413 139 gene locus_tag LOCUS_09370 1413 139 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_09370 3232 1625 gene locus_tag LOCUS_09380 3232 1625 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086217.1 protein_id gnl|my_center|LOCUS_09380 3469 4410 gene locus_tag LOCUS_09390 3469 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4461 4856 gene locus_tag LOCUS_09400 4461 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence146 1240 1079 gene locus_tag LOCUS_09410 1240 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2474 1275 gene locus_tag LOCUS_09420 2474 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3103 2480 gene locus_tag LOCUS_09430 gene cycA 3103 2480 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260948.1 protein_id gnl|my_center|LOCUS_09430 4332 3259 gene locus_tag LOCUS_09440 4332 3259 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence147 367 1233 gene locus_tag LOCUS_09450 gene btuF 367 1233 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_09450 1239 1898 gene locus_tag LOCUS_09460 1239 1898 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185643.1 protein_id gnl|my_center|LOCUS_09460 2239 1895 gene locus_tag LOCUS_09470 2239 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2367 2756 gene locus_tag LOCUS_09480 2367 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2753 3370 gene locus_tag LOCUS_09490 2753 3370 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_09490 4204 3410 gene locus_tag LOCUS_09500 4204 3410 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence148 2246 1371 gene locus_tag LOCUS_09510 2246 1371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_09510 2850 2323 gene locus_tag LOCUS_09520 2850 2323 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_09520 3171 4616 gene locus_tag LOCUS_09530 3171 4616 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088066.1 protein_id gnl|my_center|LOCUS_09530 <5202 4630 gene locus_tag LOCUS_09540 <5202 4630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437552.1:permease >Feature sequence149 4 807 gene locus_tag LOCUS_09550 4 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 811 2595 gene locus_tag LOCUS_09560 811 2595 CDS product terpene utilization protein AtuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_09560 2632 3402 gene locus_tag LOCUS_09570 gene kduD 2632 3402 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_09570 3406 4185 gene locus_tag LOCUS_09580 gene bdhA 3406 4185 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_09580 4248 5027 gene locus_tag LOCUS_09590 4248 5027 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705635.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence150 2399 1767 gene locus_tag LOCUS_09600 gene rlmE 2399 1767 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_09600 2504 2803 gene locus_tag LOCUS_09610 2504 2803 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_09610 3680 2793 gene locus_tag LOCUS_09620 3680 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_09620 3807 4583 gene locus_tag LOCUS_09630 3807 4583 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957888.1 protein_id gnl|my_center|LOCUS_09630 4585 4932 gene locus_tag LOCUS_09640 4585 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence151 1742 789 gene locus_tag LOCUS_09650 gene glyQ 1742 789 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_09650 1867 2649 gene locus_tag LOCUS_09660 gene djlA 1867 2649 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST2 protein_id gnl|my_center|LOCUS_09660 3717 2665 gene locus_tag LOCUS_09670 3717 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_09670 4574 3870 gene locus_tag LOCUS_09680 4574 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 <5179 4653 gene locus_tag LOCUS_09690 <5179 4653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071247.1:type 12 methyltransferase >Feature sequence152 <1 830 gene locus_tag LOCUS_09700 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946887.1:amine oxidase 3379 1004 gene locus_tag LOCUS_09710 3379 1004 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211632.1 protein_id gnl|my_center|LOCUS_09710 3568 4227 gene locus_tag LOCUS_09720 3568 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 <5143 4360 gene locus_tag LOCUS_09730 <5143 4360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035527.1:methyltransferase >Feature sequence153 1982 1293 gene locus_tag LOCUS_09740 1982 1293 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGI7 protein_id gnl|my_center|LOCUS_09740 2097 3095 gene locus_tag LOCUS_09750 2097 3095 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_09750 4023 3097 gene locus_tag LOCUS_09760 4023 3097 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460655.1 protein_id gnl|my_center|LOCUS_09760 4795 4004 gene locus_tag LOCUS_09770 gene pyrK 4795 4004 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB8 protein_id gnl|my_center|LOCUS_09770 >Feature sequence154 26 1492 gene locus_tag LOCUS_09780 gene ilvC 26 1492 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_09780 2085 1594 gene locus_tag LOCUS_09790 gene ilvH 2085 1594 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_09790 3830 2085 gene locus_tag LOCUS_09800 gene ilvI 3830 2085 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_09800 4340 4750 gene locus_tag LOCUS_09810 4340 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence155 <1 744 gene locus_tag LOCUS_09820 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:pyridine nucleotide-disulfide oxidoreductase 756 1067 gene locus_tag LOCUS_09830 756 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_09830 2994 1081 gene locus_tag LOCUS_09840 2994 1081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_09840 2954 3508 gene locus_tag LOCUS_09850 2954 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3499 4068 gene locus_tag LOCUS_09860 3499 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4100 4828 gene locus_tag LOCUS_09870 4100 4828 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WG9 protein_id gnl|my_center|LOCUS_09870 >Feature sequence156 2446 1235 gene locus_tag LOCUS_09880 2446 1235 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_09880 2768 3211 gene locus_tag LOCUS_09890 2768 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3219 3872 gene locus_tag LOCUS_09900 3219 3872 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_09900 4428 3853 gene locus_tag LOCUS_09910 4428 3853 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_09910 4595 5074 gene locus_tag LOCUS_09920 4595 5074 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence157 926 1300 gene locus_tag LOCUS_09930 926 1300 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_09930 1978 1493 gene locus_tag LOCUS_09940 1978 1493 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719731.1 protein_id gnl|my_center|LOCUS_09940 2949 1984 gene locus_tag LOCUS_09950 2949 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_09950 4930 2975 gene locus_tag LOCUS_09960 gene wbfY 4930 2975 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence158 <1 762 gene locus_tag LOCUS_09970 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115817.1:glycosyl transferase 780 1718 gene locus_tag LOCUS_09980 780 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence159 222 959 gene locus_tag LOCUS_09990 222 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 956 2425 gene locus_tag LOCUS_10000 956 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2487 3308 gene locus_tag LOCUS_10010 2487 3308 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_10010 3347 4345 gene locus_tag LOCUS_10020 3347 4345 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence160 <1 502 gene locus_tag LOCUS_10030 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYK0:glutamate 5-kinase 836 570 gene locus_tag LOCUS_10040 gene rpsT 836 570 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E8 protein_id gnl|my_center|LOCUS_10040 1059 1673 gene locus_tag LOCUS_10050 1059 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1719 2501 gene locus_tag LOCUS_10060 1719 2501 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 protein_id gnl|my_center|LOCUS_10060 2848 2573 gene locus_tag LOCUS_10070 2848 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3318 3094 gene locus_tag LOCUS_10080 3318 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4228 3374 gene locus_tag LOCUS_10090 gene purU 4228 3374 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP74 protein_id gnl|my_center|LOCUS_10090 >Feature sequence161 2140 611 gene locus_tag LOCUS_10100 2140 611 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_10100 2994 2155 gene locus_tag LOCUS_10110 2994 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_10110 4000 3008 gene locus_tag LOCUS_10120 4000 3008 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_10120 4118 5005 gene locus_tag LOCUS_10130 4118 5005 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence162 1718 3328 gene locus_tag LOCUS_10140 1718 3328 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117762.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence163 244 612 gene locus_tag LOCUS_10150 gene rplN 244 612 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W1 protein_id gnl|my_center|LOCUS_10150 643 957 gene locus_tag LOCUS_10160 gene rplX 643 957 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_10160 973 1512 gene locus_tag LOCUS_10170 gene rplE 973 1512 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_10170 1533 1838 gene locus_tag LOCUS_10180 gene rpsN 1533 1838 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V8 protein_id gnl|my_center|LOCUS_10180 1889 2284 gene locus_tag LOCUS_10190 gene rpsH 1889 2284 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_10190 2314 2841 gene locus_tag LOCUS_10200 gene rplF 2314 2841 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_10200 2850 3200 gene locus_tag LOCUS_10210 gene rplR 2850 3200 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_10210 3212 3724 gene locus_tag LOCUS_10220 gene rpsE 3212 3724 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_10220 3762 3944 gene locus_tag LOCUS_10230 gene rpmD 3762 3944 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK52 protein_id gnl|my_center|LOCUS_10230 3950 4396 gene locus_tag LOCUS_10240 gene rplO 3950 4396 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS08 protein_id gnl|my_center|LOCUS_10240 >Feature sequence164 1038 1535 gene locus_tag LOCUS_10250 1038 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_10250 1541 2683 gene locus_tag LOCUS_10260 1541 2683 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_10260 3058 2702 gene locus_tag LOCUS_10270 3058 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence165 <1 2013 gene locus_tag LOCUS_10280 <1 2013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946694.1:ABC transporter substrate-binding protein 2016 2993 gene locus_tag LOCUS_10290 gene oppB 2016 2993 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_10290 2993 4363 gene locus_tag LOCUS_10300 2993 4363 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence166 2941 776 gene locus_tag LOCUS_10310 2941 776 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_10310 3475 2951 gene locus_tag LOCUS_10320 3475 2951 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463089.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence167 1914 1591 gene locus_tag LOCUS_10330 1914 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2621 2136 gene locus_tag LOCUS_10340 2621 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2866 4581 gene locus_tag LOCUS_10350 gene proS 2866 4581 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8W2 protein_id gnl|my_center|LOCUS_10350 >Feature sequence168 503 955 gene locus_tag LOCUS_10360 503 955 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_10360 1020 1358 gene locus_tag LOCUS_10370 1020 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989439.1 protein_id gnl|my_center|LOCUS_10370 1374 2306 gene locus_tag LOCUS_10380 1374 2306 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776260.1 protein_id gnl|my_center|LOCUS_10380 2311 2508 gene locus_tag LOCUS_10390 2311 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2556 3173 gene locus_tag LOCUS_10400 2556 3173 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_10400 3334 3510 gene locus_tag LOCUS_10410 3334 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4848 3580 gene locus_tag LOCUS_10420 4848 3580 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453942.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence169 1634 132 gene locus_tag LOCUS_10430 gene plsC 1634 132 CDS product L-3-phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412713.1 protein_id gnl|my_center|LOCUS_10430 2064 3542 gene locus_tag LOCUS_10440 2064 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3571 4017 gene locus_tag LOCUS_10450 3571 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence170 884 114 gene locus_tag LOCUS_10460 884 114 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_10460 1802 969 gene locus_tag LOCUS_10470 1802 969 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 protein_id gnl|my_center|LOCUS_10470 2800 1799 gene locus_tag LOCUS_10480 gene gpsA 2800 1799 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA8 protein_id gnl|my_center|LOCUS_10480 <4835 2797 gene locus_tag LOCUS_10490 <4835 2797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730022.1:glycerol-3-phosphate acyltransferase >Feature sequence171 1534 761 gene locus_tag LOCUS_10500 1534 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3396 1531 gene locus_tag LOCUS_10510 3396 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4307 3393 gene locus_tag LOCUS_10520 4307 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence172 1707 910 gene locus_tag LOCUS_10530 1707 910 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_10530 2747 1707 gene locus_tag LOCUS_10540 2747 1707 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_10540 3981 2845 gene locus_tag LOCUS_10550 3981 2845 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_10550 <4823 3991 gene locus_tag LOCUS_10560 <4823 3991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919187.1:acyl-CoA dehydrogenase >Feature sequence173 2237 1413 gene locus_tag LOCUS_10570 gene nei 2237 1413 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8D2 protein_id gnl|my_center|LOCUS_10570 2406 3587 gene locus_tag LOCUS_10580 2406 3587 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_10580 3619 4029 gene locus_tag LOCUS_10590 3619 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4192 4040 gene locus_tag LOCUS_10600 4192 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence174 <1 2832 gene locus_tag LOCUS_10610 <1 2832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KC02:pyruvate-flavodoxin oxidoreductase 2848 3861 gene locus_tag LOCUS_10620 2848 3861 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence175 560 1168 gene locus_tag LOCUS_10630 560 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1197 2201 gene locus_tag LOCUS_10640 1197 2201 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_10640 2835 2212 gene locus_tag LOCUS_10650 2835 2212 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_10650 2999 3616 gene locus_tag LOCUS_10660 2999 3616 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence176 2517 433 gene locus_tag LOCUS_10670 gene fusA2 2517 433 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_10670 2955 3791 gene locus_tag LOCUS_10680 2955 3791 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027180.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence177 875 1414 gene locus_tag LOCUS_10690 875 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1411 1923 gene locus_tag LOCUS_10700 1411 1923 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_10700 1933 2970 gene locus_tag LOCUS_10710 1933 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2980 3444 gene locus_tag LOCUS_10720 2980 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence178 426 1070 gene locus_tag LOCUS_10730 426 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1113 1610 gene locus_tag LOCUS_10740 1113 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1633 1839 gene locus_tag LOCUS_10750 1633 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1874 2998 gene locus_tag LOCUS_10760 1874 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3921 2995 gene locus_tag LOCUS_10770 3921 2995 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_10770 4372 3998 gene locus_tag LOCUS_10780 4372 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence179 1059 1244 gene locus_tag LOCUS_10790 1059 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1678 1259 gene locus_tag LOCUS_10800 1678 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2281 3204 gene locus_tag LOCUS_10810 2281 3204 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140956.1 protein_id gnl|my_center|LOCUS_10810 3305 3784 gene locus_tag LOCUS_10820 3305 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4141 4347 gene locus_tag LOCUS_10830 4141 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence180 3 734 gene locus_tag LOCUS_10840 3 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 835 3717 gene locus_tag LOCUS_10850 835 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3805 4377 gene locus_tag LOCUS_10860 3805 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence181 327 1490 gene locus_tag LOCUS_10870 327 1490 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_10870 1521 2138 gene locus_tag LOCUS_10880 gene cysC 1521 2138 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MT8 protein_id gnl|my_center|LOCUS_10880 2149 3336 gene locus_tag LOCUS_10890 gene sat 2149 3336 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_10890 3422 3844 gene locus_tag LOCUS_10900 3422 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_10900 3899 4228 gene locus_tag LOCUS_10910 3899 4228 CDS product zinc-finger-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence182 2798 30 gene locus_tag LOCUS_10920 2798 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3980 2985 gene locus_tag LOCUS_10930 3980 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence183 1885 872 gene locus_tag LOCUS_10940 1885 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_10940 2373 1882 gene locus_tag LOCUS_10950 2373 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3314 2370 gene locus_tag LOCUS_10960 3314 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_10960 4267 3311 gene locus_tag LOCUS_10970 4267 3311 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence184 113 877 gene locus_tag LOCUS_10980 113 877 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_10980 995 3253 gene locus_tag LOCUS_10990 gene fyuA 995 3253 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_10990 4306 3266 gene locus_tag LOCUS_11000 4306 3266 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence185 1298 6 gene locus_tag LOCUS_11010 1298 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1840 2409 gene locus_tag LOCUS_11020 1840 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2710 2516 gene locus_tag LOCUS_11030 2710 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3340 2882 gene locus_tag LOCUS_11040 3340 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3956 3375 gene locus_tag LOCUS_11050 3956 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 <4662 4071 gene locus_tag LOCUS_11060 <4662 4071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88AR2:amino-acid acetyltransferase >Feature sequence186 <1 797 gene locus_tag LOCUS_11070 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:C4-dicarboxylate ABC transporter 1196 807 gene locus_tag LOCUS_11080 1196 807 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_11080 2586 1219 gene locus_tag LOCUS_11090 2586 1219 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_11090 3104 2583 gene locus_tag LOCUS_11100 3104 2583 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_11100 3200 3970 gene locus_tag LOCUS_11110 3200 3970 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPL2 protein_id gnl|my_center|LOCUS_11110 3978 4595 gene locus_tag LOCUS_11120 3978 4595 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence187 2 544 gene locus_tag LOCUS_11130 2 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1426 674 gene locus_tag LOCUS_11140 1426 674 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_11140 3060 1438 gene locus_tag LOCUS_11150 3060 1438 CDS product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225732.1 protein_id gnl|my_center|LOCUS_11150 <4602 3105 gene locus_tag LOCUS_11160 <4602 3105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730593.1:acetyl-CoA acetyltransferase >Feature sequence188 2416 1244 gene locus_tag LOCUS_11170 2416 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721110.1 protein_id gnl|my_center|LOCUS_11170 3309 2413 gene locus_tag LOCUS_11180 3309 2413 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464912.1 protein_id gnl|my_center|LOCUS_11180 4027 3362 gene locus_tag LOCUS_11190 4027 3362 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence189 841 104 gene locus_tag LOCUS_11200 841 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 995 1849 gene locus_tag LOCUS_11210 995 1849 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 protein_id gnl|my_center|LOCUS_11210 1902 2675 gene locus_tag LOCUS_11220 1902 2675 CDS product putative enoyl-coa hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704585.1 protein_id gnl|my_center|LOCUS_11220 2739 3521 gene locus_tag LOCUS_11230 2739 3521 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_11230 4296 3532 gene locus_tag LOCUS_11240 4296 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence190 2152 1220 gene locus_tag LOCUS_11250 2152 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2367 3371 gene locus_tag LOCUS_11260 2367 3371 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 protein_id gnl|my_center|LOCUS_11260 3371 3853 gene locus_tag LOCUS_11270 3371 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107402.1 protein_id gnl|my_center|LOCUS_11270 3872 4486 gene locus_tag LOCUS_11280 3872 4486 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence191 507 929 gene locus_tag LOCUS_11290 507 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 922 1179 gene locus_tag LOCUS_11300 922 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1176 1682 gene locus_tag LOCUS_11310 1176 1682 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389144.1 protein_id gnl|my_center|LOCUS_11310 1758 2372 gene locus_tag LOCUS_11320 1758 2372 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_11320 2562 2990 gene locus_tag LOCUS_11330 2562 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4258 3149 gene locus_tag LOCUS_11340 4258 3149 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence192 466 1299 gene locus_tag LOCUS_11350 466 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_11350 1379 1660 gene locus_tag LOCUS_11360 1379 1660 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_11360 1819 2778 gene locus_tag LOCUS_11370 gene chpB 1819 2778 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_11370 2913 3308 gene locus_tag LOCUS_11380 2913 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3750 3313 gene locus_tag LOCUS_11390 3750 3313 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266436.1 protein_id gnl|my_center|LOCUS_11390 <4538 3776 gene locus_tag LOCUS_11400 <4538 3776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266435.1:sensor histidine kinase >Feature sequence193 247 1152 gene locus_tag LOCUS_11410 247 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1158 1523 gene locus_tag LOCUS_11420 1158 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1520 1876 gene locus_tag LOCUS_11430 1520 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1973 2560 gene locus_tag LOCUS_11440 1973 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3504 3385 gene locus_tag LOCUS_11450 3504 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3553 4419 gene locus_tag LOCUS_11460 3553 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence194 1545 1012 gene locus_tag LOCUS_11470 1545 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3376 1898 gene locus_tag LOCUS_11480 gene yehZ 3376 1898 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_11480 4113 3373 gene locus_tag LOCUS_11490 4113 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence195 944 321 gene locus_tag LOCUS_11500 gene gst 944 321 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_11500 1079 1504 gene locus_tag LOCUS_11510 1079 1504 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_11510 1718 1978 gene locus_tag LOCUS_11520 1718 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1982 3820 gene locus_tag LOCUS_11530 1982 3820 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5G5 protein_id gnl|my_center|LOCUS_11530 >Feature sequence196 <1 785 gene locus_tag LOCUS_11540 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089481.1:glutamate synthase 787 2649 gene locus_tag LOCUS_11550 787 2649 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089482.1 protein_id gnl|my_center|LOCUS_11550 2646 3698 gene locus_tag LOCUS_11560 2646 3698 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_11560 3768 4475 gene locus_tag LOCUS_11570 gene phoB 3768 4475 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence197 1034 537 gene locus_tag LOCUS_11580 gene folK-1 1034 537 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_11580 2494 1031 gene locus_tag LOCUS_11590 gene pcnB 2494 1031 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_11590 4493 3015 gene locus_tag LOCUS_11600 4493 3015 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103371.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence198 2570 1614 gene locus_tag LOCUS_11610 gene aes 2570 1614 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_11610 2734 3336 gene locus_tag LOCUS_11620 2734 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence199 <1 1108 gene locus_tag LOCUS_11630 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113843.1:GMC-type oxidoreductase 1892 1101 gene locus_tag LOCUS_11640 1892 1101 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225423.1 protein_id gnl|my_center|LOCUS_11640 2350 1895 gene locus_tag LOCUS_11650 2350 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2463 3335 gene locus_tag LOCUS_11660 2463 3335 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455019.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence200 342 2711 gene locus_tag LOCUS_11670 gene icfG 342 2711 CDS product IcfG protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038705.1 protein_id gnl|my_center|LOCUS_11670 2727 3101 gene locus_tag LOCUS_11680 gene spoIIAA 2727 3101 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4T7 protein_id gnl|my_center|LOCUS_11680 3804 3103 gene locus_tag LOCUS_11690 3804 3103 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113570.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence201 1533 205 gene locus_tag LOCUS_11700 1533 205 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_11700 2639 1596 gene locus_tag LOCUS_11710 2639 1596 CDS product putative 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY68 protein_id gnl|my_center|LOCUS_11710 2984 2649 gene locus_tag LOCUS_11720 2984 2649 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_11720 3800 3018 gene locus_tag LOCUS_11730 gene xth 3800 3018 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946385.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence202 1394 111 gene locus_tag LOCUS_11740 gene tolB 1394 111 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y40 protein_id gnl|my_center|LOCUS_11740 2149 1394 gene locus_tag LOCUS_11750 2149 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2576 2157 gene locus_tag LOCUS_11760 gene tolR 2576 2157 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_11760 3296 2580 gene locus_tag LOCUS_11770 gene tolQ 3296 2580 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_11770 3719 3315 gene locus_tag LOCUS_11780 3719 3315 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_11780 <4377 3712 gene locus_tag LOCUS_11790 <4377 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWL1:Holliday junction ATP-dependent DNA helicase RuvB >Feature sequence203 2002 1346 gene locus_tag LOCUS_11800 2002 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2329 2006 gene locus_tag LOCUS_11810 2329 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3213 2371 gene locus_tag LOCUS_11820 3213 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244513.1 protein_id gnl|my_center|LOCUS_11820 3976 3239 gene locus_tag LOCUS_11830 3976 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence204 1864 830 gene locus_tag LOCUS_11840 1864 830 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453776.1 protein_id gnl|my_center|LOCUS_11840 2113 2916 gene locus_tag LOCUS_11850 2113 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3075 3428 gene locus_tag LOCUS_11860 3075 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3994 3473 gene locus_tag LOCUS_11870 3994 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence205 911 1258 gene locus_tag LOCUS_11880 gene yhaH 911 1258 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005050947.1 protein_id gnl|my_center|LOCUS_11880 1998 1255 gene locus_tag LOCUS_11890 1998 1255 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_11890 2105 2731 gene locus_tag LOCUS_11900 2105 2731 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence206 1311 2123 gene locus_tag LOCUS_11910 1311 2123 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700858.1 protein_id gnl|my_center|LOCUS_11910 2127 3143 gene locus_tag LOCUS_11920 2127 3143 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence207 3601 971 gene locus_tag LOCUS_11930 gene pepN 3601 971 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence208 <1 915 gene locus_tag LOCUS_11940 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454162.1:arylsulfatase 3246 961 gene locus_tag LOCUS_11950 gene mtrF 3246 961 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence209 1202 204 gene locus_tag LOCUS_11960 1202 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_11960 2136 1216 gene locus_tag LOCUS_11970 2136 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_11970 3347 2148 gene locus_tag LOCUS_11980 gene metZ 3347 2148 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_11980 <4326 3347 gene locus_tag LOCUS_11990 <4326 3347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51342:amidophosphoribosyltransferase >Feature sequence210 593 168 gene locus_tag LOCUS_12000 gene ndk 593 168 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_12000 991 788 gene locus_tag LOCUS_12010 gene iscX 991 788 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417922.1 protein_id gnl|my_center|LOCUS_12010 1313 1167 gene locus_tag LOCUS_12020 1313 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12020 2651 1437 gene locus_tag LOCUS_12030 gene iscS 2651 1437 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_12030 3161 2682 gene locus_tag LOCUS_12040 gene iscR 3161 2682 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_12040 4075 3326 gene locus_tag LOCUS_12050 gene trmJ 4075 3326 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_12050 >Feature sequence211 629 1792 gene locus_tag LOCUS_12060 gene ftsY 629 1792 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C1 protein_id gnl|my_center|LOCUS_12060 1789 2457 gene locus_tag LOCUS_12070 gene ftsE 1789 2457 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_12070 2604 3437 gene locus_tag LOCUS_12080 gene ftsX 2604 3437 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B9 protein_id gnl|my_center|LOCUS_12080 >Feature sequence212 1754 597 gene locus_tag LOCUS_12090 1754 597 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_12090 3307 1754 gene locus_tag LOCUS_12100 gene gpmI 3307 1754 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_12100 3469 3882 gene locus_tag LOCUS_12110 3469 3882 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_12110 3882 4160 gene locus_tag LOCUS_12120 gene grx 3882 4160 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU55 protein_id gnl|my_center|LOCUS_12120 >Feature sequence213 431 838 gene locus_tag LOCUS_12130 431 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 protein_id gnl|my_center|LOCUS_12130 1647 877 gene locus_tag LOCUS_12140 gene cobB1 1647 877 CDS product NAD-dependent protein deacetylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LY4 protein_id gnl|my_center|LOCUS_12140 2577 1651 gene locus_tag LOCUS_12150 2577 1651 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_12150 2982 2602 gene locus_tag LOCUS_12160 gene yyaQ 2982 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994638.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence214 1118 1939 gene locus_tag LOCUS_12170 1118 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_12170 1982 2920 gene locus_tag LOCUS_12180 gene kdgK 1982 2920 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958085.1 protein_id gnl|my_center|LOCUS_12180 3833 2940 gene locus_tag LOCUS_12190 3833 2940 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223587.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence215 1265 501 gene locus_tag LOCUS_12200 gene ftsQ 1265 501 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA7 protein_id gnl|my_center|LOCUS_12200 2190 1258 gene locus_tag LOCUS_12210 gene ddlB 2190 1258 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_12210 3620 2187 gene locus_tag LOCUS_12220 gene murC 3620 2187 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX1 protein_id gnl|my_center|LOCUS_12220 <4250 3613 gene locus_tag LOCUS_12230 <4250 3613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CX35:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase >Feature sequence216 1902 991 gene locus_tag LOCUS_12240 gene fieF 1902 991 CDS product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTL0 protein_id gnl|my_center|LOCUS_12240 2078 4045 gene locus_tag LOCUS_12250 2078 4045 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence217 619 1083 gene locus_tag LOCUS_12260 619 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1151 2194 gene locus_tag LOCUS_12270 1151 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_12270 2547 2203 gene locus_tag LOCUS_12280 2547 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence218 41 472 gene locus_tag LOCUS_12290 41 472 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_12290 582 1262 gene locus_tag LOCUS_12300 582 1262 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602785.1 protein_id gnl|my_center|LOCUS_12300 1323 2222 gene locus_tag LOCUS_12310 1323 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2568 2320 gene locus_tag LOCUS_12320 2568 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2899 2528 gene locus_tag LOCUS_12330 2899 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3741 2977 gene locus_tag LOCUS_12340 3741 2977 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence219 <4194 2007 gene locus_tag LOCUS_12350 <4194 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958090.1:ATP-dependent helicase >Feature sequence220 1341 1826 gene locus_tag LOCUS_12360 gene hcp1 1341 1826 CDS product protein hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I747 protein_id gnl|my_center|LOCUS_12360 1955 2767 gene locus_tag LOCUS_12370 1955 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_12370 2776 3279 gene locus_tag LOCUS_12380 2776 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence221 1570 326 gene locus_tag LOCUS_12390 1570 326 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 protein_id gnl|my_center|LOCUS_12390 1776 3488 gene locus_tag LOCUS_12400 1776 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 <4159 3490 gene locus_tag LOCUS_12410 <4159 3490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035732.1:hybrid sensor histidine kinase/response regulator >Feature sequence222 3143 1455 gene locus_tag LOCUS_12420 3143 1455 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence223 1547 1119 gene locus_tag LOCUS_12430 1547 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268368.1 protein_id gnl|my_center|LOCUS_12430 2407 1544 gene locus_tag LOCUS_12440 2407 1544 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_12440 2516 3484 gene locus_tag LOCUS_12450 2516 3484 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267100.1 protein_id gnl|my_center|LOCUS_12450 <4148 3515 gene locus_tag LOCUS_12460 <4148 3515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228948.1:hydroxylase >Feature sequence224 2715 2050 gene locus_tag LOCUS_12470 gene msrA 2715 2050 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W59 protein_id gnl|my_center|LOCUS_12470 <4133 2754 gene locus_tag LOCUS_12480 <4133 2754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887042.1:molybdopterin oxidoreductase >Feature sequence225 2048 516 gene locus_tag LOCUS_12490 2048 516 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706760.1 protein_id gnl|my_center|LOCUS_12490 3466 2045 gene locus_tag LOCUS_12500 3466 2045 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106279.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence226 <1 1356 gene locus_tag LOCUS_12510 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I7C2:DNA gyrase subunit B 1720 2328 gene locus_tag LOCUS_12520 1720 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2333 2893 gene locus_tag LOCUS_12530 2333 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2972 3814 gene locus_tag LOCUS_12540 2972 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence227 1405 1860 gene locus_tag LOCUS_12550 1405 1860 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_12550 1870 2583 gene locus_tag LOCUS_12560 1870 2583 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_12560 3159 2662 gene locus_tag LOCUS_12570 gene ppiB 3159 2662 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U9 protein_id gnl|my_center|LOCUS_12570 >Feature sequence228 607 900 gene locus_tag LOCUS_12580 607 900 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262218.1 protein_id gnl|my_center|LOCUS_12580 929 2467 gene locus_tag LOCUS_12590 929 2467 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_12590 3324 2464 gene locus_tag LOCUS_12600 3324 2464 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence229 1554 670 gene locus_tag LOCUS_12610 gene ivdF 1554 670 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC2 protein_id gnl|my_center|LOCUS_12610 2696 1557 gene locus_tag LOCUS_12620 2696 1557 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 protein_id gnl|my_center|LOCUS_12620 3469 2681 gene locus_tag LOCUS_12630 3469 2681 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_12630 <4090 3466 gene locus_tag LOCUS_12640 <4090 3466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071829.1:acyl-CoA dehydrogenase >Feature sequence230 128 724 gene locus_tag LOCUS_12650 128 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1836 856 gene locus_tag LOCUS_12660 1836 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2924 2127 gene locus_tag LOCUS_12670 2924 2127 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925816.1 protein_id gnl|my_center|LOCUS_12670 3916 2921 gene locus_tag LOCUS_12680 3916 2921 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence231 563 1768 gene locus_tag LOCUS_12690 gene coaC 563 1768 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence232 524 862 gene locus_tag LOCUS_12700 524 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53867 protein_id gnl|my_center|LOCUS_12700 1339 926 gene locus_tag LOCUS_12710 1339 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701369.1 protein_id gnl|my_center|LOCUS_12710 1865 1332 gene locus_tag LOCUS_12720 1865 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2953 1862 gene locus_tag LOCUS_12730 2953 1862 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_12730 3541 3059 gene locus_tag LOCUS_12740 3541 3059 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_12740 >Feature sequence233 147 2801 gene locus_tag LOCUS_12750 147 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2919 3374 gene locus_tag LOCUS_12760 2919 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3377 3892 gene locus_tag LOCUS_12770 3377 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence234 1399 1046 gene locus_tag LOCUS_12780 1399 1046 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624701.1 protein_id gnl|my_center|LOCUS_12780 1734 1399 gene locus_tag LOCUS_12790 1734 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1914 2141 gene locus_tag LOCUS_12800 1914 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2212 2544 gene locus_tag LOCUS_12810 2212 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence235 1096 89 gene locus_tag LOCUS_12820 1096 89 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887575.1 protein_id gnl|my_center|LOCUS_12820 2171 1182 gene locus_tag LOCUS_12830 2171 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence236 2882 2235 gene locus_tag LOCUS_12840 2882 2235 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_12840 3862 2882 gene locus_tag LOCUS_12850 gene mdh 3862 2882 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_12850 >Feature sequence237 168 1850 gene locus_tag LOCUS_12860 168 1850 CDS product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223246.1 protein_id gnl|my_center|LOCUS_12860 2120 2599 gene locus_tag LOCUS_12870 2120 2599 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_12870 <4034 2880 gene locus_tag LOCUS_12880 <4034 2880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83C58:pyrophosphate--fructose 6-phosphate 1-phosphotransferase >Feature sequence238 1509 691 gene locus_tag LOCUS_12890 1509 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1581 2636 gene locus_tag LOCUS_12900 1581 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3668 2640 gene locus_tag LOCUS_12910 gene rsgA 3668 2640 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY9 protein_id gnl|my_center|LOCUS_12910 >Feature sequence239 2168 1359 gene locus_tag LOCUS_12920 gene cbpA 2168 1359 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_12920 2342 2824 gene locus_tag LOCUS_12930 2342 2824 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_12930 2826 3299 gene locus_tag LOCUS_12940 2826 3299 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence240 <1 2574 gene locus_tag LOCUS_12950 <1 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:cation transporter 3710 3976 gene locus_tag LOCUS_12960 3710 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence241 20 2227 gene locus_tag LOCUS_12970 20 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 <4012 2230 gene locus_tag LOCUS_12980 <4012 2230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122644.1:cadherin-related protein >Feature sequence242 955 98 gene locus_tag LOCUS_12990 955 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2968 1049 gene locus_tag LOCUS_13000 2968 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence243 370 1119 gene locus_tag LOCUS_13010 gene ubiE 370 1119 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_13010 1121 1744 gene locus_tag LOCUS_13020 1121 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1938 3392 gene locus_tag LOCUS_13030 gene ubiB 1938 3392 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_13030 3454 3858 gene locus_tag LOCUS_13040 gene hisI 3454 3858 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_13040 >Feature sequence244 <1 1019 gene locus_tag LOCUS_13050 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096404.1:alginate biosynthesis protein AlgZ/FimS 1016 1741 gene locus_tag LOCUS_13060 gene algR 1016 1741 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_13060 1826 2752 gene locus_tag LOCUS_13070 gene hemC 1826 2752 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_13070 2842 3531 gene locus_tag LOCUS_13080 gene hemD 2842 3531 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_13080 >Feature sequence245 390 1376 gene locus_tag LOCUS_13090 gene dusB 390 1376 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_13090 1373 1702 gene locus_tag LOCUS_13100 1373 1702 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 protein_id gnl|my_center|LOCUS_13100 1741 3315 gene locus_tag LOCUS_13110 gene purH 1741 3315 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAR3 protein_id gnl|my_center|LOCUS_13110 >Feature sequence246 2 1381 gene locus_tag LOCUS_13120 2 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1378 1980 gene locus_tag LOCUS_13130 gene lolA 1378 1980 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M4 protein_id gnl|my_center|LOCUS_13130 1970 3340 gene locus_tag LOCUS_13140 1970 3340 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_13140 3344 3721 gene locus_tag LOCUS_13150 gene crcB 3344 3721 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXV4 protein_id gnl|my_center|LOCUS_13150 >Feature sequence247 786 172 gene locus_tag LOCUS_13160 786 172 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 protein_id gnl|my_center|LOCUS_13160 2317 908 gene locus_tag LOCUS_13170 2317 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_13170 2765 2496 gene locus_tag LOCUS_13180 2765 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence248 1 1266 gene locus_tag LOCUS_13190 1 1266 CDS product 4-coumarate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_13190 1306 2553 gene locus_tag LOCUS_13200 1306 2553 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_13200 2560 3603 gene locus_tag LOCUS_13210 2560 3603 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence249 <1 771 gene locus_tag LOCUS_13220 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268765.1:urea carboxylase 788 2587 gene locus_tag LOCUS_13230 788 2587 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096801.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence250 <1 1588 gene locus_tag LOCUS_13240 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q887L5:glycine dehydrogenase (decarboxylating) 3096 1585 gene locus_tag LOCUS_13250 3096 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence251 458 709 gene locus_tag LOCUS_13260 gene xseB 458 709 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 protein_id gnl|my_center|LOCUS_13260 706 1614 gene locus_tag LOCUS_13270 706 1614 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_13270 2217 1630 gene locus_tag LOCUS_13280 gene ribA 2217 1630 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY1 protein_id gnl|my_center|LOCUS_13280 2936 2301 gene locus_tag LOCUS_13290 2936 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_13290 3926 2961 gene locus_tag LOCUS_13300 3926 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence252 2770 533 gene locus_tag LOCUS_13310 2770 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227803.1 protein_id gnl|my_center|LOCUS_13310 3718 2789 gene locus_tag LOCUS_13320 3718 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 >Feature sequence253 2067 2936 gene locus_tag LOCUS_13330 gene oxyR 2067 2936 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_13330 3046 3879 gene locus_tag LOCUS_13340 3046 3879 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence254 <1 1434 gene locus_tag LOCUS_13350 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211122.1:short-chain dehydrogenase 1540 3204 gene locus_tag LOCUS_13360 1540 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence255 1669 392 gene locus_tag LOCUS_13370 gene surA 1669 392 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_13370 <3882 1662 gene locus_tag LOCUS_13380 <3882 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5U2:LPS-assembly protein LptD >Feature sequence256 410 78 gene locus_tag LOCUS_13390 410 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 831 424 gene locus_tag LOCUS_13400 831 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1140 1592 gene locus_tag LOCUS_13410 1140 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13410 1589 2104 gene locus_tag LOCUS_13420 1589 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13420 2107 3168 gene locus_tag LOCUS_13430 2107 3168 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence257 853 482 gene locus_tag LOCUS_13440 853 482 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639894.1 protein_id gnl|my_center|LOCUS_13440 1498 959 gene locus_tag LOCUS_13450 1498 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1693 2205 gene locus_tag LOCUS_13460 1693 2205 CDS product carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 protein_id gnl|my_center|LOCUS_13460 3198 2215 gene locus_tag LOCUS_13470 3198 2215 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926487.1 protein_id gnl|my_center|LOCUS_13470 <3868 3210 gene locus_tag LOCUS_13480 <3868 3210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921026.1:serine hydrolase >Feature sequence258 487 1293 gene locus_tag LOCUS_13490 487 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1617 2336 gene locus_tag LOCUS_13500 1617 2336 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_13500 2773 3333 gene locus_tag LOCUS_13510 2773 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence259 554 478 gene locus_tag LOCUS_t00030 554 478 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 540 1304 gene locus_tag LOCUS_13520 540 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703805.1 protein_id gnl|my_center|LOCUS_13520 1320 1841 gene locus_tag LOCUS_13530 1320 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1961 3796 gene locus_tag LOCUS_13540 gene sltY 1961 3796 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072113.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence260 <1 1544 gene locus_tag LOCUS_13550 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100071.1:RNA-binding transcriptional accessory protein 3685 1550 gene locus_tag LOCUS_13560 3685 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence261 408 851 gene locus_tag LOCUS_13570 gene aroQ1 408 851 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_13570 865 1326 gene locus_tag LOCUS_13580 865 1326 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269006.1 protein_id gnl|my_center|LOCUS_13580 1319 2698 gene locus_tag LOCUS_13590 gene accC 1319 2698 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_13590 2712 3584 gene locus_tag LOCUS_13600 gene prmA 2712 3584 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_13600 >Feature sequence262 296 221 gene locus_tag LOCUS_t00040 296 221 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 760 380 gene locus_tag LOCUS_13610 760 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090890.1 protein_id gnl|my_center|LOCUS_13610 832 1773 gene locus_tag LOCUS_13620 832 1773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_13620 1760 2533 gene locus_tag LOCUS_13630 gene yadH 1760 2533 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T0 protein_id gnl|my_center|LOCUS_13630 2540 3361 gene locus_tag LOCUS_13640 gene queF 2540 3361 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I037 protein_id gnl|my_center|LOCUS_13640 3550 3383 gene locus_tag LOCUS_13650 3550 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3736 3823 gene locus_tag LOCUS_t00050 3736 3823 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence263 1826 735 gene locus_tag LOCUS_13660 1826 735 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_13660 3358 1934 gene locus_tag LOCUS_13670 3358 1934 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGS2 protein_id gnl|my_center|LOCUS_13670 >Feature sequence264 1363 452 gene locus_tag LOCUS_13680 gene exo 1363 452 CDS product exodeoxyribonuclease IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_13680 1914 1363 gene locus_tag LOCUS_13690 1914 1363 CDS product transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947623.1 protein_id gnl|my_center|LOCUS_13690 2153 1914 gene locus_tag LOCUS_13700 gene tusA 2153 1914 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_13700 2389 2150 gene locus_tag LOCUS_13710 2389 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2562 3086 gene locus_tag LOCUS_13720 2562 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_13720 3319 3083 gene locus_tag LOCUS_13730 3319 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 <3818 3297 gene locus_tag LOCUS_13740 <3818 3297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114618.1:MFS metabolite transporter >Feature sequence265 150 2327 gene locus_tag LOCUS_13750 150 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2394 3260 gene locus_tag LOCUS_13760 2394 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_13760 <3818 3280 gene locus_tag LOCUS_13770 <3818 3280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730868.1:short-chain dehydrogenase >Feature sequence266 966 520 gene locus_tag LOCUS_13780 966 520 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_13780 2462 981 gene locus_tag LOCUS_13790 gene nnr 2462 981 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_13790 2480 3559 gene locus_tag LOCUS_13800 gene queG 2480 3559 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY6 protein_id gnl|my_center|LOCUS_13800 >Feature sequence267 905 1498 gene locus_tag LOCUS_13810 905 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2512 1541 gene locus_tag LOCUS_13820 gene tqsA 2512 1541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence268 671 123 gene locus_tag LOCUS_13830 gene yfhC 671 123 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_13830 768 1583 gene locus_tag LOCUS_13840 768 1583 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 protein_id gnl|my_center|LOCUS_13840 2498 1644 gene locus_tag LOCUS_13850 2498 1644 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 protein_id gnl|my_center|LOCUS_13850 3344 2577 gene locus_tag LOCUS_13860 3344 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence269 1839 586 gene locus_tag LOCUS_13870 1839 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2703 2056 gene locus_tag LOCUS_13880 2703 2056 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 protein_id gnl|my_center|LOCUS_13880 2735 3454 gene locus_tag LOCUS_13890 2735 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence270 311 1177 gene locus_tag LOCUS_13900 311 1177 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_13900 2362 1193 gene locus_tag LOCUS_13910 2362 1193 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_13910 3560 2373 gene locus_tag LOCUS_13920 3560 2373 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence271 451 1548 gene locus_tag LOCUS_13930 451 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1545 2759 gene locus_tag LOCUS_13940 1545 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence272 <3758 438 gene locus_tag LOCUS_13950 <3758 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein >Feature sequence273 1583 939 gene locus_tag LOCUS_13960 1583 939 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730273.1 protein_id gnl|my_center|LOCUS_13960 1821 2279 gene locus_tag LOCUS_13970 1821 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence274 425 1480 gene locus_tag LOCUS_13980 425 1480 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_13980 <3732 1502 gene locus_tag LOCUS_13990 <3732 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210878.1:membrane protein >Feature sequence275 <1 595 gene locus_tag LOCUS_14000 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPF6:UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase 610 3192 gene locus_tag LOCUS_14010 610 3192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence276 977 96 gene locus_tag LOCUS_14020 977 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704001.1 protein_id gnl|my_center|LOCUS_14020 2662 1049 gene locus_tag LOCUS_14030 2662 1049 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040488.1 protein_id gnl|my_center|LOCUS_14030 3609 2677 gene locus_tag LOCUS_14040 3609 2677 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence277 818 129 gene locus_tag LOCUS_14050 818 129 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_14050 1948 953 gene locus_tag LOCUS_14060 1948 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2281 3057 gene locus_tag LOCUS_14070 gene hetN 2281 3057 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence278 3 1937 gene locus_tag LOCUS_14080 3 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1939 2472 gene locus_tag LOCUS_14090 1939 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2469 2942 gene locus_tag LOCUS_14100 2469 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence279 404 1360 gene locus_tag LOCUS_14110 404 1360 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_14110 1376 2494 gene locus_tag LOCUS_14120 gene arcT 1376 2494 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R6 protein_id gnl|my_center|LOCUS_14120 >Feature sequence280 595 1518 gene locus_tag LOCUS_14130 595 1518 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_14130 1515 1997 gene locus_tag LOCUS_14140 1515 1997 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence281 <1 876 gene locus_tag LOCUS_14150 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122176.1:thiol-disulfide isomerase 2512 902 gene locus_tag LOCUS_14160 2512 902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528531.1 protein_id gnl|my_center|LOCUS_14160 3402 2512 gene locus_tag LOCUS_14170 3402 2512 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence282 340 20 gene locus_tag LOCUS_14180 340 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 252 788 gene locus_tag LOCUS_14190 252 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 801 2324 gene locus_tag LOCUS_14200 801 2324 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_14200 2324 3289 gene locus_tag LOCUS_14210 2324 3289 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence283 2740 1436 gene locus_tag LOCUS_14220 gene rsmB 2740 1436 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_14220 <3694 2743 gene locus_tag LOCUS_14230 <3694 2743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O85732:methionyl-tRNA formyltransferase >Feature sequence284 772 2064 gene locus_tag LOCUS_14240 772 2064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_14240 3063 2092 gene locus_tag LOCUS_14250 3063 2092 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence285 739 224 gene locus_tag LOCUS_14260 gene aroK 739 224 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_14260 2812 743 gene locus_tag LOCUS_14270 gene pilQ 2812 743 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_14270 3445 2915 gene locus_tag LOCUS_14280 gene pilP 3445 2915 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence286 1732 740 gene locus_tag LOCUS_14290 1732 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1957 2121 gene locus_tag LOCUS_14300 1957 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2146 2283 gene locus_tag LOCUS_14310 2146 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2320 2487 gene locus_tag LOCUS_14320 2320 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14320 3180 2518 gene locus_tag LOCUS_14330 3180 2518 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_14330 3516 3235 gene locus_tag LOCUS_14340 3516 3235 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence287 1956 1417 gene locus_tag LOCUS_14350 gene pilI 1956 1417 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_14350 2360 1956 gene locus_tag LOCUS_14360 gene pilG 2360 1956 CDS product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 protein_id gnl|my_center|LOCUS_14360 >Feature sequence288 878 1753 gene locus_tag LOCUS_14370 878 1753 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 protein_id gnl|my_center|LOCUS_14370 1882 3222 gene locus_tag LOCUS_14380 1882 3222 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114138.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence289 466 945 gene locus_tag LOCUS_14390 466 945 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706997.1 protein_id gnl|my_center|LOCUS_14390 965 2203 gene locus_tag LOCUS_14400 965 2203 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_14400 3204 2200 gene locus_tag LOCUS_14410 3204 2200 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence290 939 160 gene locus_tag LOCUS_14420 gene fabG 939 160 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_14420 2666 936 gene locus_tag LOCUS_14430 2666 936 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_14430 3197 2679 gene locus_tag LOCUS_14440 3197 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence291 1712 2788 gene locus_tag LOCUS_14450 1712 2788 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040591.1 protein_id gnl|my_center|LOCUS_14450 2785 3522 gene locus_tag LOCUS_14460 2785 3522 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence292 2 1336 gene locus_tag LOCUS_14470 2 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1959 1657 gene locus_tag LOCUS_14480 1959 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2209 2346 gene locus_tag LOCUS_14490 2209 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3572 2397 gene locus_tag LOCUS_14500 3572 2397 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence293 176 559 gene locus_tag LOCUS_14510 176 559 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_14510 1475 627 gene locus_tag LOCUS_14520 1475 627 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_14520 1617 3629 gene locus_tag LOCUS_14530 gene recG 1617 3629 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_14530 >Feature sequence294 2770 1094 gene locus_tag LOCUS_14540 2770 1094 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ35 protein_id gnl|my_center|LOCUS_14540 <3634 2792 gene locus_tag LOCUS_14550 <3634 2792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVD6:pyruvate dehydrogenase E1 component >Feature sequence295 2697 1081 gene locus_tag LOCUS_14560 2697 1081 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGS2 protein_id gnl|my_center|LOCUS_14560 >Feature sequence296 3271 1583 gene locus_tag LOCUS_14570 3271 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence297 184 1383 gene locus_tag LOCUS_14580 184 1383 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_14580 1383 2639 gene locus_tag LOCUS_14590 gene murA 1383 2639 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P719 protein_id gnl|my_center|LOCUS_14590 2652 3557 gene locus_tag LOCUS_14600 2652 3557 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence298 792 1619 gene locus_tag LOCUS_14610 792 1619 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_14610 1631 2158 gene locus_tag LOCUS_14620 1631 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2155 3084 gene locus_tag LOCUS_14630 2155 3084 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence299 3363 1354 gene locus_tag LOCUS_14640 gene gspD 3363 1354 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262833.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence300 1051 3492 gene locus_tag LOCUS_14650 gene mrcA 1051 3492 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_14650 >Feature sequence301 <1 965 gene locus_tag LOCUS_14660 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63WB9:dihydroxy-acid dehydratase 971 1825 gene locus_tag LOCUS_14670 971 1825 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090614.1 protein_id gnl|my_center|LOCUS_14670 1868 2764 gene locus_tag LOCUS_14680 1868 2764 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_14680 3012 3356 gene locus_tag LOCUS_14690 3012 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence302 <1 508 gene locus_tag LOCUS_14700 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QNU3:sulfurtransferase FdhD 544 1002 gene locus_tag LOCUS_14710 gene fdsG 544 1002 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 protein_id gnl|my_center|LOCUS_14710 999 2024 gene locus_tag LOCUS_14720 999 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 <3548 2835 gene locus_tag LOCUS_14730 <3548 2835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I553:alanine--tRNA ligase >Feature sequence303 1887 1657 gene locus_tag LOCUS_14740 1887 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2567 1884 gene locus_tag LOCUS_14750 2567 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence304 837 481 gene locus_tag LOCUS_14760 837 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1059 1385 gene locus_tag LOCUS_14770 1059 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2801 1485 gene locus_tag LOCUS_14780 2801 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence305 746 171 gene locus_tag LOCUS_14790 746 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3379 854 gene locus_tag LOCUS_14800 3379 854 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence306 1700 2842 gene locus_tag LOCUS_14810 gene clS 1700 2842 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769406.1 protein_id gnl|my_center|LOCUS_14810 <3533 2849 gene locus_tag LOCUS_14820 <3533 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUB3:Sec-independent protein translocase protein TatC >Feature sequence307 <1 1568 gene locus_tag LOCUS_14830 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705450.1:outer membrane protein assembly factor >Feature sequence308 2026 599 gene locus_tag LOCUS_14840 2026 599 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_14840 2260 3414 gene locus_tag LOCUS_14850 2260 3414 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence309 1228 551 gene locus_tag LOCUS_14860 1228 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2049 1402 gene locus_tag LOCUS_14870 gene can 2049 1402 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB3 protein_id gnl|my_center|LOCUS_14870 3042 2353 gene locus_tag LOCUS_14880 3042 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence310 391 636 gene locus_tag LOCUS_14890 391 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 661 1458 gene locus_tag LOCUS_14900 661 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1495 2775 gene locus_tag LOCUS_14910 1495 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence311 1203 199 gene locus_tag LOCUS_14920 1203 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2157 1420 gene locus_tag LOCUS_14930 2157 1420 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 protein_id gnl|my_center|LOCUS_14930 2897 2154 gene locus_tag LOCUS_14940 2897 2154 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_14940 <3505 2913 gene locus_tag LOCUS_14950 <3505 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895493.1:type VI secretion protein IcmF >Feature sequence312 1625 1338 gene locus_tag LOCUS_14960 gene gatC 1625 1338 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS0 protein_id gnl|my_center|LOCUS_14960 1829 2890 gene locus_tag LOCUS_14970 gene mreB 1829 2890 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence313 1346 549 gene locus_tag LOCUS_14980 1346 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1909 1349 gene locus_tag LOCUS_14990 1909 1349 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464867.1 protein_id gnl|my_center|LOCUS_14990 3062 1950 gene locus_tag LOCUS_15000 3062 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence314 2548 878 gene locus_tag LOCUS_15010 2548 878 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477565.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence315 1036 1944 gene locus_tag LOCUS_15020 1036 1944 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_15020 1948 2223 gene locus_tag LOCUS_15030 1948 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2207 2473 gene locus_tag LOCUS_15040 2207 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3479 2439 gene locus_tag LOCUS_15050 3479 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence316 799 449 gene locus_tag LOCUS_15060 799 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <3476 878 gene locus_tag LOCUS_15070 <3476 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920248.1:cation transporter >Feature sequence317 533 1600 gene locus_tag LOCUS_15080 533 1600 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 protein_id gnl|my_center|LOCUS_15080 2192 1614 gene locus_tag LOCUS_15090 gene nfuA 2192 1614 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_15090 >Feature sequence318 1019 2761 gene locus_tag LOCUS_15100 1019 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 >Feature sequence319 <1 365 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtatatcagatagggaattgagctctgacaacaac 842 766 gene locus_tag LOCUS_t00060 842 766 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1063 881 gene locus_tag LOCUS_15110 1063 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3010 1217 gene locus_tag LOCUS_15120 3010 1217 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence320 934 1407 gene locus_tag LOCUS_15130 934 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_15130 1667 2170 gene locus_tag LOCUS_15140 1667 2170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071751.1 protein_id gnl|my_center|LOCUS_15140 2866 2384 gene locus_tag LOCUS_15150 2866 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence321 17 628 gene locus_tag LOCUS_15160 17 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 861 625 gene locus_tag LOCUS_15170 861 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1375 896 gene locus_tag LOCUS_15180 1375 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_15180 1659 2261 gene locus_tag LOCUS_15190 1659 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence322 <1 1012 gene locus_tag LOCUS_15200 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIA9:glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1088 1717 gene locus_tag LOCUS_15210 1088 1717 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_15210 1732 3282 gene locus_tag LOCUS_15220 1732 3282 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence323 1133 1981 gene locus_tag LOCUS_15230 1133 1981 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_15230 2809 2024 gene locus_tag LOCUS_15240 2809 2024 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E524 protein_id gnl|my_center|LOCUS_15240 >Feature sequence324 1 207 gene locus_tag LOCUS_15250 1 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 238 942 gene locus_tag LOCUS_15260 238 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_15260 1829 939 gene locus_tag LOCUS_15270 gene htpX 1829 939 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 protein_id gnl|my_center|LOCUS_15270 2355 2017 gene locus_tag LOCUS_15280 2355 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3191 2472 gene locus_tag LOCUS_15290 3191 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence325 1195 2436 gene locus_tag LOCUS_15300 1195 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 <3437 2433 gene locus_tag LOCUS_15310 <3437 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUK1:DNA topoisomerase 4 subunit A >Feature sequence326 1771 1169 gene locus_tag LOCUS_15320 1771 1169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 protein_id gnl|my_center|LOCUS_15320 <3435 1774 gene locus_tag LOCUS_15330 <3435 1774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KHL9:DNA ligase >Feature sequence327 810 298 gene locus_tag LOCUS_15340 810 298 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAU5 protein_id gnl|my_center|LOCUS_15340 2161 803 gene locus_tag LOCUS_15350 2161 803 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_15350 2431 2162 gene locus_tag LOCUS_15360 2431 2162 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400240.1 protein_id gnl|my_center|LOCUS_15360 3300 2443 gene locus_tag LOCUS_15370 3300 2443 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_15370 >Feature sequence328 1581 1225 gene locus_tag LOCUS_15380 1581 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2326 1778 gene locus_tag LOCUS_15390 2326 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2565 2434 gene locus_tag LOCUS_15400 2565 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2586 2795 gene locus_tag LOCUS_15410 2586 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence329 <1 1244 gene locus_tag LOCUS_15420 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066717.1:TonB-dependent receptor 1318 3318 gene locus_tag LOCUS_15430 1318 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence330 2473 1070 gene locus_tag LOCUS_15440 gene thrC 2473 1070 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_15440 <3408 2498 gene locus_tag LOCUS_15450 <3408 2498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P29365:homoserine dehydrogenase >Feature sequence331 126 1502 gene locus_tag LOCUS_15460 126 1502 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_15460 1504 2616 gene locus_tag LOCUS_15470 1504 2616 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246030.1 protein_id gnl|my_center|LOCUS_15470 2609 3118 gene locus_tag LOCUS_15480 2609 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence332 <1 1314 gene locus_tag LOCUS_15490 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LA0:UvrABC system protein A 1763 1374 gene locus_tag LOCUS_15500 gene rplQ 1763 1374 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK46 protein_id gnl|my_center|LOCUS_15500 2829 1825 gene locus_tag LOCUS_15510 gene rpoA 2829 1825 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR8 protein_id gnl|my_center|LOCUS_15510 <3405 2866 gene locus_tag LOCUS_15520 <3405 2866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O52759:30S ribosomal protein S4 >Feature sequence333 <1 806 gene locus_tag LOCUS_15530 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KKG3:pseudouridine synthase 806 1471 gene locus_tag LOCUS_15540 806 1471 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_15540 2008 1424 gene locus_tag LOCUS_15550 2008 1424 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV74 protein_id gnl|my_center|LOCUS_15550 2090 2623 gene locus_tag LOCUS_15560 2090 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_15560 2628 2810 gene locus_tag LOCUS_15570 gene rpmF 2628 2810 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN60 protein_id gnl|my_center|LOCUS_15570 >Feature sequence334 <1 1190 gene locus_tag LOCUS_15580 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390664.1:two-component sensor histidine kinase 2055 1201 gene locus_tag LOCUS_15590 2055 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2232 3275 gene locus_tag LOCUS_15600 2232 3275 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969985.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence335 969 2165 gene locus_tag LOCUS_15610 969 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_15610 3381 2308 gene locus_tag LOCUS_15620 3381 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence336 >Feature sequence337 <1 1011 gene locus_tag LOCUS_15630 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405245.1:glycosyl hydrolase 1120 1776 gene locus_tag LOCUS_15640 1120 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_15640 1865 2566 gene locus_tag LOCUS_15650 1865 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2583 2870 gene locus_tag LOCUS_15660 2583 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence338 >Feature sequence339 <1 990 gene locus_tag LOCUS_15670 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730955.1:lipid-transfer protein 2358 1051 gene locus_tag LOCUS_15680 2358 1051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119153.1 protein_id gnl|my_center|LOCUS_15680 2555 2746 gene locus_tag LOCUS_15690 2555 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 <3369 2853 gene locus_tag LOCUS_15700 <3369 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704883.1:3-oxoacyl-ACP reductase >Feature sequence340 940 152 gene locus_tag LOCUS_15710 940 152 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_15710 1109 1690 gene locus_tag LOCUS_15720 gene ampD 1109 1690 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_15720 1690 2559 gene locus_tag LOCUS_15730 1690 2559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_15730 2575 3342 gene locus_tag LOCUS_15740 2575 3342 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence341 2287 653 gene locus_tag LOCUS_15750 gene pilS 2287 653 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_15750 <3345 2508 gene locus_tag LOCUS_15760 <3345 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33641:outer membrane protein assembly factor BamD >Feature sequence342 209 1651 gene locus_tag LOCUS_15770 209 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1635 2282 gene locus_tag LOCUS_15780 1635 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence343 317 721 gene locus_tag LOCUS_15790 317 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1427 744 gene locus_tag LOCUS_15800 1427 744 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105836.1 protein_id gnl|my_center|LOCUS_15800 1858 1475 gene locus_tag LOCUS_15810 1858 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 <3338 1828 gene locus_tag LOCUS_15820 <3338 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706128.1:short chain dehydrogenase note possible pseudo, frameshifted >Feature sequence344 917 684 gene locus_tag LOCUS_15830 917 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_15830 1110 2510 gene locus_tag LOCUS_15840 1110 2510 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_15840 <3323 2514 gene locus_tag LOCUS_15850 <3323 2514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEN5:quinolinate synthase A >Feature sequence345 1332 166 gene locus_tag LOCUS_15860 1332 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2326 1691 gene locus_tag LOCUS_15870 2326 1691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381663.1 protein_id gnl|my_center|LOCUS_15870 3061 2330 gene locus_tag LOCUS_15880 3061 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence346 438 1580 gene locus_tag LOCUS_15890 gene metX 438 1580 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 protein_id gnl|my_center|LOCUS_15890 1580 2170 gene locus_tag LOCUS_15900 1580 2170 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_15900 2160 2600 gene locus_tag LOCUS_15910 2160 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_15910 2587 3207 gene locus_tag LOCUS_15920 2587 3207 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence347 1952 615 gene locus_tag LOCUS_15930 1952 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 <3317 2123 gene locus_tag LOCUS_15940 <3317 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89MQ0:UPF0061 protein >Feature sequence348 1179 160 gene locus_tag LOCUS_15950 1179 160 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_15950 2386 1199 gene locus_tag LOCUS_15960 2386 1199 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_15960 <3315 2537 gene locus_tag LOCUS_15970 <3315 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227519.1:short-chain dehydrogenase >Feature sequence349 <3306 2798 gene locus_tag LOCUS_15980 <3306 2798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974566.1:sensor >Feature sequence350 <1 672 gene locus_tag LOCUS_15990 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405558.1:ATPase 665 1489 gene locus_tag LOCUS_16000 665 1489 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_16000 2275 1496 gene locus_tag LOCUS_16010 2275 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2719 2303 gene locus_tag LOCUS_16020 2719 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence351 1565 558 gene locus_tag LOCUS_16030 gene acoB 1565 558 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 protein_id gnl|my_center|LOCUS_16030 2554 1577 gene locus_tag LOCUS_16040 2554 1577 CDS product dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_16040 <3292 2633 gene locus_tag LOCUS_16050 <3292 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919187.1:acyl-CoA dehydrogenase >Feature sequence352 <1 1881 gene locus_tag LOCUS_16060 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141986.1:penicillin amidase 3221 1956 gene locus_tag LOCUS_16070 gene speB 3221 1956 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence353 451 1638 gene locus_tag LOCUS_16080 451 1638 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_16080 1647 2786 gene locus_tag LOCUS_16090 1647 2786 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence354 763 1392 gene locus_tag LOCUS_16100 763 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1545 1925 gene locus_tag LOCUS_16110 1545 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2842 1937 gene locus_tag LOCUS_16120 2842 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence355 543 1556 gene locus_tag LOCUS_16130 543 1556 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_16130 1553 2047 gene locus_tag LOCUS_16140 gene ybeY 1553 2047 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQ74 protein_id gnl|my_center|LOCUS_16140 2044 2886 gene locus_tag LOCUS_16150 2044 2886 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence356 1958 975 gene locus_tag LOCUS_16160 gene pstS 1958 975 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_16160 3140 2016 gene locus_tag LOCUS_16170 gene phoR 3140 2016 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_16170 >Feature sequence357 270 31 gene locus_tag LOCUS_16180 270 31 CDS product BolA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348457.1 protein_id gnl|my_center|LOCUS_16180 1083 379 gene locus_tag LOCUS_16190 gene ttg2D 1083 379 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_16190 1198 2178 gene locus_tag LOCUS_16200 1198 2178 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_16200 2210 3190 gene locus_tag LOCUS_16210 gene kdsD 2210 3190 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_16210 >Feature sequence358 21 2309 gene locus_tag LOCUS_16220 gene clpA 21 2309 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_16220 2602 2384 gene locus_tag LOCUS_16230 gene infA 2602 2384 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_16230 3245 2703 gene locus_tag LOCUS_16240 gene ate 3245 2703 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_16240 >Feature sequence359 3 209 gene locus_tag LOCUS_16250 3 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1042 248 gene locus_tag LOCUS_16260 gene ditI 1042 248 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_16260 1194 1778 gene locus_tag LOCUS_16270 1194 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence360 1629 835 gene locus_tag LOCUS_16280 1629 835 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 protein_id gnl|my_center|LOCUS_16280 2523 1648 gene locus_tag LOCUS_16290 2523 1648 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_16290 3001 2534 gene locus_tag LOCUS_16300 3001 2534 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053852.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence361 1582 512 gene locus_tag LOCUS_16310 1582 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2250 1579 gene locus_tag LOCUS_16320 2250 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2676 2380 gene locus_tag LOCUS_16330 2676 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence362 281 1516 gene locus_tag LOCUS_16340 281 1516 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892094.1 protein_id gnl|my_center|LOCUS_16340 2144 1500 gene locus_tag LOCUS_16350 2144 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 <3214 2123 gene locus_tag LOCUS_16360 <3214 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902857.1:membrane protein >Feature sequence363 <1 1214 gene locus_tag LOCUS_16370 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088947.1:quinoprotein ethanol dehydrogenase 1448 2320 gene locus_tag LOCUS_16380 1448 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence364 <1 824 gene locus_tag LOCUS_16390 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055994.1:tetracycline resistance MFS efflux pump 2513 1095 gene locus_tag LOCUS_16400 2513 1095 CDS product carotenoid oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence365 <1 815 gene locus_tag LOCUS_16410 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027934.1:dehydrogenase 820 1053 gene locus_tag LOCUS_16420 820 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1056 1448 gene locus_tag LOCUS_16430 1056 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1486 2826 gene locus_tag LOCUS_16440 1486 2826 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence366 229 1203 gene locus_tag LOCUS_16450 229 1203 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_16450 1247 2416 gene locus_tag LOCUS_16460 1247 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_16460 3146 2466 gene locus_tag LOCUS_16470 3146 2466 CDS product diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence367 1498 137 gene locus_tag LOCUS_16480 1498 137 CDS product polysaccharide export related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709180.1 protein_id gnl|my_center|LOCUS_16480 2634 1495 gene locus_tag LOCUS_16490 2634 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence368 2088 661 gene locus_tag LOCUS_16500 gene pykA 2088 661 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFM1 protein_id gnl|my_center|LOCUS_16500 <3149 2085 gene locus_tag LOCUS_16510 <3149 2085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390217.1:hydroxypyruvate reductase >Feature sequence369 <1 2211 gene locus_tag LOCUS_16520 <1 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923250.1:TonB-dependent receptor 2379 2828 gene locus_tag LOCUS_16530 2379 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3147 2956 gene locus_tag LOCUS_16540 3147 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence370 561 971 gene locus_tag LOCUS_16550 561 971 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106034.1 protein_id gnl|my_center|LOCUS_16550 1384 1049 gene locus_tag LOCUS_16560 1384 1049 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103157.1 protein_id gnl|my_center|LOCUS_16560 2060 3049 gene locus_tag LOCUS_16570 2060 3049 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence371 <1 839 gene locus_tag LOCUS_16580 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZG0:ribosomal RNA large subunit methyltransferase K/L 2160 1135 gene locus_tag LOCUS_16590 2160 1135 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_16590 2191 2649 gene locus_tag LOCUS_16600 2191 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2664 3134 gene locus_tag LOCUS_16610 2664 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence372 629 108 gene locus_tag LOCUS_16620 gene dsbB2 629 108 CDS product disulfide bond formation protein B 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57701 protein_id gnl|my_center|LOCUS_16620 1112 2293 gene locus_tag LOCUS_16630 gene purT 1112 2293 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWZ4 protein_id gnl|my_center|LOCUS_16630 >Feature sequence373 98 850 gene locus_tag LOCUS_16640 98 850 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_16640 2024 879 gene locus_tag LOCUS_16650 2024 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2854 2030 gene locus_tag LOCUS_16660 2854 2030 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence374 1385 96 gene locus_tag LOCUS_16670 gene hemL 1385 96 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHB0 protein_id gnl|my_center|LOCUS_16670 1898 1479 gene locus_tag LOCUS_16680 1898 1479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947265.1 protein_id gnl|my_center|LOCUS_16680 <3132 1908 gene locus_tag LOCUS_16690 <3132 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942999.1:chloride channel protein >Feature sequence375 950 2113 gene locus_tag LOCUS_16700 950 2113 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_16700 <3126 2119 gene locus_tag LOCUS_16710 <3126 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262022.1:arylsulfatase >Feature sequence376 34 489 gene locus_tag LOCUS_16720 34 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 619 2886 gene locus_tag LOCUS_16730 619 2886 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence377 1898 720 gene locus_tag LOCUS_16740 1898 720 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808070.1 protein_id gnl|my_center|LOCUS_16740 <3116 1929 gene locus_tag LOCUS_16750 <3116 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HD65:glutamate-1-semialdehyde 2,1-aminomutase 2 >Feature sequence378 704 1927 gene locus_tag LOCUS_16760 704 1927 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence379 1081 107 gene locus_tag LOCUS_16770 1081 107 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887496.1 protein_id gnl|my_center|LOCUS_16770 1791 1078 gene locus_tag LOCUS_16780 1791 1078 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389547.1 protein_id gnl|my_center|LOCUS_16780 2789 1914 gene locus_tag LOCUS_16790 2789 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence380 533 330 gene locus_tag LOCUS_16800 533 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 802 1458 gene locus_tag LOCUS_16810 802 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1698 1528 gene locus_tag LOCUS_16820 1698 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1923 1837 gene locus_tag LOCUS_t00070 1923 1837 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence381 120 1556 gene locus_tag LOCUS_16830 120 1556 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_16830 1684 3039 gene locus_tag LOCUS_16840 1684 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence382 431 1444 gene locus_tag LOCUS_16850 431 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1353 1574 gene locus_tag LOCUS_16860 1353 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1580 2404 gene locus_tag LOCUS_16870 1580 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_16870 2503 2799 gene locus_tag LOCUS_16880 2503 2799 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890111.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence383 86 1066 gene locus_tag LOCUS_16890 86 1066 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_16890 1502 1089 gene locus_tag LOCUS_16900 1502 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114197.1 protein_id gnl|my_center|LOCUS_16900 2454 1495 gene locus_tag LOCUS_16910 gene dhmA 2454 1495 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_16910 >Feature sequence384 <1 927 gene locus_tag LOCUS_16920 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103022.1:acyl-CoA thiolase 938 2053 gene locus_tag LOCUS_16930 gene ribB 938 2053 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_16930 2824 2057 gene locus_tag LOCUS_16940 2824 2057 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918285.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence385 <1 1057 gene locus_tag LOCUS_16950 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005051889.1:acyl-CoA synthetase 1147 1983 gene locus_tag LOCUS_16960 1147 1983 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077173.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence386 935 2683 gene locus_tag LOCUS_16970 935 2683 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence387 475 1185 gene locus_tag LOCUS_16980 475 1185 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_16980 2475 1195 gene locus_tag LOCUS_16990 2475 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16990 <3063 2423 gene locus_tag LOCUS_17000 <3063 2423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085964.1:monooxygenase note possible pseudo, frameshifted >Feature sequence388 2707 1325 gene locus_tag LOCUS_17010 2707 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence389 3 341 gene locus_tag LOCUS_17020 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 375 1058 gene locus_tag LOCUS_17030 375 1058 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172351.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence390 857 1651 gene locus_tag LOCUS_17040 gene kduD 857 1651 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_17040 2755 1679 gene locus_tag LOCUS_17050 2755 1679 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence391 484 609 gene locus_tag LOCUS_17060 484 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1536 853 gene locus_tag LOCUS_17070 1536 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2326 2072 gene locus_tag LOCUS_17080 2326 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2933 2331 gene locus_tag LOCUS_17090 2933 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence392 242 1108 gene locus_tag LOCUS_17100 242 1108 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974920.1 protein_id gnl|my_center|LOCUS_17100 1113 1565 gene locus_tag LOCUS_17110 1113 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1555 2703 gene locus_tag LOCUS_17120 1555 2703 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086647.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence393 1094 690 gene locus_tag LOCUS_17130 1094 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2017 1181 gene locus_tag LOCUS_17140 gene fabG3 2017 1181 CDS product 3-alpha-(or 20-beta)-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69166 protein_id gnl|my_center|LOCUS_17140 2193 2729 gene locus_tag LOCUS_17150 2193 2729 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence394 1135 1791 gene locus_tag LOCUS_17160 1135 1791 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_17160 1945 2805 gene locus_tag LOCUS_17170 1945 2805 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence395 1595 678 gene locus_tag LOCUS_17180 1595 678 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence396 1059 1721 gene locus_tag LOCUS_17190 1059 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2958 1759 gene locus_tag LOCUS_17200 gene dnaB 2958 1759 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_17200 >Feature sequence397 2609 2085 gene locus_tag LOCUS_17210 2609 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 >Feature sequence398 <1 599 gene locus_tag LOCUS_17220 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176634.1:EpsI family protein 602 2215 gene locus_tag LOCUS_17230 602 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence399 358 182 gene locus_tag LOCUS_17240 358 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1265 399 gene locus_tag LOCUS_17250 1265 399 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731406.1 protein_id gnl|my_center|LOCUS_17250 2272 1364 gene locus_tag LOCUS_17260 2272 1364 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_17260 <3005 2322 gene locus_tag LOCUS_17270 <3005 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74A53:carboxynorspermidine/carboxyspermidine decarboxylase >Feature sequence400 22 507 gene locus_tag LOCUS_17280 gene pilE 22 507 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_17280 614 2566 gene locus_tag LOCUS_17290 614 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence401 734 96 gene locus_tag LOCUS_17300 734 96 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_17300 989 2125 gene locus_tag LOCUS_17310 989 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2364 2837 gene locus_tag LOCUS_17320 2364 2837 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261062.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence402 1352 243 gene locus_tag LOCUS_17330 1352 243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389544.1 protein_id gnl|my_center|LOCUS_17330 <2983 1349 gene locus_tag LOCUS_17340 <2983 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887495.1:ABC transporter ATP-binding protein >Feature sequence403 1078 80 gene locus_tag LOCUS_17350 1078 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1722 1132 gene locus_tag LOCUS_17360 1722 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1821 2930 gene locus_tag LOCUS_17370 1821 2930 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EH78 protein_id gnl|my_center|LOCUS_17370 >Feature sequence404 1265 33 gene locus_tag LOCUS_17380 1265 33 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_17380 2087 1362 gene locus_tag LOCUS_17390 2087 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_17390 2249 2749 gene locus_tag LOCUS_17400 2249 2749 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence405 1980 697 gene locus_tag LOCUS_17410 gene hisS 1980 697 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FJU7 protein_id gnl|my_center|LOCUS_17410 <2953 1995 gene locus_tag LOCUS_17420 <2953 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXJ4:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) >Feature sequence406 1220 1546 gene locus_tag LOCUS_17430 gene trxA 1220 1546 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence407 1 732 gene locus_tag LOCUS_17440 1 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 738 1622 gene locus_tag LOCUS_17450 738 1622 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence408 995 2251 gene locus_tag LOCUS_17460 995 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence409 102 917 gene locus_tag LOCUS_17470 102 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1247 948 gene locus_tag LOCUS_17480 1247 948 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_17480 1492 2850 gene locus_tag LOCUS_17490 gene glmU 1492 2850 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAY5 protein_id gnl|my_center|LOCUS_17490 >Feature sequence410 165 1274 gene locus_tag LOCUS_17500 gene anmK 165 1274 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMW8 protein_id gnl|my_center|LOCUS_17500 1777 1286 gene locus_tag LOCUS_17510 1777 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2087 1734 gene locus_tag LOCUS_17520 gene erpA 2087 1734 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_17520 2596 2159 gene locus_tag LOCUS_17530 2596 2159 CDS product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_17530 2944 2603 gene locus_tag LOCUS_17540 2944 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence411 2388 952 gene locus_tag LOCUS_17550 2388 952 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502881.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence412 1999 1520 gene locus_tag LOCUS_17560 1999 1520 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968070.1 protein_id gnl|my_center|LOCUS_17560 2882 2001 gene locus_tag LOCUS_17570 2882 2001 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence413 202 711 gene locus_tag LOCUS_17580 202 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 708 1097 gene locus_tag LOCUS_17590 708 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1120 1572 gene locus_tag LOCUS_17600 1120 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2129 1590 gene locus_tag LOCUS_17610 2129 1590 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043733.1 protein_id gnl|my_center|LOCUS_17610 <2924 2126 gene locus_tag LOCUS_17620 <2924 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJW1:5-methylthioadenosine/S-adenosylhomocysteine deaminase >Feature sequence414 1451 318 gene locus_tag LOCUS_17630 gene acd 1451 318 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_17630 2671 1463 gene locus_tag LOCUS_17640 2671 1463 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_17640 2921 2682 gene locus_tag LOCUS_17650 2921 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence415 <1 1012 gene locus_tag LOCUS_17660 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DCP2:tryptophan synthase beta chain >Feature sequence416 1202 2326 gene locus_tag LOCUS_17670 1202 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_17670 <2897 2344 gene locus_tag LOCUS_17680 <2897 2344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729365.1:phosphotransferase >Feature sequence417 1032 1508 gene locus_tag LOCUS_17690 1032 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118447.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence418 2017 878 gene locus_tag LOCUS_17700 2017 878 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_17700 <2887 2030 gene locus_tag LOCUS_17710 <2887 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083841.1:acyl-CoA dehydrogenase >Feature sequence419 2 1210 gene locus_tag LOCUS_17720 2 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1388 2323 gene locus_tag LOCUS_17730 1388 2323 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence420 65 2296 gene locus_tag LOCUS_17740 65 2296 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_17740 <2881 2329 gene locus_tag LOCUS_17750 <2881 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257654.1:sugar transporter >Feature sequence421 1287 547 gene locus_tag LOCUS_17760 1287 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_17760 2106 1345 gene locus_tag LOCUS_17770 2106 1345 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_17770 <2880 2099 gene locus_tag LOCUS_17780 <2880 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWS2:UPF0276 protein >Feature sequence422 1231 1506 gene locus_tag LOCUS_17790 1231 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence423 >Feature sequence424 1469 474 gene locus_tag LOCUS_17800 gene hpnA 1469 474 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_17800 2768 1575 gene locus_tag LOCUS_17810 2768 1575 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence425 <1 528 gene locus_tag LOCUS_17820 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946338.1:Fe-S cluster assembly protein SufB 570 1319 gene locus_tag LOCUS_17830 570 1319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 protein_id gnl|my_center|LOCUS_17830 1319 2620 gene locus_tag LOCUS_17840 gene sufD 1319 2620 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence426 2148 448 gene locus_tag LOCUS_17850 gene argS 2148 448 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_17850 <2862 2217 gene locus_tag LOCUS_17860 <2862 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87V04:primosomal protein N' >Feature sequence427 <1 1367 gene locus_tag LOCUS_17870 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402334.1:ATP-dependent DNA helicase DinG 1790 1536 gene locus_tag LOCUS_17880 1790 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 <2856 1809 gene locus_tag LOCUS_17890 <2856 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPL5:ribonucleoside-diphosphate reductase subunit beta >Feature sequence428 1129 164 gene locus_tag LOCUS_17900 1129 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1907 1116 gene locus_tag LOCUS_17910 gene pilF 1907 1116 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_17910 <2853 1904 gene locus_tag LOCUS_17920 <2853 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51385:dual-specificity RNA methyltransferase RlmN >Feature sequence429 518 1150 gene locus_tag LOCUS_17930 518 1150 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD4 protein_id gnl|my_center|LOCUS_17930 1169 1798 gene locus_tag LOCUS_17940 1169 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1758 2756 gene locus_tag LOCUS_17950 gene mucB 1758 2756 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38108 protein_id gnl|my_center|LOCUS_17950 >Feature sequence430 1327 419 gene locus_tag LOCUS_17960 gene menA 1327 419 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNW3 protein_id gnl|my_center|LOCUS_17960 2666 1386 gene locus_tag LOCUS_17970 2666 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence431 1934 546 gene locus_tag LOCUS_17980 1934 546 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_17980 <2836 1993 gene locus_tag LOCUS_17990 <2836 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454895.1:alcohol dehydrogenase >Feature sequence432 756 1331 gene locus_tag LOCUS_18000 756 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2520 1444 gene locus_tag LOCUS_18010 2520 1444 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304146.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence433 <2835 752 gene locus_tag LOCUS_18020 <2835 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088947.1:quinoprotein ethanol dehydrogenase >Feature sequence434 <2823 1649 gene locus_tag LOCUS_18030 <2823 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919198.1:fatty acid--CoA ligase >Feature sequence435 <1 741 gene locus_tag LOCUS_18040 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2L1:DNA polymerase 1763 762 gene locus_tag LOCUS_18050 1763 762 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence436 1277 1026 gene locus_tag LOCUS_18060 gene hfq 1277 1026 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_18060 2354 1404 gene locus_tag LOCUS_18070 gene miaA 2354 1404 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_18070 >Feature sequence437 3 620 gene locus_tag LOCUS_18080 3 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1255 593 gene locus_tag LOCUS_18090 1255 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1751 1332 gene locus_tag LOCUS_18100 1751 1332 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207891.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence438 399 854 gene locus_tag LOCUS_18110 399 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2056 869 gene locus_tag LOCUS_18120 2056 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence439 338 1453 gene locus_tag LOCUS_18130 338 1453 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_18130 1481 2488 gene locus_tag LOCUS_18140 gene trpS 1481 2488 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYQ9 protein_id gnl|my_center|LOCUS_18140 >Feature sequence440 1647 472 gene locus_tag LOCUS_18150 1647 472 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence441 1182 1940 gene locus_tag LOCUS_18160 gene rsmJ 1182 1940 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886R2 protein_id gnl|my_center|LOCUS_18160 >Feature sequence442 2476 1238 gene locus_tag LOCUS_18170 2476 1238 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence443 403 1116 gene locus_tag LOCUS_18180 gene recO 403 1116 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44642 protein_id gnl|my_center|LOCUS_18180 1126 1500 gene locus_tag LOCUS_18190 gene acpS 1126 1500 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB6 protein_id gnl|my_center|LOCUS_18190 1525 2421 gene locus_tag LOCUS_18200 1525 2421 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_18200 >Feature sequence444 3 341 gene locus_tag LOCUS_18210 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 355 2259 gene locus_tag LOCUS_18220 355 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence445 <1 832 gene locus_tag LOCUS_18230 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920611.1:toxin HipA 983 1501 gene locus_tag LOCUS_18240 983 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1800 2342 gene locus_tag LOCUS_18250 1800 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence446 <1 1813 gene locus_tag LOCUS_18260 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:diguanylate cyclase >Feature sequence447 1200 274 gene locus_tag LOCUS_18270 1200 274 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence448 311 1108 gene locus_tag LOCUS_18280 gene uspE 311 1108 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_18280 2145 1105 gene locus_tag LOCUS_18290 gene ywcH 2145 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_18290 2264 2737 gene locus_tag LOCUS_18300 2264 2737 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence449 385 942 gene locus_tag LOCUS_18310 385 942 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_18310 986 2296 gene locus_tag LOCUS_18320 986 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence450 640 68 gene locus_tag LOCUS_18330 640 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2157 676 gene locus_tag LOCUS_18340 gene lysS 2157 676 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU0 protein_id gnl|my_center|LOCUS_18340 <2743 2184 gene locus_tag LOCUS_18350 <2743 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHA8:peptide chain release factor 2 >Feature sequence451 <1 520 gene locus_tag LOCUS_18360 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229596.1:CoA transferase 622 1953 gene locus_tag LOCUS_18370 622 1953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_18370 <2735 1978 gene locus_tag LOCUS_18380 <2735 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419253.1:3-oxosteroid 1-dehydrogenase >Feature sequence452 1075 392 gene locus_tag LOCUS_18390 1075 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_18390 1745 1065 gene locus_tag LOCUS_18400 1745 1065 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_18400 2700 1738 gene locus_tag LOCUS_18410 2700 1738 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124947.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence453 389 1588 gene locus_tag LOCUS_18420 389 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence454 254 856 gene locus_tag LOCUS_18430 254 856 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_18430 >Feature sequence455 <1 2473 gene locus_tag LOCUS_18440 <1 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112762.1:MexW/MexI family multidrug efflux RND transporter permease subunit >Feature sequence456 1086 2057 gene locus_tag LOCUS_18450 1086 2057 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 >Feature sequence457 1566 34 gene locus_tag LOCUS_18460 gene ppx 1566 34 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence458 1680 1294 gene locus_tag LOCUS_18470 1680 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2153 1869 gene locus_tag LOCUS_18480 2153 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence459 256 1077 gene locus_tag LOCUS_18490 256 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2016 1099 gene locus_tag LOCUS_18500 2016 1099 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence460 2050 1187 gene locus_tag LOCUS_18510 2050 1187 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731406.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence461 1177 269 gene locus_tag LOCUS_18520 gene rbsK 1177 269 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XGW5 protein_id gnl|my_center|LOCUS_18520 2266 1190 gene locus_tag LOCUS_18530 2266 1190 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence462 1173 199 gene locus_tag LOCUS_18540 1173 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1843 1505 gene locus_tag LOCUS_18550 1843 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_18550 2038 1853 gene locus_tag LOCUS_18560 2038 1853 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence463 2242 1877 gene locus_tag LOCUS_18570 2242 1877 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence464 697 1527 gene locus_tag LOCUS_18580 697 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551304.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence465 965 36 gene locus_tag LOCUS_18590 965 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1796 987 gene locus_tag LOCUS_18600 1796 987 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_18600 <2645 1815 gene locus_tag LOCUS_18610 <2645 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176617.1:chain-length determining protein >Feature sequence466 926 1231 gene locus_tag LOCUS_18620 926 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2636 1248 gene locus_tag LOCUS_18630 2636 1248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence467 1010 720 gene locus_tag LOCUS_18640 1010 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1614 1102 gene locus_tag LOCUS_18650 1614 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405082.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence468 74 490 gene locus_tag LOCUS_18660 74 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1173 559 gene locus_tag LOCUS_18670 1173 559 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_18670 1204 1794 gene locus_tag LOCUS_18680 1204 1794 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_18680 <2642 1840 gene locus_tag LOCUS_18690 <2642 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887384.1:aldehyde dehydrogenase >Feature sequence469 517 185 gene locus_tag LOCUS_18700 517 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1261 566 gene locus_tag LOCUS_18710 gene pyrF 1261 566 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N497 protein_id gnl|my_center|LOCUS_18710 1555 1262 gene locus_tag LOCUS_18720 1555 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1940 1644 gene locus_tag LOCUS_18730 gene ihfB 1940 1644 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N46 protein_id gnl|my_center|LOCUS_18730 >Feature sequence470 592 1791 gene locus_tag LOCUS_18740 592 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 <2639 1784 gene locus_tag LOCUS_18750 <2639 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529052.1:ABC transporter permease >Feature sequence471 1590 2483 gene locus_tag LOCUS_18760 1590 2483 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence472 1710 1943 gene locus_tag LOCUS_18770 1710 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 <2634 1839 gene locus_tag LOCUS_18780 <2634 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703354.1:putative lipid-transfer protein Ltp1 >Feature sequence473 <1 577 gene locus_tag LOCUS_18790 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114330.1:DNA polymerase III subunit delta 574 1191 gene locus_tag LOCUS_18800 gene mcbG 574 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_18800 1500 1210 gene locus_tag LOCUS_18810 1500 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1751 2446 gene locus_tag LOCUS_18820 1751 2446 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267742.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence474 1218 61 gene locus_tag LOCUS_18830 gene yjcL 1218 61 CDS product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 protein_id gnl|my_center|LOCUS_18830 <2630 1325 gene locus_tag LOCUS_18840 <2630 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence475 1060 2412 gene locus_tag LOCUS_18850 1060 2412 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence476 797 1798 gene locus_tag LOCUS_18860 797 1798 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_18860 1940 2089 gene locus_tag LOCUS_18870 1940 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence477 843 1571 gene locus_tag LOCUS_18880 843 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_18880 1574 2620 gene locus_tag LOCUS_18890 gene degP 1574 2620 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence478 <1 837 gene locus_tag LOCUS_18900 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZY87:pantothenate synthetase >Feature sequence479 >Feature sequence480 2064 1177 gene locus_tag LOCUS_18910 2064 1177 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence481 749 1786 gene locus_tag LOCUS_18920 749 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1810 2124 gene locus_tag LOCUS_18930 1810 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence482 >Feature sequence483 560 2011 gene locus_tag LOCUS_18940 560 2011 CDS product retinal pigment epithelial membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_18940 2560 2003 gene locus_tag LOCUS_18950 2560 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence484 1470 1922 gene locus_tag LOCUS_18960 1470 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23205 protein_id gnl|my_center|LOCUS_18960 >Feature sequence485 245 1609 gene locus_tag LOCUS_18970 gene fumC 245 1609 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_18970 >Feature sequence486 1953 736 gene locus_tag LOCUS_18980 1953 736 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence487 2390 39 gene locus_tag LOCUS_18990 gene rnr 2390 39 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_18990 >Feature sequence488 640 1233 gene locus_tag LOCUS_19000 gene hisB 640 1233 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_19000 1278 1934 gene locus_tag LOCUS_19010 gene hisH1 1278 1934 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_19010 >Feature sequence489 1681 485 gene locus_tag LOCUS_19020 1681 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence490 >Feature sequence491 <1 796 gene locus_tag LOCUS_19030 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120323.1:fructokinase >Feature sequence492 105 1313 gene locus_tag LOCUS_19040 105 1313 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EG58 protein_id gnl|my_center|LOCUS_19040 1322 2179 gene locus_tag LOCUS_19050 gene pabC 1322 2179 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence493 1508 528 gene locus_tag LOCUS_19060 1508 528 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 protein_id gnl|my_center|LOCUS_19060 1654 2499 gene locus_tag LOCUS_19070 1654 2499 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence494 >Feature sequence495 >Feature sequence496 561 1643 gene locus_tag LOCUS_19080 561 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2424 1651 gene locus_tag LOCUS_19090 2424 1651 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266208.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence497 2049 1558 gene locus_tag LOCUS_19100 gene rppH 2049 1558 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_19100 >Feature sequence498 150 1343 gene locus_tag LOCUS_19110 150 1343 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 protein_id gnl|my_center|LOCUS_19110 1340 2002 gene locus_tag LOCUS_19120 gene nth 1340 2002 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_19120 >Feature sequence499 969 2066 gene locus_tag LOCUS_19130 gene trmA 969 2066 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNF5 protein_id gnl|my_center|LOCUS_19130 >Feature sequence500 1289 2194 gene locus_tag LOCUS_19140 1289 2194 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113629.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence501 82 648 gene locus_tag LOCUS_19150 82 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 661 1920 gene locus_tag LOCUS_19160 661 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence502 1470 424 gene locus_tag LOCUS_19170 1470 424 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_19170 2311 1484 gene locus_tag LOCUS_19180 2311 1484 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence503 <1 670 gene locus_tag LOCUS_19190 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000864071.1:sodium:calcium antiporter 2264 978 gene locus_tag LOCUS_19200 2264 978 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJA6 protein_id gnl|my_center|LOCUS_19200 >Feature sequence504 783 2336 gene locus_tag LOCUS_19210 783 2336 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence505 >Feature sequence506 857 2482 gene locus_tag LOCUS_19220 857 2482 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence507 93 1214 gene locus_tag LOCUS_19230 93 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_19230 1610 1224 gene locus_tag LOCUS_19240 1610 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence508 729 1937 gene locus_tag LOCUS_19250 729 1937 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887546.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence509 <1 972 gene locus_tag LOCUS_19260 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0M7:siroheme synthase 1040 1570 gene locus_tag LOCUS_19270 1040 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 <2493 1567 gene locus_tag LOCUS_19280 <2493 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267119.1:peptidase S41 >Feature sequence510 2243 174 gene locus_tag LOCUS_19290 2243 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence511 1234 1884 gene locus_tag LOCUS_19300 1234 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 <2492 1899 gene locus_tag LOCUS_19310 <2492 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919061.1:transcriptional regulator >Feature sequence512 1841 1572 gene locus_tag LOCUS_19320 gene rpsO 1841 1572 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L2 protein_id gnl|my_center|LOCUS_19320 <2490 1937 gene locus_tag LOCUS_19330 <2490 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P72154:tRNA pseudouridine synthase B >Feature sequence513 865 272 gene locus_tag LOCUS_19340 865 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_19340 973 1590 gene locus_tag LOCUS_19350 973 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2225 1587 gene locus_tag LOCUS_19360 gene dsb 2225 1587 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708016.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence514 69 158 gene locus_tag LOCUS_t00080 69 158 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 319 993 gene locus_tag LOCUS_19370 319 993 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_19370 1072 1467 gene locus_tag LOCUS_19380 gene dsrE 1072 1467 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_19380 1472 1822 gene locus_tag LOCUS_19390 1472 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1824 2123 gene locus_tag LOCUS_19400 1824 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2130 2447 gene locus_tag LOCUS_19410 2130 2447 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 protein_id gnl|my_center|LOCUS_19410 >Feature sequence515 140 1009 gene locus_tag LOCUS_19420 gene rfbD 140 1009 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_19420 1006 2067 gene locus_tag LOCUS_19430 gene rfbB 1006 2067 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_19430 >Feature sequence516 372 1082 gene locus_tag LOCUS_19440 372 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1300 1935 gene locus_tag LOCUS_19450 1300 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence517 1088 15 gene locus_tag LOCUS_19460 1088 15 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_19460 <2474 1093 gene locus_tag LOCUS_19470 <2474 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456743.1:lytic transglycosylase >Feature sequence518 >Feature sequence519 588 1520 gene locus_tag LOCUS_19480 588 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence520 1158 385 gene locus_tag LOCUS_19490 gene cmoA 1158 385 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_19490 1240 2049 gene locus_tag LOCUS_19500 1240 2049 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_19500 2057 2446 gene locus_tag LOCUS_19510 2057 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence521 <1 728 gene locus_tag LOCUS_19520 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I719:protoheme IX farnesyltransferase 1 725 1402 gene locus_tag LOCUS_19530 gene senC 725 1402 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence522 261 1028 gene locus_tag LOCUS_19540 261 1028 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530305.1 protein_id gnl|my_center|LOCUS_19540 <2460 1163 gene locus_tag LOCUS_19550 <2460 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266456.1:ATP-dependent RNA helicase >Feature sequence523 1790 933 gene locus_tag LOCUS_19560 gene kdsA 1790 933 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRS8 protein_id gnl|my_center|LOCUS_19560 <2456 1787 gene locus_tag LOCUS_19570 <2456 1787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGH2:CTP synthase >Feature sequence524 873 289 gene locus_tag LOCUS_19580 873 289 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 protein_id gnl|my_center|LOCUS_19580 1463 870 gene locus_tag LOCUS_19590 gene gmhA 1463 870 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_19590 1823 1467 gene locus_tag LOCUS_19600 1823 1467 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SH5 protein_id gnl|my_center|LOCUS_19600 <2455 1860 gene locus_tag LOCUS_19610 <2455 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103096.1:penicillin-binding protein activator >Feature sequence525 1246 509 gene locus_tag LOCUS_19620 1246 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 <2451 1243 gene locus_tag LOCUS_19630 <2451 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582952.1:ATP-grasp protein >Feature sequence526 <1 513 gene locus_tag LOCUS_19640 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206144.1:AraC family transcriptional regulator 602 1114 gene locus_tag LOCUS_19650 602 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1199 1423 gene locus_tag LOCUS_19660 1199 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1428 1682 gene locus_tag LOCUS_19670 1428 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence527 1071 391 gene locus_tag LOCUS_19680 1071 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1600 1076 gene locus_tag LOCUS_19690 1600 1076 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968030.1 protein_id gnl|my_center|LOCUS_19690 1762 2091 gene locus_tag LOCUS_19700 1762 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence528 705 1727 gene locus_tag LOCUS_19710 gene glsA 705 1727 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSH9 protein_id gnl|my_center|LOCUS_19710 >Feature sequence529 904 2064 gene locus_tag LOCUS_19720 904 2064 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971791.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence530 689 2158 gene locus_tag LOCUS_19730 689 2158 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence531 <1 1456 gene locus_tag LOCUS_19740 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206764.1:TonB-dependent receptor 1474 2397 gene locus_tag LOCUS_19750 1474 2397 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406220.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence532 <1 2119 gene locus_tag LOCUS_19760 <1 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase >Feature sequence533 1573 428 gene locus_tag LOCUS_19770 1573 428 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_19770 <2428 1605 gene locus_tag LOCUS_19780 <2428 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390868.1:exosortase A >Feature sequence534 571 161 gene locus_tag LOCUS_19790 571 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 737 1162 gene locus_tag LOCUS_19800 737 1162 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228575.1 protein_id gnl|my_center|LOCUS_19800 2393 1191 gene locus_tag LOCUS_19810 2393 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence535 >Feature sequence536 919 125 gene locus_tag LOCUS_19820 919 125 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_19820 2131 965 gene locus_tag LOCUS_19830 2131 965 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464060.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence537 608 1774 gene locus_tag LOCUS_19840 608 1774 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence538 1115 273 gene locus_tag LOCUS_19850 1115 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1567 1995 gene locus_tag LOCUS_19860 gene rplM 1567 1995 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_19860 2007 2399 gene locus_tag LOCUS_19870 gene rpsI 2007 2399 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_19870 >Feature sequence539 <2405 1389 gene locus_tag LOCUS_19880 <2405 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920352.1:cytochrome P450 >Feature sequence540 <1 652 gene locus_tag LOCUS_19890 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003380594.1:inositol monophosphatase 1603 689 gene locus_tag LOCUS_19900 gene secF 1603 689 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI2 protein_id gnl|my_center|LOCUS_19900 <2402 1600 gene locus_tag LOCUS_19910 <2402 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXI1:protein translocase subunit SecD >Feature sequence541 106 1605 gene locus_tag LOCUS_19920 106 1605 CDS product putative fumarate reductase/succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703124.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence542 1196 684 gene locus_tag LOCUS_19930 gene cobU 1196 684 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_19930 1969 1193 gene locus_tag LOCUS_19940 gene hmuV 1969 1193 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_19940 >Feature sequence543 >Feature sequence544 1107 346 gene locus_tag LOCUS_19950 1107 346 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNW3 protein_id gnl|my_center|LOCUS_19950 1169 2254 gene locus_tag LOCUS_19960 1169 2254 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence545 <1 860 gene locus_tag LOCUS_19970 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVH4:ribosomal RNA large subunit methyltransferase G 857 1357 gene locus_tag LOCUS_19980 gene ptpA 857 1357 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_19980 2285 1359 gene locus_tag LOCUS_19990 2285 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence546 <1 1410 gene locus_tag LOCUS_20000 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KLT4:glycerol-3-phosphate dehydrogenase <2386 1433 gene locus_tag LOCUS_20010 <2386 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478455.1:multidrug transporter AcrB >Feature sequence547 <1 1265 gene locus_tag LOCUS_20020 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141940.1:cytochrome P-450 like protein 1327 1992 gene locus_tag LOCUS_20030 1327 1992 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence548 296 598 gene locus_tag LOCUS_20040 296 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 <2381 595 gene locus_tag LOCUS_20050 <2381 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83CM3:ribonuclease R >Feature sequence549 100 2319 gene locus_tag LOCUS_20060 100 2319 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence550 >Feature sequence551 406 1815 gene locus_tag LOCUS_20070 406 1815 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence552 <2368 951 gene locus_tag LOCUS_20080 <2368 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459236.1:ATPase >Feature sequence553 <1 589 gene locus_tag LOCUS_20090 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZX12:exodeoxyribonuclease 7 large subunit 595 978 gene locus_tag LOCUS_20100 595 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1705 1055 gene locus_tag LOCUS_20110 gene fnr 1705 1055 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence554 2308 1589 gene locus_tag LOCUS_20120 2308 1589 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence555 <1 1262 gene locus_tag LOCUS_20130 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388138.1:gamma-glutamyltransferase 2083 1274 gene locus_tag LOCUS_20140 2083 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence556 311 1201 gene locus_tag LOCUS_20150 311 1201 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073590.1 protein_id gnl|my_center|LOCUS_20150 <2356 1253 gene locus_tag LOCUS_20160 <2356 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106103.1:cation acetate symporter >Feature sequence557 241 1008 gene locus_tag LOCUS_20170 241 1008 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 protein_id gnl|my_center|LOCUS_20170 1005 1460 gene locus_tag LOCUS_20180 gene rnhA 1005 1460 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVL1 protein_id gnl|my_center|LOCUS_20180 1457 2167 gene locus_tag LOCUS_20190 1457 2167 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence558 2166 493 gene locus_tag LOCUS_20200 2166 493 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence559 <1 546 gene locus_tag LOCUS_20210 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957514.1:aminopeptidase N 543 1655 gene locus_tag LOCUS_20220 543 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1660 2157 gene locus_tag LOCUS_20230 1660 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence560 >Feature sequence561 <1 963 gene locus_tag LOCUS_20240 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206773.1:TonB-dependent receptor >Feature sequence562 1495 542 gene locus_tag LOCUS_20250 gene ephA 1495 542 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_20250 <2347 1492 gene locus_tag LOCUS_20260 <2347 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926642.1:amidohydrolase >Feature sequence563 1384 623 gene locus_tag LOCUS_20270 1384 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 <2344 1365 gene locus_tag LOCUS_20280 <2344 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545339.1:ATP-dependent protease >Feature sequence564 <1 1071 gene locus_tag LOCUS_20290 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404259.1:DNA recombination protein RmuC 1068 1550 gene locus_tag LOCUS_20300 1068 1550 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence565 1397 819 gene locus_tag LOCUS_20310 gene tesA 1397 819 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY8 protein_id gnl|my_center|LOCUS_20310 1459 2127 gene locus_tag LOCUS_20320 1459 2127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence566 1 789 gene locus_tag LOCUS_20330 gene pheS 1 789 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_20330 >Feature sequence567 1135 266 gene locus_tag LOCUS_20340 1135 266 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_20340 <2336 1132 gene locus_tag LOCUS_20350 <2336 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114679.1:xanthine dehydrogenase molybdopterin binding subunit >Feature sequence568 2181 964 gene locus_tag LOCUS_20360 2181 964 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 protein_id gnl|my_center|LOCUS_20360 2327 2190 gene locus_tag LOCUS_20370 2327 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence569 >Feature sequence570 1378 29 gene locus_tag LOCUS_20380 1378 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_20380 1483 2286 gene locus_tag LOCUS_20390 1483 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence571 1411 716 gene locus_tag LOCUS_20400 gene rplA 1411 716 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2A4 protein_id gnl|my_center|LOCUS_20400 1845 1411 gene locus_tag LOCUS_20410 gene rplK 1845 1411 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 protein_id gnl|my_center|LOCUS_20410 >Feature sequence572 249 1112 gene locus_tag LOCUS_20420 249 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKP1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence573 1257 229 gene locus_tag LOCUS_20430 1257 229 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_20430 1901 1257 gene locus_tag LOCUS_20440 1901 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence574 624 283 gene locus_tag LOCUS_20450 624 283 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ4 protein_id gnl|my_center|LOCUS_20450 805 2022 gene locus_tag LOCUS_20460 gene argD 805 2022 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_20460 >Feature sequence575 250 384 gene locus_tag LOCUS_20470 250 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 1654 395 gene locus_tag LOCUS_20480 gene pksS 1654 395 CDS product polyketide biosynthesis cytochrome P450 PksS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31785 protein_id gnl|my_center|LOCUS_20480 >Feature sequence576 2149 200 gene locus_tag LOCUS_20490 gene dxs 2149 200 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence577 <2302 584 gene locus_tag LOCUS_20500 <2302 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206764.1:TonB-dependent receptor >Feature sequence578 >Feature sequence579 >Feature sequence580 >Feature sequence581 1818 340 gene locus_tag LOCUS_20510 1818 340 CDS product putative fumarate reductase/succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703124.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence582 <1 515 gene locus_tag LOCUS_20520 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005489375.1:Zn-dependent protease note possible pseudo, frameshifted 398 1642 gene locus_tag LOCUS_20530 398 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 >Feature sequence583 1232 624 gene locus_tag LOCUS_20540 1232 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2025 1249 gene locus_tag LOCUS_20550 2025 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence584 259 552 gene locus_tag LOCUS_20560 259 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 555 1475 gene locus_tag LOCUS_20570 555 1475 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence585 311 1420 gene locus_tag LOCUS_20580 gene zapE 311 1420 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_20580 <2256 1447 gene locus_tag LOCUS_20590 <2256 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975875.1:lipid A biosynthesis lauroyl acyltransferase >Feature sequence586 2245 1100 gene locus_tag LOCUS_20600 2245 1100 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence587 <1 990 gene locus_tag LOCUS_20610 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein 2253 1033 gene locus_tag LOCUS_20620 gene pckA 2253 1033 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_20620 >Feature sequence588 1232 378 gene locus_tag LOCUS_20630 1232 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_20630 1312 2079 gene locus_tag LOCUS_20640 gene rph 1312 2079 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_20640 >Feature sequence589 1427 255 gene locus_tag LOCUS_20650 1427 255 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 protein_id gnl|my_center|LOCUS_20650 <2244 1506 gene locus_tag LOCUS_20660 <2244 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071595.1:Xaa-Pro aminopeptidase >Feature sequence590 1372 209 gene locus_tag LOCUS_20670 1372 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1856 1677 gene locus_tag LOCUS_20680 1856 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence591 <1 562 gene locus_tag LOCUS_20690 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P66956:transaldolase B 546 998 gene locus_tag LOCUS_20700 546 998 CDS product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_20700 1502 1023 gene locus_tag LOCUS_20710 1502 1023 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315067.1 protein_id gnl|my_center|LOCUS_20710 <2241 1506 gene locus_tag LOCUS_20720 <2241 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114778.1:fused response regulator/phosphatase >Feature sequence592 <1 1144 gene locus_tag LOCUS_20730 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EX62:pyruvate kinase >Feature sequence593 1470 1973 gene locus_tag LOCUS_20740 1470 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence594 982 500 gene locus_tag LOCUS_20750 982 500 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_20750 2099 1065 gene locus_tag LOCUS_20760 2099 1065 CDS product hydrolase glyoxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence595 718 161 gene locus_tag LOCUS_20770 gene frr 718 161 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_20770 1490 762 gene locus_tag LOCUS_20780 gene pyrH 1490 762 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS6 protein_id gnl|my_center|LOCUS_20780 <2225 1654 gene locus_tag LOCUS_20790 <2225 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O82851:elongation factor Ts >Feature sequence596 <2225 12 gene locus_tag LOCUS_20800 <2225 12 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207561.1:nodulation protein NolG >Feature sequence597 <2224 349 gene locus_tag LOCUS_20810 <2224 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387949.1:TonB-dependent receptor >Feature sequence598 138 1079 gene locus_tag LOCUS_20820 gene ubiA 138 1079 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK0 protein_id gnl|my_center|LOCUS_20820 >Feature sequence599 1612 815 gene locus_tag LOCUS_20830 1612 815 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence600 <2214 23 gene locus_tag LOCUS_20840 <2214 23 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:type IV pili system adhesin PilY >Feature sequence601 >Feature sequence602 <1 757 gene locus_tag LOCUS_20850 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000564921.1:biotin carboxylase 768 1178 gene locus_tag LOCUS_20860 gene mceE 768 1178 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence603 1002 25 gene locus_tag LOCUS_20870 1002 25 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599366.1 protein_id gnl|my_center|LOCUS_20870 1331 999 gene locus_tag LOCUS_20880 1331 999 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_20880 1599 1324 gene locus_tag LOCUS_20890 1599 1324 CDS product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_20890 2108 1602 gene locus_tag LOCUS_20900 2108 1602 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence604 420 1454 gene locus_tag LOCUS_20910 420 1454 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_20910 1464 1631 gene locus_tag LOCUS_20920 1464 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence605 736 1647 gene locus_tag LOCUS_20930 736 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2201 1635 gene locus_tag LOCUS_20940 2201 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence606 3 479 gene locus_tag LOCUS_20950 gene coaD 3 479 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AH3 protein_id gnl|my_center|LOCUS_20950 1307 492 gene locus_tag LOCUS_20960 gene mutM 1307 492 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_20960 1559 1404 gene locus_tag LOCUS_20970 gene rpmG 1559 1404 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BC7 protein_id gnl|my_center|LOCUS_20970 1822 1586 gene locus_tag LOCUS_20980 gene rpmB 1822 1586 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2A6 protein_id gnl|my_center|LOCUS_20980 >Feature sequence607 122 1036 gene locus_tag LOCUS_20990 122 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 <2196 1021 gene locus_tag LOCUS_21000 <2196 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114255.1:beta-ketoacyl-[acyl-carrier-protein] synthase I >Feature sequence608 2001 529 gene locus_tag LOCUS_21010 gene opuE 2001 529 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181816.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence609 <2185 912 gene locus_tag LOCUS_21020 <2185 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388635.1:TonB-dependent receptor >Feature sequence610 <1 880 gene locus_tag LOCUS_21030 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112659.1:TonB-dependent receptor 2014 890 gene locus_tag LOCUS_21040 2014 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence611 1376 204 gene locus_tag LOCUS_21050 1376 204 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence612 608 2059 gene locus_tag LOCUS_21060 608 2059 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707852.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence613 1510 809 gene locus_tag LOCUS_21070 1510 809 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265945.1 protein_id gnl|my_center|LOCUS_21070 <2167 1523 gene locus_tag LOCUS_21080 <2167 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730644.1:LLM class F420-dependent oxidoreductase >Feature sequence614 <1 1542 gene locus_tag LOCUS_21090 <1 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5F9:Lon protease <2165 1565 gene locus_tag LOCUS_21100 <2165 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3G2T3:tRNA U34 carboxymethyltransferase >Feature sequence615 <1 859 gene locus_tag LOCUS_21110 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P34002:3-dehydroquinate synthase <2164 951 gene locus_tag LOCUS_21120 <2164 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330518.1:glutamate synthase subunit beta >Feature sequence616 <2158 1243 gene locus_tag LOCUS_21130 <2158 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZP61:fumarate hydratase class I >Feature sequence617 428 1330 gene locus_tag LOCUS_21140 428 1330 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_21140 <2157 1339 gene locus_tag LOCUS_21150 <2157 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226539.1:cytochrome P450 >Feature sequence618 1 1089 gene locus_tag LOCUS_21160 1 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1960 1115 gene locus_tag LOCUS_21170 1960 1115 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338472.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence619 <1 1026 gene locus_tag LOCUS_21180 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P3Y0:bifunctional ligase/repressor BirA 1023 1763 gene locus_tag LOCUS_21190 gene coaX 1023 1763 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence620 1058 582 gene locus_tag LOCUS_21200 gene ispF 1058 582 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ2 protein_id gnl|my_center|LOCUS_21200 1776 1060 gene locus_tag LOCUS_21210 gene ispD 1776 1060 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57707 protein_id gnl|my_center|LOCUS_21210 2074 1763 gene locus_tag LOCUS_21220 gene ftsB 2074 1763 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence621 1654 878 gene locus_tag LOCUS_21230 1654 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1685 1804 gene locus_tag LOCUS_21240 1685 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence622 >Feature sequence623 1796 810 gene locus_tag LOCUS_21250 1796 810 CDS product putative epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704492.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence624 >Feature sequence625 458 51 gene locus_tag LOCUS_21260 458 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1210 455 gene locus_tag LOCUS_21270 1210 455 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_21270 2139 1453 gene locus_tag LOCUS_21280 2139 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence626 >Feature sequence627 1455 976 gene locus_tag LOCUS_21290 gene allA 1455 976 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH1 protein_id gnl|my_center|LOCUS_21290 1826 1485 gene locus_tag LOCUS_21300 gene hiuH 1826 1485 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7Q6 protein_id gnl|my_center|LOCUS_21300 >Feature sequence628 <1 1111 gene locus_tag LOCUS_21310 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887727.1:methylmalonyl-CoA mutase 1144 2106 gene locus_tag LOCUS_21320 1144 2106 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence629 89 1546 gene locus_tag LOCUS_21330 89 1546 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124070.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence630 783 1034 gene locus_tag LOCUS_21340 783 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence631 1017 1967 gene locus_tag LOCUS_21350 gene rmlA 1017 1967 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU22 protein_id gnl|my_center|LOCUS_21350 >Feature sequence632 <1 890 gene locus_tag LOCUS_21360 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KQ83:50S ribosomal protein L3 glutamine methyltransferase 940 2049 gene locus_tag LOCUS_21370 gene aroC 940 2049 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I344 protein_id gnl|my_center|LOCUS_21370 >Feature sequence633 1744 1112 gene locus_tag LOCUS_21380 1744 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2121 1741 gene locus_tag LOCUS_21390 2121 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence634 <2120 1586 gene locus_tag LOCUS_21400 <2120 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071990.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence635 72 1262 gene locus_tag LOCUS_21410 gene uxuA2 72 1262 CDS product mannonate dehydratase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UA46 protein_id gnl|my_center|LOCUS_21410 1924 1259 gene locus_tag LOCUS_21420 1924 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence636 <2108 1428 gene locus_tag LOCUS_21430 <2108 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y407:deoxyribose-phosphate aldolase >Feature sequence637 >Feature sequence638 367 1035 gene locus_tag LOCUS_21440 367 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence639 988 1455 gene locus_tag LOCUS_21450 988 1455 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence640 705 1289 gene locus_tag LOCUS_21460 705 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 <2099 1306 gene locus_tag LOCUS_21470 <2099 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390885.1:GGDEF domain-containing protein >Feature sequence641 <1 1208 gene locus_tag LOCUS_21480 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886X6:inosine-5'-monophosphate dehydrogenase >Feature sequence642 >Feature sequence643 1582 1160 gene locus_tag LOCUS_21490 1582 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence644 >Feature sequence645 967 1524 gene locus_tag LOCUS_21500 967 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1992 1558 gene locus_tag LOCUS_21510 1992 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence646 1530 859 gene locus_tag LOCUS_21520 1530 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence647 1005 427 gene locus_tag LOCUS_21530 1005 427 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_21530 1548 1009 gene locus_tag LOCUS_21540 1548 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1985 1602 gene locus_tag LOCUS_21550 1985 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence648 3 137 gene locus_tag LOCUS_21560 3 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1072 119 gene locus_tag LOCUS_21570 1072 119 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 protein_id gnl|my_center|LOCUS_21570 2001 1069 gene locus_tag LOCUS_21580 2001 1069 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence649 286 164 gene locus_tag LOCUS_21590 286 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 375 1289 gene locus_tag LOCUS_21600 375 1289 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_21600 1530 1243 gene locus_tag LOCUS_21610 1530 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence650 1957 605 gene locus_tag LOCUS_21620 gene tilS 1957 605 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_21620 >Feature sequence651 1897 11 gene locus_tag LOCUS_21630 1897 11 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence652 622 44 gene locus_tag LOCUS_21640 gene slmA 622 44 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L9 protein_id gnl|my_center|LOCUS_21640 1667 768 gene locus_tag LOCUS_21650 gene argB 1667 768 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_21650 >Feature sequence653 565 1503 gene locus_tag LOCUS_21660 565 1503 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266560.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence654 1261 614 gene locus_tag LOCUS_21670 1261 614 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence655 729 61 gene locus_tag LOCUS_21680 729 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1445 726 gene locus_tag LOCUS_21690 1445 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence656 455 1339 gene locus_tag LOCUS_21700 455 1339 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946494.1 protein_id gnl|my_center|LOCUS_21700 1323 1856 gene locus_tag LOCUS_21710 1323 1856 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_21710 >Feature sequence657 1140 1781 gene locus_tag LOCUS_21720 1140 1781 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence658 <1 1489 gene locus_tag LOCUS_21730 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920256.1:TonB-dependent receptor >Feature sequence659 743 459 gene locus_tag LOCUS_21740 743 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1102 863 gene locus_tag LOCUS_21750 1102 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence660 <1 1142 gene locus_tag LOCUS_21760 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JPS4:S-adenosylmethionine synthase >Feature sequence661 615 1955 gene locus_tag LOCUS_21770 615 1955 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence662 261 1136 gene locus_tag LOCUS_21780 gene dapA 261 1136 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW75 protein_id gnl|my_center|LOCUS_21780 >Feature sequence663 1981 713 gene locus_tag LOCUS_21790 1981 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence664 >Feature sequence665 >Feature sequence666 2 526 gene locus_tag LOCUS_21800 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 634 1785 gene locus_tag LOCUS_21810 634 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence667 >Feature sequence668 490 1572 gene locus_tag LOCUS_21820 gene mraY 490 1572 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY7 protein_id gnl|my_center|LOCUS_21820 >Feature sequence669 >Feature sequence670 333 452 gene locus_tag LOCUS_21830 333 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 473 1945 gene locus_tag LOCUS_21840 473 1945 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence671 693 37 gene locus_tag LOCUS_21850 693 37 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_21850 1727 690 gene locus_tag LOCUS_21860 1727 690 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_21860 >Feature sequence672 <1 531 gene locus_tag LOCUS_21870 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086638.1:monooxygenase 1656 532 gene locus_tag LOCUS_21880 1656 532 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence673 506 249 gene locus_tag LOCUS_21890 gene pspB 506 249 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_21890 1212 517 gene locus_tag LOCUS_21900 gene pspA 1212 517 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_21900 1431 1234 gene locus_tag LOCUS_21910 1431 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence674 535 1488 gene locus_tag LOCUS_21920 535 1488 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence675 1088 219 gene locus_tag LOCUS_21930 1088 219 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_21930 1786 1085 gene locus_tag LOCUS_21940 1786 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence676 <1 933 gene locus_tag LOCUS_21950 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256282.1:3-oxosteroid 1-dehydrogenase >Feature sequence677 1562 495 gene locus_tag LOCUS_21960 gene mnmA 1562 495 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_21960 >Feature sequence678 1214 570 gene locus_tag LOCUS_21970 1214 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence679 >Feature sequence680 >Feature sequence681 >Feature sequence682 >Feature sequence683 >Feature sequence684 381 752 gene locus_tag LOCUS_21980 381 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 749 1456 gene locus_tag LOCUS_21990 749 1456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence685 >Feature sequence686 1202 519 gene locus_tag LOCUS_22000 1202 519 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 protein_id gnl|my_center|LOCUS_22000 1918 1316 gene locus_tag LOCUS_22010 1918 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence687 1630 437 gene locus_tag LOCUS_22020 gene gspL 1630 437 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT4 protein_id gnl|my_center|LOCUS_22020 >Feature sequence688 >Feature sequence689 <1 640 gene locus_tag LOCUS_22030 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTJ5:phosphate transport system permease protein PstA 651 1478 gene locus_tag LOCUS_22040 gene pstB 651 1478 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_22040 >Feature sequence690 <1 1365 gene locus_tag LOCUS_22050 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114738.1:acetyl-CoA carboxylase carboxyltransferase subunit >Feature sequence691 541 1770 gene locus_tag LOCUS_22060 gene argG 541 1770 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_22060 >Feature sequence692 423 1862 gene locus_tag LOCUS_22070 gene lpdG 423 1862 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence693 241 1383 gene locus_tag LOCUS_22080 241 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence694 <1 558 gene locus_tag LOCUS_22090 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KT86:electron transport complex subunit A 555 1187 gene locus_tag LOCUS_22100 555 1187 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_22100 >Feature sequence695 <1909 630 gene locus_tag LOCUS_22110 <1909 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268592.1:GTP pyrophosphokinase >Feature sequence696 79 3 gene locus_tag LOCUS_t00090 79 3 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 246 1091 gene locus_tag LOCUS_22120 gene folD 246 1091 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_22120 <1908 1095 gene locus_tag LOCUS_22130 <1908 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWK2:cysteine--tRNA ligase >Feature sequence697 <1 792 gene locus_tag LOCUS_22140 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064882.1:CoA transferase 1492 821 gene locus_tag LOCUS_22150 1492 821 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence698 190 1593 gene locus_tag LOCUS_22160 190 1593 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence699 >Feature sequence700 1275 556 gene locus_tag LOCUS_22170 1275 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence701 >Feature sequence702 1802 336 gene locus_tag LOCUS_22180 1802 336 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence703 >Feature sequence704 820 245 gene locus_tag LOCUS_22190 820 245 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence705 <1 1265 gene locus_tag LOCUS_22200 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I467:cobyric acid synthase >Feature sequence706 1571 1077 gene locus_tag LOCUS_22210 1571 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence707 <1865 1064 gene locus_tag LOCUS_22220 <1865 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein >Feature sequence708 628 1056 gene locus_tag LOCUS_22230 628 1056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_22230 1053 1829 gene locus_tag LOCUS_22240 1053 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence709 >Feature sequence710 1414 14 gene locus_tag LOCUS_22250 1414 14 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence711 <1859 149 gene locus_tag LOCUS_22260 <1859 149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZE0:NAD-specific glutamate dehydrogenase >Feature sequence712 1275 97 gene locus_tag LOCUS_22270 1275 97 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence713 379 750 gene locus_tag LOCUS_22280 379 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence714 >Feature sequence715 <1853 1303 gene locus_tag LOCUS_22290 <1853 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003364105.1:ribonuclease G >Feature sequence716 1518 460 gene locus_tag LOCUS_22300 1518 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence717 <1 1004 gene locus_tag LOCUS_22310 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729321.1:acyl-CoA dehydrogenase 1710 1051 gene locus_tag LOCUS_22320 1710 1051 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence718 <1 688 gene locus_tag LOCUS_22330 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005467801.1:ABC transporter ATP-binding protein >Feature sequence719 <1841 791 gene locus_tag LOCUS_22340 <1841 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000388786.1:DNA-binding protein >Feature sequence720 267 482 gene locus_tag LOCUS_22350 gene rpmE 267 482 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_22350 576 1823 gene locus_tag LOCUS_22360 576 1823 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence721 297 587 gene locus_tag LOCUS_22370 297 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1568 591 gene locus_tag LOCUS_22380 gene coIII 1568 591 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence722 >Feature sequence723 <1 677 gene locus_tag LOCUS_22390 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226841.1:LLM class F420-dependent oxidoreductase 739 1260 gene locus_tag LOCUS_22400 739 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1604 1257 gene locus_tag LOCUS_22410 1604 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence724 >Feature sequence725 1149 367 gene locus_tag LOCUS_22420 1149 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 <1821 1280 gene locus_tag LOCUS_22430 <1821 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256493.1:saccharopine dehydrogenase >Feature sequence726 487 161 gene locus_tag LOCUS_22440 487 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 903 487 gene locus_tag LOCUS_22450 903 487 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_22450 <1815 900 gene locus_tag LOCUS_22460 <1815 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893406.1:LLM class F420-dependent oxidoreductase >Feature sequence727 <1812 981 gene locus_tag LOCUS_22470 <1812 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I618:biotin synthase >Feature sequence728 137 661 gene locus_tag LOCUS_22480 137 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 770 1201 gene locus_tag LOCUS_22490 gene fabZ 770 1201 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_22490 >Feature sequence729 <1792 240 gene locus_tag LOCUS_22500 <1792 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R086:diacylglycerol O-acyltransferase >Feature sequence730 246 124 gene locus_tag LOCUS_22510 246 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence731 169 678 gene locus_tag LOCUS_22520 169 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 681 1214 gene locus_tag LOCUS_22530 681 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence732 <1766 153 gene locus_tag LOCUS_22540 <1766 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104717.1:membrane protein >Feature sequence733 <1 669 gene locus_tag LOCUS_22550 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369796.1:ssDNA exonuclease RecJ 736 1137 gene locus_tag LOCUS_22560 gene cueR 736 1137 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence734 677 231 gene locus_tag LOCUS_22570 gene dtd 677 231 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_22570 <1764 731 gene locus_tag LOCUS_22580 <1764 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116501.1:GTP-binding protein >Feature sequence735 609 265 gene locus_tag LOCUS_22590 609 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 855 1067 gene locus_tag LOCUS_22600 855 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1759 1064 gene locus_tag LOCUS_22610 1759 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence736 183 1253 gene locus_tag LOCUS_22620 183 1253 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence737 2 232 gene locus_tag LOCUS_22630 2 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 370 1152 gene locus_tag LOCUS_22640 370 1152 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence738 <1 653 gene locus_tag LOCUS_22650 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701013.1:putative short-chain dehydrogenase/reductase 722 1000 gene locus_tag LOCUS_22660 722 1000 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768750.1 protein_id gnl|my_center|LOCUS_22660 1445 1041 gene locus_tag LOCUS_22670 1445 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence739 169 405 gene locus_tag LOCUS_22680 169 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 436 888 gene locus_tag LOCUS_22690 436 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65054 protein_id gnl|my_center|LOCUS_22690 908 1657 gene locus_tag LOCUS_22700 908 1657 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence740 1713 976 gene locus_tag LOCUS_22710 gene natA 1713 976 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence741 >Feature sequence742 <1 875 gene locus_tag LOCUS_22720 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O53554:putative acetolactate synthase large subunit IlvX >Feature sequence743 324 1274 gene locus_tag LOCUS_22730 324 1274 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889219.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence744 >Feature sequence745 653 1552 gene locus_tag LOCUS_22740 653 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence746 <1 617 gene locus_tag LOCUS_22750 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974911.1:glucose 1-dehydrogenase 661 1494 gene locus_tag LOCUS_22760 661 1494 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence747 >Feature sequence748 <1 833 gene locus_tag LOCUS_22770 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I507:UPF0761 membrane protein 830 1249 gene locus_tag LOCUS_22780 830 1249 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_22780 1400 1549 gene locus_tag LOCUS_22790 1400 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence749 <1711 575 gene locus_tag LOCUS_22800 <1711 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2V5:aconitate hydratase B >Feature sequence750 <1 767 gene locus_tag LOCUS_22810 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268560.1:UDP-glucose 4-epimerase >Feature sequence751 1457 603 gene locus_tag LOCUS_22820 1457 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence752 >Feature sequence753 <1 1533 gene locus_tag LOCUS_22830 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HYF0:tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC >Feature sequence754 <1 771 gene locus_tag LOCUS_22840 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056430.1:sucrose-phosphate synthase 764 1600 gene locus_tag LOCUS_22850 764 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence755 1368 676 gene locus_tag LOCUS_22860 1368 676 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_22860 >Feature sequence756 208 567 gene locus_tag LOCUS_22870 208 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence757 205 897 gene locus_tag LOCUS_22880 gene cbbZ 205 897 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYC6 protein_id gnl|my_center|LOCUS_22880 928 1392 gene locus_tag LOCUS_22890 928 1392 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921141.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence758 272 1297 gene locus_tag LOCUS_22900 gene gutB 272 1297 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_22900 1682 1311 gene locus_tag LOCUS_22910 1682 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence759 742 1419 gene locus_tag LOCUS_22920 742 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence760 >Feature sequence761 1160 540 gene locus_tag LOCUS_22930 gene fklB 1160 540 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_22930 >Feature sequence762 <1677 32 gene locus_tag LOCUS_22940 <1677 32 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G3XD04:DNA helicase >Feature sequence763 354 133 gene locus_tag LOCUS_22950 354 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719749.1 protein_id gnl|my_center|LOCUS_22950 <1676 347 gene locus_tag LOCUS_22960 <1676 347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249925.1:MATE family efflux transporter >Feature sequence764 <1666 199 gene locus_tag LOCUS_22970 <1666 199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035957.1:penicillin-binding protein 3 >Feature sequence765 <1 535 gene locus_tag LOCUS_22980 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267258.1:xanthine dehydrogenase small subunit >Feature sequence766 <1 746 gene locus_tag LOCUS_22990 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210753.1:molybdate ABC transporter ATP-binding protein ModF 1120 743 gene locus_tag LOCUS_23000 1120 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 <1661 1099 gene locus_tag LOCUS_23010 <1661 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to G3XD31:penicillin-binding protein 1B >Feature sequence767 >Feature sequence768 1442 48 gene locus_tag LOCUS_23020 1442 48 CDS product carboxypeptidase S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265607.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence769 409 1575 gene locus_tag LOCUS_23030 409 1575 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence770 1299 157 gene locus_tag LOCUS_23040 1299 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence771 >Feature sequence772 <1 742 gene locus_tag LOCUS_23050 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413458.1:sigma-54-dependent Fis family transcriptional regulator 755 1243 gene locus_tag LOCUS_23060 gene trmL 755 1243 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74Y93 protein_id gnl|my_center|LOCUS_23060 >Feature sequence773 1318 779 gene locus_tag LOCUS_23070 1318 779 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence774 1347 1478 gene locus_tag LOCUS_23080 1347 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence775 >Feature sequence776 1531 734 gene locus_tag LOCUS_23090 1531 734 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106425.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence777 899 129 gene locus_tag LOCUS_23100 gene gluQ 899 129 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 protein_id gnl|my_center|LOCUS_23100 1476 1030 gene locus_tag LOCUS_23110 gene dksA 1476 1030 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 protein_id gnl|my_center|LOCUS_23110 >Feature sequence778 <1621 341 gene locus_tag LOCUS_23120 <1621 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83F28:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence779 >Feature sequence780 180 737 gene locus_tag LOCUS_23130 180 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 >Feature sequence781 631 1464 gene locus_tag LOCUS_23140 gene rsmI 631 1464 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX5 protein_id gnl|my_center|LOCUS_23140 >Feature sequence782 <1609 730 gene locus_tag LOCUS_23150 <1609 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886N7:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence783 >Feature sequence784 716 36 gene locus_tag LOCUS_23160 gene erd13 716 36 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence785 1115 726 gene locus_tag LOCUS_23170 gene hslR 1115 726 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_23170 >Feature sequence786 1099 371 gene locus_tag LOCUS_23180 1099 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1591 1139 gene locus_tag LOCUS_23190 1591 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence787 >Feature sequence788 475 876 gene locus_tag LOCUS_23200 475 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_23200 <1570 920 gene locus_tag LOCUS_23210 <1570 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122456.1:arylsulfatase >Feature sequence789 <1569 152 gene locus_tag LOCUS_23220 <1569 152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated >Feature sequence790 695 910 gene locus_tag LOCUS_23230 gene rpsU 695 910 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K1 protein_id gnl|my_center|LOCUS_23230 929 1381 gene locus_tag LOCUS_23240 929 1381 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence791 1334 654 gene locus_tag LOCUS_23250 1334 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112853.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence792 <1 694 gene locus_tag LOCUS_23260 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704696.1:putative sulfotransferase >Feature sequence793 828 250 gene locus_tag LOCUS_23270 828 250 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_23270 <1550 840 gene locus_tag LOCUS_23280 <1550 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTY6:glutamate--cysteine ligase >Feature sequence794 1073 63 gene locus_tag LOCUS_23290 1073 63 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703703.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence795 1028 246 gene locus_tag LOCUS_23300 1028 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence796 687 872 gene locus_tag LOCUS_23310 687 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence797 360 938 gene locus_tag LOCUS_23320 360 938 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence798 725 81 gene locus_tag LOCUS_23330 725 81 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence799 512 174 gene locus_tag LOCUS_23340 512 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23340 1072 725 gene locus_tag LOCUS_23350 1072 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence800 <1523 986 gene locus_tag LOCUS_23360 <1523 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WQ51:long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase >Feature sequence801 820 128 gene locus_tag LOCUS_23370 gene ung 820 128 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPC2 protein_id gnl|my_center|LOCUS_23370 915 1340 gene locus_tag LOCUS_23380 915 1340 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708965.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence802 996 151 gene locus_tag LOCUS_23390 996 151 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence803 161 973 gene locus_tag LOCUS_23400 161 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence804 293 1321 gene locus_tag LOCUS_23410 gene alc 293 1321 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J8 protein_id gnl|my_center|LOCUS_23410 >Feature sequence805 327 1118 gene locus_tag LOCUS_23420 gene uppP 327 1118 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_23420 >Feature sequence806 447 947 gene locus_tag LOCUS_23430 447 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_23430