>Feature sequence01 775 275 gene locus_tag LOCUS_00010 gene mobA 775 275 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 protein_id gnl|my_center|LOCUS_00010 1164 1748 gene locus_tag LOCUS_00020 1164 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00020 1745 2548 gene locus_tag LOCUS_00030 gene uppP 1745 2548 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_00030 2588 3895 gene locus_tag LOCUS_00040 gene apeB 2588 3895 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC5 protein_id gnl|my_center|LOCUS_00040 3905 5032 gene locus_tag LOCUS_00050 3905 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5081 6088 gene locus_tag LOCUS_00060 gene trpS 5081 6088 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7X0 protein_id gnl|my_center|LOCUS_00060 6239 6078 gene locus_tag LOCUS_00070 6239 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6466 6816 gene locus_tag LOCUS_00080 6466 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6830 7483 gene locus_tag LOCUS_00090 6830 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7494 8978 gene locus_tag LOCUS_00100 7494 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_00100 9115 10158 gene locus_tag LOCUS_00110 9115 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10304 11671 gene locus_tag LOCUS_00120 10304 11671 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_00120 12567 11686 gene locus_tag LOCUS_00130 12567 11686 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_00130 12631 13557 gene locus_tag LOCUS_00140 12631 13557 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_00140 13798 14754 gene locus_tag LOCUS_00150 13798 14754 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887764.1 protein_id gnl|my_center|LOCUS_00150 14835 16046 gene locus_tag LOCUS_00160 14835 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117833.1 protein_id gnl|my_center|LOCUS_00160 16115 16480 gene locus_tag LOCUS_00170 16115 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16522 17199 gene locus_tag LOCUS_00180 16522 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17226 18668 gene locus_tag LOCUS_00190 17226 18668 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_00190 18668 19966 gene locus_tag LOCUS_00200 18668 19966 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531147.1 protein_id gnl|my_center|LOCUS_00200 19963 20739 gene locus_tag LOCUS_00210 19963 20739 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 protein_id gnl|my_center|LOCUS_00210 21065 22624 gene locus_tag LOCUS_00220 21065 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23574 22555 gene locus_tag LOCUS_00230 23574 22555 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_00230 23799 24476 gene locus_tag LOCUS_00240 gene pspA 23799 24476 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_00240 24562 24831 gene locus_tag LOCUS_00250 gene pspB 24562 24831 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300084.1 protein_id gnl|my_center|LOCUS_00250 24835 25395 gene locus_tag LOCUS_00260 gene pspC 24835 25395 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263198.1 protein_id gnl|my_center|LOCUS_00260 25515 26306 gene locus_tag LOCUS_00270 25515 26306 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_00270 26465 27367 gene locus_tag LOCUS_00280 gene uspE 26465 27367 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAC0 protein_id gnl|my_center|LOCUS_00280 27805 29949 gene locus_tag LOCUS_00290 gene ppk 27805 29949 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU07 protein_id gnl|my_center|LOCUS_00290 30054 30422 gene locus_tag LOCUS_00300 30054 30422 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_00300 30535 31476 gene locus_tag LOCUS_00310 30535 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_00310 32970 31504 gene locus_tag LOCUS_00320 32970 31504 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930860.1 protein_id gnl|my_center|LOCUS_00320 33060 33965 gene locus_tag LOCUS_00330 33060 33965 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397257.1 protein_id gnl|my_center|LOCUS_00330 34090 34344 gene locus_tag LOCUS_00340 34090 34344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35878 34385 gene locus_tag LOCUS_00350 35878 34385 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_00350 36398 35967 gene locus_tag LOCUS_00360 36398 35967 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708965.1 protein_id gnl|my_center|LOCUS_00360 36683 37786 gene locus_tag LOCUS_00370 gene purC 36683 37786 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGP5 protein_id gnl|my_center|LOCUS_00370 37795 38547 gene locus_tag LOCUS_00380 37795 38547 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_00380 38578 39384 gene locus_tag LOCUS_00390 38578 39384 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701584.1 protein_id gnl|my_center|LOCUS_00390 39449 39859 gene locus_tag LOCUS_00400 39449 39859 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_00400 39991 40629 gene locus_tag LOCUS_00410 39991 40629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40626 41297 gene locus_tag LOCUS_00420 40626 41297 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_00420 41566 44148 gene locus_tag LOCUS_00430 41566 44148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44435 45424 gene locus_tag LOCUS_00440 44435 45424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45454 45858 gene locus_tag LOCUS_00450 45454 45858 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206733.1 protein_id gnl|my_center|LOCUS_00450 46386 45904 gene locus_tag LOCUS_00460 46386 45904 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_00460 46611 48323 gene locus_tag LOCUS_00470 46611 48323 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 protein_id gnl|my_center|LOCUS_00470 48500 49873 gene locus_tag LOCUS_00480 48500 49873 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389294.1 protein_id gnl|my_center|LOCUS_00480 49955 50923 gene locus_tag LOCUS_00490 49955 50923 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_00490 51282 50920 gene locus_tag LOCUS_00500 51282 50920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51460 52596 gene locus_tag LOCUS_00510 51460 52596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52597 53361 gene locus_tag LOCUS_00520 52597 53361 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029015.1 protein_id gnl|my_center|LOCUS_00520 53423 54196 gene locus_tag LOCUS_00530 53423 54196 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_00530 54679 54296 gene locus_tag LOCUS_00540 54679 54296 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_00540 56161 54755 gene locus_tag LOCUS_00550 56161 54755 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970945.1 protein_id gnl|my_center|LOCUS_00550 56451 56218 gene locus_tag LOCUS_00560 56451 56218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57161 56595 gene locus_tag LOCUS_00570 57161 56595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57291 58466 gene locus_tag LOCUS_00580 57291 58466 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 protein_id gnl|my_center|LOCUS_00580 58545 59399 gene locus_tag LOCUS_00590 58545 59399 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_00590 59434 61374 gene locus_tag LOCUS_00600 59434 61374 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_00600 61422 62204 gene locus_tag LOCUS_00610 gene bacC 61422 62204 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39640 protein_id gnl|my_center|LOCUS_00610 63348 62212 gene locus_tag LOCUS_00620 63348 62212 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_00620 63526 64953 gene locus_tag LOCUS_00630 63526 64953 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_00630 64956 66446 gene locus_tag LOCUS_00640 gene glpK2 64956 66446 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_00640 66418 66651 gene locus_tag LOCUS_00650 66418 66651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66684 68093 gene locus_tag LOCUS_00660 66684 68093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_00660 68165 68761 gene locus_tag LOCUS_00670 gene mcbG 68165 68761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_00670 69411 68779 gene locus_tag LOCUS_00680 69411 68779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 69607 70569 gene locus_tag LOCUS_00690 69607 70569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_00690 71143 70583 gene locus_tag LOCUS_00700 71143 70583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704609.1 protein_id gnl|my_center|LOCUS_00700 71460 74027 gene locus_tag LOCUS_00710 71460 74027 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268962.1 protein_id gnl|my_center|LOCUS_00710 74623 74024 gene locus_tag LOCUS_00720 74623 74024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_00720 75961 74639 gene locus_tag LOCUS_00730 75961 74639 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_00730 76461 76042 gene locus_tag LOCUS_00740 76461 76042 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_00740 79774 76619 gene locus_tag LOCUS_00750 79774 76619 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_00750 80934 79792 gene locus_tag LOCUS_00760 80934 79792 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_00760 81558 81001 gene locus_tag LOCUS_00770 81558 81001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707296.1 protein_id gnl|my_center|LOCUS_00770 83744 81612 gene locus_tag LOCUS_00780 83744 81612 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 protein_id gnl|my_center|LOCUS_00780 86189 83823 gene locus_tag LOCUS_00790 86189 83823 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_00790 87203 86334 gene locus_tag LOCUS_00800 87203 86334 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 protein_id gnl|my_center|LOCUS_00800 87329 88123 gene locus_tag LOCUS_00810 87329 88123 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_00810 89618 88329 gene locus_tag LOCUS_00820 gene bioA 89618 88329 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGC1 protein_id gnl|my_center|LOCUS_00820 90280 89615 gene locus_tag LOCUS_00830 gene tesA 90280 89615 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY8 protein_id gnl|my_center|LOCUS_00830 90309 90935 gene locus_tag LOCUS_00840 90309 90935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_00840 90942 93416 gene locus_tag LOCUS_00850 90942 93416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_00850 94111 93485 gene locus_tag LOCUS_00860 94111 93485 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_00860 95476 94496 gene locus_tag LOCUS_00870 gene mdh 95476 94496 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_00870 95783 96625 gene locus_tag LOCUS_00880 gene ttcA 95783 96625 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEM4 protein_id gnl|my_center|LOCUS_00880 96625 97242 gene locus_tag LOCUS_00890 gene ccmA 96625 97242 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJZ1 protein_id gnl|my_center|LOCUS_00890 97239 97925 gene locus_tag LOCUS_00900 97239 97925 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ8 protein_id gnl|my_center|LOCUS_00900 98004 98750 gene locus_tag LOCUS_00910 gene ccmC 98004 98750 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_00910 98750 98953 gene locus_tag LOCUS_00920 98750 98953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 98953 99402 gene locus_tag LOCUS_00930 gene ccmE 98953 99402 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_00930 99399 101375 gene locus_tag LOCUS_00940 gene ccmF 99399 101375 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_00940 101365 101907 gene locus_tag LOCUS_00950 101365 101907 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 protein_id gnl|my_center|LOCUS_00950 101904 102383 gene locus_tag LOCUS_00960 gene ccmH 101904 102383 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N0 protein_id gnl|my_center|LOCUS_00960 102380 103594 gene locus_tag LOCUS_00970 102380 103594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 103868 107365 gene locus_tag LOCUS_00980 gene smc 103868 107365 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_00980 107396 108307 gene locus_tag LOCUS_00990 gene zipA 107396 108307 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I5 protein_id gnl|my_center|LOCUS_00990 108316 110349 gene locus_tag LOCUS_01000 gene ligA 108316 110349 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_01000 110346 110963 gene locus_tag LOCUS_01010 110346 110963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_01010 111154 112926 gene locus_tag LOCUS_01020 111154 112926 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_01020 112923 114791 gene locus_tag LOCUS_01030 112923 114791 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089482.1 protein_id gnl|my_center|LOCUS_01030 114788 115840 gene locus_tag LOCUS_01040 114788 115840 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_01040 115990 116694 gene locus_tag LOCUS_01050 gene phoB 115990 116694 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_01050 116780 117997 gene locus_tag LOCUS_01060 gene phoR 116780 117997 CDS product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 protein_id gnl|my_center|LOCUS_01060 118010 118726 gene locus_tag LOCUS_01070 gene phoU 118010 118726 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 protein_id gnl|my_center|LOCUS_01070 118957 120006 gene locus_tag LOCUS_01080 118957 120006 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970883.1 protein_id gnl|my_center|LOCUS_01080 120132 121520 gene locus_tag LOCUS_01090 120132 121520 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_01090 121609 122802 gene locus_tag LOCUS_01100 121609 122802 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_01100 122838 123734 gene locus_tag LOCUS_01110 gene pstB 122838 123734 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU0 protein_id gnl|my_center|LOCUS_01110 123929 123765 gene locus_tag LOCUS_01120 123929 123765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 124420 125697 gene locus_tag LOCUS_01130 124420 125697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932573.1 protein_id gnl|my_center|LOCUS_01130 125855 125930 gene locus_tag LOCUS_t00010 125855 125930 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 126008 127066 gene locus_tag LOCUS_01140 gene hisC1 126008 127066 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX0 protein_id gnl|my_center|LOCUS_01140 128246 127125 gene locus_tag LOCUS_01150 128246 127125 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104870.1 protein_id gnl|my_center|LOCUS_01150 129622 128336 gene locus_tag LOCUS_01160 gene gltA 129622 128336 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_01160 129940 130314 gene locus_tag LOCUS_01170 gene sdhC 129940 130314 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738085.1 protein_id gnl|my_center|LOCUS_01170 130329 130670 gene locus_tag LOCUS_01180 130329 130670 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A0 protein_id gnl|my_center|LOCUS_01180 130671 132443 gene locus_tag LOCUS_01190 gene sdhA 130671 132443 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 protein_id gnl|my_center|LOCUS_01190 132456 133160 gene locus_tag LOCUS_01200 gene sdhB 132456 133160 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_01200 133357 136215 gene locus_tag LOCUS_01210 gene sucA 133357 136215 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_01210 136246 137490 gene locus_tag LOCUS_01220 gene sucB 136246 137490 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_01220 137571 139007 gene locus_tag LOCUS_01230 gene lpdG 137571 139007 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_01230 139141 140310 gene locus_tag LOCUS_01240 gene sucC 139141 140310 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_01240 140310 141182 gene locus_tag LOCUS_01250 gene sucD 140310 141182 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_01250 141393 143318 gene locus_tag LOCUS_01260 gene htpG 141393 143318 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 protein_id gnl|my_center|LOCUS_01260 143487 143987 gene locus_tag LOCUS_01270 143487 143987 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_01270 143987 144871 gene locus_tag LOCUS_01280 143987 144871 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_01280 144868 145428 gene locus_tag LOCUS_01290 144868 145428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 146004 145462 gene locus_tag LOCUS_01300 gene folE2 146004 145462 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I351 protein_id gnl|my_center|LOCUS_01300 146132 147052 gene locus_tag LOCUS_01310 gene prmB 146132 147052 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECQ4 protein_id gnl|my_center|LOCUS_01310 147103 148218 gene locus_tag LOCUS_01320 gene aroC 147103 148218 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3U6 protein_id gnl|my_center|LOCUS_01320 148234 148476 gene locus_tag LOCUS_01330 148234 148476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 149010 148480 gene locus_tag LOCUS_01340 149010 148480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_01340 149089 149331 gene locus_tag LOCUS_01350 149089 149331 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS94 protein_id gnl|my_center|LOCUS_01350 149344 149586 gene locus_tag LOCUS_01360 gene tusA 149344 149586 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 protein_id gnl|my_center|LOCUS_01360 149586 150170 gene locus_tag LOCUS_01370 149586 150170 CDS product transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947623.1 protein_id gnl|my_center|LOCUS_01370 150199 151350 gene locus_tag LOCUS_01380 gene pdxB 150199 151350 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE7 protein_id gnl|my_center|LOCUS_01380 151353 152501 gene locus_tag LOCUS_01390 151353 152501 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_01390 152607 152999 gene locus_tag LOCUS_01400 gene msrB 152607 152999 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLB3 protein_id gnl|my_center|LOCUS_01400 153196 153121 gene locus_tag LOCUS_t00020 153196 153121 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 153291 153216 gene locus_tag LOCUS_t00030 153291 153216 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 153758 153375 gene locus_tag LOCUS_01410 153758 153375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090890.1 protein_id gnl|my_center|LOCUS_01410 153761 154750 gene locus_tag LOCUS_01420 153761 154750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_01420 154747 155520 gene locus_tag LOCUS_01430 154747 155520 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 protein_id gnl|my_center|LOCUS_01430 155527 156348 gene locus_tag LOCUS_01440 gene queF 155527 156348 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE7 protein_id gnl|my_center|LOCUS_01440 156417 157643 gene locus_tag LOCUS_01450 156417 157643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 157712 157799 gene locus_tag LOCUS_t00040 157712 157799 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 157953 158615 gene locus_tag LOCUS_01460 157953 158615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703805.1 protein_id gnl|my_center|LOCUS_01460 158615 159148 gene locus_tag LOCUS_01470 158615 159148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 160003 159245 gene locus_tag LOCUS_01480 gene hmuV 160003 159245 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB59 protein_id gnl|my_center|LOCUS_01480 161018 160008 gene locus_tag LOCUS_01490 gene hmuC 161018 160008 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073469.1 protein_id gnl|my_center|LOCUS_01490 161869 161030 gene locus_tag LOCUS_01500 gene hmuB 161869 161030 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073468.1 protein_id gnl|my_center|LOCUS_01500 162079 164088 gene locus_tag LOCUS_01510 gene hmuA 162079 164088 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_01510 164101 164502 gene locus_tag LOCUS_01520 164101 164502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 164513 165049 gene locus_tag LOCUS_01530 gene hutZ 164513 165049 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 protein_id gnl|my_center|LOCUS_01530 166761 165073 gene locus_tag LOCUS_01540 166761 165073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702605.1 protein_id gnl|my_center|LOCUS_01540 167056 167967 gene locus_tag LOCUS_01550 167056 167967 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_01550 167967 170024 gene locus_tag LOCUS_01560 167967 170024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461379.1 protein_id gnl|my_center|LOCUS_01560 170174 170857 gene locus_tag LOCUS_01570 gene fabG 170174 170857 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_01570 172271 170883 gene locus_tag LOCUS_01580 172271 170883 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706833.1 protein_id gnl|my_center|LOCUS_01580 173980 172268 gene locus_tag LOCUS_01590 173980 172268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_01590 174781 174005 gene locus_tag LOCUS_01600 174781 174005 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533598.1 protein_id gnl|my_center|LOCUS_01600 174922 177030 gene locus_tag LOCUS_01610 174922 177030 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974433.1 protein_id gnl|my_center|LOCUS_01610 177043 178335 gene locus_tag LOCUS_01620 177043 178335 CDS product putative sugar isomerase R00627 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S14 protein_id gnl|my_center|LOCUS_01620 178990 178403 gene locus_tag LOCUS_01630 178990 178403 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119975.1 protein_id gnl|my_center|LOCUS_01630 179275 180471 gene locus_tag LOCUS_01640 179275 180471 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_01640 180498 183674 gene locus_tag LOCUS_01650 gene mexF2 180498 183674 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970173.1 protein_id gnl|my_center|LOCUS_01650 184265 183735 gene locus_tag LOCUS_01660 184265 183735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 184730 184413 gene locus_tag LOCUS_01670 184730 184413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 185229 185978 gene locus_tag LOCUS_01680 185229 185978 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_01680 186930 186019 gene locus_tag LOCUS_01690 186930 186019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 190393 186923 gene locus_tag LOCUS_01700 gene mfd 190393 186923 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_01700 190579 192048 gene locus_tag LOCUS_01710 190579 192048 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV81 protein_id gnl|my_center|LOCUS_01710 192328 193665 gene locus_tag LOCUS_01720 gene nqrA 192328 193665 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_01720 193669 194865 gene locus_tag LOCUS_01730 gene nqrB 193669 194865 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_01730 194855 195631 gene locus_tag LOCUS_01740 gene nqrC 194855 195631 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_01740 195634 196296 gene locus_tag LOCUS_01750 gene nqrD 195634 196296 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_01750 196297 196905 gene locus_tag LOCUS_01760 gene nqrE 196297 196905 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_01760 196922 198145 gene locus_tag LOCUS_01770 gene nqrF 196922 198145 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_01770 198150 199190 gene locus_tag LOCUS_01780 198150 199190 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_01780 199218 199451 gene locus_tag LOCUS_01790 199218 199451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_01790 199467 200729 gene locus_tag LOCUS_01800 gene lolC 199467 200729 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244213.1 protein_id gnl|my_center|LOCUS_01800 200722 201402 gene locus_tag LOCUS_01810 gene lolD 200722 201402 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 protein_id gnl|my_center|LOCUS_01810 201399 202643 gene locus_tag LOCUS_01820 gene lolC 201399 202643 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244213.1 protein_id gnl|my_center|LOCUS_01820 203112 202627 gene locus_tag LOCUS_01830 203112 202627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_01830 203430 205745 gene locus_tag LOCUS_01840 203430 205745 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_01840 205816 206445 gene locus_tag LOCUS_01850 205816 206445 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_01850 206442 206873 gene locus_tag LOCUS_01860 206442 206873 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770645.1 protein_id gnl|my_center|LOCUS_01860 206898 207662 gene locus_tag LOCUS_01870 gene kdsB 206898 207662 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM5 protein_id gnl|my_center|LOCUS_01870 207665 208153 gene locus_tag LOCUS_01880 gene ptpA 207665 208153 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_01880 208140 209186 gene locus_tag LOCUS_01890 gene murB 208140 209186 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_01890 209183 211006 gene locus_tag LOCUS_01900 gene uvrC 209183 211006 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_01900 211226 211798 gene locus_tag LOCUS_01910 gene pgsA 211226 211798 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_01910 212027 212102 gene locus_tag LOCUS_t00050 212027 212102 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 212115 212188 gene locus_tag LOCUS_t00060 212115 212188 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 213594 212608 gene locus_tag LOCUS_01920 213594 212608 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5M7 protein_id gnl|my_center|LOCUS_01920 213813 214055 gene locus_tag LOCUS_01930 213813 214055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 214511 215683 gene locus_tag LOCUS_01940 214511 215683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 217680 216043 gene locus_tag LOCUS_01950 217680 216043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886094.1 protein_id gnl|my_center|LOCUS_01950 217947 219104 gene locus_tag LOCUS_01960 217947 219104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_01960 221447 219162 gene locus_tag LOCUS_01970 gene katG2 221447 219162 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_01970 221795 222553 gene locus_tag LOCUS_01980 221795 222553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 223498 222590 gene locus_tag LOCUS_01990 223498 222590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 224977 223649 gene locus_tag LOCUS_02000 224977 223649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 225409 227406 gene locus_tag LOCUS_02010 225409 227406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 227510 228406 gene locus_tag LOCUS_02020 gene tauD 227510 228406 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 protein_id gnl|my_center|LOCUS_02020 229467 228436 gene locus_tag LOCUS_02030 229467 228436 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224028.1 protein_id gnl|my_center|LOCUS_02030 229641 230654 gene locus_tag LOCUS_02040 229641 230654 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_02040 230713 230880 gene locus_tag LOCUS_02050 230713 230880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 230877 231338 gene locus_tag LOCUS_02060 230877 231338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 232687 231335 gene locus_tag LOCUS_02070 232687 231335 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_02070 232933 233019 gene locus_tag LOCUS_t00070 232933 233019 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 233120 233587 gene locus_tag LOCUS_02080 233120 233587 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065668.1 protein_id gnl|my_center|LOCUS_02080 233692 234321 gene locus_tag LOCUS_02090 gene dut 233692 234321 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_02090 234325 235218 gene locus_tag LOCUS_02100 234325 235218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882836.1 protein_id gnl|my_center|LOCUS_02100 236347 235238 gene locus_tag LOCUS_02110 gene trmA 236347 235238 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNF5 protein_id gnl|my_center|LOCUS_02110 237375 236347 gene locus_tag LOCUS_02120 237375 236347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_02120 237695 237372 gene locus_tag LOCUS_02130 237695 237372 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL9 protein_id gnl|my_center|LOCUS_02130 237985 237695 gene locus_tag LOCUS_02140 237985 237695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 238361 237990 gene locus_tag LOCUS_02150 gene tusC 238361 237990 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 protein_id gnl|my_center|LOCUS_02150 238756 238364 gene locus_tag LOCUS_02160 gene tusD 238756 238364 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1Y3 protein_id gnl|my_center|LOCUS_02160 239497 238823 gene locus_tag LOCUS_02170 239497 238823 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_02170 239760 239671 gene locus_tag LOCUS_t00080 239760 239671 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 242677 239882 gene locus_tag LOCUS_02180 242677 239882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 243296 244201 gene locus_tag LOCUS_02190 243296 244201 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNF7 protein_id gnl|my_center|LOCUS_02190 244945 244361 gene locus_tag LOCUS_02200 gene yceF 244945 244361 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAW3 protein_id gnl|my_center|LOCUS_02200 245039 245572 gene locus_tag LOCUS_02210 245039 245572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_02210 245584 245766 gene locus_tag LOCUS_02220 gene rpmF 245584 245766 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN60 protein_id gnl|my_center|LOCUS_02220 246052 247014 gene locus_tag LOCUS_02230 gene fabD 246052 247014 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7J5 protein_id gnl|my_center|LOCUS_02230 247018 247761 gene locus_tag LOCUS_02240 gene fabG 247018 247761 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_02240 247908 248144 gene locus_tag LOCUS_02250 gene acpP 247908 248144 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80923 protein_id gnl|my_center|LOCUS_02250 248241 249482 gene locus_tag LOCUS_02260 gene fabF 248241 249482 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAI7 protein_id gnl|my_center|LOCUS_02260 249539 250330 gene locus_tag LOCUS_02270 249539 250330 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_02270 250327 251358 gene locus_tag LOCUS_02280 250327 251358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_02280 251360 252013 gene locus_tag LOCUS_02290 gene tmk 251360 252013 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 protein_id gnl|my_center|LOCUS_02290 252010 253023 gene locus_tag LOCUS_02300 gene holB 252010 253023 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52024 protein_id gnl|my_center|LOCUS_02300 253020 253373 gene locus_tag LOCUS_02310 gene pilZ 253020 253373 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_02310 253682 254740 gene locus_tag LOCUS_02320 253682 254740 CDS product hyaluronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_02320 254984 255068 gene locus_tag LOCUS_t00090 254984 255068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 255169 256476 gene locus_tag LOCUS_02330 gene tig 255169 256476 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_02330 256511 257173 gene locus_tag LOCUS_02340 gene clpP 256511 257173 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR6 protein_id gnl|my_center|LOCUS_02340 257277 258566 gene locus_tag LOCUS_02350 gene clpX 257277 258566 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YR7 protein_id gnl|my_center|LOCUS_02350 258698 261109 gene locus_tag LOCUS_02360 gene lon 258698 261109 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM5 protein_id gnl|my_center|LOCUS_02360 261317 261592 gene locus_tag LOCUS_02370 gene hupB 261317 261592 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_02370 261724 263595 gene locus_tag LOCUS_02380 gene ppiD 261724 263595 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 protein_id gnl|my_center|LOCUS_02380 263615 264799 gene locus_tag LOCUS_02390 263615 264799 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_02390 265692 264844 gene locus_tag LOCUS_02400 265692 264844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 265852 266388 gene locus_tag LOCUS_02410 265852 266388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_02410 268083 266431 gene locus_tag LOCUS_02420 268083 266431 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_02420 268353 269105 gene locus_tag LOCUS_02430 gene etfB 268353 269105 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_02430 269102 270031 gene locus_tag LOCUS_02440 gene etfA 269102 270031 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_02440 271273 270098 gene locus_tag LOCUS_02450 271273 270098 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_02450 271819 271352 gene locus_tag LOCUS_02460 271819 271352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_02460 273467 271803 gene locus_tag LOCUS_02470 gene cysI 273467 271803 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_02470 273686 273808 gene locus_tag LOCUS_02480 273686 273808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 274083 273838 gene locus_tag LOCUS_02490 274083 273838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 277789 274097 gene locus_tag LOCUS_02500 gene metH 277789 274097 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_02500 277992 278567 gene locus_tag LOCUS_02510 gene nfuA 277992 278567 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_02510 279683 278601 gene locus_tag LOCUS_02520 279683 278601 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUQ6 protein_id gnl|my_center|LOCUS_02520 279839 282565 gene locus_tag LOCUS_02530 279839 282565 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_02530 282562 285984 gene locus_tag LOCUS_02540 282562 285984 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_02540 285956 286675 gene locus_tag LOCUS_02550 gene cobB 285956 286675 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E581 protein_id gnl|my_center|LOCUS_02550 287238 286708 gene locus_tag LOCUS_02560 287238 286708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 288517 287318 gene locus_tag LOCUS_02570 288517 287318 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 protein_id gnl|my_center|LOCUS_02570 288925 289836 gene locus_tag LOCUS_02580 288925 289836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 289833 290282 gene locus_tag LOCUS_02590 gene rnhA 289833 290282 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHK3 protein_id gnl|my_center|LOCUS_02590 290304 291035 gene locus_tag LOCUS_02600 gene dnaQ 290304 291035 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_02600 292531 291032 gene locus_tag LOCUS_02610 gene nhaB 292531 291032 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_02610 292689 293501 gene locus_tag LOCUS_02620 292689 293501 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966666.1 protein_id gnl|my_center|LOCUS_02620 293520 294584 gene locus_tag LOCUS_02630 293520 294584 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_02630 295476 294592 gene locus_tag LOCUS_02640 295476 294592 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339525.1 protein_id gnl|my_center|LOCUS_02640 295683 296300 gene locus_tag LOCUS_02650 gene cysC 295683 296300 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MT8 protein_id gnl|my_center|LOCUS_02650 296314 297501 gene locus_tag LOCUS_02660 gene sat 296314 297501 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_02660 297555 298511 gene locus_tag LOCUS_02670 297555 298511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_02670 299236 298499 gene locus_tag LOCUS_02680 299236 298499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 299363 300520 gene locus_tag LOCUS_02690 299363 300520 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_02690 300560 301615 gene locus_tag LOCUS_02700 300560 301615 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_02700 301670 302998 gene locus_tag LOCUS_02710 301670 302998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 303012 303854 gene locus_tag LOCUS_02720 303012 303854 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970670.1 protein_id gnl|my_center|LOCUS_02720 303908 304165 gene locus_tag LOCUS_02730 303908 304165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 304175 304792 gene locus_tag LOCUS_02740 304175 304792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_02740 304810 306516 gene locus_tag LOCUS_02750 304810 306516 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_02750 306654 307757 gene locus_tag LOCUS_02760 306654 307757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 307754 308920 gene locus_tag LOCUS_02770 307754 308920 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730899.1 protein_id gnl|my_center|LOCUS_02770 309897 308929 gene locus_tag LOCUS_02780 gene corA 309897 308929 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE82 protein_id gnl|my_center|LOCUS_02780 310116 312356 gene locus_tag LOCUS_02790 gene ptsP 310116 312356 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_02790 312391 312834 gene locus_tag LOCUS_02800 312391 312834 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_02800 312932 313912 gene locus_tag LOCUS_02810 312932 313912 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_02810 313956 314933 gene locus_tag LOCUS_02820 gene yrbG 313956 314933 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_02820 315030 316223 gene locus_tag LOCUS_02830 gene rimK 315030 316223 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_02830 316353 316754 gene locus_tag LOCUS_02840 316353 316754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 316975 318237 gene locus_tag LOCUS_02850 316975 318237 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_02850 318230 319489 gene locus_tag LOCUS_02860 318230 319489 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706760.1 protein_id gnl|my_center|LOCUS_02860 319486 322656 gene locus_tag LOCUS_02870 gene cusA 319486 322656 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_02870 323907 323593 gene locus_tag LOCUS_02880 323907 323593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 323971 324429 gene locus_tag LOCUS_02890 323971 324429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 324434 324802 gene locus_tag LOCUS_02900 324434 324802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 325925 324927 gene locus_tag LOCUS_02910 325925 324927 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_02910 326100 327653 gene locus_tag LOCUS_02920 326100 327653 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_02920 329280 327700 gene locus_tag LOCUS_02930 329280 327700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 331252 329273 gene locus_tag LOCUS_02940 331252 329273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 331629 334412 gene locus_tag LOCUS_02950 331629 334412 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 protein_id gnl|my_center|LOCUS_02950 335464 334424 gene locus_tag LOCUS_02960 335464 334424 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_02960 337735 335480 gene locus_tag LOCUS_02970 337735 335480 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_02970 338799 337804 gene locus_tag LOCUS_02980 338799 337804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 339248 340099 gene locus_tag LOCUS_02990 339248 340099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 340096 340641 gene locus_tag LOCUS_03000 340096 340641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 340631 342307 gene locus_tag LOCUS_03010 340631 342307 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_03010 343187 342420 gene locus_tag LOCUS_03020 343187 342420 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564075.1 protein_id gnl|my_center|LOCUS_03020 344904 343180 gene locus_tag LOCUS_03030 gene hyuB 344904 343180 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385682.1 protein_id gnl|my_center|LOCUS_03030 346952 344901 gene locus_tag LOCUS_03040 346952 344901 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_03040 347851 346949 gene locus_tag LOCUS_03050 347851 346949 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186835.1 protein_id gnl|my_center|LOCUS_03050 348629 347853 gene locus_tag LOCUS_03060 348629 347853 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03060 350112 348652 gene locus_tag LOCUS_03070 350112 348652 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_03070 350756 350190 gene locus_tag LOCUS_03080 350756 350190 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479676.1 protein_id gnl|my_center|LOCUS_03080 351142 352158 gene locus_tag LOCUS_03090 351142 352158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 352227 353837 gene locus_tag LOCUS_03100 352227 353837 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957568.1 protein_id gnl|my_center|LOCUS_03100 356136 353980 gene locus_tag LOCUS_03110 356136 353980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 356404 356177 gene locus_tag LOCUS_03120 356404 356177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 357132 356623 gene locus_tag LOCUS_03130 357132 356623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 358485 357385 gene locus_tag LOCUS_03140 358485 357385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_03140 358746 359798 gene locus_tag LOCUS_03150 358746 359798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 359959 360738 gene locus_tag LOCUS_03160 359959 360738 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_03160 360789 361859 gene locus_tag LOCUS_03170 360789 361859 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_03170 362253 361924 gene locus_tag LOCUS_03180 362253 361924 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_03180 363502 362333 gene locus_tag LOCUS_03190 363502 362333 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_03190 364691 363513 gene locus_tag LOCUS_03200 364691 363513 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_03200 366229 364943 gene locus_tag LOCUS_03210 366229 364943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 367067 366222 gene locus_tag LOCUS_03220 367067 366222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 368015 367089 gene locus_tag LOCUS_03230 368015 367089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 368827 368012 gene locus_tag LOCUS_03240 368827 368012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 369260 368970 gene locus_tag LOCUS_03250 369260 368970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 369426 371573 gene locus_tag LOCUS_03260 gene fadB 369426 371573 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 protein_id gnl|my_center|LOCUS_03260 371602 372783 gene locus_tag LOCUS_03270 gene fadA 371602 372783 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZB3 protein_id gnl|my_center|LOCUS_03270 372907 373764 gene locus_tag LOCUS_03280 372907 373764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 374708 373824 gene locus_tag LOCUS_03290 374708 373824 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_03290 376158 374776 gene locus_tag LOCUS_03300 376158 374776 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_03300 376845 376162 gene locus_tag LOCUS_03310 376845 376162 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_03310 377464 376874 gene locus_tag LOCUS_03320 377464 376874 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_03320 377615 378301 gene locus_tag LOCUS_03330 gene echA3 377615 378301 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_03330 379173 378313 gene locus_tag LOCUS_03340 379173 378313 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_03340 380314 379193 gene locus_tag LOCUS_03350 380314 379193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 380622 382790 gene locus_tag LOCUS_03360 380622 382790 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267119.1 protein_id gnl|my_center|LOCUS_03360 384131 382791 gene locus_tag LOCUS_03370 gene cysG 384131 382791 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_03370 385485 384187 gene locus_tag LOCUS_03380 gene serS 385485 384187 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQR6 protein_id gnl|my_center|LOCUS_03380 385907 385530 gene locus_tag LOCUS_03390 gene crcB 385907 385530 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U893 protein_id gnl|my_center|LOCUS_03390 387263 385923 gene locus_tag LOCUS_03400 387263 385923 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_03400 387870 387253 gene locus_tag LOCUS_03410 387870 387253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 390205 387890 gene locus_tag LOCUS_03420 gene ftsK 390205 387890 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U1 protein_id gnl|my_center|LOCUS_03420 390458 391405 gene locus_tag LOCUS_03430 gene trxB1 390458 391405 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_03430 391415 392128 gene locus_tag LOCUS_03440 gene aat 391415 392128 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M1 protein_id gnl|my_center|LOCUS_03440 392125 392835 gene locus_tag LOCUS_03450 gene ate 392125 392835 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M0 protein_id gnl|my_center|LOCUS_03450 392968 393186 gene locus_tag LOCUS_03460 gene infA 392968 393186 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_03460 395478 393193 gene locus_tag LOCUS_03470 gene clpA 395478 393193 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_03470 395874 395494 gene locus_tag LOCUS_03480 gene clpS 395874 395494 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_03480 397337 396084 gene locus_tag LOCUS_03490 gene icd 397337 396084 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_03490 397481 398089 gene locus_tag LOCUS_03500 397481 398089 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_03500 398090 398542 gene locus_tag LOCUS_03510 398090 398542 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_03510 398539 399633 gene locus_tag LOCUS_03520 gene mnmA 398539 399633 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 protein_id gnl|my_center|LOCUS_03520 399630 400274 gene locus_tag LOCUS_03530 gene hflD 399630 400274 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZR5 protein_id gnl|my_center|LOCUS_03530 400303 401673 gene locus_tag LOCUS_03540 400303 401673 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRJ8 protein_id gnl|my_center|LOCUS_03540 401681 402814 gene locus_tag LOCUS_03550 401681 402814 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246030.1 protein_id gnl|my_center|LOCUS_03550 402804 403304 gene locus_tag LOCUS_03560 402804 403304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 404179 403310 gene locus_tag LOCUS_03570 404179 403310 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_03570 404499 406196 gene locus_tag LOCUS_03580 gene caiA 404499 406196 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_03580 406199 407371 gene locus_tag LOCUS_03590 406199 407371 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 protein_id gnl|my_center|LOCUS_03590 407383 409383 gene locus_tag LOCUS_03600 407383 409383 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_03600 409395 410387 gene locus_tag LOCUS_03610 409395 410387 CDS product ArgK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_03610 410409 411458 gene locus_tag LOCUS_03620 gene citE 410409 411458 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_03620 411948 411631 gene locus_tag LOCUS_03630 411948 411631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 412919 411960 gene locus_tag LOCUS_03640 gene argK 412919 411960 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_03640 415080 412966 gene locus_tag LOCUS_03650 415080 412966 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_03650 415501 415091 gene locus_tag LOCUS_03660 gene mceE 415501 415091 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_03660 418330 415514 gene locus_tag LOCUS_03670 418330 415514 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943912.1 protein_id gnl|my_center|LOCUS_03670 420159 418369 gene locus_tag LOCUS_03680 420159 418369 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 protein_id gnl|my_center|LOCUS_03680 420441 421808 gene locus_tag LOCUS_03690 420441 421808 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 protein_id gnl|my_center|LOCUS_03690 422439 421822 gene locus_tag LOCUS_03700 422439 421822 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883R9 protein_id gnl|my_center|LOCUS_03700 423519 422545 gene locus_tag LOCUS_03710 gene cysB 423519 422545 CDS product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_03710 424536 423637 gene locus_tag LOCUS_03720 424536 423637 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_03720 425887 424550 gene locus_tag LOCUS_03730 425887 424550 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_03730 426926 425910 gene locus_tag LOCUS_03740 426926 425910 CDS product putative 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY68 protein_id gnl|my_center|LOCUS_03740 427261 426929 gene locus_tag LOCUS_03750 gene yajC 427261 426929 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 protein_id gnl|my_center|LOCUS_03750 428210 427428 gene locus_tag LOCUS_03760 gene xth 428210 427428 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_03760 428372 428905 gene locus_tag LOCUS_03770 428372 428905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 429344 428892 gene locus_tag LOCUS_03780 429344 428892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WL25 protein_id gnl|my_center|LOCUS_03780 430123 429359 gene locus_tag LOCUS_03790 430123 429359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 431002 430133 gene locus_tag LOCUS_03800 431002 430133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 432189 431098 gene locus_tag LOCUS_03810 432189 431098 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_03810 432674 432198 gene locus_tag LOCUS_03820 gene bcp 432674 432198 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 protein_id gnl|my_center|LOCUS_03820 433244 432702 gene locus_tag LOCUS_03830 433244 432702 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_03830 433816 433340 gene locus_tag LOCUS_03840 433816 433340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 434422 433946 gene locus_tag LOCUS_03850 gene moaE 434422 433946 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 protein_id gnl|my_center|LOCUS_03850 434697 434443 gene locus_tag LOCUS_03860 gene moaD 434697 434443 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E943 protein_id gnl|my_center|LOCUS_03860 435188 434691 gene locus_tag LOCUS_03870 gene moaC 435188 434691 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q887P4 protein_id gnl|my_center|LOCUS_03870 435353 436369 gene locus_tag LOCUS_03880 435353 436369 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_03880 436684 438738 gene locus_tag LOCUS_03890 436684 438738 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_03890 438776 439060 gene locus_tag LOCUS_03900 438776 439060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 439239 439841 gene locus_tag LOCUS_03910 gene lexA 439239 439841 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ16 protein_id gnl|my_center|LOCUS_03910 440088 439846 gene locus_tag LOCUS_03920 440088 439846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 440322 441095 gene locus_tag LOCUS_03930 gene hetN 440322 441095 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_03930 443870 441204 gene locus_tag LOCUS_03940 gene topA 443870 441204 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 protein_id gnl|my_center|LOCUS_03940 444425 443979 gene locus_tag LOCUS_03950 444425 443979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 444545 444979 gene locus_tag LOCUS_03960 444545 444979 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZA9 protein_id gnl|my_center|LOCUS_03960 445171 444992 gene locus_tag LOCUS_03970 445171 444992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 445418 446323 gene locus_tag LOCUS_03980 445418 446323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 446341 447120 gene locus_tag LOCUS_03990 gene yjfH 446341 447120 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_03990 448280 447105 gene locus_tag LOCUS_04000 448280 447105 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_04000 449169 448312 gene locus_tag LOCUS_04010 449169 448312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_04010 449646 449272 gene locus_tag LOCUS_04020 449646 449272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 450100 449657 gene locus_tag LOCUS_04030 450100 449657 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 protein_id gnl|my_center|LOCUS_04030 450359 450087 gene locus_tag LOCUS_04040 450359 450087 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I449 protein_id gnl|my_center|LOCUS_04040 451489 450356 gene locus_tag LOCUS_04050 gene rnd 451489 450356 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y81 protein_id gnl|my_center|LOCUS_04050 452092 451493 gene locus_tag LOCUS_04060 gene recR 452092 451493 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44712 protein_id gnl|my_center|LOCUS_04060 452449 452126 gene locus_tag LOCUS_04070 452449 452126 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 protein_id gnl|my_center|LOCUS_04070 454301 452469 gene locus_tag LOCUS_04080 454301 452469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence02 223 147 gene locus_tag LOCUS_t00100 223 147 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 322 247 gene locus_tag LOCUS_t00110 322 247 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 533 889 gene locus_tag LOCUS_04090 533 889 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSF7 protein_id gnl|my_center|LOCUS_04090 2060 1419 gene locus_tag LOCUS_04100 2060 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2154 3860 gene locus_tag LOCUS_04110 2154 3860 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 protein_id gnl|my_center|LOCUS_04110 3882 5330 gene locus_tag LOCUS_04120 3882 5330 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9G0 protein_id gnl|my_center|LOCUS_04120 5669 5343 gene locus_tag LOCUS_04130 5669 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6488 5676 gene locus_tag LOCUS_04140 6488 5676 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_04140 6553 7341 gene locus_tag LOCUS_04150 6553 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 7391 9217 gene locus_tag LOCUS_04160 7391 9217 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYI2 protein_id gnl|my_center|LOCUS_04160 10353 9226 gene locus_tag LOCUS_04170 10353 9226 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_04170 12248 10476 gene locus_tag LOCUS_04180 12248 10476 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_04180 13234 12278 gene locus_tag LOCUS_04190 13234 12278 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_04190 14207 13371 gene locus_tag LOCUS_04200 14207 13371 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705517.1 protein_id gnl|my_center|LOCUS_04200 15234 14230 gene locus_tag LOCUS_04210 15234 14230 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_04210 16163 15231 gene locus_tag LOCUS_04220 16163 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 17057 16245 gene locus_tag LOCUS_04230 17057 16245 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104157.1 protein_id gnl|my_center|LOCUS_04230 17652 17095 gene locus_tag LOCUS_04240 17652 17095 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_04240 18533 17730 gene locus_tag LOCUS_04250 18533 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 20418 18559 gene locus_tag LOCUS_04260 gene fabY 20418 18559 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_04260 20546 21535 gene locus_tag LOCUS_04270 20546 21535 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_04270 21835 21644 gene locus_tag LOCUS_04280 21835 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 21795 22976 gene locus_tag LOCUS_04290 21795 22976 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_04290 23001 24113 gene locus_tag LOCUS_04300 gene ribB 23001 24113 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_04300 24202 25257 gene locus_tag LOCUS_04310 24202 25257 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_04310 25262 28438 gene locus_tag LOCUS_04320 25262 28438 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_04320 29273 28383 gene locus_tag LOCUS_04330 29273 28383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKP1 protein_id gnl|my_center|LOCUS_04330 29494 31716 gene locus_tag LOCUS_04340 29494 31716 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_04340 32314 31754 gene locus_tag LOCUS_04350 32314 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 33526 32543 gene locus_tag LOCUS_04360 33526 32543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_04360 33624 34079 gene locus_tag LOCUS_04370 33624 34079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 36616 34172 gene locus_tag LOCUS_04380 36616 34172 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_04380 37516 36755 gene locus_tag LOCUS_04390 37516 36755 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_04390 38207 37533 gene locus_tag LOCUS_04400 gene nfnB 38207 37533 CDS product nitroreductase NfnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D0 protein_id gnl|my_center|LOCUS_04400 39144 38326 gene locus_tag LOCUS_04410 gene paaG 39144 38326 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_04410 41296 39668 gene locus_tag LOCUS_04420 41296 39668 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224430.1 protein_id gnl|my_center|LOCUS_04420 42495 41332 gene locus_tag LOCUS_04430 42495 41332 CDS product putative lipid carrier protein or keto acyl-COA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704896.1 protein_id gnl|my_center|LOCUS_04430 43562 42495 gene locus_tag LOCUS_04440 43562 42495 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_04440 44081 43566 gene locus_tag LOCUS_04450 44081 43566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 44539 44093 gene locus_tag LOCUS_04460 44539 44093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04460 44871 45719 gene locus_tag LOCUS_04470 44871 45719 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 protein_id gnl|my_center|LOCUS_04470 46786 45752 gene locus_tag LOCUS_04480 46786 45752 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 protein_id gnl|my_center|LOCUS_04480 47473 46823 gene locus_tag LOCUS_04490 47473 46823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 47571 48464 gene locus_tag LOCUS_04500 47571 48464 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_04500 48569 49147 gene locus_tag LOCUS_04510 48569 49147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_04510 51613 49250 gene locus_tag LOCUS_04520 51613 49250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 52317 51676 gene locus_tag LOCUS_04530 52317 51676 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_04530 53913 52450 gene locus_tag LOCUS_04540 53913 52450 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_04540 55276 54179 gene locus_tag LOCUS_04550 55276 54179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 56581 55649 gene locus_tag LOCUS_04560 56581 55649 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_04560 56806 56636 gene locus_tag LOCUS_04570 56806 56636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 58537 56816 gene locus_tag LOCUS_04580 58537 56816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04580 59398 58628 gene locus_tag LOCUS_04590 gene kduD 59398 58628 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_04590 60495 59476 gene locus_tag LOCUS_04600 60495 59476 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_04600 62020 60485 gene locus_tag LOCUS_04610 62020 60485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 62908 62120 gene locus_tag LOCUS_04620 gene paaB1 62908 62120 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709123.1 protein_id gnl|my_center|LOCUS_04620 64067 62934 gene locus_tag LOCUS_04630 64067 62934 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_04630 64937 64146 gene locus_tag LOCUS_04640 64937 64146 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_04640 66219 64978 gene locus_tag LOCUS_04650 66219 64978 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_04650 66288 67460 gene locus_tag LOCUS_04660 66288 67460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 67468 68469 gene locus_tag LOCUS_04670 gene oruR 67468 68469 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_04670 68558 71374 gene locus_tag LOCUS_04680 68558 71374 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263656.1 protein_id gnl|my_center|LOCUS_04680 71967 71371 gene locus_tag LOCUS_04690 gene sprT 71967 71371 CDS product protein SprT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX4 protein_id gnl|my_center|LOCUS_04690 72543 72001 gene locus_tag LOCUS_04700 72543 72001 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082473.1 protein_id gnl|my_center|LOCUS_04700 72882 73904 gene locus_tag LOCUS_04710 72882 73904 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529667.1 protein_id gnl|my_center|LOCUS_04710 73962 74726 gene locus_tag LOCUS_04720 73962 74726 CDS product enoyl CoA dehydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_04720 74738 75973 gene locus_tag LOCUS_04730 74738 75973 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_04730 76151 77380 gene locus_tag LOCUS_04740 76151 77380 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_04740 77909 77364 gene locus_tag LOCUS_04750 77909 77364 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063693.1 protein_id gnl|my_center|LOCUS_04750 78724 78032 gene locus_tag LOCUS_04760 78724 78032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 80812 79145 gene locus_tag LOCUS_04770 80812 79145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_04770 81163 82230 gene locus_tag LOCUS_04780 81163 82230 CDS product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_04780 82237 85299 gene locus_tag LOCUS_04790 82237 85299 CDS product MexW/MexI family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 protein_id gnl|my_center|LOCUS_04790 86858 85320 gene locus_tag LOCUS_04800 86858 85320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 87085 88287 gene locus_tag LOCUS_04810 87085 88287 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_04810 89863 88292 gene locus_tag LOCUS_04820 89863 88292 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_04820 90703 89933 gene locus_tag LOCUS_04830 90703 89933 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_04830 90919 91701 gene locus_tag LOCUS_04840 90919 91701 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MF66 protein_id gnl|my_center|LOCUS_04840 91717 92457 gene locus_tag LOCUS_04850 91717 92457 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I203 protein_id gnl|my_center|LOCUS_04850 92464 93144 gene locus_tag LOCUS_04860 92464 93144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_04860 93141 94079 gene locus_tag LOCUS_04870 gene ybgK 93141 94079 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 protein_id gnl|my_center|LOCUS_04870 94076 94945 gene locus_tag LOCUS_04880 94076 94945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_04880 94994 95851 gene locus_tag LOCUS_04890 94994 95851 CDS product cytochrome c551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_04890 95851 96930 gene locus_tag LOCUS_04900 gene alr 95851 96930 CDS product alanine racemase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN4 protein_id gnl|my_center|LOCUS_04900 96923 98437 gene locus_tag LOCUS_04910 96923 98437 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729267.1 protein_id gnl|my_center|LOCUS_04910 99521 98439 gene locus_tag LOCUS_04920 99521 98439 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_04920 99577 99768 gene locus_tag LOCUS_04930 99577 99768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 99755 101272 gene locus_tag LOCUS_04940 99755 101272 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_04940 101345 104020 gene locus_tag LOCUS_04950 gene acn 101345 104020 CDS product aconitate hydratase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37032 protein_id gnl|my_center|LOCUS_04950 104603 104052 gene locus_tag LOCUS_04960 104603 104052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421912.1 protein_id gnl|my_center|LOCUS_04960 104815 106872 gene locus_tag LOCUS_04970 104815 106872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_04970 107109 108617 gene locus_tag LOCUS_04980 107109 108617 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266304.1 protein_id gnl|my_center|LOCUS_04980 109619 108645 gene locus_tag LOCUS_04990 109619 108645 CDS product putative epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704492.1 protein_id gnl|my_center|LOCUS_04990 111001 109682 gene locus_tag LOCUS_05000 111001 109682 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 protein_id gnl|my_center|LOCUS_05000 111342 111004 gene locus_tag LOCUS_05010 gene glnK 111342 111004 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_05010 111623 113032 gene locus_tag LOCUS_05020 111623 113032 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368025.1 protein_id gnl|my_center|LOCUS_05020 114027 113128 gene locus_tag LOCUS_05030 114027 113128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 115906 114143 gene locus_tag LOCUS_05040 gene gspA 115906 114143 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_05040 117620 116022 gene locus_tag LOCUS_05050 117620 116022 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418263.1 protein_id gnl|my_center|LOCUS_05050 117900 118367 gene locus_tag LOCUS_05060 117900 118367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 119431 118568 gene locus_tag LOCUS_05070 119431 118568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_05070 119672 121099 gene locus_tag LOCUS_05080 119672 121099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 121105 121731 gene locus_tag LOCUS_05090 121105 121731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_05090 122764 121772 gene locus_tag LOCUS_05100 122764 121772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 124618 122867 gene locus_tag LOCUS_05110 124618 122867 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKA5 protein_id gnl|my_center|LOCUS_05110 124760 125344 gene locus_tag LOCUS_05120 124760 125344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_05120 125341 125742 gene locus_tag LOCUS_05130 125341 125742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921101.1 protein_id gnl|my_center|LOCUS_05130 125714 126343 gene locus_tag LOCUS_05140 125714 126343 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 protein_id gnl|my_center|LOCUS_05140 126340 127248 gene locus_tag LOCUS_05150 126340 127248 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186174.1 protein_id gnl|my_center|LOCUS_05150 127309 128190 gene locus_tag LOCUS_05160 127309 128190 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957705.1 protein_id gnl|my_center|LOCUS_05160 128536 128228 gene locus_tag LOCUS_05170 128536 128228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 128768 129367 gene locus_tag LOCUS_05180 gene msrA 128768 129367 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_05180 129928 129368 gene locus_tag LOCUS_05190 129928 129368 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_05190 130804 129947 gene locus_tag LOCUS_05200 130804 129947 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731406.1 protein_id gnl|my_center|LOCUS_05200 132050 130968 gene locus_tag LOCUS_05210 gene aroG 132050 130968 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_05210 132521 132060 gene locus_tag LOCUS_05220 132521 132060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080407.1 protein_id gnl|my_center|LOCUS_05220 133148 137542 gene locus_tag LOCUS_05230 133148 137542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 137539 137994 gene locus_tag LOCUS_05240 137539 137994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 137984 138301 gene locus_tag LOCUS_05250 137984 138301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_05250 138530 139294 gene locus_tag LOCUS_05260 138530 139294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551753.1 protein_id gnl|my_center|LOCUS_05260 139299 141518 gene locus_tag LOCUS_05270 139299 141518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064406.1 protein_id gnl|my_center|LOCUS_05270 141521 142162 gene locus_tag LOCUS_05280 141521 142162 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064407.1 protein_id gnl|my_center|LOCUS_05280 142164 142853 gene locus_tag LOCUS_05290 142164 142853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198086.1 protein_id gnl|my_center|LOCUS_05290 143072 145006 gene locus_tag LOCUS_05300 143072 145006 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_05300 145053 145655 gene locus_tag LOCUS_05310 145053 145655 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461596.1 protein_id gnl|my_center|LOCUS_05310 146480 145767 gene locus_tag LOCUS_05320 gene bluB 146480 145767 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PC8 protein_id gnl|my_center|LOCUS_05320 147412 146522 gene locus_tag LOCUS_05330 gene btuF 147412 146522 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_05330 148434 147397 gene locus_tag LOCUS_05340 gene cobC 148434 147397 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I468 protein_id gnl|my_center|LOCUS_05340 149387 148431 gene locus_tag LOCUS_05350 gene cobD 149387 148431 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ62 protein_id gnl|my_center|LOCUS_05350 150159 149389 gene locus_tag LOCUS_05360 gene cobS 150159 149389 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN06 protein_id gnl|my_center|LOCUS_05360 150782 150159 gene locus_tag LOCUS_05370 150782 150159 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_05370 151822 150782 gene locus_tag LOCUS_05380 gene cobT 151822 150782 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 protein_id gnl|my_center|LOCUS_05380 152348 151824 gene locus_tag LOCUS_05390 gene cobP 152348 151824 CDS product bifunctional adenosylcobalamin biosynthesis protein CobP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I466 protein_id gnl|my_center|LOCUS_05390 153135 152362 gene locus_tag LOCUS_05400 gene hmuV 153135 152362 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 protein_id gnl|my_center|LOCUS_05400 154178 153138 gene locus_tag LOCUS_05410 154178 153138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 protein_id gnl|my_center|LOCUS_05410 154894 154184 gene locus_tag LOCUS_05420 154894 154184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 156363 154891 gene locus_tag LOCUS_05430 156363 154891 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638408.2 protein_id gnl|my_center|LOCUS_05430 156845 158119 gene locus_tag LOCUS_05440 gene metY 156845 158119 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_05440 158658 158140 gene locus_tag LOCUS_05450 158658 158140 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068860.1 protein_id gnl|my_center|LOCUS_05450 160351 158756 gene locus_tag LOCUS_05460 160351 158756 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_05460 162169 160643 gene locus_tag LOCUS_05470 162169 160643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 163371 162166 gene locus_tag LOCUS_05480 163371 162166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 164004 163384 gene locus_tag LOCUS_05490 164004 163384 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884290.1 protein_id gnl|my_center|LOCUS_05490 164191 166653 gene locus_tag LOCUS_05500 gene fyuA 164191 166653 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_05500 167065 166679 gene locus_tag LOCUS_05510 167065 166679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 168485 167070 gene locus_tag LOCUS_05520 gene der 168485 167070 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW7 protein_id gnl|my_center|LOCUS_05520 169660 168485 gene locus_tag LOCUS_05530 gene bamB 169660 168485 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_05530 170402 169665 gene locus_tag LOCUS_05540 170402 169665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 protein_id gnl|my_center|LOCUS_05540 171710 170427 gene locus_tag LOCUS_05550 gene hisS 171710 170427 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCT6 protein_id gnl|my_center|LOCUS_05550 172871 171738 gene locus_tag LOCUS_05560 gene ispG 172871 171738 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_05560 173347 172868 gene locus_tag LOCUS_05570 173347 172868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 174138 173344 gene locus_tag LOCUS_05580 174138 173344 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799875.1 protein_id gnl|my_center|LOCUS_05580 175298 174141 gene locus_tag LOCUS_05590 gene rlmN 175298 174141 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z3 protein_id gnl|my_center|LOCUS_05590 175745 175320 gene locus_tag LOCUS_05600 gene ndk 175745 175320 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 protein_id gnl|my_center|LOCUS_05600 176153 175959 gene locus_tag LOCUS_05610 176153 175959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_05610 176506 176168 gene locus_tag LOCUS_05620 gene fdx 176506 176168 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_05620 178386 176503 gene locus_tag LOCUS_05630 gene hscA 178386 176503 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CP83 protein_id gnl|my_center|LOCUS_05630 178943 178407 gene locus_tag LOCUS_05640 gene hscB 178943 178407 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ35 protein_id gnl|my_center|LOCUS_05640 179290 178967 gene locus_tag LOCUS_05650 gene iscA 179290 178967 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ0 protein_id gnl|my_center|LOCUS_05650 179675 179292 gene locus_tag LOCUS_05660 gene iscU 179675 179292 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_05660 180912 179698 gene locus_tag LOCUS_05670 gene iscS 180912 179698 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 protein_id gnl|my_center|LOCUS_05670 181425 180952 gene locus_tag LOCUS_05680 181425 180952 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_05680 182294 181533 gene locus_tag LOCUS_05690 gene trmJ 182294 181533 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_05690 183119 182325 gene locus_tag LOCUS_05700 gene suhB 183119 182325 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 protein_id gnl|my_center|LOCUS_05700 184070 183141 gene locus_tag LOCUS_05710 gene secF 184070 183141 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 protein_id gnl|my_center|LOCUS_05710 185947 184067 gene locus_tag LOCUS_05720 gene secD 185947 184067 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_05720 189956 186060 gene locus_tag LOCUS_05730 gene purL 189956 186060 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 protein_id gnl|my_center|LOCUS_05730 190067 191527 gene locus_tag LOCUS_05740 gene mltF 190067 191527 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886W7 protein_id gnl|my_center|LOCUS_05740 192004 191546 gene locus_tag LOCUS_05750 gene tadA 192004 191546 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM8 protein_id gnl|my_center|LOCUS_05750 192104 192643 gene locus_tag LOCUS_05760 192104 192643 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLR2 protein_id gnl|my_center|LOCUS_05760 192646 193959 gene locus_tag LOCUS_05770 192646 193959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 194013 195326 gene locus_tag LOCUS_05780 194013 195326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709316.1 protein_id gnl|my_center|LOCUS_05780 195994 195410 gene locus_tag LOCUS_05790 gene sodB 195994 195410 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED83 protein_id gnl|my_center|LOCUS_05790 196233 196403 gene locus_tag LOCUS_05800 196233 196403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 protein_id gnl|my_center|LOCUS_05800 196674 196507 gene locus_tag LOCUS_05810 196674 196507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 197331 196720 gene locus_tag LOCUS_05820 197331 196720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 197912 198163 gene locus_tag LOCUS_05830 197912 198163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 199583 198228 gene locus_tag LOCUS_05840 199583 198228 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478617.1 protein_id gnl|my_center|LOCUS_05840 200145 200456 gene locus_tag LOCUS_05850 200145 200456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 200566 200955 gene locus_tag LOCUS_05860 200566 200955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 200952 201209 gene locus_tag LOCUS_05870 200952 201209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 202306 201257 gene locus_tag LOCUS_05880 gene yfeW 202306 201257 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 202298 202513 gene locus_tag LOCUS_05890 202298 202513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 203964 202621 gene locus_tag LOCUS_05900 203964 202621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_05900 204696 204232 gene locus_tag LOCUS_05910 204696 204232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 205655 204921 gene locus_tag LOCUS_05920 205655 204921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_05920 205953 205801 gene locus_tag LOCUS_05930 205953 205801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 205891 206658 gene locus_tag LOCUS_05940 205891 206658 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726855.1 protein_id gnl|my_center|LOCUS_05940 208090 206738 gene locus_tag LOCUS_05950 gene gdhA 208090 206738 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55990 protein_id gnl|my_center|LOCUS_05950 209247 208180 gene locus_tag LOCUS_05960 209247 208180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 210658 209285 gene locus_tag LOCUS_05970 210658 209285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089102.1 protein_id gnl|my_center|LOCUS_05970 211287 210763 gene locus_tag LOCUS_05980 211287 210763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 211792 213486 gene locus_tag LOCUS_05990 211792 213486 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_05990 213517 214920 gene locus_tag LOCUS_06000 213517 214920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 217268 214977 gene locus_tag LOCUS_06010 217268 214977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 218260 217319 gene locus_tag LOCUS_06020 218260 217319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 218487 220754 gene locus_tag LOCUS_06030 218487 220754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 223219 220751 gene locus_tag LOCUS_06040 223219 220751 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727995.1 protein_id gnl|my_center|LOCUS_06040 224175 223216 gene locus_tag LOCUS_06050 224175 223216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 225837 224227 gene locus_tag LOCUS_06060 225837 224227 CDS product nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_06060 226108 225851 gene locus_tag LOCUS_06070 226108 225851 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144208.1 protein_id gnl|my_center|LOCUS_06070 230994 226252 gene locus_tag LOCUS_06080 230994 226252 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144209.1 protein_id gnl|my_center|LOCUS_06080 233046 231061 gene locus_tag LOCUS_06090 233046 231061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 233892 233107 gene locus_tag LOCUS_06100 233892 233107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 234739 233948 gene locus_tag LOCUS_06110 234739 233948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 243411 234820 gene locus_tag LOCUS_06120 243411 234820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 245604 243601 gene locus_tag LOCUS_06130 245604 243601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 246981 246142 gene locus_tag LOCUS_06140 246981 246142 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_06140 247228 249111 gene locus_tag LOCUS_06150 247228 249111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 249799 249236 gene locus_tag LOCUS_06160 249799 249236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 250175 250011 gene locus_tag LOCUS_06170 250175 250011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 250390 250172 gene locus_tag LOCUS_06180 250390 250172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 250548 251735 gene locus_tag LOCUS_06190 250548 251735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 252915 251788 gene locus_tag LOCUS_06200 252915 251788 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_06200 253249 253578 gene locus_tag LOCUS_06210 253249 253578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 253572 254888 gene locus_tag LOCUS_06220 253572 254888 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_06220 254942 255535 gene locus_tag LOCUS_06230 254942 255535 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_06230 257496 255559 gene locus_tag LOCUS_06240 257496 255559 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_06240 257870 258724 gene locus_tag LOCUS_06250 257870 258724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_06250 258799 260460 gene locus_tag LOCUS_06260 258799 260460 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_06260 260505 261110 gene locus_tag LOCUS_06270 260505 261110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879652.1 protein_id gnl|my_center|LOCUS_06270 261107 261628 gene locus_tag LOCUS_06280 261107 261628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 261674 263941 gene locus_tag LOCUS_06290 261674 263941 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_06290 264055 266163 gene locus_tag LOCUS_06300 264055 266163 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_06300 266244 267422 gene locus_tag LOCUS_06310 266244 267422 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 protein_id gnl|my_center|LOCUS_06310 267570 268961 gene locus_tag LOCUS_06320 267570 268961 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_06320 270067 269108 gene locus_tag LOCUS_06330 270067 269108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_06330 270163 270948 gene locus_tag LOCUS_06340 gene rhlG 270163 270948 CDS product rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT1 protein_id gnl|my_center|LOCUS_06340 271201 272739 gene locus_tag LOCUS_06350 271201 272739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 272872 274179 gene locus_tag LOCUS_06360 gene roxS 272872 274179 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_06360 274176 274712 gene locus_tag LOCUS_06370 274176 274712 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_06370 274893 274738 gene locus_tag LOCUS_06380 274893 274738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 275380 275871 gene locus_tag LOCUS_06390 275380 275871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 276208 280215 gene locus_tag LOCUS_06400 276208 280215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 280356 281591 gene locus_tag LOCUS_06410 gene vieA 280356 281591 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_06410 282338 281706 gene locus_tag LOCUS_06420 282338 281706 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525376.1 protein_id gnl|my_center|LOCUS_06420 284270 282639 gene locus_tag LOCUS_06430 284270 282639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 284695 286449 gene locus_tag LOCUS_06440 284695 286449 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893345.1 protein_id gnl|my_center|LOCUS_06440 286460 286852 gene locus_tag LOCUS_06450 286460 286852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 289001 286893 gene locus_tag LOCUS_06460 289001 286893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 291356 289215 gene locus_tag LOCUS_06470 291356 289215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 293277 291574 gene locus_tag LOCUS_06480 293277 291574 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705127.1 protein_id gnl|my_center|LOCUS_06480 295717 293642 gene locus_tag LOCUS_06490 gene btuB 295717 293642 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTG7 protein_id gnl|my_center|LOCUS_06490 296201 297472 gene locus_tag LOCUS_06500 296201 297472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_06500 298034 300166 gene locus_tag LOCUS_06510 298034 300166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066717.1 protein_id gnl|my_center|LOCUS_06510 301607 300231 gene locus_tag LOCUS_06520 301607 300231 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_06520 303025 301622 gene locus_tag LOCUS_06530 gene fumC2 303025 301622 CDS product fumarate hydratase class II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XM2 protein_id gnl|my_center|LOCUS_06530 305649 303388 gene locus_tag LOCUS_06540 305649 303388 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918224.1 protein_id gnl|my_center|LOCUS_06540 306406 306176 gene locus_tag LOCUS_06550 306406 306176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 307628 306465 gene locus_tag LOCUS_06560 307628 306465 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_06560 307865 309337 gene locus_tag LOCUS_06570 307865 309337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_06570 309420 310637 gene locus_tag LOCUS_06580 309420 310637 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_06580 310663 311436 gene locus_tag LOCUS_06590 gene fabG 310663 311436 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812486.1 protein_id gnl|my_center|LOCUS_06590 311476 312213 gene locus_tag LOCUS_06600 311476 312213 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707378.1 protein_id gnl|my_center|LOCUS_06600 312242 313549 gene locus_tag LOCUS_06610 312242 313549 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 protein_id gnl|my_center|LOCUS_06610 313627 314775 gene locus_tag LOCUS_06620 313627 314775 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039693.1 protein_id gnl|my_center|LOCUS_06620 314772 315977 gene locus_tag LOCUS_06630 314772 315977 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_06630 315986 316792 gene locus_tag LOCUS_06640 315986 316792 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_06640 316824 318011 gene locus_tag LOCUS_06650 316824 318011 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730851.1 protein_id gnl|my_center|LOCUS_06650 318624 318034 gene locus_tag LOCUS_06660 318624 318034 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_06660 319910 318720 gene locus_tag LOCUS_06670 319910 318720 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_06670 320651 320031 gene locus_tag LOCUS_06680 320651 320031 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 protein_id gnl|my_center|LOCUS_06680 321600 320884 gene locus_tag LOCUS_06690 321600 320884 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_06690 322068 321667 gene locus_tag LOCUS_06700 322068 321667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 323262 322114 gene locus_tag LOCUS_06710 323262 322114 CDS product putative lipid transfer protein or keto acyl-CoA thiolase Ltp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701370.1 protein_id gnl|my_center|LOCUS_06710 324202 323312 gene locus_tag LOCUS_06720 324202 323312 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_06720 327794 324234 gene locus_tag LOCUS_06730 327794 324234 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_06730 328786 327821 gene locus_tag LOCUS_06740 328786 327821 CDS product putative 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701337.1 protein_id gnl|my_center|LOCUS_06740 329317 328877 gene locus_tag LOCUS_06750 329317 328877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 329848 329381 gene locus_tag LOCUS_06760 gene nodN 329848 329381 CDS product nodulation protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25200 protein_id gnl|my_center|LOCUS_06760 330628 329888 gene locus_tag LOCUS_06770 330628 329888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 331442 330645 gene locus_tag LOCUS_06780 gene paaG 331442 330645 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_06780 332652 331495 gene locus_tag LOCUS_06790 gene acd 332652 331495 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_06790 333273 332803 gene locus_tag LOCUS_06800 333273 332803 CDS product MaoC-like dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702791.1 protein_id gnl|my_center|LOCUS_06800 333788 333270 gene locus_tag LOCUS_06810 333788 333270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 334037 335704 gene locus_tag LOCUS_06820 334037 335704 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536471.1 protein_id gnl|my_center|LOCUS_06820 335781 336578 gene locus_tag LOCUS_06830 335781 336578 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730661.1 protein_id gnl|my_center|LOCUS_06830 336697 337455 gene locus_tag LOCUS_06840 336697 337455 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_06840 337526 339871 gene locus_tag LOCUS_06850 337526 339871 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_06850 340813 339956 gene locus_tag LOCUS_06860 340813 339956 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_06860 341832 340921 gene locus_tag LOCUS_06870 341832 340921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085120.1 protein_id gnl|my_center|LOCUS_06870 342010 343389 gene locus_tag LOCUS_06880 342010 343389 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 protein_id gnl|my_center|LOCUS_06880 343386 343694 gene locus_tag LOCUS_06890 343386 343694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 protein_id gnl|my_center|LOCUS_06890 343714 344571 gene locus_tag LOCUS_06900 343714 344571 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_06900 344931 346397 gene locus_tag LOCUS_06910 344931 346397 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_06910 346444 346821 gene locus_tag LOCUS_06920 346444 346821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 346826 349201 gene locus_tag LOCUS_06930 346826 349201 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_06930 349295 349678 gene locus_tag LOCUS_06940 349295 349678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 349695 350738 gene locus_tag LOCUS_06950 gene yesN 349695 350738 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_06950 351691 350744 gene locus_tag LOCUS_06960 351691 350744 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 protein_id gnl|my_center|LOCUS_06960 351784 352821 gene locus_tag LOCUS_06970 351784 352821 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103266.1 protein_id gnl|my_center|LOCUS_06970 352849 353655 gene locus_tag LOCUS_06980 352849 353655 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_06980 353652 354485 gene locus_tag LOCUS_06990 353652 354485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 354810 356981 gene locus_tag LOCUS_07000 354810 356981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 357157 357732 gene locus_tag LOCUS_07010 357157 357732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 357913 358392 gene locus_tag LOCUS_07020 357913 358392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 358594 359211 gene locus_tag LOCUS_07030 358594 359211 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528636.1 protein_id gnl|my_center|LOCUS_07030 360354 359452 gene locus_tag LOCUS_07040 360354 359452 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_07040 360498 361412 gene locus_tag LOCUS_07050 360498 361412 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976359.1 protein_id gnl|my_center|LOCUS_07050 362465 361479 gene locus_tag LOCUS_07060 362465 361479 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_07060 363037 362603 gene locus_tag LOCUS_07070 363037 362603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708713.1 protein_id gnl|my_center|LOCUS_07070 363867 363040 gene locus_tag LOCUS_07080 363867 363040 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_07080 364134 364637 gene locus_tag LOCUS_07090 364134 364637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524989.1 protein_id gnl|my_center|LOCUS_07090 364826 366145 gene locus_tag LOCUS_07100 364826 366145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 366221 366856 gene locus_tag LOCUS_07110 366221 366856 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_07110 366940 367107 gene locus_tag LOCUS_07120 366940 367107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 368671 367235 gene locus_tag LOCUS_07130 368671 367235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_07130 368782 369024 gene locus_tag LOCUS_07140 368782 369024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 369036 369341 gene locus_tag LOCUS_07150 369036 369341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 369973 369716 gene locus_tag LOCUS_07160 369973 369716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 370832 369861 gene locus_tag LOCUS_07170 370832 369861 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531869.1 protein_id gnl|my_center|LOCUS_07170 371032 372306 gene locus_tag LOCUS_07180 371032 372306 CDS product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528286.1 protein_id gnl|my_center|LOCUS_07180 373222 372362 gene locus_tag LOCUS_07190 373222 372362 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ00 protein_id gnl|my_center|LOCUS_07190 374214 373255 gene locus_tag LOCUS_07200 374214 373255 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_07200 374477 374217 gene locus_tag LOCUS_07210 374477 374217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 374953 374507 gene locus_tag LOCUS_07220 374953 374507 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 protein_id gnl|my_center|LOCUS_07220 375074 376003 gene locus_tag LOCUS_07230 375074 376003 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 protein_id gnl|my_center|LOCUS_07230 376678 376109 gene locus_tag LOCUS_07240 376678 376109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 376854 376636 gene locus_tag LOCUS_07250 376854 376636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 379144 377579 gene locus_tag LOCUS_07260 379144 377579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969474.1 protein_id gnl|my_center|LOCUS_07260 380758 379208 gene locus_tag LOCUS_07270 380758 379208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969475.1 protein_id gnl|my_center|LOCUS_07270 382071 380902 gene locus_tag LOCUS_07280 382071 380902 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263350.1 protein_id gnl|my_center|LOCUS_07280 383235 382093 gene locus_tag LOCUS_07290 383235 382093 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422647.1 protein_id gnl|my_center|LOCUS_07290 384041 383259 gene locus_tag LOCUS_07300 384041 383259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 384209 385159 gene locus_tag LOCUS_07310 384209 385159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence03 1966 389 gene locus_tag LOCUS_07320 gene guaA 1966 389 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 protein_id gnl|my_center|LOCUS_07320 3459 1990 gene locus_tag LOCUS_07330 gene guaB 3459 1990 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_07330 3615 4976 gene locus_tag LOCUS_07340 gene xseA 3615 4976 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR3 protein_id gnl|my_center|LOCUS_07340 5670 5023 gene locus_tag LOCUS_07350 5670 5023 CDS product catabolite gene activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_07350 6004 7401 gene locus_tag LOCUS_07360 6004 7401 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969398.1 protein_id gnl|my_center|LOCUS_07360 7398 7772 gene locus_tag LOCUS_07370 7398 7772 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_07370 7769 9280 gene locus_tag LOCUS_07380 7769 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 9851 9249 gene locus_tag LOCUS_07390 9851 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 11486 9972 gene locus_tag LOCUS_07400 gene lysS 11486 9972 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886S6 protein_id gnl|my_center|LOCUS_07400 12431 11499 gene locus_tag LOCUS_07410 gene prfB 12431 11499 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL5 protein_id gnl|my_center|LOCUS_07410 13907 12900 gene locus_tag LOCUS_07420 13907 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 14467 14057 gene locus_tag LOCUS_07430 gene cueR 14467 14057 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_07430 16247 14712 gene locus_tag LOCUS_07440 16247 14712 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066943.1 protein_id gnl|my_center|LOCUS_07440 18162 16420 gene locus_tag LOCUS_07450 gene recJ 18162 16420 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_07450 19576 18179 gene locus_tag LOCUS_07460 gene thrC 19576 18179 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_07460 20917 19610 gene locus_tag LOCUS_07470 gene hom 20917 19610 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_07470 22146 20950 gene locus_tag LOCUS_07480 22146 20950 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813076.1 protein_id gnl|my_center|LOCUS_07480 23045 22296 gene locus_tag LOCUS_07490 gene dsbC 23045 22296 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245372.1 protein_id gnl|my_center|LOCUS_07490 24035 23130 gene locus_tag LOCUS_07500 gene xerD 24035 23130 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 protein_id gnl|my_center|LOCUS_07500 25449 24112 gene locus_tag LOCUS_07510 25449 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 26156 25806 gene locus_tag LOCUS_07520 gene rplS 26156 25806 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_07520 26946 26194 gene locus_tag LOCUS_07530 gene trmD 26946 26194 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V0 protein_id gnl|my_center|LOCUS_07530 27514 26957 gene locus_tag LOCUS_07540 gene rimM 27514 26957 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 protein_id gnl|my_center|LOCUS_07540 27794 27546 gene locus_tag LOCUS_07550 gene rpsP 27794 27546 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXP9 protein_id gnl|my_center|LOCUS_07550 29353 27959 gene locus_tag LOCUS_07560 gene ffh 29353 27959 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LS7 protein_id gnl|my_center|LOCUS_07560 29494 30297 gene locus_tag LOCUS_07570 29494 30297 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266932.1 protein_id gnl|my_center|LOCUS_07570 30400 31656 gene locus_tag LOCUS_07580 30400 31656 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_07580 31859 31668 gene locus_tag LOCUS_07590 31859 31668 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771683.1 protein_id gnl|my_center|LOCUS_07590 32380 31856 gene locus_tag LOCUS_07600 32380 31856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 protein_id gnl|my_center|LOCUS_07600 32988 32377 gene locus_tag LOCUS_07610 gene nudL 32988 32377 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_07610 33308 32985 gene locus_tag LOCUS_07620 33308 32985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_07620 34411 33308 gene locus_tag LOCUS_07630 gene tgt 34411 33308 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX43 protein_id gnl|my_center|LOCUS_07630 35496 34426 gene locus_tag LOCUS_07640 gene queA 35496 34426 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_07640 35812 35546 gene locus_tag LOCUS_07650 35812 35546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 36008 36094 gene locus_tag LOCUS_t00120 36008 36094 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 36806 36207 gene locus_tag LOCUS_07660 36806 36207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 38010 36823 gene locus_tag LOCUS_07670 38010 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 38288 38635 gene locus_tag LOCUS_07680 38288 38635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 41606 38643 gene locus_tag LOCUS_07690 41606 38643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 42795 41890 gene locus_tag LOCUS_07700 42795 41890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 43209 42871 gene locus_tag LOCUS_07710 43209 42871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 45044 43449 gene locus_tag LOCUS_07720 45044 43449 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_07720 45427 45185 gene locus_tag LOCUS_07730 45427 45185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 45864 47246 gene locus_tag LOCUS_07740 45864 47246 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_07740 47274 48587 gene locus_tag LOCUS_07750 gene aspB 47274 48587 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CNM6 protein_id gnl|my_center|LOCUS_07750 50095 48644 gene locus_tag LOCUS_07760 50095 48644 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391093.1 protein_id gnl|my_center|LOCUS_07760 51295 50699 gene locus_tag LOCUS_07770 gene gmhA2 51295 50699 CDS product phosphoheptose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMN3 protein_id gnl|my_center|LOCUS_07770 52308 51277 gene locus_tag LOCUS_07780 52308 51277 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_07780 53528 52311 gene locus_tag LOCUS_07790 53528 52311 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942493.1 protein_id gnl|my_center|LOCUS_07790 54736 53528 gene locus_tag LOCUS_07800 54736 53528 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_07800 54873 56099 gene locus_tag LOCUS_07810 54873 56099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088729.1 protein_id gnl|my_center|LOCUS_07810 57250 56120 gene locus_tag LOCUS_07820 57250 56120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 58811 57252 gene locus_tag LOCUS_07830 58811 57252 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_07830 59038 60969 gene locus_tag LOCUS_07840 59038 60969 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_07840 61848 60994 gene locus_tag LOCUS_07850 61848 60994 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_07850 62672 61845 gene locus_tag LOCUS_07860 62672 61845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 62923 62675 gene locus_tag LOCUS_07870 62923 62675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_07870 63195 64214 gene locus_tag LOCUS_07880 63195 64214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 65137 64250 gene locus_tag LOCUS_07890 65137 64250 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_07890 65958 65134 gene locus_tag LOCUS_07900 65958 65134 CDS product hydrolase 2, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390871.1 protein_id gnl|my_center|LOCUS_07900 66843 66067 gene locus_tag LOCUS_07910 66843 66067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 68600 66855 gene locus_tag LOCUS_07920 68600 66855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 68936 69952 gene locus_tag LOCUS_07930 68936 69952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 69979 70761 gene locus_tag LOCUS_07940 69979 70761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 70867 71637 gene locus_tag LOCUS_07950 70867 71637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 72603 71617 gene locus_tag LOCUS_07960 72603 71617 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_07960 73966 72647 gene locus_tag LOCUS_07970 73966 72647 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_07970 75340 73991 gene locus_tag LOCUS_07980 75340 73991 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_07980 76416 75337 gene locus_tag LOCUS_07990 76416 75337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 78314 76413 gene locus_tag LOCUS_08000 78314 76413 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_08000 79490 78333 gene locus_tag LOCUS_08010 79490 78333 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_08010 81031 79490 gene locus_tag LOCUS_08020 81031 79490 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_08020 82068 81037 gene locus_tag LOCUS_08030 82068 81037 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_08030 82940 82065 gene locus_tag LOCUS_08040 82940 82065 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_08040 84079 82937 gene locus_tag LOCUS_08050 84079 82937 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_08050 85542 84091 gene locus_tag LOCUS_08060 85542 84091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 86627 85587 gene locus_tag LOCUS_08070 86627 85587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 88307 86685 gene locus_tag LOCUS_08080 88307 86685 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_08080 88996 88340 gene locus_tag LOCUS_08090 88996 88340 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_08090 91630 89213 gene locus_tag LOCUS_08100 91630 89213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 91807 92013 gene locus_tag LOCUS_08110 91807 92013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 92469 92855 gene locus_tag LOCUS_08120 92469 92855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 92972 93238 gene locus_tag LOCUS_08130 92972 93238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 93239 94159 gene locus_tag LOCUS_08140 93239 94159 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_08140 94156 95232 gene locus_tag LOCUS_08150 94156 95232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_08150 96592 95282 gene locus_tag LOCUS_08160 96592 95282 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768856.1 protein_id gnl|my_center|LOCUS_08160 97639 96605 gene locus_tag LOCUS_08170 97639 96605 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039035.1 protein_id gnl|my_center|LOCUS_08170 97807 99942 gene locus_tag LOCUS_08180 97807 99942 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_08180 99939 101294 gene locus_tag LOCUS_08190 99939 101294 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_08190 104168 101385 gene locus_tag LOCUS_08200 104168 101385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 105017 104481 gene locus_tag LOCUS_08210 105017 104481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 105515 107854 gene locus_tag LOCUS_08220 105515 107854 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_08220 107904 108683 gene locus_tag LOCUS_08230 107904 108683 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_08230 108773 109942 gene locus_tag LOCUS_08240 108773 109942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_08240 111056 110097 gene locus_tag LOCUS_08250 111056 110097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 114187 111386 gene locus_tag LOCUS_08260 114187 111386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176614.1 protein_id gnl|my_center|LOCUS_08260 114967 114290 gene locus_tag LOCUS_08270 114967 114290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 116370 115126 gene locus_tag LOCUS_08280 116370 115126 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFR1 protein_id gnl|my_center|LOCUS_08280 118341 116377 gene locus_tag LOCUS_08290 118341 116377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 119346 118513 gene locus_tag LOCUS_08300 119346 118513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 119872 119447 gene locus_tag LOCUS_08310 gene ptpA 119872 119447 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_08310 120910 120116 gene locus_tag LOCUS_08320 120910 120116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 121049 122653 gene locus_tag LOCUS_08330 121049 122653 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_08330 122650 123897 gene locus_tag LOCUS_08340 122650 123897 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_08340 124304 125716 gene locus_tag LOCUS_08350 124304 125716 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_08350 125911 126180 gene locus_tag LOCUS_08360 125911 126180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 126448 128775 gene locus_tag LOCUS_08370 126448 128775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 128866 130656 gene locus_tag LOCUS_08380 128866 130656 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402551.1 protein_id gnl|my_center|LOCUS_08380 130968 132152 gene locus_tag LOCUS_08390 130968 132152 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_08390 132176 132592 gene locus_tag LOCUS_08400 132176 132592 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_08400 132621 133040 gene locus_tag LOCUS_08410 132621 133040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 133083 134273 gene locus_tag LOCUS_08420 133083 134273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 135216 134326 gene locus_tag LOCUS_08430 135216 134326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 136427 135300 gene locus_tag LOCUS_08440 136427 135300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_08440 136633 137868 gene locus_tag LOCUS_08450 136633 137868 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_08450 137873 138886 gene locus_tag LOCUS_08460 137873 138886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 139825 138896 gene locus_tag LOCUS_08470 139825 138896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 141395 139875 gene locus_tag LOCUS_08480 gene exaC 141395 139875 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_08480 141613 144333 gene locus_tag LOCUS_08490 gene pepN 141613 144333 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_08490 145282 144344 gene locus_tag LOCUS_08500 145282 144344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 146441 145344 gene locus_tag LOCUS_08510 146441 145344 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_08510 146659 148395 gene locus_tag LOCUS_08520 146659 148395 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_08520 149078 148455 gene locus_tag LOCUS_08530 149078 148455 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_08530 149339 151087 gene locus_tag LOCUS_08540 149339 151087 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815309.1 protein_id gnl|my_center|LOCUS_08540 151122 152756 gene locus_tag LOCUS_08550 151122 152756 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 protein_id gnl|my_center|LOCUS_08550 154559 152796 gene locus_tag LOCUS_08560 154559 152796 CDS product neutral ceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I596 protein_id gnl|my_center|LOCUS_08560 154485 154808 gene locus_tag LOCUS_08570 154485 154808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 155349 154813 gene locus_tag LOCUS_08580 155349 154813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 155933 155463 gene locus_tag LOCUS_08590 gene recX 155933 155463 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_08590 157081 156026 gene locus_tag LOCUS_08600 gene recA 157081 156026 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_08600 157098 157376 gene locus_tag LOCUS_08610 157098 157376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 158515 157322 gene locus_tag LOCUS_08620 158515 157322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 158843 159808 gene locus_tag LOCUS_08630 gene fabH2 158843 159808 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9J6 protein_id gnl|my_center|LOCUS_08630 159819 160706 gene locus_tag LOCUS_08640 159819 160706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 161608 160751 gene locus_tag LOCUS_08650 161608 160751 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_08650 162918 161620 gene locus_tag LOCUS_08660 162918 161620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_08660 163699 162959 gene locus_tag LOCUS_08670 163699 162959 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 protein_id gnl|my_center|LOCUS_08670 164401 163748 gene locus_tag LOCUS_08680 164401 163748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 164321 164590 gene locus_tag LOCUS_08690 164321 164590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 165686 164610 gene locus_tag LOCUS_08700 165686 164610 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_08700 166949 165762 gene locus_tag LOCUS_08710 166949 165762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 167852 167091 gene locus_tag LOCUS_08720 167852 167091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 171552 168145 gene locus_tag LOCUS_08730 171552 168145 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_08730 172828 171785 gene locus_tag LOCUS_08740 172828 171785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 173089 175707 gene locus_tag LOCUS_08750 gene mutS 173089 175707 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 protein_id gnl|my_center|LOCUS_08750 175836 176159 gene locus_tag LOCUS_08760 gene fdxA 175836 176159 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_08760 176307 177029 gene locus_tag LOCUS_08770 176307 177029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 177541 177089 gene locus_tag LOCUS_08780 177541 177089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 178763 177693 gene locus_tag LOCUS_08790 gene rpoS 178763 177693 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_08790 179879 178938 gene locus_tag LOCUS_08800 gene nlpD 179879 178938 CDS product lipoprotein NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815613.1 protein_id gnl|my_center|LOCUS_08800 180830 179889 gene locus_tag LOCUS_08810 180830 179889 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_08810 181462 180830 gene locus_tag LOCUS_08820 gene pcm 181462 180830 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_08820 182537 181479 gene locus_tag LOCUS_08830 gene truD 182537 181479 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY04 protein_id gnl|my_center|LOCUS_08830 183013 182534 gene locus_tag LOCUS_08840 gene ispF 183013 182534 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_08840 183773 183039 gene locus_tag LOCUS_08850 gene ispD 183773 183039 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_08850 184073 183774 gene locus_tag LOCUS_08860 gene ftsB 184073 183774 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR1 protein_id gnl|my_center|LOCUS_08860 185374 184085 gene locus_tag LOCUS_08870 gene eno 185374 184085 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_08870 186246 185395 gene locus_tag LOCUS_08880 gene kdsA 186246 185395 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRL2 protein_id gnl|my_center|LOCUS_08880 187892 186243 gene locus_tag LOCUS_08890 gene pyrG 187892 186243 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_08890 189366 188020 gene locus_tag LOCUS_08900 gene tilS 189366 188020 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ3 protein_id gnl|my_center|LOCUS_08900 190320 189373 gene locus_tag LOCUS_08910 gene accA 190320 189373 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 protein_id gnl|my_center|LOCUS_08910 191207 190554 gene locus_tag LOCUS_08920 191207 190554 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 protein_id gnl|my_center|LOCUS_08920 191299 191961 gene locus_tag LOCUS_08930 gene rluA 191299 191961 CDS product ribosomal large subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIK1 protein_id gnl|my_center|LOCUS_08930 192336 193784 gene locus_tag LOCUS_08940 192336 193784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 194193 196289 gene locus_tag LOCUS_08950 194193 196289 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_08950 196347 196937 gene locus_tag LOCUS_08960 196347 196937 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 protein_id gnl|my_center|LOCUS_08960 196976 197428 gene locus_tag LOCUS_08970 196976 197428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 protein_id gnl|my_center|LOCUS_08970 197506 198237 gene locus_tag LOCUS_08980 197506 198237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810472.1 protein_id gnl|my_center|LOCUS_08980 198456 198851 gene locus_tag LOCUS_08990 198456 198851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 199634 198858 gene locus_tag LOCUS_09000 199634 198858 CDS product putative enoyl-coa hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704585.1 protein_id gnl|my_center|LOCUS_09000 199781 201874 gene locus_tag LOCUS_09010 199781 201874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_09010 201861 202520 gene locus_tag LOCUS_09020 201861 202520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 202635 202934 gene locus_tag LOCUS_09030 202635 202934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 202957 204609 gene locus_tag LOCUS_09040 202957 204609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122339.1 protein_id gnl|my_center|LOCUS_09040 204690 205964 gene locus_tag LOCUS_09050 204690 205964 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_09050 206393 209002 gene locus_tag LOCUS_09060 206393 209002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 209693 209064 gene locus_tag LOCUS_09070 209693 209064 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812956.1 protein_id gnl|my_center|LOCUS_09070 209809 212460 gene locus_tag LOCUS_09080 209809 212460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 212626 213960 gene locus_tag LOCUS_09090 gene rimO 212626 213960 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_09090 213968 214675 gene locus_tag LOCUS_09100 213968 214675 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 protein_id gnl|my_center|LOCUS_09100 215046 217502 gene locus_tag LOCUS_09110 gene fyuA 215046 217502 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_09110 218200 217577 gene locus_tag LOCUS_09120 gene msrA1 218200 217577 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9I6 protein_id gnl|my_center|LOCUS_09120 218299 220317 gene locus_tag LOCUS_09130 218299 220317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 220476 220676 gene locus_tag LOCUS_09140 220476 220676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 220701 221387 gene locus_tag LOCUS_09150 220701 221387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531779.1 protein_id gnl|my_center|LOCUS_09150 221396 222124 gene locus_tag LOCUS_09160 221396 222124 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_09160 222277 222573 gene locus_tag LOCUS_09170 222277 222573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 222625 223506 gene locus_tag LOCUS_09180 gene htpX 222625 223506 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 protein_id gnl|my_center|LOCUS_09180 223544 225709 gene locus_tag LOCUS_09190 223544 225709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 226522 225812 gene locus_tag LOCUS_09200 226522 225812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_09200 227314 226544 gene locus_tag LOCUS_09210 227314 226544 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_09210 227540 228262 gene locus_tag LOCUS_09220 227540 228262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_09220 228270 229343 gene locus_tag LOCUS_09230 gene degP 228270 229343 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_09230 230108 229359 gene locus_tag LOCUS_09240 230108 229359 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226182.1 protein_id gnl|my_center|LOCUS_09240 230388 231575 gene locus_tag LOCUS_09250 230388 231575 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_09250 231589 232728 gene locus_tag LOCUS_09260 231589 232728 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_09260 232744 233103 gene locus_tag LOCUS_09270 232744 233103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701948.1 protein_id gnl|my_center|LOCUS_09270 233443 233156 gene locus_tag LOCUS_09280 233443 233156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 234023 233562 gene locus_tag LOCUS_09290 234023 233562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265794.1 protein_id gnl|my_center|LOCUS_09290 234233 234036 gene locus_tag LOCUS_09300 234233 234036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 234413 234249 gene locus_tag LOCUS_09310 234413 234249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 234388 235449 gene locus_tag LOCUS_09320 234388 235449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 235728 235564 gene locus_tag LOCUS_09330 235728 235564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 235762 236028 gene locus_tag LOCUS_09340 235762 236028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 237819 236146 gene locus_tag LOCUS_09350 237819 236146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 238086 238490 gene locus_tag LOCUS_09360 238086 238490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 238539 239777 gene locus_tag LOCUS_09370 238539 239777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 240146 239859 gene locus_tag LOCUS_09380 240146 239859 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768750.1 protein_id gnl|my_center|LOCUS_09380 240996 240175 gene locus_tag LOCUS_09390 240996 240175 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897328.1 protein_id gnl|my_center|LOCUS_09390 244536 241042 gene locus_tag LOCUS_09400 gene dnaE 244536 241042 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M8 protein_id gnl|my_center|LOCUS_09400 245253 244654 gene locus_tag LOCUS_09410 gene rnhB 245253 244654 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_09410 245714 245286 gene locus_tag LOCUS_09420 gene fabZ 245714 245286 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 protein_id gnl|my_center|LOCUS_09420 246306 245788 gene locus_tag LOCUS_09430 246306 245788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 248893 246338 gene locus_tag LOCUS_09440 gene bamA 248893 246338 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_09440 250342 248987 gene locus_tag LOCUS_09450 250342 248987 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_09450 251553 250342 gene locus_tag LOCUS_09460 gene dxr 251553 250342 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_09460 252395 251559 gene locus_tag LOCUS_09470 gene cdsA 252395 251559 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59640 protein_id gnl|my_center|LOCUS_09470 253170 252388 gene locus_tag LOCUS_09480 gene uppS 253170 252388 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY2 protein_id gnl|my_center|LOCUS_09480 253737 253180 gene locus_tag LOCUS_09490 gene frr 253737 253180 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 protein_id gnl|my_center|LOCUS_09490 254517 253792 gene locus_tag LOCUS_09500 gene pyrH 254517 253792 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_09500 255583 254726 gene locus_tag LOCUS_09510 gene tsf 255583 254726 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82851 protein_id gnl|my_center|LOCUS_09510 256550 255705 gene locus_tag LOCUS_09520 gene rpsB 256550 255705 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_09520 256913 257701 gene locus_tag LOCUS_09530 gene map 256913 257701 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS9 protein_id gnl|my_center|LOCUS_09530 257709 260381 gene locus_tag LOCUS_09540 gene glnD 257709 260381 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_09540 260381 261571 gene locus_tag LOCUS_09550 260381 261571 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_09550 261582 262235 gene locus_tag LOCUS_09560 gene nth 261582 262235 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_09560 262309 262665 gene locus_tag LOCUS_09570 262309 262665 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703145.1 protein_id gnl|my_center|LOCUS_09570 262694 263713 gene locus_tag LOCUS_09580 gene dapD 262694 263713 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWT5 protein_id gnl|my_center|LOCUS_09580 263738 264874 gene locus_tag LOCUS_09590 gene dapE 263738 264874 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_09590 265612 264857 gene locus_tag LOCUS_09600 265612 264857 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_09600 266525 265716 gene locus_tag LOCUS_09610 gene rsmJ 266525 265716 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU6 protein_id gnl|my_center|LOCUS_09610 267443 266541 gene locus_tag LOCUS_09620 267443 266541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 268926 267451 gene locus_tag LOCUS_09630 268926 267451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 268963 269463 gene locus_tag LOCUS_09640 268963 269463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 270372 269608 gene locus_tag LOCUS_09650 270372 269608 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_09650 271421 270372 gene locus_tag LOCUS_09660 271421 270372 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245782.1 protein_id gnl|my_center|LOCUS_09660 272299 271427 gene locus_tag LOCUS_09670 gene dapA 272299 271427 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_09670 272467 272973 gene locus_tag LOCUS_09680 272467 272973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 273037 274167 gene locus_tag LOCUS_09690 273037 274167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_09690 274164 274949 gene locus_tag LOCUS_09700 274164 274949 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_09700 274946 275911 gene locus_tag LOCUS_09710 274946 275911 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_09710 275908 276513 gene locus_tag LOCUS_09720 275908 276513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 277524 276760 gene locus_tag LOCUS_09730 277524 276760 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_09730 278357 277671 gene locus_tag LOCUS_09740 278357 277671 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_09740 278508 278942 gene locus_tag LOCUS_09750 278508 278942 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_09750 278971 280158 gene locus_tag LOCUS_09760 278971 280158 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 protein_id gnl|my_center|LOCUS_09760 280586 280182 gene locus_tag LOCUS_09770 280586 280182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 282121 280583 gene locus_tag LOCUS_09780 282121 280583 CDS product putative fumarate reductase/succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703124.1 protein_id gnl|my_center|LOCUS_09780 282835 282143 gene locus_tag LOCUS_09790 282835 282143 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_09790 283343 282888 gene locus_tag LOCUS_09800 283343 282888 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_09800 283561 284877 gene locus_tag LOCUS_09810 283561 284877 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_09810 284877 288014 gene locus_tag LOCUS_09820 284877 288014 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_09820 289877 288030 gene locus_tag LOCUS_09830 289877 288030 CDS product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS9 protein_id gnl|my_center|LOCUS_09830 290198 289881 gene locus_tag LOCUS_09840 290198 289881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 290851 290252 gene locus_tag LOCUS_09850 290851 290252 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 protein_id gnl|my_center|LOCUS_09850 291201 290851 gene locus_tag LOCUS_09860 gene arsC 291201 290851 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_09860 291379 292617 gene locus_tag LOCUS_09870 291379 292617 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_09870 292614 293075 gene locus_tag LOCUS_09880 292614 293075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 293475 294455 gene locus_tag LOCUS_09890 gene cysK 293475 294455 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y99 protein_id gnl|my_center|LOCUS_09890 295055 294456 gene locus_tag LOCUS_09900 295055 294456 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_09900 296041 295070 gene locus_tag LOCUS_09910 gene qor 296041 295070 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_09910 296283 297620 gene locus_tag LOCUS_09920 296283 297620 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_09920 297620 298177 gene locus_tag LOCUS_09930 297620 298177 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP01 protein_id gnl|my_center|LOCUS_09930 298170 299417 gene locus_tag LOCUS_09940 298170 299417 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_09940 299492 301525 gene locus_tag LOCUS_09950 gene prlC 299492 301525 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_09950 301951 301547 gene locus_tag LOCUS_09960 301951 301547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 302236 303525 gene locus_tag LOCUS_09970 302236 303525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 304023 303541 gene locus_tag LOCUS_09980 304023 303541 CDS product 6-pyruvoyl tetrahydrobiopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948551.1 protein_id gnl|my_center|LOCUS_09980 304140 304841 gene locus_tag LOCUS_09990 304140 304841 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974472.1 protein_id gnl|my_center|LOCUS_09990 304931 306073 gene locus_tag LOCUS_10000 304931 306073 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266912.1 protein_id gnl|my_center|LOCUS_10000 306061 306831 gene locus_tag LOCUS_10010 306061 306831 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816946.1 protein_id gnl|my_center|LOCUS_10010 307571 306840 gene locus_tag LOCUS_10020 307571 306840 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268586.1 protein_id gnl|my_center|LOCUS_10020 308623 307562 gene locus_tag LOCUS_10030 308623 307562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112582.1 protein_id gnl|my_center|LOCUS_10030 308787 309827 gene locus_tag LOCUS_10040 gene purM 308787 309827 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM24 protein_id gnl|my_center|LOCUS_10040 309824 310477 gene locus_tag LOCUS_10050 gene purN 309824 310477 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_10050 311097 310531 gene locus_tag LOCUS_10060 gene dcd 311097 310531 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK9 protein_id gnl|my_center|LOCUS_10060 311964 311131 gene locus_tag LOCUS_10070 311964 311131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 313809 312166 gene locus_tag LOCUS_10080 313809 312166 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072291.1 protein_id gnl|my_center|LOCUS_10080 313979 313809 gene locus_tag LOCUS_10090 313979 313809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 314372 316438 gene locus_tag LOCUS_10100 gene metG 314372 316438 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT69 protein_id gnl|my_center|LOCUS_10100 316576 317154 gene locus_tag LOCUS_10110 gene rnfA 316576 317154 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ2 protein_id gnl|my_center|LOCUS_10110 317161 317790 gene locus_tag LOCUS_10120 317161 317790 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_10120 317787 319808 gene locus_tag LOCUS_10130 317787 319808 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB8 protein_id gnl|my_center|LOCUS_10130 319810 320841 gene locus_tag LOCUS_10140 319810 320841 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB7 protein_id gnl|my_center|LOCUS_10140 320841 321485 gene locus_tag LOCUS_10150 320841 321485 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_10150 321488 322201 gene locus_tag LOCUS_10160 321488 322201 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 protein_id gnl|my_center|LOCUS_10160 322605 322198 gene locus_tag LOCUS_10170 322605 322198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 323071 322592 gene locus_tag LOCUS_10180 gene rimI 323071 322592 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVZ8 protein_id gnl|my_center|LOCUS_10180 323790 323068 gene locus_tag LOCUS_10190 323790 323068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 324700 323852 gene locus_tag LOCUS_10200 gene wbiF 324700 323852 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938487.1 protein_id gnl|my_center|LOCUS_10200 325060 327606 gene locus_tag LOCUS_10210 325060 327606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 327771 330923 gene locus_tag LOCUS_10220 327771 330923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 332209 330920 gene locus_tag LOCUS_10230 332209 330920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188709.1 protein_id gnl|my_center|LOCUS_10230 332761 335028 gene locus_tag LOCUS_10240 gene fyuA 332761 335028 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_10240 335046 335882 gene locus_tag LOCUS_10250 335046 335882 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920426.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence04 276 1418 gene locus_tag LOCUS_10260 276 1418 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976026.1 protein_id gnl|my_center|LOCUS_10260 1551 1475 gene locus_tag LOCUS_t00130 1551 1475 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1798 2121 gene locus_tag LOCUS_10270 1798 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2571 2152 gene locus_tag LOCUS_10280 2571 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3071 2661 gene locus_tag LOCUS_10290 3071 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3152 4363 gene locus_tag LOCUS_10300 3152 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087453.1 protein_id gnl|my_center|LOCUS_10300 4369 5352 gene locus_tag LOCUS_10310 gene ywcH 4369 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_10310 6001 5408 gene locus_tag LOCUS_10320 6001 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6821 6108 gene locus_tag LOCUS_10330 6821 6108 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_10330 8383 7142 gene locus_tag LOCUS_10340 8383 7142 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096809.1 protein_id gnl|my_center|LOCUS_10340 8733 9857 gene locus_tag LOCUS_10350 8733 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409518.1 protein_id gnl|my_center|LOCUS_10350 10096 9884 gene locus_tag LOCUS_10360 10096 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10287 11216 gene locus_tag LOCUS_10370 10287 11216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_10370 11338 11925 gene locus_tag LOCUS_10380 11338 11925 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_10380 12174 12770 gene locus_tag LOCUS_10390 12174 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 14045 12873 gene locus_tag LOCUS_10400 14045 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 14184 15443 gene locus_tag LOCUS_10410 14184 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 15461 16363 gene locus_tag LOCUS_10420 15461 16363 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_10420 17418 16489 gene locus_tag LOCUS_10430 17418 16489 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_10430 17912 17415 gene locus_tag LOCUS_10440 17912 17415 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_10440 19060 17900 gene locus_tag LOCUS_10450 gene purK 19060 17900 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_10450 21569 19293 gene locus_tag LOCUS_10460 gene fyuA 21569 19293 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_10460 22192 21704 gene locus_tag LOCUS_10470 22192 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 23204 22185 gene locus_tag LOCUS_10480 23204 22185 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703703.1 protein_id gnl|my_center|LOCUS_10480 23410 23201 gene locus_tag LOCUS_10490 23410 23201 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_10490 24775 23429 gene locus_tag LOCUS_10500 24775 23429 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 protein_id gnl|my_center|LOCUS_10500 25278 24772 gene locus_tag LOCUS_10510 25278 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701954.1 protein_id gnl|my_center|LOCUS_10510 25477 26340 gene locus_tag LOCUS_10520 25477 26340 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_10520 27411 26353 gene locus_tag LOCUS_10530 27411 26353 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 protein_id gnl|my_center|LOCUS_10530 29003 27447 gene locus_tag LOCUS_10540 29003 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 30387 29086 gene locus_tag LOCUS_10550 30387 29086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898398.1 protein_id gnl|my_center|LOCUS_10550 30465 31073 gene locus_tag LOCUS_10560 30465 31073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 32306 31080 gene locus_tag LOCUS_10570 32306 31080 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701953.1 protein_id gnl|my_center|LOCUS_10570 33606 32395 gene locus_tag LOCUS_10580 33606 32395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_10580 34888 33635 gene locus_tag LOCUS_10590 34888 33635 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702676.1 protein_id gnl|my_center|LOCUS_10590 35619 34885 gene locus_tag LOCUS_10600 35619 34885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_10600 35820 36356 gene locus_tag LOCUS_10610 35820 36356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 36556 36801 gene locus_tag LOCUS_10620 36556 36801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 37845 36919 gene locus_tag LOCUS_10630 37845 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_10630 40275 38077 gene locus_tag LOCUS_10640 40275 38077 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_10640 40500 43199 gene locus_tag LOCUS_10650 40500 43199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 43196 46339 gene locus_tag LOCUS_10660 43196 46339 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MI38 protein_id gnl|my_center|LOCUS_10660 47155 46610 gene locus_tag LOCUS_10670 47155 46610 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_10670 47325 47945 gene locus_tag LOCUS_10680 47325 47945 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_10680 48087 48821 gene locus_tag LOCUS_10690 48087 48821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 protein_id gnl|my_center|LOCUS_10690 49650 48916 gene locus_tag LOCUS_10700 49650 48916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 50331 53042 gene locus_tag LOCUS_10710 50331 53042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 53135 56005 gene locus_tag LOCUS_10720 53135 56005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 57922 56057 gene locus_tag LOCUS_10730 57922 56057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_10730 59578 58049 gene locus_tag LOCUS_10740 59578 58049 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_10740 60786 59779 gene locus_tag LOCUS_10750 60786 59779 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899659.1 protein_id gnl|my_center|LOCUS_10750 62885 60891 gene locus_tag LOCUS_10760 62885 60891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_10760 63361 65766 gene locus_tag LOCUS_10770 gene fyuA 63361 65766 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_10770 65846 66322 gene locus_tag LOCUS_10780 65846 66322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 66367 67212 gene locus_tag LOCUS_10790 66367 67212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 67212 68045 gene locus_tag LOCUS_10800 67212 68045 CDS product 3-ketodihydrosphingosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706792.1 protein_id gnl|my_center|LOCUS_10800 68038 69420 gene locus_tag LOCUS_10810 68038 69420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 69570 70589 gene locus_tag LOCUS_10820 69570 70589 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_10820 70784 70551 gene locus_tag LOCUS_10830 70784 70551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 71009 75574 gene locus_tag LOCUS_10840 gene gltB 71009 75574 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_10840 75583 77028 gene locus_tag LOCUS_10850 gene gltD 75583 77028 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_10850 78813 77095 gene locus_tag LOCUS_10860 78813 77095 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_10860 81225 78946 gene locus_tag LOCUS_10870 81225 78946 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_10870 81372 83183 gene locus_tag LOCUS_10880 81372 83183 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122176.1 protein_id gnl|my_center|LOCUS_10880 84149 83202 gene locus_tag LOCUS_10890 84149 83202 CDS product putative 2-nitropropane dioxygenase, NPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704729.1 protein_id gnl|my_center|LOCUS_10890 85309 84272 gene locus_tag LOCUS_10900 85309 84272 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_10900 85452 86042 gene locus_tag LOCUS_10910 85452 86042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 86572 86063 gene locus_tag LOCUS_10920 86572 86063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 86946 89159 gene locus_tag LOCUS_10930 86946 89159 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_10930 90884 89217 gene locus_tag LOCUS_10940 90884 89217 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_10940 91906 90932 gene locus_tag LOCUS_10950 91906 90932 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_10950 92098 93561 gene locus_tag LOCUS_10960 92098 93561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703155.1 protein_id gnl|my_center|LOCUS_10960 95098 93572 gene locus_tag LOCUS_10970 95098 93572 CDS product malonyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 protein_id gnl|my_center|LOCUS_10970 95199 95957 gene locus_tag LOCUS_10980 95199 95957 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_10980 96466 96026 gene locus_tag LOCUS_10990 96466 96026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 97242 96514 gene locus_tag LOCUS_11000 97242 96514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 97970 97239 gene locus_tag LOCUS_11010 97970 97239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 100493 98049 gene locus_tag LOCUS_11020 gene pvdQ 100493 98049 CDS product acyl-homoserine lactone acylase PvdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV08 protein_id gnl|my_center|LOCUS_11020 101263 100640 gene locus_tag LOCUS_11030 101263 100640 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 protein_id gnl|my_center|LOCUS_11030 102027 101395 gene locus_tag LOCUS_11040 102027 101395 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_11040 102148 103053 gene locus_tag LOCUS_11050 102148 103053 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930749.1 protein_id gnl|my_center|LOCUS_11050 103678 103079 gene locus_tag LOCUS_11060 103678 103079 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_11060 103795 105453 gene locus_tag LOCUS_11070 103795 105453 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_11070 106734 105499 gene locus_tag LOCUS_11080 106734 105499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 protein_id gnl|my_center|LOCUS_11080 107754 106744 gene locus_tag LOCUS_11090 gene gapA 107754 106744 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_11090 108155 107868 gene locus_tag LOCUS_11100 gene arsR 108155 107868 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 protein_id gnl|my_center|LOCUS_11100 108628 108224 gene locus_tag LOCUS_11110 108628 108224 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_11110 108766 108984 gene locus_tag LOCUS_11120 108766 108984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 108981 109598 gene locus_tag LOCUS_11130 108981 109598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_11130 111745 109697 gene locus_tag LOCUS_11140 111745 109697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 112266 111742 gene locus_tag LOCUS_11150 112266 111742 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_11150 113287 112379 gene locus_tag LOCUS_11160 113287 112379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 115520 113508 gene locus_tag LOCUS_11170 115520 113508 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031470.1 protein_id gnl|my_center|LOCUS_11170 115725 116291 gene locus_tag LOCUS_11180 115725 116291 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066604.1 protein_id gnl|my_center|LOCUS_11180 117673 116333 gene locus_tag LOCUS_11190 117673 116333 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_11190 117846 117676 gene locus_tag LOCUS_11200 117846 117676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 118619 117849 gene locus_tag LOCUS_11210 118619 117849 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_11210 118871 119314 gene locus_tag LOCUS_11220 118871 119314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 119331 119867 gene locus_tag LOCUS_11230 119331 119867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 119958 121040 gene locus_tag LOCUS_11240 119958 121040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 121069 123234 gene locus_tag LOCUS_11250 121069 123234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 124602 123331 gene locus_tag LOCUS_11260 124602 123331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_11260 124897 126078 gene locus_tag LOCUS_11270 124897 126078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 127182 126058 gene locus_tag LOCUS_11280 127182 126058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11280 127800 129158 gene locus_tag LOCUS_11290 127800 129158 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893656.1 protein_id gnl|my_center|LOCUS_11290 129225 130217 gene locus_tag LOCUS_11300 gene hpnA 129225 130217 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_11300 130347 131189 gene locus_tag LOCUS_11310 130347 131189 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730893.1 protein_id gnl|my_center|LOCUS_11310 132330 131308 gene locus_tag LOCUS_11320 132330 131308 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893406.1 protein_id gnl|my_center|LOCUS_11320 133389 132343 gene locus_tag LOCUS_11330 133389 132343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 135893 133386 gene locus_tag LOCUS_11340 135893 133386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 136019 136645 gene locus_tag LOCUS_11350 136019 136645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 136747 137532 gene locus_tag LOCUS_11360 136747 137532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 138605 137562 gene locus_tag LOCUS_11370 138605 137562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_11370 139948 138926 gene locus_tag LOCUS_11380 139948 138926 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 protein_id gnl|my_center|LOCUS_11380 141006 139948 gene locus_tag LOCUS_11390 141006 139948 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957882.1 protein_id gnl|my_center|LOCUS_11390 141173 141931 gene locus_tag LOCUS_11400 141173 141931 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 protein_id gnl|my_center|LOCUS_11400 144084 141934 gene locus_tag LOCUS_11410 144084 141934 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_11410 144831 144229 gene locus_tag LOCUS_11420 144831 144229 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719729.1 protein_id gnl|my_center|LOCUS_11420 145181 145420 gene locus_tag LOCUS_11430 145181 145420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 146079 145489 gene locus_tag LOCUS_11440 146079 145489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 146223 146816 gene locus_tag LOCUS_11450 146223 146816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 146982 147347 gene locus_tag LOCUS_11460 146982 147347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 147538 148140 gene locus_tag LOCUS_11470 147538 148140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 148850 148227 gene locus_tag LOCUS_11480 148850 148227 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970142.1 protein_id gnl|my_center|LOCUS_11480 149382 149014 gene locus_tag LOCUS_11490 149382 149014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_11490 150282 149470 gene locus_tag LOCUS_11500 150282 149470 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970229.1 protein_id gnl|my_center|LOCUS_11500 150694 150320 gene locus_tag LOCUS_11510 150694 150320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_11510 151193 150777 gene locus_tag LOCUS_11520 151193 150777 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530666.1 protein_id gnl|my_center|LOCUS_11520 152579 151290 gene locus_tag LOCUS_11530 152579 151290 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_11530 153261 152560 gene locus_tag LOCUS_11540 153261 152560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 154894 155910 gene locus_tag LOCUS_11550 154894 155910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 157589 156048 gene locus_tag LOCUS_11560 157589 156048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 157966 158889 gene locus_tag LOCUS_11570 157966 158889 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_11570 159596 158886 gene locus_tag LOCUS_11580 159596 158886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 161288 159717 gene locus_tag LOCUS_11590 161288 159717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 161364 161531 gene locus_tag LOCUS_11600 161364 161531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 164052 164222 gene locus_tag LOCUS_11610 164052 164222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 164866 164333 gene locus_tag LOCUS_11620 164866 164333 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_11620 166665 165199 gene locus_tag LOCUS_11630 166665 165199 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945966.1 protein_id gnl|my_center|LOCUS_11630 167006 167950 gene locus_tag LOCUS_11640 167006 167950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_11640 169876 168083 gene locus_tag LOCUS_11650 gene atsA 169876 168083 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_11650 171086 169923 gene locus_tag LOCUS_11660 171086 169923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 171475 171251 gene locus_tag LOCUS_11670 171475 171251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 172132 171494 gene locus_tag LOCUS_11680 172132 171494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 172340 172951 gene locus_tag LOCUS_11690 172340 172951 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_11690 173144 173392 gene locus_tag LOCUS_11700 173144 173392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 173395 173763 gene locus_tag LOCUS_11710 173395 173763 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351248.1 protein_id gnl|my_center|LOCUS_11710 174937 174068 gene locus_tag LOCUS_11720 174937 174068 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_11720 175692 174934 gene locus_tag LOCUS_11730 175692 174934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 176178 175711 gene locus_tag LOCUS_11740 176178 175711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 177522 176308 gene locus_tag LOCUS_11750 177522 176308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 178809 177580 gene locus_tag LOCUS_11760 178809 177580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 179035 180042 gene locus_tag LOCUS_11770 179035 180042 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_11770 180151 181254 gene locus_tag LOCUS_11780 180151 181254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 181280 181960 gene locus_tag LOCUS_11790 181280 181960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 182027 182275 gene locus_tag LOCUS_11800 182027 182275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 182301 182738 gene locus_tag LOCUS_11810 182301 182738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 182767 183144 gene locus_tag LOCUS_11820 182767 183144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 183335 183141 gene locus_tag LOCUS_11830 183335 183141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 183723 183313 gene locus_tag LOCUS_11840 183723 183313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 184539 183733 gene locus_tag LOCUS_11850 184539 183733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 185370 184606 gene locus_tag LOCUS_11860 185370 184606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_11860 186372 185407 gene locus_tag LOCUS_11870 186372 185407 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764106.1 protein_id gnl|my_center|LOCUS_11870 186694 188094 gene locus_tag LOCUS_11880 gene selA 186694 188094 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A822 protein_id gnl|my_center|LOCUS_11880 188091 190010 gene locus_tag LOCUS_11890 gene selB 188091 190010 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102294.1 protein_id gnl|my_center|LOCUS_11890 190020 190113 gene locus_tag LOCUS_t00140 190020 190113 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 190528 190178 gene locus_tag LOCUS_11900 190528 190178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 190939 190547 gene locus_tag LOCUS_11910 190939 190547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 191845 191054 gene locus_tag LOCUS_11920 gene fadB 191845 191054 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94549 protein_id gnl|my_center|LOCUS_11920 192454 194106 gene locus_tag LOCUS_11930 192454 194106 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_11930 194387 194956 gene locus_tag LOCUS_11940 194387 194956 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_11940 195173 196879 gene locus_tag LOCUS_11950 gene dsbD 195173 196879 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 protein_id gnl|my_center|LOCUS_11950 197462 199657 gene locus_tag LOCUS_11960 197462 199657 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_11960 199742 201175 gene locus_tag LOCUS_11970 199742 201175 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_11970 201189 202259 gene locus_tag LOCUS_11980 201189 202259 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_11980 202387 203118 gene locus_tag LOCUS_11990 202387 203118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 204002 203151 gene locus_tag LOCUS_12000 gene oruR 204002 203151 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_12000 204272 205162 gene locus_tag LOCUS_12010 204272 205162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_12010 205304 205939 gene locus_tag LOCUS_12020 205304 205939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_12020 205990 206271 gene locus_tag LOCUS_12030 205990 206271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 206391 207185 gene locus_tag LOCUS_12040 206391 207185 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887409.1 protein_id gnl|my_center|LOCUS_12040 208969 207305 gene locus_tag LOCUS_12050 208969 207305 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975401.1 protein_id gnl|my_center|LOCUS_12050 210084 209065 gene locus_tag LOCUS_12060 210084 209065 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087508.1 protein_id gnl|my_center|LOCUS_12060 210322 211275 gene locus_tag LOCUS_12070 210322 211275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 211927 211526 gene locus_tag LOCUS_12080 211927 211526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 213088 212003 gene locus_tag LOCUS_12090 213088 212003 CDS product proline dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966073.1 protein_id gnl|my_center|LOCUS_12090 214578 213337 gene locus_tag LOCUS_12100 214578 213337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 216746 214578 gene locus_tag LOCUS_12110 gene fyuA 216746 214578 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_12110 217028 218035 gene locus_tag LOCUS_12120 217028 218035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 221246 218115 gene locus_tag LOCUS_12130 gene putA 221246 218115 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P476 protein_id gnl|my_center|LOCUS_12130 221379 221858 gene locus_tag LOCUS_12140 221379 221858 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388413.1 protein_id gnl|my_center|LOCUS_12140 222180 222824 gene locus_tag LOCUS_12150 222180 222824 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_12150 222852 223709 gene locus_tag LOCUS_12160 222852 223709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 223940 225361 gene locus_tag LOCUS_12170 223940 225361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 225862 225353 gene locus_tag LOCUS_12180 225862 225353 CDS product bile-acid 7-alpha-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_12180 226630 225998 gene locus_tag LOCUS_12190 226630 225998 CDS product putative transcriptional regulator TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701351.1 protein_id gnl|my_center|LOCUS_12190 226833 227717 gene locus_tag LOCUS_12200 226833 227717 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_12200 228415 228098 gene locus_tag LOCUS_12210 228415 228098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 229419 229329 gene locus_tag LOCUS_t00150 229419 229329 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 229794 229516 gene locus_tag LOCUS_12220 229794 229516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 231131 229890 gene locus_tag LOCUS_12230 231131 229890 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_12230 233847 231247 gene locus_tag LOCUS_12240 gene alaS 233847 231247 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_12240 234231 233884 gene locus_tag LOCUS_12250 234231 233884 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_12250 234437 234252 gene locus_tag LOCUS_12260 234437 234252 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YF6 protein_id gnl|my_center|LOCUS_12260 234546 235049 gene locus_tag LOCUS_12270 gene greB 234546 235049 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 protein_id gnl|my_center|LOCUS_12270 236345 235125 gene locus_tag LOCUS_12280 236345 235125 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_12280 236567 239461 gene locus_tag LOCUS_12290 gene gcvP 236567 239461 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH2 protein_id gnl|my_center|LOCUS_12290 239473 240504 gene locus_tag LOCUS_12300 gene exoZ 239473 240504 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972679.1 protein_id gnl|my_center|LOCUS_12300 241928 240531 gene locus_tag LOCUS_12310 241928 240531 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867906.1 protein_id gnl|my_center|LOCUS_12310 243414 241945 gene locus_tag LOCUS_12320 243414 241945 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 protein_id gnl|my_center|LOCUS_12320 243815 243411 gene locus_tag LOCUS_12330 gene ectC 243815 243411 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 protein_id gnl|my_center|LOCUS_12330 245174 243867 gene locus_tag LOCUS_12340 gene ectB 245174 243867 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_12340 245719 245171 gene locus_tag LOCUS_12350 gene ectA 245719 245171 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC1 protein_id gnl|my_center|LOCUS_12350 246015 246533 gene locus_tag LOCUS_12360 246015 246533 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_12360 246731 248023 gene locus_tag LOCUS_12370 246731 248023 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_12370 249419 248001 gene locus_tag LOCUS_12380 249419 248001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 252620 249534 gene locus_tag LOCUS_12390 252620 249534 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_12390 253762 252617 gene locus_tag LOCUS_12400 253762 252617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 255355 253952 gene locus_tag LOCUS_12410 255355 253952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 256795 255359 gene locus_tag LOCUS_12420 gene phrA 256795 255359 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_12420 258074 256818 gene locus_tag LOCUS_12430 258074 256818 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705033.1 protein_id gnl|my_center|LOCUS_12430 258766 258074 gene locus_tag LOCUS_12440 258766 258074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 260046 258844 gene locus_tag LOCUS_12450 260046 258844 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_12450 260417 261025 gene locus_tag LOCUS_12460 260417 261025 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAF3 protein_id gnl|my_center|LOCUS_12460 261030 261680 gene locus_tag LOCUS_12470 gene chrR 261030 261680 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_12470 262466 261690 gene locus_tag LOCUS_12480 262466 261690 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705635.1 protein_id gnl|my_center|LOCUS_12480 262620 263375 gene locus_tag LOCUS_12490 262620 263375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 263390 263680 gene locus_tag LOCUS_12500 263390 263680 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UE17 protein_id gnl|my_center|LOCUS_12500 269365 263963 gene locus_tag LOCUS_12510 269365 263963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 269494 270864 gene locus_tag LOCUS_12520 269494 270864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 271540 270857 gene locus_tag LOCUS_12530 gene tcsR 271540 270857 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 protein_id gnl|my_center|LOCUS_12530 272548 271610 gene locus_tag LOCUS_12540 272548 271610 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975419.1 protein_id gnl|my_center|LOCUS_12540 273867 272674 gene locus_tag LOCUS_12550 273867 272674 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 protein_id gnl|my_center|LOCUS_12550 274015 275667 gene locus_tag LOCUS_12560 274015 275667 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899716.1 protein_id gnl|my_center|LOCUS_12560 276205 275627 gene locus_tag LOCUS_12570 276205 275627 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223605.1 protein_id gnl|my_center|LOCUS_12570 276316 277653 gene locus_tag LOCUS_12580 276316 277653 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_12580 277650 278765 gene locus_tag LOCUS_12590 277650 278765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 278767 280005 gene locus_tag LOCUS_12600 278767 280005 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_12600 280117 280989 gene locus_tag LOCUS_12610 280117 280989 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_12610 281068 281838 gene locus_tag LOCUS_12620 281068 281838 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 protein_id gnl|my_center|LOCUS_12620 281881 282753 gene locus_tag LOCUS_12630 281881 282753 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406286.1 protein_id gnl|my_center|LOCUS_12630 284028 282775 gene locus_tag LOCUS_12640 284028 282775 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence05 640 948 gene locus_tag LOCUS_12650 640 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1018 1350 gene locus_tag LOCUS_12660 1018 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1347 1895 gene locus_tag LOCUS_12670 1347 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3886 2063 gene locus_tag LOCUS_12680 3886 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 7127 3960 gene locus_tag LOCUS_12690 7127 3960 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_12690 8907 7255 gene locus_tag LOCUS_12700 8907 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9589 8909 gene locus_tag LOCUS_12710 9589 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 11766 10213 gene locus_tag LOCUS_12720 gene hsdM-1 11766 10213 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_12720 12275 11802 gene locus_tag LOCUS_12730 12275 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070549.1 protein_id gnl|my_center|LOCUS_12730 12759 13532 gene locus_tag LOCUS_12740 12759 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 13483 15270 gene locus_tag LOCUS_12750 13483 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12750 15502 15427 gene locus_tag LOCUS_t00160 15502 15427 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15872 15600 gene locus_tag LOCUS_12760 15872 15600 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_12760 16960 15875 gene locus_tag LOCUS_12770 gene mutY 16960 15875 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_12770 17172 17765 gene locus_tag LOCUS_12780 gene hisB 17172 17765 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_12780 17807 18457 gene locus_tag LOCUS_12790 gene hisH1 17807 18457 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_12790 18451 19185 gene locus_tag LOCUS_12800 gene hisA 18451 19185 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_12800 19190 19963 gene locus_tag LOCUS_12810 gene hisF 19190 19963 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG4 protein_id gnl|my_center|LOCUS_12810 21317 19971 gene locus_tag LOCUS_12820 21317 19971 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_12820 22491 21373 gene locus_tag LOCUS_12830 22491 21373 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_12830 24114 22558 gene locus_tag LOCUS_12840 gene gpmI 24114 22558 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_12840 24139 24360 gene locus_tag LOCUS_12850 24139 24360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 24375 24788 gene locus_tag LOCUS_12860 24375 24788 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_12860 24802 25074 gene locus_tag LOCUS_12870 24802 25074 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 protein_id gnl|my_center|LOCUS_12870 25120 25599 gene locus_tag LOCUS_12880 gene secB 25120 25599 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UH3 protein_id gnl|my_center|LOCUS_12880 26078 25614 gene locus_tag LOCUS_12890 gene trmL 26078 25614 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU57 protein_id gnl|my_center|LOCUS_12890 27503 26100 gene locus_tag LOCUS_12900 27503 26100 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_12900 28557 27496 gene locus_tag LOCUS_12910 gene ntrB 28557 27496 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_12910 29375 28845 gene locus_tag LOCUS_12920 29375 28845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260967.1 protein_id gnl|my_center|LOCUS_12920 30923 29517 gene locus_tag LOCUS_12930 30923 29517 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLX8 protein_id gnl|my_center|LOCUS_12930 31239 32705 gene locus_tag LOCUS_12940 gene thiI 31239 32705 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU66 protein_id gnl|my_center|LOCUS_12940 32831 34642 gene locus_tag LOCUS_12950 gene typA 32831 34642 CDS product GTP-binding protein TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_12950 34660 35097 gene locus_tag LOCUS_12960 gene dtd 34660 35097 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HB3 protein_id gnl|my_center|LOCUS_12960 35574 35110 gene locus_tag LOCUS_12970 gene elaA 35574 35110 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070867.1 protein_id gnl|my_center|LOCUS_12970 35771 36592 gene locus_tag LOCUS_12980 gene cbpA 35771 36592 CDS product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_12980 36729 38984 gene locus_tag LOCUS_12990 gene parC 36729 38984 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_12990 40188 39007 gene locus_tag LOCUS_13000 40188 39007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 40438 41667 gene locus_tag LOCUS_13010 40438 41667 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_13010 43504 41687 gene locus_tag LOCUS_13020 43504 41687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105244.1 protein_id gnl|my_center|LOCUS_13020 43645 44217 gene locus_tag LOCUS_13030 gene efp 43645 44217 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_13030 44241 45194 gene locus_tag LOCUS_13040 gene epmA 44241 45194 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIX3 protein_id gnl|my_center|LOCUS_13040 46598 45246 gene locus_tag LOCUS_13050 gene pntB 46598 45246 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIW3 protein_id gnl|my_center|LOCUS_13050 46891 46604 gene locus_tag LOCUS_13060 46891 46604 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_13060 48035 46893 gene locus_tag LOCUS_13070 gene pntA 48035 46893 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123663.1 protein_id gnl|my_center|LOCUS_13070 50595 48295 gene locus_tag LOCUS_13080 50595 48295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_13080 52266 50605 gene locus_tag LOCUS_13090 52266 50605 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268224.1 protein_id gnl|my_center|LOCUS_13090 52451 53926 gene locus_tag LOCUS_13100 52451 53926 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_13100 53926 54387 gene locus_tag LOCUS_13110 53926 54387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_13110 54467 55549 gene locus_tag LOCUS_13120 54467 55549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 56142 55708 gene locus_tag LOCUS_13130 56142 55708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474275.1 protein_id gnl|my_center|LOCUS_13130 56740 56228 gene locus_tag LOCUS_13140 56740 56228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 58379 57036 gene locus_tag LOCUS_13150 58379 57036 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803809.1 protein_id gnl|my_center|LOCUS_13150 59068 59487 gene locus_tag LOCUS_13160 59068 59487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 59984 60442 gene locus_tag LOCUS_13170 59984 60442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 60533 61057 gene locus_tag LOCUS_13180 60533 61057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 63085 61307 gene locus_tag LOCUS_13190 63085 61307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478447.1 protein_id gnl|my_center|LOCUS_13190 63302 64060 gene locus_tag LOCUS_13200 63302 64060 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762581.1 protein_id gnl|my_center|LOCUS_13200 64803 64057 gene locus_tag LOCUS_13210 gene tatC 64803 64057 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVQ3 protein_id gnl|my_center|LOCUS_13210 65132 64800 gene locus_tag LOCUS_13220 65132 64800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 65379 65140 gene locus_tag LOCUS_13230 gene tatA 65379 65140 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57051 protein_id gnl|my_center|LOCUS_13230 65749 65420 gene locus_tag LOCUS_13240 gene hisE 65749 65420 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_13240 66147 65746 gene locus_tag LOCUS_13250 gene hisI 66147 65746 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB7 protein_id gnl|my_center|LOCUS_13250 67844 66204 gene locus_tag LOCUS_13260 gene ubiB 67844 66204 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_13260 68489 67848 gene locus_tag LOCUS_13270 68489 67848 CDS product sterol-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_13270 69240 68491 gene locus_tag LOCUS_13280 gene ubiE 69240 68491 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_13280 69427 71964 gene locus_tag LOCUS_13290 69427 71964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 72325 71996 gene locus_tag LOCUS_13300 72325 71996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 73713 72388 gene locus_tag LOCUS_13310 gene hslU 73713 72388 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC5 protein_id gnl|my_center|LOCUS_13310 74261 73722 gene locus_tag LOCUS_13320 gene hslV 74261 73722 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_13320 74974 74372 gene locus_tag LOCUS_13330 74974 74372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_13330 76663 74978 gene locus_tag LOCUS_13340 gene argS 76663 74978 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P455 protein_id gnl|my_center|LOCUS_13340 79017 76819 gene locus_tag LOCUS_13350 gene priA 79017 76819 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 protein_id gnl|my_center|LOCUS_13350 79244 79459 gene locus_tag LOCUS_13360 gene rpmE 79244 79459 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_13360 79618 80868 gene locus_tag LOCUS_13370 79618 80868 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_13370 83309 80865 gene locus_tag LOCUS_13380 gene mrcA 83309 80865 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q07806 protein_id gnl|my_center|LOCUS_13380 83483 84547 gene locus_tag LOCUS_13390 83483 84547 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_13390 84547 85116 gene locus_tag LOCUS_13400 gene pilN 84547 85116 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_13400 85120 85734 gene locus_tag LOCUS_13410 gene pilO 85120 85734 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_13410 85734 86270 gene locus_tag LOCUS_13420 gene pilP 85734 86270 CDS product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_13420 86377 88437 gene locus_tag LOCUS_13430 gene pilQ 86377 88437 CDS product fimbrial assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34750 protein_id gnl|my_center|LOCUS_13430 88453 88971 gene locus_tag LOCUS_13440 gene aroK 88453 88971 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_13440 89044 90132 gene locus_tag LOCUS_13450 gene aroB 89044 90132 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_13450 90250 91320 gene locus_tag LOCUS_13460 gene hemE 90250 91320 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_13460 92164 91343 gene locus_tag LOCUS_13470 gene cysE 92164 91343 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_13470 92874 92215 gene locus_tag LOCUS_13480 92874 92215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 92990 93715 gene locus_tag LOCUS_13490 92990 93715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 95091 94111 gene locus_tag LOCUS_13500 gene srkA 95091 94111 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 protein_id gnl|my_center|LOCUS_13500 96179 95088 gene locus_tag LOCUS_13510 gene modC 96179 95088 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2N4 protein_id gnl|my_center|LOCUS_13510 96862 96176 gene locus_tag LOCUS_13520 gene modB 96862 96176 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705491.1 protein_id gnl|my_center|LOCUS_13520 97551 96853 gene locus_tag LOCUS_13530 gene modA 97551 96853 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705490.1 protein_id gnl|my_center|LOCUS_13530 98308 97577 gene locus_tag LOCUS_13540 98308 97577 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_13540 98478 99449 gene locus_tag LOCUS_13550 gene bioB 98478 99449 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_13550 99459 100625 gene locus_tag LOCUS_13560 gene bioF 99459 100625 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I617 protein_id gnl|my_center|LOCUS_13560 100626 102224 gene locus_tag LOCUS_13570 100626 102224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 102221 102910 gene locus_tag LOCUS_13580 gene bioD 102221 102910 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I614 protein_id gnl|my_center|LOCUS_13580 103105 104898 gene locus_tag LOCUS_13590 103105 104898 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_13590 105013 105228 gene locus_tag LOCUS_13600 105013 105228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 105284 105360 gene locus_tag LOCUS_t00170 105284 105360 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 105473 105679 gene locus_tag LOCUS_13610 105473 105679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 105962 108379 gene locus_tag LOCUS_13620 105962 108379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 108617 109921 gene locus_tag LOCUS_13630 108617 109921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 109918 110901 gene locus_tag LOCUS_13640 109918 110901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 110898 111941 gene locus_tag LOCUS_13650 110898 111941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 111938 112237 gene locus_tag LOCUS_13660 111938 112237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 112340 112798 gene locus_tag LOCUS_13670 112340 112798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 112853 115957 gene locus_tag LOCUS_13680 gene hsdR-1 112853 115957 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_13680 115957 116682 gene locus_tag LOCUS_13690 115957 116682 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_13690 116761 117024 gene locus_tag LOCUS_13700 116761 117024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 118024 118620 gene locus_tag LOCUS_13710 118024 118620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 119563 118814 gene locus_tag LOCUS_13720 119563 118814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 121499 120384 gene locus_tag LOCUS_13730 gene nodX 121499 120384 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_13730 122700 121681 gene locus_tag LOCUS_13740 122700 121681 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_13740 122892 124241 gene locus_tag LOCUS_13750 122892 124241 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 protein_id gnl|my_center|LOCUS_13750 124349 125431 gene locus_tag LOCUS_13760 gene mtnA 124349 125431 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI0 protein_id gnl|my_center|LOCUS_13760 125691 125470 gene locus_tag LOCUS_13770 125691 125470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 126164 127273 gene locus_tag LOCUS_13780 126164 127273 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXH3 protein_id gnl|my_center|LOCUS_13780 128333 127245 gene locus_tag LOCUS_13790 128333 127245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 129982 128330 gene locus_tag LOCUS_13800 129982 128330 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262013.1 protein_id gnl|my_center|LOCUS_13800 130973 129975 gene locus_tag LOCUS_13810 130973 129975 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477545.1 protein_id gnl|my_center|LOCUS_13810 131472 130966 gene locus_tag LOCUS_13820 131472 130966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 132407 131469 gene locus_tag LOCUS_13830 132407 131469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122330.1 protein_id gnl|my_center|LOCUS_13830 133382 132414 gene locus_tag LOCUS_13840 133382 132414 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262017.1 protein_id gnl|my_center|LOCUS_13840 134018 133467 gene locus_tag LOCUS_13850 134018 133467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 protein_id gnl|my_center|LOCUS_13850 135276 134098 gene locus_tag LOCUS_13860 135276 134098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 136457 135276 gene locus_tag LOCUS_13870 136457 135276 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244100.1 protein_id gnl|my_center|LOCUS_13870 137621 136602 gene locus_tag LOCUS_13880 137621 136602 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453776.1 protein_id gnl|my_center|LOCUS_13880 138655 137810 gene locus_tag LOCUS_13890 138655 137810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 138793 139533 gene locus_tag LOCUS_13900 gene gst 138793 139533 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039034.1 protein_id gnl|my_center|LOCUS_13900 140301 139576 gene locus_tag LOCUS_13910 140301 139576 CDS product aromatic compound degradation protein PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229221.1 protein_id gnl|my_center|LOCUS_13910 141432 140350 gene locus_tag LOCUS_13920 141432 140350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 141590 141997 gene locus_tag LOCUS_13930 141590 141997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 protein_id gnl|my_center|LOCUS_13930 142180 142857 gene locus_tag LOCUS_13940 142180 142857 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_13940 142867 145575 gene locus_tag LOCUS_13950 142867 145575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125416.1 protein_id gnl|my_center|LOCUS_13950 145562 146242 gene locus_tag LOCUS_13960 145562 146242 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_13960 146275 146781 gene locus_tag LOCUS_13970 146275 146781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 146812 147915 gene locus_tag LOCUS_13980 146812 147915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 149380 147986 gene locus_tag LOCUS_13990 149380 147986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 149575 149859 gene locus_tag LOCUS_14000 149575 149859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 149759 149962 gene locus_tag LOCUS_14010 149759 149962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 150046 150576 gene locus_tag LOCUS_14020 150046 150576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 151448 150612 gene locus_tag LOCUS_14030 151448 150612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_14030 152384 151584 gene locus_tag LOCUS_14040 152384 151584 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730636.1 protein_id gnl|my_center|LOCUS_14040 154280 152439 gene locus_tag LOCUS_14050 154280 152439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 154162 154452 gene locus_tag LOCUS_14060 154162 154452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 154582 155400 gene locus_tag LOCUS_14070 154582 155400 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_14070 155443 156180 gene locus_tag LOCUS_14080 gene ptr1 155443 156180 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_14080 156618 156193 gene locus_tag LOCUS_14090 156618 156193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_14090 158456 156735 gene locus_tag LOCUS_14100 158456 156735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 158715 160652 gene locus_tag LOCUS_14110 158715 160652 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_14110 160645 162120 gene locus_tag LOCUS_14120 160645 162120 CDS product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705288.1 protein_id gnl|my_center|LOCUS_14120 164054 162174 gene locus_tag LOCUS_14130 164054 162174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 164842 164240 gene locus_tag LOCUS_14140 164842 164240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701109.1 protein_id gnl|my_center|LOCUS_14140 164978 165823 gene locus_tag LOCUS_14150 164978 165823 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_14150 166210 165848 gene locus_tag LOCUS_14160 166210 165848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 166791 166249 gene locus_tag LOCUS_14170 166791 166249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 167748 166891 gene locus_tag LOCUS_14180 167748 166891 CDS product RIO1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705970.1 protein_id gnl|my_center|LOCUS_14180 168027 168413 gene locus_tag LOCUS_14190 168027 168413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_14190 168467 169141 gene locus_tag LOCUS_14200 168467 169141 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_14200 169196 169591 gene locus_tag LOCUS_14210 169196 169591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114197.1 protein_id gnl|my_center|LOCUS_14210 170677 169616 gene locus_tag LOCUS_14220 170677 169616 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_14220 171605 170718 gene locus_tag LOCUS_14230 171605 170718 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104939.1 protein_id gnl|my_center|LOCUS_14230 171797 172960 gene locus_tag LOCUS_14240 171797 172960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 173208 173975 gene locus_tag LOCUS_14250 173208 173975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 174328 174023 gene locus_tag LOCUS_14260 174328 174023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 175275 174328 gene locus_tag LOCUS_14270 gene cbpA 175275 174328 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VN8 protein_id gnl|my_center|LOCUS_14270 175549 176802 gene locus_tag LOCUS_14280 175549 176802 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701953.1 protein_id gnl|my_center|LOCUS_14280 176850 177251 gene locus_tag LOCUS_14290 176850 177251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 178344 177280 gene locus_tag LOCUS_14300 gene corA-1 178344 177280 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB7 protein_id gnl|my_center|LOCUS_14300 179106 178369 gene locus_tag LOCUS_14310 179106 178369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_14310 179377 180102 gene locus_tag LOCUS_14320 179377 180102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 180239 181180 gene locus_tag LOCUS_14330 180239 181180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 protein_id gnl|my_center|LOCUS_14330 181229 181846 gene locus_tag LOCUS_14340 181229 181846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_14340 182497 181868 gene locus_tag LOCUS_14350 gene hlY-III 182497 181868 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 protein_id gnl|my_center|LOCUS_14350 182711 183394 gene locus_tag LOCUS_14360 182711 183394 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 protein_id gnl|my_center|LOCUS_14360 183494 184828 gene locus_tag LOCUS_14370 183494 184828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 185784 184849 gene locus_tag LOCUS_14380 185784 184849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268573.1 protein_id gnl|my_center|LOCUS_14380 186463 185831 gene locus_tag LOCUS_14390 186463 185831 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_14390 187210 186503 gene locus_tag LOCUS_14400 187210 186503 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974531.1 protein_id gnl|my_center|LOCUS_14400 188348 187281 gene locus_tag LOCUS_14410 188348 187281 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_14410 188472 188834 gene locus_tag LOCUS_14420 188472 188834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 189901 188912 gene locus_tag LOCUS_14430 189901 188912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 193697 190056 gene locus_tag LOCUS_14440 193697 190056 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937370.1 protein_id gnl|my_center|LOCUS_14440 194818 193709 gene locus_tag LOCUS_14450 194818 193709 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937369.1 protein_id gnl|my_center|LOCUS_14450 196141 194819 gene locus_tag LOCUS_14460 196141 194819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 197879 196305 gene locus_tag LOCUS_14470 197879 196305 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262022.1 protein_id gnl|my_center|LOCUS_14470 199342 198035 gene locus_tag LOCUS_14480 199342 198035 CDS product Na+/H+-exchanging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140517.1 protein_id gnl|my_center|LOCUS_14480 199551 200195 gene locus_tag LOCUS_14490 199551 200195 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_14490 200296 200661 gene locus_tag LOCUS_14500 200296 200661 CDS product mono-heme cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115372.1 protein_id gnl|my_center|LOCUS_14500 200658 202028 gene locus_tag LOCUS_14510 200658 202028 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_14510 202176 202766 gene locus_tag LOCUS_14520 202176 202766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 202885 203952 gene locus_tag LOCUS_14530 202885 203952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 203945 207091 gene locus_tag LOCUS_14540 203945 207091 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_14540 208429 207098 gene locus_tag LOCUS_14550 gene rlmD 208429 207098 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP5 protein_id gnl|my_center|LOCUS_14550 208753 208541 gene locus_tag LOCUS_14560 208753 208541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 208935 209333 gene locus_tag LOCUS_14570 208935 209333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 209424 210002 gene locus_tag LOCUS_14580 209424 210002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 211637 210063 gene locus_tag LOCUS_14590 211637 210063 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_14590 211821 213002 gene locus_tag LOCUS_14600 gene hmp 211821 213002 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H4 protein_id gnl|my_center|LOCUS_14600 213355 213879 gene locus_tag LOCUS_14610 213355 213879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 214628 213921 gene locus_tag LOCUS_14620 214628 213921 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816581.1 protein_id gnl|my_center|LOCUS_14620 214858 215670 gene locus_tag LOCUS_14630 214858 215670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 215667 216440 gene locus_tag LOCUS_14640 215667 216440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_14640 216440 217387 gene locus_tag LOCUS_14650 216440 217387 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_14650 218581 217394 gene locus_tag LOCUS_14660 218581 217394 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_14660 218776 219228 gene locus_tag LOCUS_14670 218776 219228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 220757 219351 gene locus_tag LOCUS_14680 220757 219351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 220946 222268 gene locus_tag LOCUS_14690 220946 222268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 222286 222816 gene locus_tag LOCUS_14700 222286 222816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_14700 223662 222889 gene locus_tag LOCUS_14710 223662 222889 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_14710 224418 223780 gene locus_tag LOCUS_14720 224418 223780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_14720 225308 224415 gene locus_tag LOCUS_14730 225308 224415 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_14730 228029 225312 gene locus_tag LOCUS_14740 228029 225312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 229771 228026 gene locus_tag LOCUS_14750 229771 228026 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_14750 231786 229876 gene locus_tag LOCUS_14760 231786 229876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 232221 232499 gene locus_tag LOCUS_14770 232221 232499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_14770 232496 232816 gene locus_tag LOCUS_14780 232496 232816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_14780 232879 233142 gene locus_tag LOCUS_14790 232879 233142 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_14790 233132 233386 gene locus_tag LOCUS_14800 233132 233386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_14800 234511 234840 gene locus_tag LOCUS_14810 234511 234840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 235100 235516 gene locus_tag LOCUS_14820 235100 235516 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706793.1 protein_id gnl|my_center|LOCUS_14820 235740 236960 gene locus_tag LOCUS_14830 235740 236960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 237575 237075 gene locus_tag LOCUS_14840 237575 237075 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071263.1 protein_id gnl|my_center|LOCUS_14840 237668 238561 gene locus_tag LOCUS_14850 237668 238561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233142.2 protein_id gnl|my_center|LOCUS_14850 238712 239212 gene locus_tag LOCUS_14860 238712 239212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 239401 241635 gene locus_tag LOCUS_14870 239401 241635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 241750 242484 gene locus_tag LOCUS_14880 241750 242484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 protein_id gnl|my_center|LOCUS_14880 242632 243981 gene locus_tag LOCUS_14890 242632 243981 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_14890 244012 245049 gene locus_tag LOCUS_14900 gene lipH 244012 245049 CDS product carboxylesterase NlhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407276.1 protein_id gnl|my_center|LOCUS_14900 245174 247270 gene locus_tag LOCUS_14910 245174 247270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 247427 247939 gene locus_tag LOCUS_14920 247427 247939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 248113 250926 gene locus_tag LOCUS_14930 248113 250926 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_14930 251101 252840 gene locus_tag LOCUS_14940 251101 252840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_14940 252840 253619 gene locus_tag LOCUS_14950 gene bdhA 252840 253619 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_14950 254831 253647 gene locus_tag LOCUS_14960 254831 253647 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_14960 254923 255546 gene locus_tag LOCUS_14970 254923 255546 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920065.1 protein_id gnl|my_center|LOCUS_14970 255555 256202 gene locus_tag LOCUS_14980 255555 256202 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_14980 256285 256944 gene locus_tag LOCUS_14990 gene cbbZ 256285 256944 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYC6 protein_id gnl|my_center|LOCUS_14990 257008 257289 gene locus_tag LOCUS_15000 257008 257289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 257429 258496 gene locus_tag LOCUS_15010 257429 258496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 258606 259484 gene locus_tag LOCUS_15020 258606 259484 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_15020 259666 262317 gene locus_tag LOCUS_15030 259666 262317 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027924.1 protein_id gnl|my_center|LOCUS_15030 263289 262378 gene locus_tag LOCUS_15040 263289 262378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 263657 264196 gene locus_tag LOCUS_15050 263657 264196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 264375 266699 gene locus_tag LOCUS_15060 264375 266699 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_15060 266793 267581 gene locus_tag LOCUS_15070 266793 267581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_15070 267667 268797 gene locus_tag LOCUS_15080 gene dinB2 267667 268797 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92XH8 protein_id gnl|my_center|LOCUS_15080 269805 268813 gene locus_tag LOCUS_15090 269805 268813 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086510.1 protein_id gnl|my_center|LOCUS_15090 271159 269798 gene locus_tag LOCUS_15100 271159 269798 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_15100 272527 271268 gene locus_tag LOCUS_15110 272527 271268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 272843 273904 gene locus_tag LOCUS_15120 272843 273904 CDS product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896630.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence06 4215 3901 gene locus_tag LOCUS_15130 4215 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4530 4234 gene locus_tag LOCUS_15140 4530 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7802 4542 gene locus_tag LOCUS_15150 7802 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8301 11699 gene locus_tag LOCUS_15160 8301 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 11686 13704 gene locus_tag LOCUS_15170 11686 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13960 15450 gene locus_tag LOCUS_15180 13960 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 15502 17385 gene locus_tag LOCUS_15190 15502 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 17300 17989 gene locus_tag LOCUS_15200 17300 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 18771 18010 gene locus_tag LOCUS_15210 gene coaX 18771 18010 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y6 protein_id gnl|my_center|LOCUS_15210 19748 18768 gene locus_tag LOCUS_15220 gene birA 19748 18768 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 protein_id gnl|my_center|LOCUS_15220 19901 20290 gene locus_tag LOCUS_15230 gene liuR 19901 20290 CDS product liu genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_15230 20402 20746 gene locus_tag LOCUS_15240 20402 20746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 20820 21362 gene locus_tag LOCUS_15250 20820 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482675.1 protein_id gnl|my_center|LOCUS_15250 21855 21490 gene locus_tag LOCUS_15260 21855 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 27239 21864 gene locus_tag LOCUS_15270 27239 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 28322 27639 gene locus_tag LOCUS_15280 28322 27639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 28822 29862 gene locus_tag LOCUS_15290 28822 29862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 31158 29923 gene locus_tag LOCUS_15300 gene erg3 31158 29923 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_15300 31308 32777 gene locus_tag LOCUS_15310 31308 32777 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482874.1 protein_id gnl|my_center|LOCUS_15310 32774 33265 gene locus_tag LOCUS_15320 32774 33265 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG04 protein_id gnl|my_center|LOCUS_15320 33575 33291 gene locus_tag LOCUS_15330 33575 33291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 34487 33633 gene locus_tag LOCUS_15340 gene cysQ 34487 33633 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638230.2 protein_id gnl|my_center|LOCUS_15340 34618 35283 gene locus_tag LOCUS_15350 34618 35283 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_15350 35280 35684 gene locus_tag LOCUS_15360 gene hslR 35280 35684 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44754 protein_id gnl|my_center|LOCUS_15360 35796 37751 gene locus_tag LOCUS_15370 gene dxs 35796 37751 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Q1 protein_id gnl|my_center|LOCUS_15370 37776 38552 gene locus_tag LOCUS_15380 37776 38552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 38542 39681 gene locus_tag LOCUS_15390 38542 39681 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_15390 40817 39714 gene locus_tag LOCUS_15400 40817 39714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 41963 40842 gene locus_tag LOCUS_15410 gene rfbD 41963 40842 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 protein_id gnl|my_center|LOCUS_15410 42709 41972 gene locus_tag LOCUS_15420 42709 41972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 44591 43005 gene locus_tag LOCUS_15430 44591 43005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 44829 45071 gene locus_tag LOCUS_15440 44829 45071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 45953 45084 gene locus_tag LOCUS_15450 45953 45084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 47216 46002 gene locus_tag LOCUS_15460 47216 46002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 48567 47194 gene locus_tag LOCUS_15470 48567 47194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 49799 48570 gene locus_tag LOCUS_15480 49799 48570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 50638 49802 gene locus_tag LOCUS_15490 50638 49802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 50999 51277 gene locus_tag LOCUS_15500 gene xseB 50999 51277 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 protein_id gnl|my_center|LOCUS_15500 51285 52178 gene locus_tag LOCUS_15510 gene ispA 51285 52178 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_15510 52709 52221 gene locus_tag LOCUS_15520 52709 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 52602 52886 gene locus_tag LOCUS_15530 52602 52886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 53533 52883 gene locus_tag LOCUS_15540 53533 52883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 54059 53553 gene locus_tag LOCUS_15550 54059 53553 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU7 protein_id gnl|my_center|LOCUS_15550 55001 54075 gene locus_tag LOCUS_15560 gene thiL 55001 54075 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX7 protein_id gnl|my_center|LOCUS_15560 55453 55001 gene locus_tag LOCUS_15570 gene nusB 55453 55001 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_15570 55927 55454 gene locus_tag LOCUS_15580 gene ribH 55927 55454 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_15580 57055 55940 gene locus_tag LOCUS_15590 gene ribB 57055 55940 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX4 protein_id gnl|my_center|LOCUS_15590 57738 57052 gene locus_tag LOCUS_15600 gene ribC 57738 57052 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_15600 58927 57788 gene locus_tag LOCUS_15610 gene ribD 58927 57788 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX2 protein_id gnl|my_center|LOCUS_15610 59410 58946 gene locus_tag LOCUS_15620 gene nrdR 59410 58946 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMX9 protein_id gnl|my_center|LOCUS_15620 60047 60316 gene locus_tag LOCUS_15630 60047 60316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 61569 60307 gene locus_tag LOCUS_15640 gene glyA 61569 60307 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH4 protein_id gnl|my_center|LOCUS_15640 61834 63282 gene locus_tag LOCUS_15650 61834 63282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_15650 63279 64238 gene locus_tag LOCUS_15660 63279 64238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_15660 64339 67641 gene locus_tag LOCUS_15670 64339 67641 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_15670 67753 70344 gene locus_tag LOCUS_15680 67753 70344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_15680 70344 71237 gene locus_tag LOCUS_15690 70344 71237 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_15690 71617 71324 gene locus_tag LOCUS_15700 71617 71324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 74126 71664 gene locus_tag LOCUS_15710 74126 71664 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031125.1 protein_id gnl|my_center|LOCUS_15710 74646 74248 gene locus_tag LOCUS_15720 74646 74248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 74934 76598 gene locus_tag LOCUS_15730 74934 76598 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_15730 76727 77089 gene locus_tag LOCUS_15740 76727 77089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 78493 77105 gene locus_tag LOCUS_15750 gene radA 78493 77105 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_15750 78645 79823 gene locus_tag LOCUS_15760 78645 79823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 79735 80406 gene locus_tag LOCUS_15770 79735 80406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 81922 80513 gene locus_tag LOCUS_15780 gene dnaB 81922 80513 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK7 protein_id gnl|my_center|LOCUS_15780 82846 82025 gene locus_tag LOCUS_15790 82846 82025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 83781 83332 gene locus_tag LOCUS_15800 gene rplI 83781 83332 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY9 protein_id gnl|my_center|LOCUS_15800 84770 83820 gene locus_tag LOCUS_15810 84770 83820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_15810 85037 84810 gene locus_tag LOCUS_15820 gene rpsR 85037 84810 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_15820 85537 85097 gene locus_tag LOCUS_15830 gene rpsF 85537 85097 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM9 protein_id gnl|my_center|LOCUS_15830 86440 85691 gene locus_tag LOCUS_15840 gene rlmB 86440 85691 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK2 protein_id gnl|my_center|LOCUS_15840 88788 86443 gene locus_tag LOCUS_15850 gene rnr 88788 86443 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 protein_id gnl|my_center|LOCUS_15850 88961 89047 gene locus_tag LOCUS_t00180 88961 89047 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 89530 89360 gene locus_tag LOCUS_15860 89530 89360 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_15860 89814 91049 gene locus_tag LOCUS_15870 89814 91049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_15870 91968 91309 gene locus_tag LOCUS_15880 91968 91309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 92734 92432 gene locus_tag LOCUS_15890 92734 92432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 95795 92727 gene locus_tag LOCUS_15900 95795 92727 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_15900 96821 95796 gene locus_tag LOCUS_15910 96821 95796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 98029 96818 gene locus_tag LOCUS_15920 98029 96818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 98165 98683 gene locus_tag LOCUS_15930 98165 98683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 98853 99236 gene locus_tag LOCUS_15940 98853 99236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 99258 100766 gene locus_tag LOCUS_15950 99258 100766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 100969 100772 gene locus_tag LOCUS_15960 100969 100772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 101543 101097 gene locus_tag LOCUS_15970 101543 101097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_15970 102321 101545 gene locus_tag LOCUS_15980 102321 101545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 103200 102325 gene locus_tag LOCUS_15990 103200 102325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946413.1 protein_id gnl|my_center|LOCUS_15990 103635 103345 gene locus_tag LOCUS_16000 103635 103345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 104293 103772 gene locus_tag LOCUS_16010 104293 103772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 104816 104403 gene locus_tag LOCUS_16020 104816 104403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_16020 105019 105591 gene locus_tag LOCUS_16030 105019 105591 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893527.1 protein_id gnl|my_center|LOCUS_16030 105743 106024 gene locus_tag LOCUS_16040 105743 106024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 106074 106670 gene locus_tag LOCUS_16050 106074 106670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_16050 106688 108643 gene locus_tag LOCUS_16060 106688 108643 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_16060 108808 109203 gene locus_tag LOCUS_16070 108808 109203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 110113 109349 gene locus_tag LOCUS_16080 110113 109349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_16080 111221 110205 gene locus_tag LOCUS_16090 111221 110205 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 protein_id gnl|my_center|LOCUS_16090 111393 112409 gene locus_tag LOCUS_16100 gene uge 111393 112409 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_16100 112406 113710 gene locus_tag LOCUS_16110 112406 113710 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_16110 113738 114811 gene locus_tag LOCUS_16120 113738 114811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 114839 116143 gene locus_tag LOCUS_16130 114839 116143 CDS product polysaccharide export related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709180.1 protein_id gnl|my_center|LOCUS_16130 116191 116748 gene locus_tag LOCUS_16140 116191 116748 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937647.1 protein_id gnl|my_center|LOCUS_16140 117920 116799 gene locus_tag LOCUS_16150 117920 116799 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_16150 118768 117974 gene locus_tag LOCUS_16160 118768 117974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 119997 118813 gene locus_tag LOCUS_16170 119997 118813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 121092 120043 gene locus_tag LOCUS_16180 121092 120043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 122233 121109 gene locus_tag LOCUS_16190 122233 121109 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_16190 123447 122230 gene locus_tag LOCUS_16200 123447 122230 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_16200 124617 123460 gene locus_tag LOCUS_16210 124617 123460 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_16210 125411 124629 gene locus_tag LOCUS_16220 125411 124629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 127691 125466 gene locus_tag LOCUS_16230 127691 125466 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_16230 128268 127723 gene locus_tag LOCUS_16240 128268 127723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_16240 128844 128371 gene locus_tag LOCUS_16250 128844 128371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 128828 128986 gene locus_tag LOCUS_16260 128828 128986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 129013 129366 gene locus_tag LOCUS_16270 129013 129366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 129916 130707 gene locus_tag LOCUS_16280 129916 130707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 130737 131429 gene locus_tag LOCUS_16290 130737 131429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 131659 132273 gene locus_tag LOCUS_16300 131659 132273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 133588 132347 gene locus_tag LOCUS_16310 133588 132347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433346.1 protein_id gnl|my_center|LOCUS_16310 133869 135218 gene locus_tag LOCUS_16320 133869 135218 CDS product polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947937.1 protein_id gnl|my_center|LOCUS_16320 135278 135718 gene locus_tag LOCUS_16330 135278 135718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 135722 136483 gene locus_tag LOCUS_16340 135722 136483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 136524 138710 gene locus_tag LOCUS_16350 gene gidA 136524 138710 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_16350 138736 140952 gene locus_tag LOCUS_16360 138736 140952 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083633.1 protein_id gnl|my_center|LOCUS_16360 140949 141362 gene locus_tag LOCUS_16370 140949 141362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 142002 141346 gene locus_tag LOCUS_16380 142002 141346 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_16380 143208 142189 gene locus_tag LOCUS_16390 gene wecA 143208 142189 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM83 protein_id gnl|my_center|LOCUS_16390 144276 143335 gene locus_tag LOCUS_16400 144276 143335 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_16400 145644 144349 gene locus_tag LOCUS_16410 gene purA 145644 144349 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_16410 146888 145698 gene locus_tag LOCUS_16420 gene hisZ 146888 145698 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 protein_id gnl|my_center|LOCUS_16420 147086 146895 gene locus_tag LOCUS_16430 147086 146895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_16430 148069 147170 gene locus_tag LOCUS_16440 gene hflC 148069 147170 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_16440 149226 148072 gene locus_tag LOCUS_16450 gene hflK 149226 148072 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_16450 150578 149307 gene locus_tag LOCUS_16460 gene hflX 150578 149307 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_16460 150885 150634 gene locus_tag LOCUS_16470 gene hfq 150885 150634 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM0 protein_id gnl|my_center|LOCUS_16470 152016 151033 gene locus_tag LOCUS_16480 gene miaA 152016 151033 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_16480 153872 152031 gene locus_tag LOCUS_16490 gene mutL 153872 152031 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 protein_id gnl|my_center|LOCUS_16490 155190 153886 gene locus_tag LOCUS_16500 gene amiB 155190 153886 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_16500 155712 155233 gene locus_tag LOCUS_16510 155712 155233 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296675.1 protein_id gnl|my_center|LOCUS_16510 157190 155709 gene locus_tag LOCUS_16520 157190 155709 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY5 protein_id gnl|my_center|LOCUS_16520 157440 158516 gene locus_tag LOCUS_16530 gene queG 157440 158516 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_16530 159048 158503 gene locus_tag LOCUS_16540 gene orn 159048 158503 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_16540 159134 160147 gene locus_tag LOCUS_16550 gene rsgA 159134 160147 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI5 protein_id gnl|my_center|LOCUS_16550 161226 160378 gene locus_tag LOCUS_16560 161226 160378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 161225 161563 gene locus_tag LOCUS_16570 161225 161563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 161632 162669 gene locus_tag LOCUS_16580 161632 162669 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_16580 162856 164019 gene locus_tag LOCUS_16590 162856 164019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 164264 164079 gene locus_tag LOCUS_16600 164264 164079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 165371 164367 gene locus_tag LOCUS_16610 165371 164367 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_16610 165508 165711 gene locus_tag LOCUS_16620 165508 165711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 166778 165771 gene locus_tag LOCUS_16630 166778 165771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261704.1 protein_id gnl|my_center|LOCUS_16630 167180 166947 gene locus_tag LOCUS_16640 167180 166947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 167082 168416 gene locus_tag LOCUS_16650 167082 168416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269202.1 protein_id gnl|my_center|LOCUS_16650 168421 169785 gene locus_tag LOCUS_16660 168421 169785 CDS product GTPase SAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103141.1 protein_id gnl|my_center|LOCUS_16660 170494 169883 gene locus_tag LOCUS_16670 170494 169883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 171462 170566 gene locus_tag LOCUS_16680 171462 170566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 173228 171669 gene locus_tag LOCUS_16690 173228 171669 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_16690 174850 173249 gene locus_tag LOCUS_16700 174850 173249 CDS product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_16700 176477 174879 gene locus_tag LOCUS_16710 176477 174879 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_16710 178081 176657 gene locus_tag LOCUS_16720 178081 176657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 178629 178084 gene locus_tag LOCUS_16730 178629 178084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 180769 178646 gene locus_tag LOCUS_16740 gene bfrI 180769 178646 CDS product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930660.1 protein_id gnl|my_center|LOCUS_16740 181012 182268 gene locus_tag LOCUS_16750 181012 182268 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_16750 182265 183485 gene locus_tag LOCUS_16760 182265 183485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 183478 186618 gene locus_tag LOCUS_16770 183478 186618 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_16770 186612 187304 gene locus_tag LOCUS_16780 186612 187304 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 protein_id gnl|my_center|LOCUS_16780 187304 188575 gene locus_tag LOCUS_16790 187304 188575 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105000.1 protein_id gnl|my_center|LOCUS_16790 190082 188640 gene locus_tag LOCUS_16800 190082 188640 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 protein_id gnl|my_center|LOCUS_16800 190597 193581 gene locus_tag LOCUS_16810 190597 193581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 194104 193667 gene locus_tag LOCUS_16820 194104 193667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 194431 196404 gene locus_tag LOCUS_16830 gene rnb 194431 196404 CDS product exoribonuclease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JM34 protein_id gnl|my_center|LOCUS_16830 196751 196401 gene locus_tag LOCUS_16840 196751 196401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 198279 196882 gene locus_tag LOCUS_16850 gene asnS 198279 196882 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC3 protein_id gnl|my_center|LOCUS_16850 199656 198709 gene locus_tag LOCUS_16860 199656 198709 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918286.1 protein_id gnl|my_center|LOCUS_16860 199717 200148 gene locus_tag LOCUS_16870 199717 200148 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256786.1 protein_id gnl|my_center|LOCUS_16870 200852 200226 gene locus_tag LOCUS_16880 200852 200226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 201810 201010 gene locus_tag LOCUS_16890 201810 201010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_16890 203099 201945 gene locus_tag LOCUS_16900 203099 201945 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_16900 203739 203104 gene locus_tag LOCUS_16910 203739 203104 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP11 protein_id gnl|my_center|LOCUS_16910 203814 204407 gene locus_tag LOCUS_16920 203814 204407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_16920 205192 204599 gene locus_tag LOCUS_16930 205192 204599 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_16930 205271 206557 gene locus_tag LOCUS_16940 gene pncC 205271 206557 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK32 protein_id gnl|my_center|LOCUS_16940 207221 206583 gene locus_tag LOCUS_16950 gene pdxH 207221 206583 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYB5 protein_id gnl|my_center|LOCUS_16950 207293 207892 gene locus_tag LOCUS_16960 207293 207892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 208199 207900 gene locus_tag LOCUS_16970 208199 207900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 208380 210128 gene locus_tag LOCUS_16980 gene ggtA 208380 210128 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 protein_id gnl|my_center|LOCUS_16980 210756 210178 gene locus_tag LOCUS_16990 210756 210178 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071247.1 protein_id gnl|my_center|LOCUS_16990 210849 211436 gene locus_tag LOCUS_17000 210849 211436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 212298 211507 gene locus_tag LOCUS_17010 212298 211507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_17010 212452 213756 gene locus_tag LOCUS_17020 212452 213756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 214049 214852 gene locus_tag LOCUS_17030 214049 214852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 214852 216060 gene locus_tag LOCUS_17040 214852 216060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 216095 217660 gene locus_tag LOCUS_17050 216095 217660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 217706 219763 gene locus_tag LOCUS_17060 217706 219763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 219767 220039 gene locus_tag LOCUS_17070 219767 220039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 220049 220846 gene locus_tag LOCUS_17080 220049 220846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 220846 222132 gene locus_tag LOCUS_17090 220846 222132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 222138 223229 gene locus_tag LOCUS_17100 222138 223229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 223229 224230 gene locus_tag LOCUS_17110 223229 224230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 224217 224873 gene locus_tag LOCUS_17120 224217 224873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 224873 225526 gene locus_tag LOCUS_17130 224873 225526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 225536 226933 gene locus_tag LOCUS_17140 225536 226933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_17140 227113 228171 gene locus_tag LOCUS_17150 227113 228171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 228642 228274 gene locus_tag LOCUS_17160 228642 228274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 229285 228635 gene locus_tag LOCUS_17170 229285 228635 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_17170 230663 229350 gene locus_tag LOCUS_17180 230663 229350 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_17180 230887 230660 gene locus_tag LOCUS_17190 230887 230660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 232372 230978 gene locus_tag LOCUS_17200 232372 230978 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918622.1 protein_id gnl|my_center|LOCUS_17200 233443 232439 gene locus_tag LOCUS_17210 233443 232439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 233595 233996 gene locus_tag LOCUS_17220 233595 233996 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072250.1 protein_id gnl|my_center|LOCUS_17220 234975 234058 gene locus_tag LOCUS_17230 234975 234058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 235243 236016 gene locus_tag LOCUS_17240 235243 236016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 236050 236802 gene locus_tag LOCUS_17250 236050 236802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 237440 236799 gene locus_tag LOCUS_17260 237440 236799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 237637 239607 gene locus_tag LOCUS_17270 237637 239607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 239778 240824 gene locus_tag LOCUS_17280 239778 240824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 240886 241341 gene locus_tag LOCUS_17290 240886 241341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704461.1 protein_id gnl|my_center|LOCUS_17290 241479 242546 gene locus_tag LOCUS_17300 241479 242546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 242582 243442 gene locus_tag LOCUS_17310 242582 243442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 243490 245463 gene locus_tag LOCUS_17320 243490 245463 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_17320 246411 247736 gene locus_tag LOCUS_17330 246411 247736 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227064.1 protein_id gnl|my_center|LOCUS_17330 248463 247831 gene locus_tag LOCUS_17340 gene lipB 248463 247831 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VW6 protein_id gnl|my_center|LOCUS_17340 248754 248467 gene locus_tag LOCUS_17350 248754 248467 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V8 protein_id gnl|my_center|LOCUS_17350 249933 248770 gene locus_tag LOCUS_17360 gene dacC 249933 248770 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_17360 251116 250277 gene locus_tag LOCUS_17370 251116 250277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947237.1 protein_id gnl|my_center|LOCUS_17370 252108 251113 gene locus_tag LOCUS_17380 gene mltB 252108 251113 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_17380 253309 252167 gene locus_tag LOCUS_17390 253309 252167 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_17390 255168 253309 gene locus_tag LOCUS_17400 255168 253309 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_17400 255665 255213 gene locus_tag LOCUS_17410 gene rlmH 255665 255213 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6V2 protein_id gnl|my_center|LOCUS_17410 256020 255679 gene locus_tag LOCUS_17420 gene rsfS 256020 255679 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_17420 256722 256063 gene locus_tag LOCUS_17430 gene nadD 256722 256063 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX21 protein_id gnl|my_center|LOCUS_17430 257957 256719 gene locus_tag LOCUS_17440 gene proA 257957 256719 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_17440 258070 258708 gene locus_tag LOCUS_17450 258070 258708 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_17450 259920 259318 gene locus_tag LOCUS_17460 259920 259318 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_17460 260401 260072 gene locus_tag LOCUS_17470 260401 260072 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_17470 260608 261774 gene locus_tag LOCUS_17480 gene argD 260608 261774 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_17480 261805 262722 gene locus_tag LOCUS_17490 gene argF 261805 262722 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_17490 263159 266050 gene locus_tag LOCUS_17500 gene nrdA 263159 266050 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 protein_id gnl|my_center|LOCUS_17500 266109 267425 gene locus_tag LOCUS_17510 266109 267425 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ19 protein_id gnl|my_center|LOCUS_17510 267450 267650 gene locus_tag LOCUS_17520 267450 267650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 267978 268442 gene locus_tag LOCUS_17530 267978 268442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 268558 268881 gene locus_tag LOCUS_17540 268558 268881 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036813.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence07 1335 469 gene locus_tag LOCUS_17550 1335 469 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_17550 1634 1371 gene locus_tag LOCUS_17560 1634 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2457 1648 gene locus_tag LOCUS_17570 2457 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4978 2513 gene locus_tag LOCUS_17580 gene fyuA 4978 2513 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_17580 5149 6579 gene locus_tag LOCUS_17590 5149 6579 CDS product carotenoid oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_17590 6810 6613 gene locus_tag LOCUS_17600 6810 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639145.2 protein_id gnl|my_center|LOCUS_17600 7194 6826 gene locus_tag LOCUS_17610 7194 6826 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_17610 7518 7312 gene locus_tag LOCUS_17620 7518 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 8585 7590 gene locus_tag LOCUS_17630 8585 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 9035 8637 gene locus_tag LOCUS_17640 9035 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 9454 9035 gene locus_tag LOCUS_17650 9454 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 10749 9604 gene locus_tag LOCUS_17660 10749 9604 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_17660 11534 10878 gene locus_tag LOCUS_17670 11534 10878 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_17670 11663 12808 gene locus_tag LOCUS_17680 11663 12808 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 protein_id gnl|my_center|LOCUS_17680 12960 13331 gene locus_tag LOCUS_17690 12960 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 13514 14311 gene locus_tag LOCUS_17700 13514 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 15040 14357 gene locus_tag LOCUS_17710 15040 14357 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_17710 15881 15099 gene locus_tag LOCUS_17720 15881 15099 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_17720 17394 16018 gene locus_tag LOCUS_17730 17394 16018 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_17730 18718 17405 gene locus_tag LOCUS_17740 18718 17405 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_17740 19974 18715 gene locus_tag LOCUS_17750 19974 18715 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_17750 21205 19988 gene locus_tag LOCUS_17760 21205 19988 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_17760 21925 21599 gene locus_tag LOCUS_17770 21925 21599 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_17770 22026 22178 gene locus_tag LOCUS_17780 22026 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 22455 22216 gene locus_tag LOCUS_17790 22455 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_17790 22936 22544 gene locus_tag LOCUS_17800 22936 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 23635 23147 gene locus_tag LOCUS_17810 23635 23147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 24151 23846 gene locus_tag LOCUS_17820 24151 23846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 25940 25131 gene locus_tag LOCUS_17830 25940 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084482.1 protein_id gnl|my_center|LOCUS_17830 26274 25942 gene locus_tag LOCUS_17840 26274 25942 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084483.1 protein_id gnl|my_center|LOCUS_17840 26400 27365 gene locus_tag LOCUS_17850 26400 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 27374 27886 gene locus_tag LOCUS_17860 27374 27886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 27883 28818 gene locus_tag LOCUS_17870 27883 28818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 28818 29546 gene locus_tag LOCUS_17880 28818 29546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 30358 29660 gene locus_tag LOCUS_17890 30358 29660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 31945 30425 gene locus_tag LOCUS_17900 31945 30425 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_17900 32081 32398 gene locus_tag LOCUS_17910 32081 32398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 33498 32431 gene locus_tag LOCUS_17920 33498 32431 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_17920 35113 33491 gene locus_tag LOCUS_17930 35113 33491 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_17930 36222 35179 gene locus_tag LOCUS_17940 gene idiA 36222 35179 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_17940 36467 37699 gene locus_tag LOCUS_17950 36467 37699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 38178 37720 gene locus_tag LOCUS_17960 38178 37720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 39416 38244 gene locus_tag LOCUS_17970 39416 38244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 39697 42588 gene locus_tag LOCUS_17980 39697 42588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 42603 44435 gene locus_tag LOCUS_17990 42603 44435 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481647.1 protein_id gnl|my_center|LOCUS_17990 44446 45600 gene locus_tag LOCUS_18000 44446 45600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 46276 47484 gene locus_tag LOCUS_18010 46276 47484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 47752 48267 gene locus_tag LOCUS_18020 47752 48267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 48278 49006 gene locus_tag LOCUS_18030 48278 49006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 49180 50043 gene locus_tag LOCUS_18040 49180 50043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 50508 50179 gene locus_tag LOCUS_18050 50508 50179 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_18050 51251 50649 gene locus_tag LOCUS_18060 51251 50649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 52078 51857 gene locus_tag LOCUS_18070 52078 51857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 52315 52082 gene locus_tag LOCUS_18080 52315 52082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 53079 52408 gene locus_tag LOCUS_18090 53079 52408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 53802 53116 gene locus_tag LOCUS_18100 53802 53116 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_18100 54842 53907 gene locus_tag LOCUS_18110 54842 53907 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_18110 56448 54982 gene locus_tag LOCUS_18120 56448 54982 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_18120 57474 56485 gene locus_tag LOCUS_18130 gene ssuD 57474 56485 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_18130 59663 57495 gene locus_tag LOCUS_18140 gene fdhF 59663 57495 CDS product formate dehydrogenase H subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861905.1 protein_id gnl|my_center|LOCUS_18140 60057 59713 gene locus_tag LOCUS_18150 60057 59713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 59956 60183 gene locus_tag LOCUS_18160 59956 60183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 60180 61196 gene locus_tag LOCUS_18170 gene yfmJ 60180 61196 CDS product putative NADP-dependent oxidoreductase YfmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34812 protein_id gnl|my_center|LOCUS_18170 62983 61235 gene locus_tag LOCUS_18180 gene phoD 62983 61235 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_18180 63530 63096 gene locus_tag LOCUS_18190 63530 63096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 63717 65135 gene locus_tag LOCUS_18200 63717 65135 CDS product retinal pigment epithelial membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_18200 65274 66245 gene locus_tag LOCUS_18210 gene acoA 65274 66245 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_18210 66327 67340 gene locus_tag LOCUS_18220 gene acoB 66327 67340 CDS product acetoin catabolism protein AcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_18220 67337 68800 gene locus_tag LOCUS_18230 gene acoC 67337 68800 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK0 protein_id gnl|my_center|LOCUS_18230 68908 69336 gene locus_tag LOCUS_18240 68908 69336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225702.1 protein_id gnl|my_center|LOCUS_18240 69350 70492 gene locus_tag LOCUS_18250 69350 70492 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 protein_id gnl|my_center|LOCUS_18250 70506 71891 gene locus_tag LOCUS_18260 70506 71891 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_18260 71963 72739 gene locus_tag LOCUS_18270 71963 72739 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_18270 72789 73544 gene locus_tag LOCUS_18280 72789 73544 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027173.1 protein_id gnl|my_center|LOCUS_18280 73560 74066 gene locus_tag LOCUS_18290 73560 74066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 74250 74678 gene locus_tag LOCUS_18300 74250 74678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704897.1 protein_id gnl|my_center|LOCUS_18300 75207 74704 gene locus_tag LOCUS_18310 75207 74704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 75352 76131 gene locus_tag LOCUS_18320 75352 76131 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_18320 76210 76722 gene locus_tag LOCUS_18330 76210 76722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 78272 76746 gene locus_tag LOCUS_18340 78272 76746 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_18340 78580 78341 gene locus_tag LOCUS_18350 78580 78341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 78595 79527 gene locus_tag LOCUS_18360 78595 79527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_012228.2 protein_id gnl|my_center|LOCUS_18360 79524 80522 gene locus_tag LOCUS_18370 79524 80522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 81351 80611 gene locus_tag LOCUS_18380 81351 80611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 81696 82658 gene locus_tag LOCUS_18390 81696 82658 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_18390 82872 83765 gene locus_tag LOCUS_18400 82872 83765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 83831 84640 gene locus_tag LOCUS_18410 83831 84640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 84946 86565 gene locus_tag LOCUS_18420 84946 86565 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_18420 87962 86586 gene locus_tag LOCUS_18430 87962 86586 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 protein_id gnl|my_center|LOCUS_18430 88655 87966 gene locus_tag LOCUS_18440 gene cpxR 88655 87966 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_18440 88902 89345 gene locus_tag LOCUS_18450 88902 89345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 92433 89482 gene locus_tag LOCUS_18460 gene preP2 92433 89482 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_18460 93297 92521 gene locus_tag LOCUS_18470 93297 92521 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_18470 95327 93312 gene locus_tag LOCUS_18480 gene mnmC 95327 93312 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_18480 96370 95324 gene locus_tag LOCUS_18490 96370 95324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 98181 96442 gene locus_tag LOCUS_18500 98181 96442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 98295 98798 gene locus_tag LOCUS_18510 98295 98798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 99271 98795 gene locus_tag LOCUS_18520 99271 98795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_18520 99359 103117 gene locus_tag LOCUS_18530 99359 103117 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_18530 103300 103617 gene locus_tag LOCUS_18540 103300 103617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091625.1 protein_id gnl|my_center|LOCUS_18540 103696 104481 gene locus_tag LOCUS_18550 103696 104481 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_18550 104474 105223 gene locus_tag LOCUS_18560 104474 105223 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_18560 105303 106031 gene locus_tag LOCUS_18570 105303 106031 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_18570 106174 107358 gene locus_tag LOCUS_18580 106174 107358 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_18580 107351 107842 gene locus_tag LOCUS_18590 107351 107842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_18590 108284 107844 gene locus_tag LOCUS_18600 108284 107844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105839.1 protein_id gnl|my_center|LOCUS_18600 109234 108281 gene locus_tag LOCUS_18610 gene tal 109234 108281 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY9 protein_id gnl|my_center|LOCUS_18610 110236 109247 gene locus_tag LOCUS_18620 gene dusA 110236 109247 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAJ0 protein_id gnl|my_center|LOCUS_18620 110640 111332 gene locus_tag LOCUS_18630 110640 111332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 112065 111319 gene locus_tag LOCUS_18640 112065 111319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 112657 112049 gene locus_tag LOCUS_18650 gene pnuC 112657 112049 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_18650 112716 113516 gene locus_tag LOCUS_18660 112716 113516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 115694 113538 gene locus_tag LOCUS_18670 115694 113538 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_18670 115989 116858 gene locus_tag LOCUS_18680 115989 116858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702031.1 protein_id gnl|my_center|LOCUS_18680 116975 118465 gene locus_tag LOCUS_18690 gene gltX 116975 118465 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C8 protein_id gnl|my_center|LOCUS_18690 118469 119221 gene locus_tag LOCUS_18700 118469 119221 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_18700 119749 119267 gene locus_tag LOCUS_18710 119749 119267 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_18710 120158 121630 gene locus_tag LOCUS_18720 120158 121630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 121636 122301 gene locus_tag LOCUS_18730 121636 122301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 122689 122315 gene locus_tag LOCUS_18740 122689 122315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 122890 122965 gene locus_tag LOCUS_t00190 122890 122965 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 123263 123628 gene locus_tag LOCUS_18750 123263 123628 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_18750 123779 124150 gene locus_tag LOCUS_18760 123779 124150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205353.1 protein_id gnl|my_center|LOCUS_18760 124521 127307 gene locus_tag LOCUS_18770 124521 127307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 127432 128166 gene locus_tag LOCUS_18780 127432 128166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877815.1 protein_id gnl|my_center|LOCUS_18780 128494 130344 gene locus_tag LOCUS_18790 128494 130344 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_18790 130344 130805 gene locus_tag LOCUS_18800 130344 130805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 130805 130957 gene locus_tag LOCUS_18810 130805 130957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_18810 131083 133095 gene locus_tag LOCUS_18820 131083 133095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 133145 134830 gene locus_tag LOCUS_18830 133145 134830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 135316 134939 gene locus_tag LOCUS_18840 135316 134939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 137303 135363 gene locus_tag LOCUS_18850 137303 135363 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 protein_id gnl|my_center|LOCUS_18850 138818 137361 gene locus_tag LOCUS_18860 138818 137361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 139281 140483 gene locus_tag LOCUS_18870 139281 140483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 140548 141933 gene locus_tag LOCUS_18880 140548 141933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 142158 143387 gene locus_tag LOCUS_18890 142158 143387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 144616 143414 gene locus_tag LOCUS_18900 144616 143414 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 protein_id gnl|my_center|LOCUS_18900 144971 147547 gene locus_tag LOCUS_18910 144971 147547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 147614 149209 gene locus_tag LOCUS_18920 147614 149209 CDS product glucose-methanol-choline oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730932.1 protein_id gnl|my_center|LOCUS_18920 149565 155087 gene locus_tag LOCUS_18930 149565 155087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 155264 156166 gene locus_tag LOCUS_18940 155264 156166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 156219 157376 gene locus_tag LOCUS_18950 156219 157376 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_18950 157427 158257 gene locus_tag LOCUS_18960 157427 158257 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067689.1 protein_id gnl|my_center|LOCUS_18960 159858 158293 gene locus_tag LOCUS_18970 159858 158293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 160207 162297 gene locus_tag LOCUS_18980 160207 162297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 162323 164017 gene locus_tag LOCUS_18990 162323 164017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 164530 166059 gene locus_tag LOCUS_19000 164530 166059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 166466 168088 gene locus_tag LOCUS_19010 166466 168088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 168208 168603 gene locus_tag LOCUS_19020 168208 168603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 168609 170738 gene locus_tag LOCUS_19030 168609 170738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 170763 171944 gene locus_tag LOCUS_19040 gene wbpY 170763 171944 CDS product glycosyltransferase WbpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_19040 174732 171970 gene locus_tag LOCUS_19050 gene hepA 174732 171970 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT66 protein_id gnl|my_center|LOCUS_19050 175658 174822 gene locus_tag LOCUS_19060 gene ycfH 175658 174822 CDS product DNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262283.1 protein_id gnl|my_center|LOCUS_19060 176651 175665 gene locus_tag LOCUS_19070 176651 175665 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704340.1 protein_id gnl|my_center|LOCUS_19070 178697 176982 gene locus_tag LOCUS_19080 178697 176982 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGS2 protein_id gnl|my_center|LOCUS_19080 179531 178908 gene locus_tag LOCUS_19090 179531 178908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 181623 179545 gene locus_tag LOCUS_19100 181623 179545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_19100 181754 182416 gene locus_tag LOCUS_19110 181754 182416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 182856 182428 gene locus_tag LOCUS_19120 182856 182428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 183245 183018 gene locus_tag LOCUS_19130 183245 183018 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_19130 186090 183322 gene locus_tag LOCUS_19140 gene valS 186090 183322 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI0 protein_id gnl|my_center|LOCUS_19140 186618 186199 gene locus_tag LOCUS_19150 186618 186199 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552284.1 protein_id gnl|my_center|LOCUS_19150 188108 186615 gene locus_tag LOCUS_19160 gene pepA 188108 186615 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WC3 protein_id gnl|my_center|LOCUS_19160 188663 188202 gene locus_tag LOCUS_19170 188663 188202 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_19170 188770 189459 gene locus_tag LOCUS_19180 188770 189459 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_19180 189470 190840 gene locus_tag LOCUS_19190 189470 190840 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 protein_id gnl|my_center|LOCUS_19190 191659 190847 gene locus_tag LOCUS_19200 191659 190847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 191879 192952 gene locus_tag LOCUS_19210 191879 192952 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_19210 193029 193352 gene locus_tag LOCUS_19220 193029 193352 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 protein_id gnl|my_center|LOCUS_19220 193362 194303 gene locus_tag LOCUS_19230 193362 194303 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ82 protein_id gnl|my_center|LOCUS_19230 195086 194451 gene locus_tag LOCUS_19240 195086 194451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 196342 195557 gene locus_tag LOCUS_19250 196342 195557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 196449 197312 gene locus_tag LOCUS_19260 196449 197312 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_19260 197476 198666 gene locus_tag LOCUS_19270 197476 198666 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_19270 198694 199527 gene locus_tag LOCUS_19280 gene mhpC 198694 199527 CDS product 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK06 protein_id gnl|my_center|LOCUS_19280 199573 200361 gene locus_tag LOCUS_19290 199573 200361 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_19290 200555 201463 gene locus_tag LOCUS_19300 200555 201463 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTR4 protein_id gnl|my_center|LOCUS_19300 201615 202643 gene locus_tag LOCUS_19310 gene mhpE 201615 202643 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6H7 protein_id gnl|my_center|LOCUS_19310 203104 202769 gene locus_tag LOCUS_19320 203104 202769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 203299 203117 gene locus_tag LOCUS_19330 203299 203117 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_19330 205806 203377 gene locus_tag LOCUS_19340 205806 203377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 205913 206929 gene locus_tag LOCUS_19350 gene tas 205913 206929 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023116.1 protein_id gnl|my_center|LOCUS_19350 207035 207757 gene locus_tag LOCUS_19360 207035 207757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 207900 208166 gene locus_tag LOCUS_19370 207900 208166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 209206 208523 gene locus_tag LOCUS_19380 209206 208523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence08 632 210 gene locus_tag LOCUS_19390 632 210 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188543.1 protein_id gnl|my_center|LOCUS_19390 1907 1032 gene locus_tag LOCUS_19400 1907 1032 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_19400 2706 2008 gene locus_tag LOCUS_19410 2706 2008 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_19410 4196 2703 gene locus_tag LOCUS_19420 4196 2703 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNU9 protein_id gnl|my_center|LOCUS_19420 4415 4774 gene locus_tag LOCUS_19430 4415 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4944 6224 gene locus_tag LOCUS_19440 gene lipL 4944 6224 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_19440 6322 7077 gene locus_tag LOCUS_19450 6322 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7440 8405 gene locus_tag LOCUS_19460 gene exoM 7440 8405 CDS product succinoglycan biosynthesis protein ExoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887909.1 protein_id gnl|my_center|LOCUS_19460 9682 8456 gene locus_tag LOCUS_19470 9682 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 10353 9679 gene locus_tag LOCUS_19480 10353 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 10405 10623 gene locus_tag LOCUS_19490 10405 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 11705 10773 gene locus_tag LOCUS_19500 11705 10773 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708333.1 protein_id gnl|my_center|LOCUS_19500 12348 11716 gene locus_tag LOCUS_19510 12348 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 13303 12317 gene locus_tag LOCUS_19520 13303 12317 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_19520 14116 13379 gene locus_tag LOCUS_19530 14116 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 16092 14314 gene locus_tag LOCUS_19540 16092 14314 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640207.1 protein_id gnl|my_center|LOCUS_19540 17036 18121 gene locus_tag LOCUS_19550 17036 18121 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 protein_id gnl|my_center|LOCUS_19550 18124 18942 gene locus_tag LOCUS_19560 18124 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_19560 19879 18968 gene locus_tag LOCUS_19570 19879 18968 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_19570 21158 19908 gene locus_tag LOCUS_19580 gene murA 21158 19908 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_19580 22363 21158 gene locus_tag LOCUS_19590 22363 21158 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_19590 22664 22422 gene locus_tag LOCUS_19600 22664 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248104.1 protein_id gnl|my_center|LOCUS_19600 22757 23788 gene locus_tag LOCUS_19610 22757 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 25513 23771 gene locus_tag LOCUS_19620 25513 23771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_19620 26647 25577 gene locus_tag LOCUS_19630 26647 25577 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387073.1 protein_id gnl|my_center|LOCUS_19630 27711 26644 gene locus_tag LOCUS_19640 27711 26644 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779635.1 protein_id gnl|my_center|LOCUS_19640 27843 28784 gene locus_tag LOCUS_19650 27843 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 28787 29881 gene locus_tag LOCUS_19660 28787 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 30211 29990 gene locus_tag LOCUS_19670 30211 29990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 30286 30570 gene locus_tag LOCUS_19680 30286 30570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 30809 30567 gene locus_tag LOCUS_19690 30809 30567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 30730 32454 gene locus_tag LOCUS_19700 gene atsA 30730 32454 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_19700 32470 34395 gene locus_tag LOCUS_19710 32470 34395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_19710 34701 35522 gene locus_tag LOCUS_19720 34701 35522 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 protein_id gnl|my_center|LOCUS_19720 35689 37995 gene locus_tag LOCUS_19730 gene fyuA 35689 37995 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_19730 38171 39070 gene locus_tag LOCUS_19740 38171 39070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 protein_id gnl|my_center|LOCUS_19740 39479 39096 gene locus_tag LOCUS_19750 39479 39096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 40369 39485 gene locus_tag LOCUS_19760 40369 39485 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_19760 41385 40366 gene locus_tag LOCUS_19770 41385 40366 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_19770 42597 41422 gene locus_tag LOCUS_19780 42597 41422 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_19780 43414 42644 gene locus_tag LOCUS_19790 43414 42644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 44305 43532 gene locus_tag LOCUS_19800 44305 43532 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227519.1 protein_id gnl|my_center|LOCUS_19800 45247 44348 gene locus_tag LOCUS_19810 45247 44348 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 protein_id gnl|my_center|LOCUS_19810 46096 45263 gene locus_tag LOCUS_19820 gene mhpC 46096 45263 CDS product 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77044 protein_id gnl|my_center|LOCUS_19820 47347 46136 gene locus_tag LOCUS_19830 47347 46136 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_19830 48619 47516 gene locus_tag LOCUS_19840 48619 47516 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731378.1 protein_id gnl|my_center|LOCUS_19840 49286 48660 gene locus_tag LOCUS_19850 49286 48660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 49448 50359 gene locus_tag LOCUS_19860 49448 50359 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061515.1 protein_id gnl|my_center|LOCUS_19860 50356 51294 gene locus_tag LOCUS_19870 50356 51294 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061515.1 protein_id gnl|my_center|LOCUS_19870 52054 51761 gene locus_tag LOCUS_19880 52054 51761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 52233 52048 gene locus_tag LOCUS_19890 52233 52048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 52609 53967 gene locus_tag LOCUS_19900 52609 53967 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803809.1 protein_id gnl|my_center|LOCUS_19900 54765 54082 gene locus_tag LOCUS_19910 gene lolD 54765 54082 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8B8 protein_id gnl|my_center|LOCUS_19910 55961 54762 gene locus_tag LOCUS_19920 gene lolE 55961 54762 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918815.1 protein_id gnl|my_center|LOCUS_19920 57105 55966 gene locus_tag LOCUS_19930 57105 55966 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918814.1 protein_id gnl|my_center|LOCUS_19930 57616 59049 gene locus_tag LOCUS_19940 57616 59049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 60226 59219 gene locus_tag LOCUS_19950 60226 59219 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_19950 61347 60274 gene locus_tag LOCUS_19960 61347 60274 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_19960 64688 61344 gene locus_tag LOCUS_19970 64688 61344 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_19970 64974 64675 gene locus_tag LOCUS_19980 64974 64675 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_19980 66038 65151 gene locus_tag LOCUS_19990 66038 65151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 66178 67269 gene locus_tag LOCUS_20000 66178 67269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 68188 67244 gene locus_tag LOCUS_20010 68188 67244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 69261 68308 gene locus_tag LOCUS_20020 69261 68308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 70223 69258 gene locus_tag LOCUS_20030 70223 69258 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_20030 71059 70223 gene locus_tag LOCUS_20040 71059 70223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 71332 72261 gene locus_tag LOCUS_20050 71332 72261 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531352.1 protein_id gnl|my_center|LOCUS_20050 72290 73204 gene locus_tag LOCUS_20060 72290 73204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 73201 73917 gene locus_tag LOCUS_20070 73201 73917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 74030 74629 gene locus_tag LOCUS_20080 74030 74629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 74724 75431 gene locus_tag LOCUS_20090 74724 75431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_20090 76129 75428 gene locus_tag LOCUS_20100 76129 75428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 77604 76129 gene locus_tag LOCUS_20110 77604 76129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 77749 78513 gene locus_tag LOCUS_20120 77749 78513 CDS product putative short-chain type dehydrogenase/reductase y4lA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55541 protein_id gnl|my_center|LOCUS_20120 78535 78996 gene locus_tag LOCUS_20130 78535 78996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 79732 79025 gene locus_tag LOCUS_20140 79732 79025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 protein_id gnl|my_center|LOCUS_20140 80434 79814 gene locus_tag LOCUS_20150 80434 79814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 81711 80452 gene locus_tag LOCUS_20160 81711 80452 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729321.1 protein_id gnl|my_center|LOCUS_20160 81869 82738 gene locus_tag LOCUS_20170 gene tauD 81869 82738 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_20170 82846 83439 gene locus_tag LOCUS_20180 82846 83439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 83596 84960 gene locus_tag LOCUS_20190 83596 84960 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880721.1 protein_id gnl|my_center|LOCUS_20190 85214 84945 gene locus_tag LOCUS_20200 85214 84945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957680.1 protein_id gnl|my_center|LOCUS_20200 85300 86562 gene locus_tag LOCUS_20210 85300 86562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_20210 86684 86968 gene locus_tag LOCUS_20220 86684 86968 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_20220 87093 88475 gene locus_tag LOCUS_20230 87093 88475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_20230 88591 90246 gene locus_tag LOCUS_20240 88591 90246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_20240 90883 90179 gene locus_tag LOCUS_20250 gene wlbG 90883 90179 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807105.1 protein_id gnl|my_center|LOCUS_20250 91805 90888 gene locus_tag LOCUS_20260 gene menA 91805 90888 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKA0 protein_id gnl|my_center|LOCUS_20260 93822 91900 gene locus_tag LOCUS_20270 93822 91900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 94189 93959 gene locus_tag LOCUS_20280 94189 93959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 95926 94205 gene locus_tag LOCUS_20290 95926 94205 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073382.1 protein_id gnl|my_center|LOCUS_20290 96384 96572 gene locus_tag LOCUS_20300 96384 96572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 97769 96603 gene locus_tag LOCUS_20310 gene nspC 97769 96603 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A53 protein_id gnl|my_center|LOCUS_20310 98999 97788 gene locus_tag LOCUS_20320 98999 97788 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_20320 100961 99015 gene locus_tag LOCUS_20330 gene speA 100961 99015 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F01 protein_id gnl|my_center|LOCUS_20330 101354 101578 gene locus_tag LOCUS_20340 101354 101578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379415.1 protein_id gnl|my_center|LOCUS_20340 101730 103241 gene locus_tag LOCUS_20350 101730 103241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 103277 104014 gene locus_tag LOCUS_20360 103277 104014 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_20360 106047 104011 gene locus_tag LOCUS_20370 106047 104011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 107238 106270 gene locus_tag LOCUS_20380 107238 106270 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267558.1 protein_id gnl|my_center|LOCUS_20380 107523 108371 gene locus_tag LOCUS_20390 107523 108371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 109430 108426 gene locus_tag LOCUS_20400 109430 108426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 110106 109492 gene locus_tag LOCUS_20410 110106 109492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 111262 110186 gene locus_tag LOCUS_20420 111262 110186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 111947 111327 gene locus_tag LOCUS_20430 111947 111327 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_20430 112125 112553 gene locus_tag LOCUS_20440 112125 112553 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 protein_id gnl|my_center|LOCUS_20440 112705 113829 gene locus_tag LOCUS_20450 gene acrA 112705 113829 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263944.1 protein_id gnl|my_center|LOCUS_20450 113833 116976 gene locus_tag LOCUS_20460 gene acrF 113833 116976 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263943.1 protein_id gnl|my_center|LOCUS_20460 119532 117535 gene locus_tag LOCUS_20470 gene rep 119532 117535 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ8 protein_id gnl|my_center|LOCUS_20470 119965 119537 gene locus_tag LOCUS_20480 119965 119537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 120239 119958 gene locus_tag LOCUS_20490 120239 119958 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_20490 121845 120475 gene locus_tag LOCUS_20500 121845 120475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_20500 123219 121963 gene locus_tag LOCUS_20510 123219 121963 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224422.1 protein_id gnl|my_center|LOCUS_20510 125236 123425 gene locus_tag LOCUS_20520 125236 123425 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096801.1 protein_id gnl|my_center|LOCUS_20520 128869 125240 gene locus_tag LOCUS_20530 128869 125240 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 protein_id gnl|my_center|LOCUS_20530 129534 128896 gene locus_tag LOCUS_20540 129534 128896 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_20540 130290 129568 gene locus_tag LOCUS_20550 130290 129568 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 protein_id gnl|my_center|LOCUS_20550 131453 130545 gene locus_tag LOCUS_20560 131453 130545 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_20560 132426 131458 gene locus_tag LOCUS_20570 132426 131458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 133482 132490 gene locus_tag LOCUS_20580 133482 132490 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_20580 135346 133841 gene locus_tag LOCUS_20590 135346 133841 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_20590 135672 135409 gene locus_tag LOCUS_20600 135672 135409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096478.1 protein_id gnl|my_center|LOCUS_20600 135982 136716 gene locus_tag LOCUS_20610 135982 136716 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_20610 136778 137116 gene locus_tag LOCUS_20620 gene glnK 136778 137116 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_20620 137150 138394 gene locus_tag LOCUS_20630 gene amtB 137150 138394 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_20630 138521 138727 gene locus_tag LOCUS_20640 138521 138727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 139234 139809 gene locus_tag LOCUS_20650 139234 139809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 139936 140556 gene locus_tag LOCUS_20660 139936 140556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 140540 141172 gene locus_tag LOCUS_20670 140540 141172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 141169 142203 gene locus_tag LOCUS_20680 141169 142203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 142200 142700 gene locus_tag LOCUS_20690 142200 142700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 142766 146629 gene locus_tag LOCUS_20700 142766 146629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 146629 147081 gene locus_tag LOCUS_20710 gene pilE 146629 147081 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_20710 147105 147416 gene locus_tag LOCUS_20720 147105 147416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 148266 147559 gene locus_tag LOCUS_20730 148266 147559 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_20730 149200 148268 gene locus_tag LOCUS_20740 gene xerC 149200 148268 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUN7 protein_id gnl|my_center|LOCUS_20740 149942 149208 gene locus_tag LOCUS_20750 149942 149208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038590.1 protein_id gnl|my_center|LOCUS_20750 150818 149988 gene locus_tag LOCUS_20760 gene dapF 150818 149988 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 protein_id gnl|my_center|LOCUS_20760 152098 150833 gene locus_tag LOCUS_20770 gene lysA 152098 150833 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_20770 152295 152113 gene locus_tag LOCUS_20780 152295 152113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 152412 152735 gene locus_tag LOCUS_20790 gene cyaY 152412 152735 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B06 protein_id gnl|my_center|LOCUS_20790 152716 153744 gene locus_tag LOCUS_20800 152716 153744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_20800 155172 153769 gene locus_tag LOCUS_20810 gene argH 155172 153769 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_20810 155579 156511 gene locus_tag LOCUS_20820 gene hemC 155579 156511 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60169 protein_id gnl|my_center|LOCUS_20820 156501 157292 gene locus_tag LOCUS_20830 gene hemD 156501 157292 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48246 protein_id gnl|my_center|LOCUS_20830 157297 158427 gene locus_tag LOCUS_20840 157297 158427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 158430 159668 gene locus_tag LOCUS_20850 158430 159668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_20850 161177 159693 gene locus_tag LOCUS_20860 gene ubiD 161177 159693 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV3 protein_id gnl|my_center|LOCUS_20860 162518 161250 gene locus_tag LOCUS_20870 gene rho 162518 161250 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_20870 163079 162753 gene locus_tag LOCUS_20880 gene trxA 163079 162753 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_20880 163484 164137 gene locus_tag LOCUS_20890 163484 164137 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_20890 164142 164396 gene locus_tag LOCUS_20900 164142 164396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20900 166299 164416 gene locus_tag LOCUS_20910 166299 164416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_20910 166552 167019 gene locus_tag LOCUS_20920 166552 167019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390539.1 protein_id gnl|my_center|LOCUS_20920 167215 168033 gene locus_tag LOCUS_20930 gene fkpA 167215 168033 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_20930 168522 168037 gene locus_tag LOCUS_20940 gene rsd 168522 168037 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_20940 169179 168655 gene locus_tag LOCUS_20950 gene dsbB 169179 168655 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_20950 169857 169273 gene locus_tag LOCUS_20960 169857 169273 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 protein_id gnl|my_center|LOCUS_20960 171456 169870 gene locus_tag LOCUS_20970 gene gshA 171456 169870 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_20970 172672 171608 gene locus_tag LOCUS_20980 172672 171608 CDS product putative phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705205.1 protein_id gnl|my_center|LOCUS_20980 172863 173996 gene locus_tag LOCUS_20990 172863 173996 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400837.1 protein_id gnl|my_center|LOCUS_20990 175036 174044 gene locus_tag LOCUS_21000 175036 174044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 175444 175085 gene locus_tag LOCUS_21010 175444 175085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 177808 175460 gene locus_tag LOCUS_21020 177808 175460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 178059 177856 gene locus_tag LOCUS_21030 178059 177856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 179484 178066 gene locus_tag LOCUS_21040 179484 178066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_21040 180450 179497 gene locus_tag LOCUS_21050 180450 179497 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_21050 181516 180506 gene locus_tag LOCUS_21060 gene moaA 181516 180506 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 protein_id gnl|my_center|LOCUS_21060 181629 182999 gene locus_tag LOCUS_21070 181629 182999 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_21070 183691 183212 gene locus_tag LOCUS_21080 183691 183212 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 protein_id gnl|my_center|LOCUS_21080 183743 184402 gene locus_tag LOCUS_21090 183743 184402 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_21090 185042 184362 gene locus_tag LOCUS_21100 gene phaD 185042 184362 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105336.1 protein_id gnl|my_center|LOCUS_21100 185547 185056 gene locus_tag LOCUS_21110 185547 185056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 186188 185700 gene locus_tag LOCUS_21120 186188 185700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 187961 186402 gene locus_tag LOCUS_21130 gene pckA 187961 186402 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 protein_id gnl|my_center|LOCUS_21130 189005 188106 gene locus_tag LOCUS_21140 gene hslO 189005 188106 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 protein_id gnl|my_center|LOCUS_21140 189216 190082 gene locus_tag LOCUS_21150 189216 190082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703184.1 protein_id gnl|my_center|LOCUS_21150 190075 191544 gene locus_tag LOCUS_21160 190075 191544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704555.1 protein_id gnl|my_center|LOCUS_21160 192539 191538 gene locus_tag LOCUS_21170 gene oruR 192539 191538 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_21170 192646 193836 gene locus_tag LOCUS_21180 192646 193836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_21180 194275 194009 gene locus_tag LOCUS_21190 gene rpsT 194275 194009 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_21190 194430 195074 gene locus_tag LOCUS_21200 194430 195074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 195074 196105 gene locus_tag LOCUS_21210 195074 196105 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_21210 196437 196165 gene locus_tag LOCUS_21220 196437 196165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 196778 198010 gene locus_tag LOCUS_21230 196778 198010 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277810.1 protein_id gnl|my_center|LOCUS_21230 198004 200130 gene locus_tag LOCUS_21240 gene dinG 198004 200130 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402334.1 protein_id gnl|my_center|LOCUS_21240 201396 200134 gene locus_tag LOCUS_21250 201396 200134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 201724 201651 gene locus_tag LOCUS_t00200 201724 201651 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 201888 202214 gene locus_tag LOCUS_21260 201888 202214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_21260 203531 202269 gene locus_tag LOCUS_21270 203531 202269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390840.1 protein_id gnl|my_center|LOCUS_21270 204159 203515 gene locus_tag LOCUS_21280 204159 203515 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_21280 204407 204156 gene locus_tag LOCUS_21290 204407 204156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 protein_id gnl|my_center|LOCUS_21290 204898 204404 gene locus_tag LOCUS_21300 gene flaR 204898 204404 CDS product topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_21300 205385 204945 gene locus_tag LOCUS_21310 205385 204945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 206625 205648 gene locus_tag LOCUS_21320 206625 205648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55520 protein_id gnl|my_center|LOCUS_21320 206811 206629 gene locus_tag LOCUS_21330 206811 206629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence09 197 454 gene locus_tag LOCUS_21340 197 454 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8M1 protein_id gnl|my_center|LOCUS_21340 860 1141 gene locus_tag LOCUS_21350 860 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1143 1400 gene locus_tag LOCUS_21360 1143 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1968 1444 gene locus_tag LOCUS_21370 1968 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2323 3606 gene locus_tag LOCUS_21380 2323 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 3603 3794 gene locus_tag LOCUS_21390 3603 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5767 3791 gene locus_tag LOCUS_21400 5767 3791 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 protein_id gnl|my_center|LOCUS_21400 6006 6386 gene locus_tag LOCUS_21410 6006 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6439 7080 gene locus_tag LOCUS_21420 6439 7080 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228914.1 protein_id gnl|my_center|LOCUS_21420 7171 7557 gene locus_tag LOCUS_21430 7171 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7640 8179 gene locus_tag LOCUS_21440 7640 8179 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_21440 9640 8213 gene locus_tag LOCUS_21450 9640 8213 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453942.1 protein_id gnl|my_center|LOCUS_21450 10038 9823 gene locus_tag LOCUS_21460 10038 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_21460 10511 10053 gene locus_tag LOCUS_21470 10511 10053 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974361.1 protein_id gnl|my_center|LOCUS_21470 11325 10576 gene locus_tag LOCUS_21480 11325 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 12868 11855 gene locus_tag LOCUS_21490 gene holA 12868 11855 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_21490 13440 12868 gene locus_tag LOCUS_21500 gene lptE 13440 12868 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX32 protein_id gnl|my_center|LOCUS_21500 15905 13452 gene locus_tag LOCUS_21510 gene leuS 15905 13452 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVU2 protein_id gnl|my_center|LOCUS_21510 16145 16432 gene locus_tag LOCUS_21520 16145 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 16644 17705 gene locus_tag LOCUS_21530 16644 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 19248 17737 gene locus_tag LOCUS_21540 gene lnt 19248 17737 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZI86 protein_id gnl|my_center|LOCUS_21540 20113 19268 gene locus_tag LOCUS_21550 20113 19268 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_21550 20592 20110 gene locus_tag LOCUS_21560 gene ybeY 20592 20110 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN83 protein_id gnl|my_center|LOCUS_21560 21620 20589 gene locus_tag LOCUS_21570 21620 20589 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_21570 23016 21685 gene locus_tag LOCUS_21580 gene miaB 23016 21685 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 protein_id gnl|my_center|LOCUS_21580 23221 23565 gene locus_tag LOCUS_21590 23221 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_21590 23605 24255 gene locus_tag LOCUS_21600 23605 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 25567 24284 gene locus_tag LOCUS_21610 25567 24284 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_21610 25766 28189 gene locus_tag LOCUS_21620 gene lon 25766 28189 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_21620 29716 28724 gene locus_tag LOCUS_21630 gene cmoB 29716 28724 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 protein_id gnl|my_center|LOCUS_21630 30447 29716 gene locus_tag LOCUS_21640 gene cmoA 30447 29716 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_21640 30604 31434 gene locus_tag LOCUS_21650 30604 31434 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_21650 31727 31527 gene locus_tag LOCUS_21660 31727 31527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 31879 33321 gene locus_tag LOCUS_21670 gene pepD 31879 33321 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_21670 33338 34525 gene locus_tag LOCUS_21680 33338 34525 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNF2 protein_id gnl|my_center|LOCUS_21680 35275 34538 gene locus_tag LOCUS_21690 35275 34538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 37367 35481 gene locus_tag LOCUS_21700 37367 35481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_21700 37583 40846 gene locus_tag LOCUS_21710 gene aefA 37583 40846 CDS product potassium efflux protein KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348034.1 protein_id gnl|my_center|LOCUS_21710 40883 41947 gene locus_tag LOCUS_21720 gene ctaA 40883 41947 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA28 protein_id gnl|my_center|LOCUS_21720 42221 42000 gene locus_tag LOCUS_21730 42221 42000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 43074 42403 gene locus_tag LOCUS_21740 43074 42403 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083679.1 protein_id gnl|my_center|LOCUS_21740 43314 43075 gene locus_tag LOCUS_21750 43314 43075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 43842 44051 gene locus_tag LOCUS_21760 43842 44051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 46056 44101 gene locus_tag LOCUS_21770 46056 44101 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088252.1 protein_id gnl|my_center|LOCUS_21770 47327 46080 gene locus_tag LOCUS_21780 gene pksS 47327 46080 CDS product polyketide biosynthesis cytochrome P450 PksS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31785 protein_id gnl|my_center|LOCUS_21780 48826 47435 gene locus_tag LOCUS_21790 48826 47435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 49981 48827 gene locus_tag LOCUS_21800 49981 48827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 50359 51027 gene locus_tag LOCUS_21810 50359 51027 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814000.1 protein_id gnl|my_center|LOCUS_21810 51583 51008 gene locus_tag LOCUS_21820 51583 51008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 53208 51583 gene locus_tag LOCUS_21830 53208 51583 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881538.1 protein_id gnl|my_center|LOCUS_21830 53824 53198 gene locus_tag LOCUS_21840 53824 53198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21840 54435 53821 gene locus_tag LOCUS_21850 54435 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21850 54853 54494 gene locus_tag LOCUS_21860 54853 54494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 55092 57218 gene locus_tag LOCUS_21870 55092 57218 CDS product fusaric acid resistance family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480180.1 protein_id gnl|my_center|LOCUS_21870 57233 58822 gene locus_tag LOCUS_21880 57233 58822 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462727.1 protein_id gnl|my_center|LOCUS_21880 58815 59027 gene locus_tag LOCUS_21890 58815 59027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 59040 59924 gene locus_tag LOCUS_21900 59040 59924 CDS product fusaric acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480130.1 protein_id gnl|my_center|LOCUS_21900 59949 60605 gene locus_tag LOCUS_21910 59949 60605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106538.1 protein_id gnl|my_center|LOCUS_21910 60633 61712 gene locus_tag LOCUS_21920 60633 61712 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462714.1 protein_id gnl|my_center|LOCUS_21920 61905 63062 gene locus_tag LOCUS_21930 61905 63062 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_21930 63111 63557 gene locus_tag LOCUS_21940 63111 63557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 63639 64016 gene locus_tag LOCUS_21950 63639 64016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 64006 65046 gene locus_tag LOCUS_21960 64006 65046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403058.1 protein_id gnl|my_center|LOCUS_21960 65104 66441 gene locus_tag LOCUS_21970 65104 66441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 66438 66692 gene locus_tag LOCUS_21980 66438 66692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 66732 67442 gene locus_tag LOCUS_21990 66732 67442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 68808 67471 gene locus_tag LOCUS_22000 68808 67471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 69017 70315 gene locus_tag LOCUS_22010 69017 70315 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 protein_id gnl|my_center|LOCUS_22010 72610 70394 gene locus_tag LOCUS_22020 gene fyuA 72610 70394 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_22020 75157 72824 gene locus_tag LOCUS_22030 gene fyuA 75157 72824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_22030 76389 75364 gene locus_tag LOCUS_22040 gene araC 76389 75364 CDS product DNA-binding transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210586.1 protein_id gnl|my_center|LOCUS_22040 76793 78367 gene locus_tag LOCUS_22050 76793 78367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 78798 78379 gene locus_tag LOCUS_22060 78798 78379 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531368.1 protein_id gnl|my_center|LOCUS_22060 79201 78809 gene locus_tag LOCUS_22070 79201 78809 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188348.1 protein_id gnl|my_center|LOCUS_22070 79536 81173 gene locus_tag LOCUS_22080 79536 81173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 81163 83292 gene locus_tag LOCUS_22090 81163 83292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_22090 83467 84192 gene locus_tag LOCUS_22100 83467 84192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 84318 85472 gene locus_tag LOCUS_22110 84318 85472 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_22110 85493 86848 gene locus_tag LOCUS_22120 85493 86848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_22120 86861 87931 gene locus_tag LOCUS_22130 86861 87931 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_22130 88012 91977 gene locus_tag LOCUS_22140 88012 91977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 92357 92001 gene locus_tag LOCUS_22150 92357 92001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 92476 94356 gene locus_tag LOCUS_22160 gene btuB 92476 94356 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP11 protein_id gnl|my_center|LOCUS_22160 94622 96151 gene locus_tag LOCUS_22170 94622 96151 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_22170 97555 96299 gene locus_tag LOCUS_22180 97555 96299 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_22180 98855 97662 gene locus_tag LOCUS_22190 98855 97662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 100614 99055 gene locus_tag LOCUS_22200 gene fadD13 100614 99055 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ37 protein_id gnl|my_center|LOCUS_22200 100874 101233 gene locus_tag LOCUS_22210 100874 101233 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_22210 101395 101631 gene locus_tag LOCUS_22220 101395 101631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 103706 101649 gene locus_tag LOCUS_22230 103706 101649 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705124.1 protein_id gnl|my_center|LOCUS_22230 104153 105658 gene locus_tag LOCUS_22240 104153 105658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_22240 105658 106590 gene locus_tag LOCUS_22250 105658 106590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_22250 106623 107474 gene locus_tag LOCUS_22260 106623 107474 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 protein_id gnl|my_center|LOCUS_22260 108661 107477 gene locus_tag LOCUS_22270 gene purT 108661 107477 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWZ4 protein_id gnl|my_center|LOCUS_22270 109019 108681 gene locus_tag LOCUS_22280 109019 108681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 110927 109146 gene locus_tag LOCUS_22290 gene atsA 110927 109146 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_22290 111308 110931 gene locus_tag LOCUS_22300 111308 110931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 111623 112339 gene locus_tag LOCUS_22310 111623 112339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 112388 113302 gene locus_tag LOCUS_22320 112388 113302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 113295 116345 gene locus_tag LOCUS_22330 113295 116345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 116335 117465 gene locus_tag LOCUS_22340 116335 117465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 117610 118830 gene locus_tag LOCUS_22350 117610 118830 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141933.1 protein_id gnl|my_center|LOCUS_22350 118864 120090 gene locus_tag LOCUS_22360 118864 120090 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103605.1 protein_id gnl|my_center|LOCUS_22360 120300 121304 gene locus_tag LOCUS_22370 120300 121304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021055.1 protein_id gnl|my_center|LOCUS_22370 121439 121813 gene locus_tag LOCUS_22380 121439 121813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 123025 121823 gene locus_tag LOCUS_22390 123025 121823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 123229 123462 gene locus_tag LOCUS_22400 123229 123462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_22400 123664 124740 gene locus_tag LOCUS_22410 123664 124740 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_22410 124763 127624 gene locus_tag LOCUS_22420 gene ptrA 124763 127624 CDS product protease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262338.1 protein_id gnl|my_center|LOCUS_22420 127910 130561 gene locus_tag LOCUS_22430 gene aceE 127910 130561 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_22430 130624 132015 gene locus_tag LOCUS_22440 gene aceF 130624 132015 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59638 protein_id gnl|my_center|LOCUS_22440 133407 132019 gene locus_tag LOCUS_22450 133407 132019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 134032 133430 gene locus_tag LOCUS_22460 134032 133430 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_22460 134306 135496 gene locus_tag LOCUS_22470 gene fabV 134306 135496 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT88 protein_id gnl|my_center|LOCUS_22470 135501 136337 gene locus_tag LOCUS_22480 135501 136337 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_22480 136412 138043 gene locus_tag LOCUS_22490 136412 138043 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_22490 138241 138762 gene locus_tag LOCUS_22500 138241 138762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 141401 138774 gene locus_tag LOCUS_22510 gene ppc 141401 138774 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z307 protein_id gnl|my_center|LOCUS_22510 141845 142858 gene locus_tag LOCUS_22520 141845 142858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 142980 143792 gene locus_tag LOCUS_22530 142980 143792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 145005 143899 gene locus_tag LOCUS_22540 145005 143899 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_22540 148288 145049 gene locus_tag LOCUS_22550 148288 145049 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105275.1 protein_id gnl|my_center|LOCUS_22550 148812 149348 gene locus_tag LOCUS_22560 148812 149348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 149560 151146 gene locus_tag LOCUS_22570 149560 151146 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701348.1 protein_id gnl|my_center|LOCUS_22570 151143 151637 gene locus_tag LOCUS_22580 151143 151637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 151627 152091 gene locus_tag LOCUS_22590 151627 152091 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053852.1 protein_id gnl|my_center|LOCUS_22590 152118 152993 gene locus_tag LOCUS_22600 152118 152993 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_22600 153015 153815 gene locus_tag LOCUS_22610 153015 153815 CDS product putative CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPV9 protein_id gnl|my_center|LOCUS_22610 153831 154910 gene locus_tag LOCUS_22620 153831 154910 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730968.1 protein_id gnl|my_center|LOCUS_22620 154914 155666 gene locus_tag LOCUS_22630 154914 155666 CDS product putative enoyl-CoA hydratase EchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701358.1 protein_id gnl|my_center|LOCUS_22630 155792 156955 gene locus_tag LOCUS_22640 155792 156955 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_22640 156959 158005 gene locus_tag LOCUS_22650 156959 158005 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225246.1 protein_id gnl|my_center|LOCUS_22650 158023 159171 gene locus_tag LOCUS_22660 gene atoB 158023 159171 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_22660 159310 159981 gene locus_tag LOCUS_22670 159310 159981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 160038 160901 gene locus_tag LOCUS_22680 160038 160901 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_22680 160926 162098 gene locus_tag LOCUS_22690 gene acd 160926 162098 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_22690 162109 163311 gene locus_tag LOCUS_22700 gene fadE30 162109 163311 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419340.1 protein_id gnl|my_center|LOCUS_22700 163335 164126 gene locus_tag LOCUS_22710 gene fabG 163335 164126 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_22710 164193 165395 gene locus_tag LOCUS_22720 164193 165395 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 protein_id gnl|my_center|LOCUS_22720 165462 166322 gene locus_tag LOCUS_22730 gene rfbQ 165462 166322 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_22730 166438 167490 gene locus_tag LOCUS_22740 166438 167490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 167808 168821 gene locus_tag LOCUS_22750 167808 168821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 168814 170037 gene locus_tag LOCUS_22760 168814 170037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 171847 170066 gene locus_tag LOCUS_22770 171847 170066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 172495 174192 gene locus_tag LOCUS_22780 172495 174192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 174308 174952 gene locus_tag LOCUS_22790 174308 174952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 175156 176421 gene locus_tag LOCUS_22800 175156 176421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523086.1 protein_id gnl|my_center|LOCUS_22800 176599 177327 gene locus_tag LOCUS_22810 176599 177327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 177341 178330 gene locus_tag LOCUS_22820 177341 178330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 178377 179177 gene locus_tag LOCUS_22830 178377 179177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104686.1 protein_id gnl|my_center|LOCUS_22830 179241 180431 gene locus_tag LOCUS_22840 179241 180431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 181488 180517 gene locus_tag LOCUS_22850 181488 180517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 181676 183160 gene locus_tag LOCUS_22860 181676 183160 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_22860 184238 183165 gene locus_tag LOCUS_22870 gene nadA 184238 183165 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W9 protein_id gnl|my_center|LOCUS_22870 184347 184844 gene locus_tag LOCUS_22880 184347 184844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730963.1 protein_id gnl|my_center|LOCUS_22880 185657 184845 gene locus_tag LOCUS_22890 185657 184845 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700858.1 protein_id gnl|my_center|LOCUS_22890 186058 187764 gene locus_tag LOCUS_22900 186058 187764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 189024 187795 gene locus_tag LOCUS_22910 189024 187795 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943270.1 protein_id gnl|my_center|LOCUS_22910 189210 190976 gene locus_tag LOCUS_22920 189210 190976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 190999 193014 gene locus_tag LOCUS_22930 190999 193014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 193294 193902 gene locus_tag LOCUS_22940 193294 193902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 194146 194817 gene locus_tag LOCUS_22950 194146 194817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 196561 195053 gene locus_tag LOCUS_22960 196561 195053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence10 750 935 gene locus_tag LOCUS_22970 gene rpmB 750 935 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHR2 protein_id gnl|my_center|LOCUS_22970 948 1103 gene locus_tag LOCUS_22980 gene rpmG 948 1103 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BC7 protein_id gnl|my_center|LOCUS_22980 1211 2023 gene locus_tag LOCUS_22990 gene mutM 1211 2023 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L7T2 protein_id gnl|my_center|LOCUS_22990 2094 2447 gene locus_tag LOCUS_23000 2094 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2965 2477 gene locus_tag LOCUS_23010 gene coaD 2965 2477 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM37 protein_id gnl|my_center|LOCUS_23010 3652 3053 gene locus_tag LOCUS_23020 gene yhhF 3652 3053 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32AR8 protein_id gnl|my_center|LOCUS_23020 3731 5290 gene locus_tag LOCUS_23030 gene ftsY 3731 5290 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C1 protein_id gnl|my_center|LOCUS_23030 5287 5952 gene locus_tag LOCUS_23040 gene ftsE 5287 5952 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_23040 5949 6932 gene locus_tag LOCUS_23050 5949 6932 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 protein_id gnl|my_center|LOCUS_23050 7082 7936 gene locus_tag LOCUS_23060 gene rpoH 7082 7936 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM47 protein_id gnl|my_center|LOCUS_23060 7986 8363 gene locus_tag LOCUS_23070 7986 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_23070 8379 9065 gene locus_tag LOCUS_23080 gene trmB 8379 9065 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPV4 protein_id gnl|my_center|LOCUS_23080 10596 9067 gene locus_tag LOCUS_23090 10596 9067 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_23090 12100 10955 gene locus_tag LOCUS_23100 12100 10955 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_23100 12705 12100 gene locus_tag LOCUS_23110 12705 12100 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUQ9 protein_id gnl|my_center|LOCUS_23110 13115 12705 gene locus_tag LOCUS_23120 13115 12705 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073226.1 protein_id gnl|my_center|LOCUS_23120 13737 13147 gene locus_tag LOCUS_23130 gene metW 13737 13147 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 protein_id gnl|my_center|LOCUS_23130 14876 13737 gene locus_tag LOCUS_23140 gene metX 14876 13737 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ78 protein_id gnl|my_center|LOCUS_23140 15481 14894 gene locus_tag LOCUS_23150 15481 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_23150 16323 15487 gene locus_tag LOCUS_23160 gene proC 16323 15487 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_23160 17070 16378 gene locus_tag LOCUS_23170 17070 16378 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24562 protein_id gnl|my_center|LOCUS_23170 17203 18237 gene locus_tag LOCUS_23180 gene pilT 17203 18237 CDS product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 protein_id gnl|my_center|LOCUS_23180 18278 19417 gene locus_tag LOCUS_23190 gene pilU 18278 19417 CDS product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_23190 20510 19479 gene locus_tag LOCUS_23200 20510 19479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 21063 20641 gene locus_tag LOCUS_23210 21063 20641 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I699 protein_id gnl|my_center|LOCUS_23210 21654 21064 gene locus_tag LOCUS_23220 gene algH 21654 21064 CDS product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 protein_id gnl|my_center|LOCUS_23220 22574 21708 gene locus_tag LOCUS_23230 gene tonB3 22574 21708 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_23230 23540 22584 gene locus_tag LOCUS_23240 gene gshB 23540 22584 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I697 protein_id gnl|my_center|LOCUS_23240 23982 25061 gene locus_tag LOCUS_23250 23982 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 25144 25473 gene locus_tag LOCUS_23260 25144 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 25918 26670 gene locus_tag LOCUS_23270 25918 26670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 27014 26667 gene locus_tag LOCUS_23280 27014 26667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 27455 27129 gene locus_tag LOCUS_23290 27455 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 27632 28879 gene locus_tag LOCUS_23300 27632 28879 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224376.1 protein_id gnl|my_center|LOCUS_23300 29620 28886 gene locus_tag LOCUS_23310 29620 28886 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V65 protein_id gnl|my_center|LOCUS_23310 30490 29651 gene locus_tag LOCUS_23320 gene metF 30490 29651 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ87 protein_id gnl|my_center|LOCUS_23320 31893 30502 gene locus_tag LOCUS_23330 gene ahcY 31893 30502 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 protein_id gnl|my_center|LOCUS_23330 33214 32057 gene locus_tag LOCUS_23340 gene metK 33214 32057 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_23340 34254 33244 gene locus_tag LOCUS_23350 34254 33244 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316359.1 protein_id gnl|my_center|LOCUS_23350 34537 36444 gene locus_tag LOCUS_23360 gene tktA 34537 36444 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_23360 36456 37472 gene locus_tag LOCUS_23370 gene epd 36456 37472 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y5 protein_id gnl|my_center|LOCUS_23370 37509 38681 gene locus_tag LOCUS_23380 gene pgk 37509 38681 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD3 protein_id gnl|my_center|LOCUS_23380 38737 39801 gene locus_tag LOCUS_23390 gene fba 38737 39801 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_23390 39798 40772 gene locus_tag LOCUS_23400 39798 40772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_23400 42385 40763 gene locus_tag LOCUS_23410 42385 40763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_23410 44825 42516 gene locus_tag LOCUS_23420 gene fyuA 44825 42516 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 protein_id gnl|my_center|LOCUS_23420 46332 45103 gene locus_tag LOCUS_23430 46332 45103 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269265.1 protein_id gnl|my_center|LOCUS_23430 46463 47860 gene locus_tag LOCUS_23440 46463 47860 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_23440 48326 48048 gene locus_tag LOCUS_23450 48326 48048 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z854 protein_id gnl|my_center|LOCUS_23450 49037 48363 gene locus_tag LOCUS_23460 gene rpiA 49037 48363 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_23460 49200 50735 gene locus_tag LOCUS_23470 gene ilvA1 49200 50735 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_23470 50893 51042 gene locus_tag LOCUS_23480 50893 51042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 51506 51039 gene locus_tag LOCUS_23490 51506 51039 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP94 protein_id gnl|my_center|LOCUS_23490 52203 51889 gene locus_tag LOCUS_23500 gene zapA 52203 51889 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 protein_id gnl|my_center|LOCUS_23500 52409 52209 gene locus_tag LOCUS_23510 52409 52209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 52551 53156 gene locus_tag LOCUS_23520 52551 53156 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW5 protein_id gnl|my_center|LOCUS_23520 53241 54554 gene locus_tag LOCUS_23530 gene pepP 53241 54554 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_23530 54558 55805 gene locus_tag LOCUS_23540 54558 55805 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266319.1 protein_id gnl|my_center|LOCUS_23540 55798 57015 gene locus_tag LOCUS_23550 55798 57015 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_23550 57150 57539 gene locus_tag LOCUS_23560 gene gcvH 57150 57539 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_23560 57576 58757 gene locus_tag LOCUS_23570 57576 58757 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_23570 59539 58886 gene locus_tag LOCUS_23580 59539 58886 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_23580 59697 60158 gene locus_tag LOCUS_23590 gene rppH 59697 60158 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLV2 protein_id gnl|my_center|LOCUS_23590 60165 62429 gene locus_tag LOCUS_23600 60165 62429 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420161.1 protein_id gnl|my_center|LOCUS_23600 63217 62444 gene locus_tag LOCUS_23610 63217 62444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_23610 63351 64169 gene locus_tag LOCUS_23620 gene lgt 63351 64169 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL3 protein_id gnl|my_center|LOCUS_23620 64166 64999 gene locus_tag LOCUS_23630 gene thyA 64166 64999 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG32 protein_id gnl|my_center|LOCUS_23630 65016 65528 gene locus_tag LOCUS_23640 gene folA 65016 65528 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBI9 protein_id gnl|my_center|LOCUS_23640 65777 66562 gene locus_tag LOCUS_23650 65777 66562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 66562 67947 gene locus_tag LOCUS_23660 66562 67947 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_23660 67949 68467 gene locus_tag LOCUS_23670 gene exbB 67949 68467 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_23670 68481 68891 gene locus_tag LOCUS_23680 68481 68891 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_23680 68906 69319 gene locus_tag LOCUS_23690 68906 69319 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_23690 69325 69930 gene locus_tag LOCUS_23700 69325 69930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 69984 71474 gene locus_tag LOCUS_23710 69984 71474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 71803 71567 gene locus_tag LOCUS_23720 71803 71567 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 protein_id gnl|my_center|LOCUS_23720 72992 72027 gene locus_tag LOCUS_23730 gene glk 72992 72027 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L90 protein_id gnl|my_center|LOCUS_23730 74450 73002 gene locus_tag LOCUS_23740 74450 73002 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N36 protein_id gnl|my_center|LOCUS_23740 75714 74725 gene locus_tag LOCUS_23750 gene glpQ 75714 74725 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_23750 76629 75820 gene locus_tag LOCUS_23760 76629 75820 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706605.1 protein_id gnl|my_center|LOCUS_23760 76779 77477 gene locus_tag LOCUS_23770 76779 77477 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085618.1 protein_id gnl|my_center|LOCUS_23770 77733 77470 gene locus_tag LOCUS_23780 77733 77470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481466.1 protein_id gnl|my_center|LOCUS_23780 79222 77762 gene locus_tag LOCUS_23790 gene calB 79222 77762 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A777 protein_id gnl|my_center|LOCUS_23790 79386 79733 gene locus_tag LOCUS_23800 79386 79733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 79844 80245 gene locus_tag LOCUS_23810 79844 80245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_23810 80370 82178 gene locus_tag LOCUS_23820 gene deaD 80370 82178 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7G9 protein_id gnl|my_center|LOCUS_23820 82236 82799 gene locus_tag LOCUS_23830 gene ubiX 82236 82799 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PF2 protein_id gnl|my_center|LOCUS_23830 82848 84044 gene locus_tag LOCUS_23840 82848 84044 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_23840 84113 84877 gene locus_tag LOCUS_23850 gene dhrS4 84113 84877 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_23850 84901 85326 gene locus_tag LOCUS_23860 84901 85326 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016656.1 protein_id gnl|my_center|LOCUS_23860 85331 86332 gene locus_tag LOCUS_23870 85331 86332 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_23870 86925 86341 gene locus_tag LOCUS_23880 86925 86341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 87148 88128 gene locus_tag LOCUS_23890 87148 88128 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064883.1 protein_id gnl|my_center|LOCUS_23890 89009 88125 gene locus_tag LOCUS_23900 89009 88125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_23900 89194 90603 gene locus_tag LOCUS_23910 89194 90603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_23910 90632 91792 gene locus_tag LOCUS_23920 gene ivdC 90632 91792 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_23920 91789 92577 gene locus_tag LOCUS_23930 gene ivdD 91789 92577 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 protein_id gnl|my_center|LOCUS_23930 92578 93702 gene locus_tag LOCUS_23940 gene ivdE 92578 93702 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_23940 93729 94619 gene locus_tag LOCUS_23950 93729 94619 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H47 protein_id gnl|my_center|LOCUS_23950 95808 94642 gene locus_tag LOCUS_23960 95808 94642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 96056 97360 gene locus_tag LOCUS_23970 96056 97360 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_23970 99233 97368 gene locus_tag LOCUS_23980 99233 97368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_23980 99516 99328 gene locus_tag LOCUS_23990 99516 99328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 99755 100558 gene locus_tag LOCUS_24000 99755 100558 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703470.1 protein_id gnl|my_center|LOCUS_24000 101248 100616 gene locus_tag LOCUS_24010 gene ychE 101248 100616 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_24010 102178 101285 gene locus_tag LOCUS_24020 102178 101285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 105036 102175 gene locus_tag LOCUS_24030 105036 102175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 105952 105020 gene locus_tag LOCUS_24040 105952 105020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_24040 106778 106020 gene locus_tag LOCUS_24050 106778 106020 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_24050 108154 106781 gene locus_tag LOCUS_24060 gene gor-1 108154 106781 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766202.1 protein_id gnl|my_center|LOCUS_24060 108318 109367 gene locus_tag LOCUS_24070 108318 109367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 109810 109412 gene locus_tag LOCUS_24080 109810 109412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_24080 110646 109981 gene locus_tag LOCUS_24090 110646 109981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 111426 110749 gene locus_tag LOCUS_24100 gene senC 111426 110749 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 protein_id gnl|my_center|LOCUS_24100 111757 111440 gene locus_tag LOCUS_24110 111757 111440 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709070.1 protein_id gnl|my_center|LOCUS_24110 112447 111767 gene locus_tag LOCUS_24120 gene coxP 112447 111767 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709069.1 protein_id gnl|my_center|LOCUS_24120 113138 112458 gene locus_tag LOCUS_24130 gene coxO 113138 112458 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086564.1 protein_id gnl|my_center|LOCUS_24130 114898 113135 gene locus_tag LOCUS_24140 gene coxN 114898 113135 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH24 protein_id gnl|my_center|LOCUS_24140 116298 114946 gene locus_tag LOCUS_24150 116298 114946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 116948 116376 gene locus_tag LOCUS_24160 116948 116376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082253.1 protein_id gnl|my_center|LOCUS_24160 118243 117245 gene locus_tag LOCUS_24170 118243 117245 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_24170 119461 118307 gene locus_tag LOCUS_24180 119461 118307 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_24180 120160 119537 gene locus_tag LOCUS_24190 120160 119537 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812956.1 protein_id gnl|my_center|LOCUS_24190 120297 121511 gene locus_tag LOCUS_24200 120297 121511 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_24200 121551 122522 gene locus_tag LOCUS_24210 121551 122522 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_24210 122525 123406 gene locus_tag LOCUS_24220 122525 123406 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704647.1 protein_id gnl|my_center|LOCUS_24220 123450 124229 gene locus_tag LOCUS_24230 123450 124229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 124289 125464 gene locus_tag LOCUS_24240 124289 125464 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_24240 125553 126758 gene locus_tag LOCUS_24250 125553 126758 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_24250 126858 127268 gene locus_tag LOCUS_24260 126858 127268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_24260 128357 127281 gene locus_tag LOCUS_24270 128357 127281 CDS product zinc metallohydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_24270 130019 128439 gene locus_tag LOCUS_24280 130019 128439 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 protein_id gnl|my_center|LOCUS_24280 131017 130037 gene locus_tag LOCUS_24290 gene aes 131017 130037 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_24290 131447 131704 gene locus_tag LOCUS_24300 131447 131704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 131806 132690 gene locus_tag LOCUS_24310 131806 132690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 133322 132783 gene locus_tag LOCUS_24320 133322 132783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 134205 133450 gene locus_tag LOCUS_24330 134205 133450 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_24330 135356 134784 gene locus_tag LOCUS_24340 135356 134784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700774.1 protein_id gnl|my_center|LOCUS_24340 137093 135483 gene locus_tag LOCUS_24350 137093 135483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969966.1 protein_id gnl|my_center|LOCUS_24350 137984 137097 gene locus_tag LOCUS_24360 137984 137097 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_24360 138917 137985 gene locus_tag LOCUS_24370 gene oppB 138917 137985 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_24370 140556 138919 gene locus_tag LOCUS_24380 140556 138919 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461499.1 protein_id gnl|my_center|LOCUS_24380 141850 140714 gene locus_tag LOCUS_24390 141850 140714 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_24390 141957 142844 gene locus_tag LOCUS_24400 141957 142844 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246046.1 protein_id gnl|my_center|LOCUS_24400 142846 144456 gene locus_tag LOCUS_24410 142846 144456 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M70 protein_id gnl|my_center|LOCUS_24410 144568 146238 gene locus_tag LOCUS_24420 144568 146238 CDS product putative transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL13 protein_id gnl|my_center|LOCUS_24420 146846 146265 gene locus_tag LOCUS_24430 146846 146265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 147137 147517 gene locus_tag LOCUS_24440 147137 147517 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969026.1 protein_id gnl|my_center|LOCUS_24440 147514 147987 gene locus_tag LOCUS_24450 147514 147987 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_24450 147987 149027 gene locus_tag LOCUS_24460 147987 149027 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_24460 150495 149128 gene locus_tag LOCUS_24470 150495 149128 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269274.1 protein_id gnl|my_center|LOCUS_24470 150683 151612 gene locus_tag LOCUS_24480 150683 151612 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393578.1 protein_id gnl|my_center|LOCUS_24480 151645 152829 gene locus_tag LOCUS_24490 gene gcdH 151645 152829 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_24490 152842 153048 gene locus_tag LOCUS_24500 152842 153048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 153960 153148 gene locus_tag LOCUS_24510 153960 153148 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 protein_id gnl|my_center|LOCUS_24510 155256 154168 gene locus_tag LOCUS_24520 155256 154168 CDS product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 protein_id gnl|my_center|LOCUS_24520 156688 155357 gene locus_tag LOCUS_24530 156688 155357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_24530 157617 156685 gene locus_tag LOCUS_24540 157617 156685 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888088.1 protein_id gnl|my_center|LOCUS_24540 158489 157656 gene locus_tag LOCUS_24550 158489 157656 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707427.1 protein_id gnl|my_center|LOCUS_24550 159495 158491 gene locus_tag LOCUS_24560 gene gpsA 159495 158491 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA8 protein_id gnl|my_center|LOCUS_24560 161874 159520 gene locus_tag LOCUS_24570 gene plsB 161874 159520 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI61 protein_id gnl|my_center|LOCUS_24570 163586 161871 gene locus_tag LOCUS_24580 163586 161871 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 protein_id gnl|my_center|LOCUS_24580 164856 163996 gene locus_tag LOCUS_24590 164856 163996 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920118.1 protein_id gnl|my_center|LOCUS_24590 165051 166046 gene locus_tag LOCUS_24600 gene hpnA 165051 166046 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_24600 167195 166062 gene locus_tag LOCUS_24610 167195 166062 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701366.1 protein_id gnl|my_center|LOCUS_24610 168389 167208 gene locus_tag LOCUS_24620 gene fadE26 168389 167208 CDS product acyl-CoA dehydrogenase FadE26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6YCA3 protein_id gnl|my_center|LOCUS_24620 169479 168469 gene locus_tag LOCUS_24630 169479 168469 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_24630 169646 169476 gene locus_tag LOCUS_24640 169646 169476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 169682 169758 gene locus_tag LOCUS_t00210 169682 169758 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 169892 171883 gene locus_tag LOCUS_24650 169892 171883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 172209 173432 gene locus_tag LOCUS_24660 172209 173432 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_24660 174849 173488 gene locus_tag LOCUS_24670 gene nhaA 174849 173488 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 protein_id gnl|my_center|LOCUS_24670 176502 174883 gene locus_tag LOCUS_24680 176502 174883 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682296.1 protein_id gnl|my_center|LOCUS_24680 178123 176645 gene locus_tag LOCUS_24690 178123 176645 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MQ0 protein_id gnl|my_center|LOCUS_24690 178328 180229 gene locus_tag LOCUS_24700 178328 180229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703697.1 protein_id gnl|my_center|LOCUS_24700 180786 180226 gene locus_tag LOCUS_24710 180786 180226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266302.1 protein_id gnl|my_center|LOCUS_24710 181178 180852 gene locus_tag LOCUS_24720 181178 180852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073750.1 protein_id gnl|my_center|LOCUS_24720 181545 181273 gene locus_tag LOCUS_24730 181545 181273 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140124.1 protein_id gnl|my_center|LOCUS_24730 181700 181999 gene locus_tag LOCUS_24740 181700 181999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 182148 182318 gene locus_tag LOCUS_24750 182148 182318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 184323 182332 gene locus_tag LOCUS_24760 gene atuF 184323 182332 CDS product geranyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_24760 185147 184338 gene locus_tag LOCUS_24770 gene atuE 185147 184338 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_24770 186801 185179 gene locus_tag LOCUS_24780 186801 185179 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544675.1 protein_id gnl|my_center|LOCUS_24780 188615 186798 gene locus_tag LOCUS_24790 gene atuA 188615 186798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_24790 189946 188738 gene locus_tag LOCUS_24800 189946 188738 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509587.1 protein_id gnl|my_center|LOCUS_24800 190243 190476 gene locus_tag LOCUS_24810 190243 190476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 190500 192338 gene locus_tag LOCUS_24820 190500 192338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 192604 192356 gene locus_tag LOCUS_24830 192604 192356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 193171 192665 gene locus_tag LOCUS_24840 193171 192665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 194098 193286 gene locus_tag LOCUS_24850 gene uspE 194098 193286 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261910.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence11 <1 581 gene locus_tag LOCUS_24860 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040515.1:CoA transferase 1104 574 gene locus_tag LOCUS_24870 1104 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2386 1253 gene locus_tag LOCUS_24880 2386 1253 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225711.1 protein_id gnl|my_center|LOCUS_24880 2740 4875 gene locus_tag LOCUS_24890 2740 4875 CDS product 9-hexadecenoic acid cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263450.1 protein_id gnl|my_center|LOCUS_24890 4902 5411 gene locus_tag LOCUS_24900 gene aroK 4902 5411 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4Z3 protein_id gnl|my_center|LOCUS_24900 5447 5902 gene locus_tag LOCUS_24910 5447 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 5927 6115 gene locus_tag LOCUS_24920 5927 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 6036 6470 gene locus_tag LOCUS_24930 6036 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 7802 6573 gene locus_tag LOCUS_24940 7802 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 7744 8091 gene locus_tag LOCUS_24950 7744 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 9871 8117 gene locus_tag LOCUS_24960 9871 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 10714 9962 gene locus_tag LOCUS_24970 10714 9962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939681.1 protein_id gnl|my_center|LOCUS_24970 11342 10806 gene locus_tag LOCUS_24980 gene yaiL 11342 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_24980 11496 12434 gene locus_tag LOCUS_24990 11496 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 13773 12406 gene locus_tag LOCUS_25000 13773 12406 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L9 protein_id gnl|my_center|LOCUS_25000 13990 14340 gene locus_tag LOCUS_25010 13990 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 16137 14356 gene locus_tag LOCUS_25020 gene ampP 16137 14356 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 protein_id gnl|my_center|LOCUS_25020 16423 16244 gene locus_tag LOCUS_25030 gene rubA 16423 16244 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH74 protein_id gnl|my_center|LOCUS_25030 17209 16460 gene locus_tag LOCUS_25040 17209 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 17684 17211 gene locus_tag LOCUS_25050 17684 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 18883 17681 gene locus_tag LOCUS_25060 gene gspL 18883 17681 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFT4 protein_id gnl|my_center|LOCUS_25060 19920 18946 gene locus_tag LOCUS_25070 gene gspK 19920 18946 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Y4 protein_id gnl|my_center|LOCUS_25070 20632 19979 gene locus_tag LOCUS_25080 gene xcpW 20632 19979 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 protein_id gnl|my_center|LOCUS_25080 21174 20671 gene locus_tag LOCUS_25090 21174 20671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 21704 21174 gene locus_tag LOCUS_25100 21704 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 22338 21904 gene locus_tag LOCUS_25110 gene epsG 22338 21904 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45773 protein_id gnl|my_center|LOCUS_25110 23562 22342 gene locus_tag LOCUS_25120 gene xcpS 23562 22342 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_25120 25120 23594 gene locus_tag LOCUS_25130 25120 23594 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 protein_id gnl|my_center|LOCUS_25130 27141 25117 gene locus_tag LOCUS_25140 gene xcpQ 27141 25117 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_25140 28193 27168 gene locus_tag LOCUS_25150 gene epsC 28193 27168 CDS product type II secretion system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45777 protein_id gnl|my_center|LOCUS_25150 30174 28402 gene locus_tag LOCUS_25160 30174 28402 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 protein_id gnl|my_center|LOCUS_25160 30304 30229 gene locus_tag LOCUS_t00220 30304 30229 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30567 30391 gene locus_tag LOCUS_25170 30567 30391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 31182 30655 gene locus_tag LOCUS_25180 31182 30655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 31829 31185 gene locus_tag LOCUS_25190 31829 31185 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_25190 32981 31839 gene locus_tag LOCUS_25200 32981 31839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 33092 33979 gene locus_tag LOCUS_25210 33092 33979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 34477 33995 gene locus_tag LOCUS_25220 34477 33995 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW11 protein_id gnl|my_center|LOCUS_25220 34582 35913 gene locus_tag LOCUS_25230 34582 35913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 36126 37130 gene locus_tag LOCUS_25240 36126 37130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 37251 39422 gene locus_tag LOCUS_25250 37251 39422 CDS product putative molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704598.1 protein_id gnl|my_center|LOCUS_25250 39501 40397 gene locus_tag LOCUS_25260 gene panE 39501 40397 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW09 protein_id gnl|my_center|LOCUS_25260 40387 41052 gene locus_tag LOCUS_25270 40387 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 42490 41054 gene locus_tag LOCUS_25280 42490 41054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 44062 42500 gene locus_tag LOCUS_25290 44062 42500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 44730 44179 gene locus_tag LOCUS_25300 gene ampD 44730 44179 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_25300 44912 45766 gene locus_tag LOCUS_25310 gene nadC 44912 45766 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 protein_id gnl|my_center|LOCUS_25310 46342 45794 gene locus_tag LOCUS_25320 46342 45794 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 protein_id gnl|my_center|LOCUS_25320 46458 47432 gene locus_tag LOCUS_25330 gene nahR 46458 47432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_25330 47556 49736 gene locus_tag LOCUS_25340 gene glcB 47556 49736 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_25340 50344 49841 gene locus_tag LOCUS_25350 gene pilE 50344 49841 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_25350 51550 50669 gene locus_tag LOCUS_25360 51550 50669 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_25360 53388 51586 gene locus_tag LOCUS_25370 53388 51586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 55445 53511 gene locus_tag LOCUS_25380 55445 53511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 56062 55568 gene locus_tag LOCUS_25390 gene pilE 56062 55568 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_25390 56594 57097 gene locus_tag LOCUS_25400 56594 57097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 57128 57586 gene locus_tag LOCUS_25410 gene pilE 57128 57586 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_25410 57747 59468 gene locus_tag LOCUS_25420 gene pilB 57747 59468 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_25420 59528 60748 gene locus_tag LOCUS_25430 gene pilC 59528 60748 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_25430 60797 61645 gene locus_tag LOCUS_25440 gene gspO 60797 61645 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPV9 protein_id gnl|my_center|LOCUS_25440 61642 62247 gene locus_tag LOCUS_25450 gene coaE 61642 62247 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVP8 protein_id gnl|my_center|LOCUS_25450 62745 62344 gene locus_tag LOCUS_25460 62745 62344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 63984 62746 gene locus_tag LOCUS_25470 gene argJ 63984 62746 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ9 protein_id gnl|my_center|LOCUS_25470 66711 64003 gene locus_tag LOCUS_25480 gene secA 66711 64003 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_25480 67721 66792 gene locus_tag LOCUS_25490 67721 66792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_25490 69181 68009 gene locus_tag LOCUS_25500 gene ftsZ 69181 68009 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47204 protein_id gnl|my_center|LOCUS_25500 70515 69259 gene locus_tag LOCUS_25510 gene ftsA 70515 69259 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ4 protein_id gnl|my_center|LOCUS_25510 71343 70534 gene locus_tag LOCUS_25520 gene ftsQ 71343 70534 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY8 protein_id gnl|my_center|LOCUS_25520 72355 71432 gene locus_tag LOCUS_25530 gene ddlB 72355 71432 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_25530 73791 72352 gene locus_tag LOCUS_25540 gene murC 73791 72352 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_25540 74884 73784 gene locus_tag LOCUS_25550 gene murG 74884 73784 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW01 protein_id gnl|my_center|LOCUS_25550 76035 74881 gene locus_tag LOCUS_25560 gene ftsW 76035 74881 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY4 protein_id gnl|my_center|LOCUS_25560 77390 76032 gene locus_tag LOCUS_25570 gene murD 77390 76032 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_25570 78485 77403 gene locus_tag LOCUS_25580 gene mraY 78485 77403 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_25580 79852 78488 gene locus_tag LOCUS_25590 gene murF 79852 78488 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_25590 81318 79852 gene locus_tag LOCUS_25600 gene murE 81318 79852 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F28 protein_id gnl|my_center|LOCUS_25600 83039 81342 gene locus_tag LOCUS_25610 gene ftsI 83039 81342 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_25610 83395 83072 gene locus_tag LOCUS_25620 83395 83072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 84334 83417 gene locus_tag LOCUS_25630 gene rsmH 84334 83417 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX19 protein_id gnl|my_center|LOCUS_25630 84799 84344 gene locus_tag LOCUS_25640 gene mraZ 84799 84344 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_25640 86535 85699 gene locus_tag LOCUS_25650 gene rsmI 86535 85699 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK05 protein_id gnl|my_center|LOCUS_25650 86832 88484 gene locus_tag LOCUS_25660 86832 88484 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_25660 88530 88889 gene locus_tag LOCUS_25670 88530 88889 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ1 protein_id gnl|my_center|LOCUS_25670 88911 89510 gene locus_tag LOCUS_25680 gene gmhA 88911 89510 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_25680 89514 90086 gene locus_tag LOCUS_25690 89514 90086 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_25690 90530 90144 gene locus_tag LOCUS_25700 gene sspB 90530 90144 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_25700 91205 90573 gene locus_tag LOCUS_25710 91205 90573 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 protein_id gnl|my_center|LOCUS_25710 93326 91287 gene locus_tag LOCUS_25720 93326 91287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 93919 93326 gene locus_tag LOCUS_25730 93919 93326 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_25730 94581 94189 gene locus_tag LOCUS_25740 gene rpsI 94581 94189 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_25740 95024 94596 gene locus_tag LOCUS_25750 gene rplM 95024 94596 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_25750 96308 95208 gene locus_tag LOCUS_25760 gene zapE 96308 95208 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_25760 96581 97042 gene locus_tag LOCUS_25770 96581 97042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 97827 97060 gene locus_tag LOCUS_25780 97827 97060 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX2 protein_id gnl|my_center|LOCUS_25780 97928 99055 gene locus_tag LOCUS_25790 97928 99055 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_25790 100407 99091 gene locus_tag LOCUS_25800 gene hisD 100407 99091 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_25800 101053 100394 gene locus_tag LOCUS_25810 gene hisG 101053 100394 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV4 protein_id gnl|my_center|LOCUS_25810 101387 101142 gene locus_tag LOCUS_25820 101387 101142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306001.1 protein_id gnl|my_center|LOCUS_25820 102158 101526 gene locus_tag LOCUS_25830 102158 101526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 102382 103356 gene locus_tag LOCUS_25840 102382 103356 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_25840 103371 104351 gene locus_tag LOCUS_25850 gene kdsD 103371 104351 CDS product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 protein_id gnl|my_center|LOCUS_25850 104369 105040 gene locus_tag LOCUS_25860 104369 105040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 105018 105743 gene locus_tag LOCUS_25870 105018 105743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_25870 105921 107414 gene locus_tag LOCUS_25880 gene rpoN 105921 107414 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WU0 protein_id gnl|my_center|LOCUS_25880 107487 107774 gene locus_tag LOCUS_25890 gene yfiA-2 107487 107774 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_25890 107785 108243 gene locus_tag LOCUS_25900 gene ptsN 107785 108243 CDS product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 protein_id gnl|my_center|LOCUS_25900 108259 109113 gene locus_tag LOCUS_25910 108259 109113 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_25910 109126 109395 gene locus_tag LOCUS_25920 gene ptsH 109126 109395 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_25920 109495 110847 gene locus_tag LOCUS_25930 109495 110847 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_25930 110840 111373 gene locus_tag LOCUS_25940 110840 111373 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP43 protein_id gnl|my_center|LOCUS_25940 115383 111355 gene locus_tag LOCUS_25950 115383 111355 CDS product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_25950 116888 115410 gene locus_tag LOCUS_25960 gene cafA 116888 115410 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_25960 117516 116899 gene locus_tag LOCUS_25970 117516 116899 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0J8 protein_id gnl|my_center|LOCUS_25970 118006 117518 gene locus_tag LOCUS_25980 gene mreD 118006 117518 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 protein_id gnl|my_center|LOCUS_25980 118801 118010 gene locus_tag LOCUS_25990 118801 118010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 119984 118947 gene locus_tag LOCUS_26000 gene mreB 119984 118947 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_26000 120213 120500 gene locus_tag LOCUS_26010 gene gatC 120213 120500 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_26010 120530 121996 gene locus_tag LOCUS_26020 gene gatA 120530 121996 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_26020 121996 123447 gene locus_tag LOCUS_26030 gene gatB 121996 123447 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT7 protein_id gnl|my_center|LOCUS_26030 123452 123742 gene locus_tag LOCUS_26040 123452 123742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 124439 123828 gene locus_tag LOCUS_26050 124439 123828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_26050 124703 125425 gene locus_tag LOCUS_26060 gene cysZ 124703 125425 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF4 protein_id gnl|my_center|LOCUS_26060 126829 125414 gene locus_tag LOCUS_26070 gene rhlB 126829 125414 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 protein_id gnl|my_center|LOCUS_26070 127566 126928 gene locus_tag LOCUS_26080 127566 126928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_26080 128327 127572 gene locus_tag LOCUS_26090 gene moeB 128327 127572 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_26090 129150 128317 gene locus_tag LOCUS_26100 gene prmC 129150 128317 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 protein_id gnl|my_center|LOCUS_26100 130235 129150 gene locus_tag LOCUS_26110 gene prfA 130235 129150 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW7 protein_id gnl|my_center|LOCUS_26110 131614 130232 gene locus_tag LOCUS_26120 gene hemA 131614 130232 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_26120 131895 133655 gene locus_tag LOCUS_26130 131895 133655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_26130 133656 134264 gene locus_tag LOCUS_26140 gene lolB 133656 134264 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C4 protein_id gnl|my_center|LOCUS_26140 134264 135094 gene locus_tag LOCUS_26150 gene ispE 134264 135094 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_26150 135109 135183 gene locus_tag LOCUS_t00230 135109 135183 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 135270 136217 gene locus_tag LOCUS_26160 gene prs 135270 136217 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC5 protein_id gnl|my_center|LOCUS_26160 136294 136962 gene locus_tag LOCUS_26170 gene rplY 136294 136962 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_26170 136997 137584 gene locus_tag LOCUS_26180 gene pth 136997 137584 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRW1 protein_id gnl|my_center|LOCUS_26180 137610 138704 gene locus_tag LOCUS_26190 gene ychF 137610 138704 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC2 protein_id gnl|my_center|LOCUS_26190 138800 138876 gene locus_tag LOCUS_t00240 138800 138876 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 139261 139067 gene locus_tag LOCUS_26200 139261 139067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 139892 139386 gene locus_tag LOCUS_26210 139892 139386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 143864 140799 gene locus_tag LOCUS_26220 gene hsdR 143864 140799 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_26220 145076 143868 gene locus_tag LOCUS_26230 145076 143868 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423274.1 protein_id gnl|my_center|LOCUS_26230 146793 145069 gene locus_tag LOCUS_26240 gene hsdM 146793 145069 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_26240 147828 147022 gene locus_tag LOCUS_26250 147828 147022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 148291 147866 gene locus_tag LOCUS_26260 148291 147866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 149027 148599 gene locus_tag LOCUS_26270 149027 148599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 150473 149247 gene locus_tag LOCUS_26280 150473 149247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 151221 150448 gene locus_tag LOCUS_26290 151221 150448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 152411 151728 gene locus_tag LOCUS_26300 152411 151728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 153716 152448 gene locus_tag LOCUS_26310 153716 152448 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_26310 154393 153947 gene locus_tag LOCUS_26320 154393 153947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 154970 155407 gene locus_tag LOCUS_26330 154970 155407 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466989.1 protein_id gnl|my_center|LOCUS_26330 156119 155715 gene locus_tag LOCUS_26340 156119 155715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 156530 156964 gene locus_tag LOCUS_26350 156530 156964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 157030 157779 gene locus_tag LOCUS_26360 157030 157779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 158165 158464 gene locus_tag LOCUS_26370 158165 158464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 159321 158950 gene locus_tag LOCUS_26380 159321 158950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26380 160710 159343 gene locus_tag LOCUS_26390 160710 159343 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_26390 160981 162966 gene locus_tag LOCUS_26400 160981 162966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037986.1 protein_id gnl|my_center|LOCUS_26400 163035 163199 gene locus_tag LOCUS_26410 163035 163199 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLW2 protein_id gnl|my_center|LOCUS_26410 163531 163716 gene locus_tag LOCUS_26420 163531 163716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466987.1 protein_id gnl|my_center|LOCUS_26420 163729 164448 gene locus_tag LOCUS_26430 163729 164448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 166131 164533 gene locus_tag LOCUS_26440 166131 164533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 166514 167533 gene locus_tag LOCUS_26450 166514 167533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_26450 167885 168187 gene locus_tag LOCUS_26460 167885 168187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889185.1 protein_id gnl|my_center|LOCUS_26460 168355 169797 gene locus_tag LOCUS_26470 168355 169797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 170020 170745 gene locus_tag LOCUS_26480 170020 170745 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_26480 172924 170780 gene locus_tag LOCUS_26490 172924 170780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_26490 172972 173184 gene locus_tag LOCUS_26500 172972 173184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 173550 174722 gene locus_tag LOCUS_26510 173550 174722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 176153 174726 gene locus_tag LOCUS_26520 176153 174726 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_26520 177209 176232 gene locus_tag LOCUS_26530 177209 176232 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_26530 177401 178036 gene locus_tag LOCUS_26540 177401 178036 CDS product putative transcriptional regulator, TetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703936.1 protein_id gnl|my_center|LOCUS_26540 178162 179085 gene locus_tag LOCUS_26550 178162 179085 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207936.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence12 759 169 gene locus_tag LOCUS_26560 759 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1472 3856 gene locus_tag LOCUS_26570 1472 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 protein_id gnl|my_center|LOCUS_26570 3952 4632 gene locus_tag LOCUS_26580 3952 4632 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_26580 4629 6017 gene locus_tag LOCUS_26590 4629 6017 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 protein_id gnl|my_center|LOCUS_26590 7296 6070 gene locus_tag LOCUS_26600 7296 6070 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416576.1 protein_id gnl|my_center|LOCUS_26600 7714 9948 gene locus_tag LOCUS_26610 7714 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 10475 10996 gene locus_tag LOCUS_26620 10475 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 11259 11441 gene locus_tag LOCUS_26630 11259 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 11929 11480 gene locus_tag LOCUS_26640 11929 11480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 13725 12295 gene locus_tag LOCUS_26650 13725 12295 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_26650 13994 14803 gene locus_tag LOCUS_26660 13994 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_26660 17001 14800 gene locus_tag LOCUS_26670 17001 14800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073784.1 protein_id gnl|my_center|LOCUS_26670 17342 18823 gene locus_tag LOCUS_26680 17342 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 19001 20308 gene locus_tag LOCUS_26690 19001 20308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 20656 22227 gene locus_tag LOCUS_26700 20656 22227 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967491.1 protein_id gnl|my_center|LOCUS_26700 22305 24008 gene locus_tag LOCUS_26710 22305 24008 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947578.1 protein_id gnl|my_center|LOCUS_26710 24370 25857 gene locus_tag LOCUS_26720 24370 25857 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_26720 25868 26719 gene locus_tag LOCUS_26730 25868 26719 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_26730 27864 26758 gene locus_tag LOCUS_26740 27864 26758 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_26740 28145 28576 gene locus_tag LOCUS_26750 28145 28576 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_26750 29525 28611 gene locus_tag LOCUS_26760 29525 28611 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_26760 30398 29628 gene locus_tag LOCUS_26770 30398 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 30842 30402 gene locus_tag LOCUS_26780 30842 30402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091697.1 protein_id gnl|my_center|LOCUS_26780 31546 30845 gene locus_tag LOCUS_26790 31546 30845 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_26790 31805 33748 gene locus_tag LOCUS_26800 31805 33748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 36328 33800 gene locus_tag LOCUS_26810 36328 33800 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_26810 36506 38257 gene locus_tag LOCUS_26820 36506 38257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 39398 38295 gene locus_tag LOCUS_26830 39398 38295 CDS product ionic antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205502.1 protein_id gnl|my_center|LOCUS_26830 39821 41320 gene locus_tag LOCUS_26840 39821 41320 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_26840 43181 41340 gene locus_tag LOCUS_26850 43181 41340 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_26850 44617 43175 gene locus_tag LOCUS_26860 44617 43175 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_26860 45751 44621 gene locus_tag LOCUS_26870 45751 44621 CDS product MFP transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364999.1 protein_id gnl|my_center|LOCUS_26870 46057 45755 gene locus_tag LOCUS_26880 46057 45755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 47955 46228 gene locus_tag LOCUS_26890 gene poxB 47955 46228 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035462.1 protein_id gnl|my_center|LOCUS_26890 48432 47986 gene locus_tag LOCUS_26900 48432 47986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_26900 49383 48502 gene locus_tag LOCUS_26910 49383 48502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_26910 49967 49380 gene locus_tag LOCUS_26920 49967 49380 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_26920 51560 49971 gene locus_tag LOCUS_26930 51560 49971 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRI5 protein_id gnl|my_center|LOCUS_26930 52703 51597 gene locus_tag LOCUS_26940 52703 51597 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRI4 protein_id gnl|my_center|LOCUS_26940 54244 52697 gene locus_tag LOCUS_26950 54244 52697 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948584.1 protein_id gnl|my_center|LOCUS_26950 56534 54345 gene locus_tag LOCUS_26960 56534 54345 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202167.1 protein_id gnl|my_center|LOCUS_26960 56788 58227 gene locus_tag LOCUS_26970 56788 58227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114010.1 protein_id gnl|my_center|LOCUS_26970 58518 59864 gene locus_tag LOCUS_26980 58518 59864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 60219 60605 gene locus_tag LOCUS_26990 60219 60605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 protein_id gnl|my_center|LOCUS_26990 60651 62147 gene locus_tag LOCUS_27000 gene mqo 60651 62147 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XM4 protein_id gnl|my_center|LOCUS_27000 62439 64598 gene locus_tag LOCUS_27010 gene fyuA 62439 64598 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_27010 66801 64636 gene locus_tag LOCUS_27020 66801 64636 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728243.1 protein_id gnl|my_center|LOCUS_27020 67591 66944 gene locus_tag LOCUS_27030 67591 66944 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_27030 67804 68808 gene locus_tag LOCUS_27040 67804 68808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 69559 68843 gene locus_tag LOCUS_27050 69559 68843 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_27050 69897 71582 gene locus_tag LOCUS_27060 69897 71582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 71875 74049 gene locus_tag LOCUS_27070 gene glnN 71875 74049 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_27070 74901 74107 gene locus_tag LOCUS_27080 74901 74107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 74821 75045 gene locus_tag LOCUS_27090 74821 75045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 75957 75274 gene locus_tag LOCUS_27100 75957 75274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 76246 78174 gene locus_tag LOCUS_27110 76246 78174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_27110 78675 78211 gene locus_tag LOCUS_27120 78675 78211 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 protein_id gnl|my_center|LOCUS_27120 82024 78704 gene locus_tag LOCUS_27130 82024 78704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 82610 82065 gene locus_tag LOCUS_27140 82610 82065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 83605 82616 gene locus_tag LOCUS_27150 83605 82616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 84201 83596 gene locus_tag LOCUS_27160 84201 83596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 84767 84186 gene locus_tag LOCUS_27170 84767 84186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 88330 85067 gene locus_tag LOCUS_27180 88330 85067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 88589 89056 gene locus_tag LOCUS_27190 88589 89056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730963.1 protein_id gnl|my_center|LOCUS_27190 89053 89268 gene locus_tag LOCUS_27200 89053 89268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104594.1 protein_id gnl|my_center|LOCUS_27200 89408 89881 gene locus_tag LOCUS_27210 89408 89881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 89976 90209 gene locus_tag LOCUS_27220 89976 90209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 90382 90882 gene locus_tag LOCUS_27230 90382 90882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 91488 90952 gene locus_tag LOCUS_27240 91488 90952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_27240 91714 92427 gene locus_tag LOCUS_27250 91714 92427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 92460 92909 gene locus_tag LOCUS_27260 92460 92909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 93747 92872 gene locus_tag LOCUS_27270 gene cobB 93747 92872 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JG5 protein_id gnl|my_center|LOCUS_27270 93844 94767 gene locus_tag LOCUS_27280 93844 94767 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706167.1 protein_id gnl|my_center|LOCUS_27280 95702 94731 gene locus_tag LOCUS_27290 95702 94731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_27290 100253 96393 gene locus_tag LOCUS_27300 100253 96393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 100671 100414 gene locus_tag LOCUS_27310 100671 100414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 100900 102141 gene locus_tag LOCUS_27320 100900 102141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958074.1 protein_id gnl|my_center|LOCUS_27320 102327 104954 gene locus_tag LOCUS_27330 102327 104954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 104971 106269 gene locus_tag LOCUS_27340 104971 106269 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_27340 107185 106298 gene locus_tag LOCUS_27350 107185 106298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 107706 107434 gene locus_tag LOCUS_27360 107706 107434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 107971 108651 gene locus_tag LOCUS_27370 107971 108651 CDS product frnE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549393.1 protein_id gnl|my_center|LOCUS_27370 108757 108915 gene locus_tag LOCUS_27380 108757 108915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 108985 109725 gene locus_tag LOCUS_27390 108985 109725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 109722 111239 gene locus_tag LOCUS_27400 109722 111239 CDS product gonadoliberin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_27400 111239 112219 gene locus_tag LOCUS_27410 111239 112219 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 protein_id gnl|my_center|LOCUS_27410 112265 114403 gene locus_tag LOCUS_27420 112265 114403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 114477 115097 gene locus_tag LOCUS_27430 114477 115097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 115090 116010 gene locus_tag LOCUS_27440 gene chpB 115090 116010 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_27440 116273 116683 gene locus_tag LOCUS_27450 gene pilG 116273 116683 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_27450 116686 117252 gene locus_tag LOCUS_27460 116686 117252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 117245 118564 gene locus_tag LOCUS_27470 117245 118564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 118561 119415 gene locus_tag LOCUS_27480 gene pilK 118561 119415 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_27480 119420 121858 gene locus_tag LOCUS_27490 119420 121858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 121873 125772 gene locus_tag LOCUS_27500 121873 125772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 125782 126228 gene locus_tag LOCUS_27510 125782 126228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 126250 126636 gene locus_tag LOCUS_27520 126250 126636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 126965 127315 gene locus_tag LOCUS_27530 126965 127315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 127406 128344 gene locus_tag LOCUS_27540 127406 128344 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_27540 128556 130847 gene locus_tag LOCUS_27550 gene fyuA 128556 130847 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_27550 131107 132288 gene locus_tag LOCUS_27560 131107 132288 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_27560 132316 133455 gene locus_tag LOCUS_27570 132316 133455 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_27570 133504 135207 gene locus_tag LOCUS_27580 133504 135207 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_27580 135271 136518 gene locus_tag LOCUS_27590 135271 136518 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529670.1 protein_id gnl|my_center|LOCUS_27590 136656 139079 gene locus_tag LOCUS_27600 136656 139079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 139319 139873 gene locus_tag LOCUS_27610 139319 139873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_27610 139920 140837 gene locus_tag LOCUS_27620 139920 140837 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_27620 140890 142068 gene locus_tag LOCUS_27630 140890 142068 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_27630 142153 143130 gene locus_tag LOCUS_27640 142153 143130 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_27640 143160 144326 gene locus_tag LOCUS_27650 143160 144326 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_27650 144323 144754 gene locus_tag LOCUS_27660 144323 144754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_27660 145992 144793 gene locus_tag LOCUS_27670 145992 144793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_27670 147204 146002 gene locus_tag LOCUS_27680 147204 146002 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_27680 148350 147235 gene locus_tag LOCUS_27690 148350 147235 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_27690 149028 148366 gene locus_tag LOCUS_27700 149028 148366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 149780 149025 gene locus_tag LOCUS_27710 gene ephD 149780 149025 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_27710 150235 151377 gene locus_tag LOCUS_27720 gene carA 150235 151377 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 protein_id gnl|my_center|LOCUS_27720 151384 154605 gene locus_tag LOCUS_27730 151384 154605 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ1 protein_id gnl|my_center|LOCUS_27730 154602 155078 gene locus_tag LOCUS_27740 gene greA 154602 155078 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_27740 156025 155183 gene locus_tag LOCUS_27750 156025 155183 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_27750 156627 156283 gene locus_tag LOCUS_27760 156627 156283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 157105 156794 gene locus_tag LOCUS_27770 157105 156794 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_27770 157197 157823 gene locus_tag LOCUS_27780 gene rlmE 157197 157823 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_27780 158142 160070 gene locus_tag LOCUS_27790 gene ftsH 158142 160070 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_27790 160094 160960 gene locus_tag LOCUS_27800 gene folP 160094 160960 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV49 protein_id gnl|my_center|LOCUS_27800 160957 162306 gene locus_tag LOCUS_27810 gene glmM 160957 162306 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_27810 162449 163162 gene locus_tag LOCUS_27820 gene tpiA 162449 163162 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZT5 protein_id gnl|my_center|LOCUS_27820 163203 163586 gene locus_tag LOCUS_27830 gene secG 163203 163586 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_27830 163604 163689 gene locus_tag LOCUS_t00250 163604 163689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 165603 163867 gene locus_tag LOCUS_27840 165603 163867 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266676.1 protein_id gnl|my_center|LOCUS_27840 166643 166314 gene locus_tag LOCUS_27850 166643 166314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 167044 168516 gene locus_tag LOCUS_27860 167044 168516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 168706 169299 gene locus_tag LOCUS_27870 168706 169299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 169567 170061 gene locus_tag LOCUS_27880 169567 170061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 170415 171161 gene locus_tag LOCUS_27890 170415 171161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 171385 171460 gene locus_tag LOCUS_t00260 171385 171460 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 171640 171723 gene locus_tag LOCUS_t00270 171640 171723 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 171895 171968 gene locus_tag LOCUS_t00280 171895 171968 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 171985 172060 gene locus_tag LOCUS_t00290 171985 172060 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 386 3031 gene locus_tag LOCUS_27900 386 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 4424 3129 gene locus_tag LOCUS_27910 gene cry 4424 3129 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JP5 protein_id gnl|my_center|LOCUS_27910 4809 5606 gene locus_tag LOCUS_27920 4809 5606 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 protein_id gnl|my_center|LOCUS_27920 6013 5873 gene locus_tag LOCUS_27930 6013 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 5972 6640 gene locus_tag LOCUS_27940 5972 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 6934 7149 gene locus_tag LOCUS_27950 6934 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_27950 7294 7731 gene locus_tag LOCUS_27960 7294 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 7824 8495 gene locus_tag LOCUS_27970 7824 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 8552 9337 gene locus_tag LOCUS_27980 8552 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123680.1 protein_id gnl|my_center|LOCUS_27980 9334 9510 gene locus_tag LOCUS_27990 9334 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 9977 9519 gene locus_tag LOCUS_28000 9977 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 10800 10093 gene locus_tag LOCUS_28010 10800 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 12920 10797 gene locus_tag LOCUS_28020 12920 10797 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_28020 14878 12920 gene locus_tag LOCUS_28030 14878 12920 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120322.1 protein_id gnl|my_center|LOCUS_28030 15834 14896 gene locus_tag LOCUS_28040 gene scrK 15834 14896 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_28040 16751 15831 gene locus_tag LOCUS_28050 16751 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 18855 16681 gene locus_tag LOCUS_28060 gene sps 18855 16681 CDS product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_28060 19094 19462 gene locus_tag LOCUS_28070 19094 19462 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037996.1 protein_id gnl|my_center|LOCUS_28070 19676 20314 gene locus_tag LOCUS_28080 19676 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 21349 20321 gene locus_tag LOCUS_28090 21349 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28090 21234 21536 gene locus_tag LOCUS_28100 21234 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 21542 21727 gene locus_tag LOCUS_28110 21542 21727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 21819 23363 gene locus_tag LOCUS_28120 21819 23363 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_28120 23613 24362 gene locus_tag LOCUS_28130 23613 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 24375 25562 gene locus_tag LOCUS_28140 24375 25562 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416576.1 protein_id gnl|my_center|LOCUS_28140 25723 26427 gene locus_tag LOCUS_28150 25723 26427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 26424 28103 gene locus_tag LOCUS_28160 26424 28103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 28819 28127 gene locus_tag LOCUS_28170 28819 28127 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_28170 29723 28896 gene locus_tag LOCUS_28180 29723 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 29913 30515 gene locus_tag LOCUS_28190 29913 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 30549 31013 gene locus_tag LOCUS_28200 30549 31013 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230404.1 protein_id gnl|my_center|LOCUS_28200 31083 31436 gene locus_tag LOCUS_28210 31083 31436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 31631 34099 gene locus_tag LOCUS_28220 31631 34099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 protein_id gnl|my_center|LOCUS_28220 34145 34960 gene locus_tag LOCUS_28230 34145 34960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 35124 36521 gene locus_tag LOCUS_28240 35124 36521 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943995.1 protein_id gnl|my_center|LOCUS_28240 36957 38033 gene locus_tag LOCUS_28250 36957 38033 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_28250 38051 41278 gene locus_tag LOCUS_28260 38051 41278 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_28260 41280 42803 gene locus_tag LOCUS_28270 41280 42803 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_28270 43099 44103 gene locus_tag LOCUS_28280 43099 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_28280 44106 46538 gene locus_tag LOCUS_28290 44106 46538 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_28290 46535 48214 gene locus_tag LOCUS_28300 46535 48214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 48237 49625 gene locus_tag LOCUS_28310 48237 49625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_28310 50132 49686 gene locus_tag LOCUS_28320 50132 49686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 50363 52534 gene locus_tag LOCUS_28330 50363 52534 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102991.1 protein_id gnl|my_center|LOCUS_28330 54228 52585 gene locus_tag LOCUS_28340 54228 52585 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_28340 55708 54221 gene locus_tag LOCUS_28350 55708 54221 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640251.1 protein_id gnl|my_center|LOCUS_28350 56725 55766 gene locus_tag LOCUS_28360 56725 55766 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531230.1 protein_id gnl|my_center|LOCUS_28360 56992 58407 gene locus_tag LOCUS_28370 gene uxaC 56992 58407 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F4 protein_id gnl|my_center|LOCUS_28370 58482 59681 gene locus_tag LOCUS_28380 gene uxuA 58482 59681 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NGX8 protein_id gnl|my_center|LOCUS_28380 59772 60566 gene locus_tag LOCUS_28390 59772 60566 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918870.1 protein_id gnl|my_center|LOCUS_28390 60618 61241 gene locus_tag LOCUS_28400 60618 61241 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_28400 62591 61251 gene locus_tag LOCUS_28410 gene xylA2 62591 61251 CDS product xylose isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3H1 protein_id gnl|my_center|LOCUS_28410 64124 62637 gene locus_tag LOCUS_28420 64124 62637 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_28420 64571 64260 gene locus_tag LOCUS_28430 64571 64260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 66235 64916 gene locus_tag LOCUS_28440 66235 64916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_28440 67186 66272 gene locus_tag LOCUS_28450 67186 66272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_28450 68020 67232 gene locus_tag LOCUS_28460 68020 67232 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_28460 68288 68467 gene locus_tag LOCUS_28470 68288 68467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 68528 68794 gene locus_tag LOCUS_28480 68528 68794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 68977 71226 gene locus_tag LOCUS_28490 gene katG1 68977 71226 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSX7 protein_id gnl|my_center|LOCUS_28490 71534 72139 gene locus_tag LOCUS_28500 gene cynT2 71534 72139 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGY2 protein_id gnl|my_center|LOCUS_28500 72418 72188 gene locus_tag LOCUS_28510 72418 72188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 72577 73278 gene locus_tag LOCUS_28520 gene dhcA 72577 73278 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_28520 73290 73946 gene locus_tag LOCUS_28530 gene dhcB 73290 73946 CDS product dehydrocarnitine CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_28530 74103 76331 gene locus_tag LOCUS_28540 gene idh 74103 76331 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_28540 76408 78093 gene locus_tag LOCUS_28550 76408 78093 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072065.1 protein_id gnl|my_center|LOCUS_28550 80661 78115 gene locus_tag LOCUS_28560 80661 78115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 protein_id gnl|my_center|LOCUS_28560 81311 80688 gene locus_tag LOCUS_28570 81311 80688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 81836 81522 gene locus_tag LOCUS_28580 81836 81522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 protein_id gnl|my_center|LOCUS_28580 82755 81877 gene locus_tag LOCUS_28590 gene dhaA 82755 81877 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XB14 protein_id gnl|my_center|LOCUS_28590 83329 82790 gene locus_tag LOCUS_28600 83329 82790 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_28600 84679 83582 gene locus_tag LOCUS_28610 84679 83582 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ1 protein_id gnl|my_center|LOCUS_28610 84804 86333 gene locus_tag LOCUS_28620 84804 86333 CDS product flavin-binding family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083785.1 protein_id gnl|my_center|LOCUS_28620 86402 87292 gene locus_tag LOCUS_28630 86402 87292 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_28630 87327 88505 gene locus_tag LOCUS_28640 87327 88505 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_28640 88782 88582 gene locus_tag LOCUS_28650 88782 88582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 90031 89138 gene locus_tag LOCUS_28660 90031 89138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525152.1 protein_id gnl|my_center|LOCUS_28660 91220 90057 gene locus_tag LOCUS_28670 91220 90057 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_28670 91365 92189 gene locus_tag LOCUS_28680 91365 92189 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_28680 92255 93520 gene locus_tag LOCUS_28690 92255 93520 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704364.1 protein_id gnl|my_center|LOCUS_28690 93517 94971 gene locus_tag LOCUS_28700 93517 94971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 95192 96361 gene locus_tag LOCUS_28710 95192 96361 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 protein_id gnl|my_center|LOCUS_28710 96416 98023 gene locus_tag LOCUS_28720 gene accB 96416 98023 CDS product carboxyltransferase subunit of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_28720 98063 100087 gene locus_tag LOCUS_28730 gene liuD 98063 100087 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072001.1 protein_id gnl|my_center|LOCUS_28730 100117 101019 gene locus_tag LOCUS_28740 gene liuE 100117 101019 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072000.1 protein_id gnl|my_center|LOCUS_28740 101933 101085 gene locus_tag LOCUS_28750 gene frmB 101933 101085 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_28750 102238 104919 gene locus_tag LOCUS_28760 102238 104919 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525316.1 protein_id gnl|my_center|LOCUS_28760 107026 104966 gene locus_tag LOCUS_28770 107026 104966 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 protein_id gnl|my_center|LOCUS_28770 107588 108097 gene locus_tag LOCUS_28780 107588 108097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 108090 109370 gene locus_tag LOCUS_28790 108090 109370 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035424.1 protein_id gnl|my_center|LOCUS_28790 109398 110378 gene locus_tag LOCUS_28800 109398 110378 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_28800 110388 111662 gene locus_tag LOCUS_28810 110388 111662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_28810 113398 111704 gene locus_tag LOCUS_28820 113398 111704 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_28820 113835 113566 gene locus_tag LOCUS_28830 113835 113566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 114356 113976 gene locus_tag LOCUS_28840 gene rnk 114356 113976 CDS product regulator of nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ43 protein_id gnl|my_center|LOCUS_28840 115381 114626 gene locus_tag LOCUS_28850 gene yxbG 115381 114626 CDS product putative oxidoreductase YxbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46331 protein_id gnl|my_center|LOCUS_28850 115892 115386 gene locus_tag LOCUS_28860 115892 115386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 116091 117191 gene locus_tag LOCUS_28870 116091 117191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 119340 117250 gene locus_tag LOCUS_28880 119340 117250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_28880 119742 120581 gene locus_tag LOCUS_28890 119742 120581 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 protein_id gnl|my_center|LOCUS_28890 121101 120586 gene locus_tag LOCUS_28900 121101 120586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 121642 121112 gene locus_tag LOCUS_28910 121642 121112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53216 protein_id gnl|my_center|LOCUS_28910 121758 123176 gene locus_tag LOCUS_28920 121758 123176 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_28920 123177 123512 gene locus_tag LOCUS_28930 gene hcaC 123177 123512 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_28930 123707 124747 gene locus_tag LOCUS_28940 123707 124747 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206144.1 protein_id gnl|my_center|LOCUS_28940 124872 125642 gene locus_tag LOCUS_28950 124872 125642 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_28950 125661 126587 gene locus_tag LOCUS_28960 gene tauD 125661 126587 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_28960 126658 128274 gene locus_tag LOCUS_28970 126658 128274 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064953.1 protein_id gnl|my_center|LOCUS_28970 128368 129573 gene locus_tag LOCUS_28980 128368 129573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_28980 129613 130632 gene locus_tag LOCUS_28990 129613 130632 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950930.1 protein_id gnl|my_center|LOCUS_28990 132197 130758 gene locus_tag LOCUS_29000 132197 130758 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938904.1 protein_id gnl|my_center|LOCUS_29000 132788 135232 gene locus_tag LOCUS_29010 132788 135232 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_29010 135411 136163 gene locus_tag LOCUS_29020 135411 136163 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 protein_id gnl|my_center|LOCUS_29020 136949 136188 gene locus_tag LOCUS_29030 136949 136188 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804205.1 protein_id gnl|my_center|LOCUS_29030 137249 138280 gene locus_tag LOCUS_29040 137249 138280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 138290 139105 gene locus_tag LOCUS_29050 gene fabG 138290 139105 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_29050 139614 139228 gene locus_tag LOCUS_29060 139614 139228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_29060 139736 140536 gene locus_tag LOCUS_29070 139736 140536 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027458.1 protein_id gnl|my_center|LOCUS_29070 141701 140661 gene locus_tag LOCUS_29080 141701 140661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_29080 142131 141739 gene locus_tag LOCUS_29090 142131 141739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 143097 142222 gene locus_tag LOCUS_29100 143097 142222 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 protein_id gnl|my_center|LOCUS_29100 143348 144418 gene locus_tag LOCUS_29110 143348 144418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 144671 147049 gene locus_tag LOCUS_29120 144671 147049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 147033 147686 gene locus_tag LOCUS_29130 147033 147686 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_29130 148147 148575 gene locus_tag LOCUS_29140 148147 148575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 149575 148562 gene locus_tag LOCUS_29150 149575 148562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 149800 151296 gene locus_tag LOCUS_29160 149800 151296 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG1 protein_id gnl|my_center|LOCUS_29160 152623 151385 gene locus_tag LOCUS_29170 152623 151385 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_29170 154641 152707 gene locus_tag LOCUS_29180 154641 152707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 155976 154732 gene locus_tag LOCUS_29190 155976 154732 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704554.1 protein_id gnl|my_center|LOCUS_29190 156959 156138 gene locus_tag LOCUS_29200 156959 156138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_29200 157115 158587 gene locus_tag LOCUS_29210 gene zwf 157115 158587 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68282 protein_id gnl|my_center|LOCUS_29210 158587 159291 gene locus_tag LOCUS_29220 158587 159291 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706901.1 protein_id gnl|my_center|LOCUS_29220 159295 161133 gene locus_tag LOCUS_29230 gene edd 159295 161133 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_29230 161144 161887 gene locus_tag LOCUS_29240 161144 161887 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478741.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence14 1096 260 gene locus_tag LOCUS_29250 1096 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1944 1093 gene locus_tag LOCUS_29260 1944 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3093 2473 gene locus_tag LOCUS_29270 3093 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3414 4241 gene locus_tag LOCUS_29280 3414 4241 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090335.1 protein_id gnl|my_center|LOCUS_29280 5171 4320 gene locus_tag LOCUS_29290 5171 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 8395 5318 gene locus_tag LOCUS_29300 8395 5318 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_29300 9212 8385 gene locus_tag LOCUS_29310 9212 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 10000 9863 gene locus_tag LOCUS_29320 10000 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 10612 10950 gene locus_tag LOCUS_29330 10612 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 10919 11260 gene locus_tag LOCUS_29340 10919 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 11325 11552 gene locus_tag LOCUS_29350 11325 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 12721 11768 gene locus_tag LOCUS_29360 12721 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 14541 12949 gene locus_tag LOCUS_29370 gene phoD 14541 12949 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339980.1 protein_id gnl|my_center|LOCUS_29370 14731 16254 gene locus_tag LOCUS_29380 14731 16254 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883980.1 protein_id gnl|my_center|LOCUS_29380 17072 16248 gene locus_tag LOCUS_29390 gene tauD 17072 16248 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706738.1 protein_id gnl|my_center|LOCUS_29390 18875 17157 gene locus_tag LOCUS_29400 18875 17157 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UUX9 protein_id gnl|my_center|LOCUS_29400 19461 18976 gene locus_tag LOCUS_29410 gene ibpA 19461 18976 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_29410 19982 19710 gene locus_tag LOCUS_29420 19982 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 19863 21695 gene locus_tag LOCUS_29430 19863 21695 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 protein_id gnl|my_center|LOCUS_29430 22902 21712 gene locus_tag LOCUS_29440 22902 21712 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_29440 23171 25453 gene locus_tag LOCUS_29450 23171 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 25699 26292 gene locus_tag LOCUS_29460 25699 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 26289 26753 gene locus_tag LOCUS_29470 26289 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 26750 27964 gene locus_tag LOCUS_29480 26750 27964 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173900.1 protein_id gnl|my_center|LOCUS_29480 28589 28041 gene locus_tag LOCUS_29490 gene blc 28589 28041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_29490 29077 28586 gene locus_tag LOCUS_29500 29077 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 29654 29346 gene locus_tag LOCUS_29510 29654 29346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 29706 30227 gene locus_tag LOCUS_29520 29706 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 30383 31399 gene locus_tag LOCUS_29530 30383 31399 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_29530 31783 33699 gene locus_tag LOCUS_29540 31783 33699 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_29540 34565 33696 gene locus_tag LOCUS_29550 34565 33696 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_29550 35016 36575 gene locus_tag LOCUS_29560 35016 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 37640 36636 gene locus_tag LOCUS_29570 37640 36636 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267162.1 protein_id gnl|my_center|LOCUS_29570 38741 37770 gene locus_tag LOCUS_29580 38741 37770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 38839 39264 gene locus_tag LOCUS_29590 38839 39264 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_29590 39269 39691 gene locus_tag LOCUS_29600 39269 39691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 39779 41197 gene locus_tag LOCUS_29610 39779 41197 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_29610 43462 41246 gene locus_tag LOCUS_29620 43462 41246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 44558 43464 gene locus_tag LOCUS_29630 gene selU 44558 43464 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK5 protein_id gnl|my_center|LOCUS_29630 45473 44568 gene locus_tag LOCUS_29640 gene rdgC 45473 44568 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP9 protein_id gnl|my_center|LOCUS_29640 45693 47186 gene locus_tag LOCUS_29650 45693 47186 CDS product putative fumarate reductase/succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703124.1 protein_id gnl|my_center|LOCUS_29650 47183 47623 gene locus_tag LOCUS_29660 gene gloA 47183 47623 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530919.1 protein_id gnl|my_center|LOCUS_29660 48395 47658 gene locus_tag LOCUS_29670 48395 47658 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_29670 48540 50786 gene locus_tag LOCUS_29680 48540 50786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_29680 51346 50795 gene locus_tag LOCUS_29690 51346 50795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268811.1 protein_id gnl|my_center|LOCUS_29690 51839 51549 gene locus_tag LOCUS_29700 51839 51549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 52327 51854 gene locus_tag LOCUS_29710 52327 51854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 52879 52421 gene locus_tag LOCUS_29720 52879 52421 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_29720 54791 52902 gene locus_tag LOCUS_29730 gene parE 54791 52902 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VH3 protein_id gnl|my_center|LOCUS_29730 55703 54864 gene locus_tag LOCUS_29740 gene cpdA 55703 54864 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 protein_id gnl|my_center|LOCUS_29740 56223 55720 gene locus_tag LOCUS_29750 56223 55720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703512.1 protein_id gnl|my_center|LOCUS_29750 56396 57820 gene locus_tag LOCUS_29760 56396 57820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_29760 57841 58458 gene locus_tag LOCUS_29770 57841 58458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_29770 59552 58476 gene locus_tag LOCUS_29780 59552 58476 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_29780 60265 59549 gene locus_tag LOCUS_29790 60265 59549 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_29790 61499 60252 gene locus_tag LOCUS_29800 61499 60252 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_29800 61871 62770 gene locus_tag LOCUS_29810 gene rfbA 61871 62770 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMA9 protein_id gnl|my_center|LOCUS_29810 62767 63315 gene locus_tag LOCUS_29820 gene rfbC 62767 63315 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920703.1 protein_id gnl|my_center|LOCUS_29820 64396 63329 gene locus_tag LOCUS_29830 gene rfbB 64396 63329 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_29830 65276 64389 gene locus_tag LOCUS_29840 gene rfbD 65276 64389 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_29840 65398 66186 gene locus_tag LOCUS_29850 65398 66186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 66967 66203 gene locus_tag LOCUS_29860 66967 66203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 67977 67051 gene locus_tag LOCUS_29870 gene ilvE 67977 67051 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_29870 70889 67992 gene locus_tag LOCUS_29880 gene glnE 70889 67992 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_29880 72691 70916 gene locus_tag LOCUS_29890 72691 70916 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_29890 72878 73561 gene locus_tag LOCUS_29900 72878 73561 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_29900 73577 74857 gene locus_tag LOCUS_29910 73577 74857 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY3 protein_id gnl|my_center|LOCUS_29910 74952 76103 gene locus_tag LOCUS_29920 gene argE 74952 76103 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_29920 76190 77494 gene locus_tag LOCUS_29930 gene argA 76190 77494 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AR2 protein_id gnl|my_center|LOCUS_29930 77672 77481 gene locus_tag LOCUS_29940 77672 77481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 77868 78188 gene locus_tag LOCUS_29950 77868 78188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 78249 78485 gene locus_tag LOCUS_29960 78249 78485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 78685 80529 gene locus_tag LOCUS_29970 gene ilvD 78685 80529 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 protein_id gnl|my_center|LOCUS_29970 81450 80518 gene locus_tag LOCUS_29980 81450 80518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922269.1 protein_id gnl|my_center|LOCUS_29980 82608 81454 gene locus_tag LOCUS_29990 82608 81454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 84480 82807 gene locus_tag LOCUS_30000 gene leuA-2 84480 82807 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_30000 84770 85258 gene locus_tag LOCUS_30010 84770 85258 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_30010 85490 86269 gene locus_tag LOCUS_30020 85490 86269 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225354.1 protein_id gnl|my_center|LOCUS_30020 86852 86328 gene locus_tag LOCUS_30030 86852 86328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 86991 87728 gene locus_tag LOCUS_30040 86991 87728 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972833.1 protein_id gnl|my_center|LOCUS_30040 87871 89073 gene locus_tag LOCUS_30050 87871 89073 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_30050 89128 90135 gene locus_tag LOCUS_30060 gene cysK 89128 90135 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_30060 90799 90158 gene locus_tag LOCUS_30070 gene dsbA 90799 90158 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_30070 91523 90909 gene locus_tag LOCUS_30080 gene cc4 91523 90909 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_30080 91873 91574 gene locus_tag LOCUS_30090 gene scyA 91873 91574 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_30090 91989 92639 gene locus_tag LOCUS_30100 gene engB 91989 92639 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ86 protein_id gnl|my_center|LOCUS_30100 95808 93088 gene locus_tag LOCUS_30110 gene polA 95808 93088 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT80 protein_id gnl|my_center|LOCUS_30110 96547 95903 gene locus_tag LOCUS_30120 gene senC 96547 95903 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_30120 97443 96544 gene locus_tag LOCUS_30130 gene cyoE1 97443 96544 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_30130 98109 97450 gene locus_tag LOCUS_30140 98109 97450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 98883 98110 gene locus_tag LOCUS_30150 98883 98110 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_30150 98944 99204 gene locus_tag LOCUS_30160 98944 99204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 100175 99201 gene locus_tag LOCUS_30170 gene coIII 100175 99201 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_30170 100777 100217 gene locus_tag LOCUS_30180 100777 100217 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_30180 102372 100792 gene locus_tag LOCUS_30190 gene coxA 102372 100792 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_30190 103533 102388 gene locus_tag LOCUS_30200 gene coxB 103533 102388 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_30200 103824 104543 gene locus_tag LOCUS_30210 103824 104543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 104926 104633 gene locus_tag LOCUS_30220 104926 104633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 105015 105581 gene locus_tag LOCUS_30230 105015 105581 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_30230 106418 105582 gene locus_tag LOCUS_30240 gene aroE 106418 105582 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43904 protein_id gnl|my_center|LOCUS_30240 107347 106415 gene locus_tag LOCUS_30250 gene hemF 107347 106415 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_30250 107969 107403 gene locus_tag LOCUS_30260 gene tsaC 107969 107403 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 protein_id gnl|my_center|LOCUS_30260 108475 107972 gene locus_tag LOCUS_30270 gene purE-2 108475 107972 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX5 protein_id gnl|my_center|LOCUS_30270 109549 108626 gene locus_tag LOCUS_30280 109549 108626 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_30280 110551 109592 gene locus_tag LOCUS_30290 110551 109592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_30290 110935 111441 gene locus_tag LOCUS_30300 gene def 110935 111441 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_30300 111461 112420 gene locus_tag LOCUS_30310 gene fmt 111461 112420 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T0 protein_id gnl|my_center|LOCUS_30310 112420 113718 gene locus_tag LOCUS_30320 gene rsmB 112420 113718 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 protein_id gnl|my_center|LOCUS_30320 113821 115197 gene locus_tag LOCUS_30330 gene trkA 113821 115197 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_30330 115201 116649 gene locus_tag LOCUS_30340 gene trkH 115201 116649 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_30340 117481 116678 gene locus_tag LOCUS_30350 gene djlA 117481 116678 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUR8 protein_id gnl|my_center|LOCUS_30350 117670 118620 gene locus_tag LOCUS_30360 gene glyQ 117670 118620 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_30360 118625 120703 gene locus_tag LOCUS_30370 gene glyS 118625 120703 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43822 protein_id gnl|my_center|LOCUS_30370 120831 122336 gene locus_tag LOCUS_30380 gene rmuC 120831 122336 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44733 protein_id gnl|my_center|LOCUS_30380 124789 122381 gene locus_tag LOCUS_30390 gene gyrB 124789 122381 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_30390 125958 124834 gene locus_tag LOCUS_30400 gene recF 125958 124834 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C3 protein_id gnl|my_center|LOCUS_30400 127169 126057 gene locus_tag LOCUS_30410 gene dnaN 127169 126057 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_30410 128849 127221 gene locus_tag LOCUS_30420 gene dnaA 128849 127221 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U7 protein_id gnl|my_center|LOCUS_30420 129357 129755 gene locus_tag LOCUS_30430 gene rnpA 129357 129755 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 protein_id gnl|my_center|LOCUS_30430 130002 131705 gene locus_tag LOCUS_30440 gene yidC 130002 131705 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_30440 131772 133136 gene locus_tag LOCUS_30450 gene mnmE 131772 133136 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_30450 >Feature sequence15 260 475 gene locus_tag LOCUS_30460 260 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 479 646 gene locus_tag LOCUS_30470 479 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30470 1183 2286 gene locus_tag LOCUS_30480 1183 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 5661 2296 gene locus_tag LOCUS_30490 5661 2296 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071612.1 protein_id gnl|my_center|LOCUS_30490 6635 5658 gene locus_tag LOCUS_30500 6635 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 7546 6890 gene locus_tag LOCUS_30510 7546 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 8250 7549 gene locus_tag LOCUS_30520 8250 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 8916 8440 gene locus_tag LOCUS_30530 8916 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 9360 8926 gene locus_tag LOCUS_30540 9360 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 10612 12603 gene locus_tag LOCUS_30550 10612 12603 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017156.1 protein_id gnl|my_center|LOCUS_30550 13446 12826 gene locus_tag LOCUS_30560 13446 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 15763 13475 gene locus_tag LOCUS_30570 15763 13475 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_30570 15777 16625 gene locus_tag LOCUS_30580 15777 16625 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_30580 16629 18689 gene locus_tag LOCUS_30590 16629 18689 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_30590 19522 18716 gene locus_tag LOCUS_30600 19522 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884032.1 protein_id gnl|my_center|LOCUS_30600 20549 19644 gene locus_tag LOCUS_30610 20549 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 22017 20635 gene locus_tag LOCUS_30620 22017 20635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403213.1 protein_id gnl|my_center|LOCUS_30620 22326 22766 gene locus_tag LOCUS_30630 22326 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 22791 24461 gene locus_tag LOCUS_30640 22791 24461 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538264.1 protein_id gnl|my_center|LOCUS_30640 25193 24471 gene locus_tag LOCUS_30650 25193 24471 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262866.1 protein_id gnl|my_center|LOCUS_30650 27094 25190 gene locus_tag LOCUS_30660 27094 25190 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_30660 27643 31860 gene locus_tag LOCUS_30670 27643 31860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 31984 33324 gene locus_tag LOCUS_30680 31984 33324 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_30680 33423 34658 gene locus_tag LOCUS_30690 33423 34658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 35468 38245 gene locus_tag LOCUS_30700 35468 38245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 39018 38287 gene locus_tag LOCUS_30710 39018 38287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061919.1 protein_id gnl|my_center|LOCUS_30710 44070 39205 gene locus_tag LOCUS_30720 44070 39205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 46221 44134 gene locus_tag LOCUS_30730 46221 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 46381 47031 gene locus_tag LOCUS_30740 46381 47031 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_30740 47163 47879 gene locus_tag LOCUS_30750 47163 47879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 48006 48968 gene locus_tag LOCUS_30760 48006 48968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 50420 49056 gene locus_tag LOCUS_30770 50420 49056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 52873 50537 gene locus_tag LOCUS_30780 52873 50537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 55258 52985 gene locus_tag LOCUS_30790 55258 52985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 55797 55426 gene locus_tag LOCUS_30800 55797 55426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 56200 57426 gene locus_tag LOCUS_30810 56200 57426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_30810 57647 59584 gene locus_tag LOCUS_30820 gene thoP1 57647 59584 CDS product Zn-dependent oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_30820 59804 61255 gene locus_tag LOCUS_30830 59804 61255 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P356 protein_id gnl|my_center|LOCUS_30830 62601 61270 gene locus_tag LOCUS_30840 gene abc1 62601 61270 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_30840 63997 62585 gene locus_tag LOCUS_30850 gene cabC1 63997 62585 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_30850 65237 64110 gene locus_tag LOCUS_30860 65237 64110 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_30860 66455 65247 gene locus_tag LOCUS_30870 gene fadE17 66455 65247 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_30870 67087 66455 gene locus_tag LOCUS_30880 67087 66455 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918663.1 protein_id gnl|my_center|LOCUS_30880 68262 67090 gene locus_tag LOCUS_30890 68262 67090 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_30890 68500 69651 gene locus_tag LOCUS_30900 68500 69651 CDS product heme transporter CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 protein_id gnl|my_center|LOCUS_30900 69987 69688 gene locus_tag LOCUS_30910 gene glpE 69987 69688 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A49 protein_id gnl|my_center|LOCUS_30910 70304 71929 gene locus_tag LOCUS_30920 70304 71929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 72139 72531 gene locus_tag LOCUS_30930 72139 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 72636 73679 gene locus_tag LOCUS_30940 gene glsA 72636 73679 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y2N4 protein_id gnl|my_center|LOCUS_30940 75060 73792 gene locus_tag LOCUS_30950 gene gdhA 75060 73792 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPH7 protein_id gnl|my_center|LOCUS_30950 75341 76333 gene locus_tag LOCUS_30960 75341 76333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 76424 76984 gene locus_tag LOCUS_30970 gene napC 76424 76984 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCN2 protein_id gnl|my_center|LOCUS_30970 77122 78000 gene locus_tag LOCUS_30980 gene mtrA 77122 78000 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_30980 77997 80279 gene locus_tag LOCUS_30990 77997 80279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 80299 82563 gene locus_tag LOCUS_31000 gene mtrF 80299 82563 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071903.1 protein_id gnl|my_center|LOCUS_31000 82741 83772 gene locus_tag LOCUS_31010 gene hemH2 82741 83772 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_31010 84098 83847 gene locus_tag LOCUS_31020 84098 83847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 84645 84196 gene locus_tag LOCUS_31030 84645 84196 CDS product S-isoprenylcysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140259.1 protein_id gnl|my_center|LOCUS_31030 85531 84662 gene locus_tag LOCUS_31040 85531 84662 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_31040 85759 87300 gene locus_tag LOCUS_31050 gene gabD 85759 87300 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224348.1 protein_id gnl|my_center|LOCUS_31050 87367 88164 gene locus_tag LOCUS_31060 87367 88164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 88872 88309 gene locus_tag LOCUS_31070 88872 88309 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702324.1 protein_id gnl|my_center|LOCUS_31070 89375 88899 gene locus_tag LOCUS_31080 gene ribH 89375 88899 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBE1 protein_id gnl|my_center|LOCUS_31080 90773 89652 gene locus_tag LOCUS_31090 gene proB 90773 89652 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_31090 91972 90782 gene locus_tag LOCUS_31100 gene obg 91972 90782 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL8 protein_id gnl|my_center|LOCUS_31100 92760 92503 gene locus_tag LOCUS_31110 gene rpmA 92760 92503 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS9 protein_id gnl|my_center|LOCUS_31110 93084 92776 gene locus_tag LOCUS_31120 gene rplU 93084 92776 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIV3 protein_id gnl|my_center|LOCUS_31120 93373 94335 gene locus_tag LOCUS_31130 93373 94335 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_31130 94440 96077 gene locus_tag LOCUS_31140 gene pgi 94440 96077 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_31140 97446 96097 gene locus_tag LOCUS_31150 97446 96097 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_31150 98285 97458 gene locus_tag LOCUS_31160 98285 97458 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T33 protein_id gnl|my_center|LOCUS_31160 99723 98314 gene locus_tag LOCUS_31170 gene xanB 99723 98314 CDS product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 protein_id gnl|my_center|LOCUS_31170 100184 100699 gene locus_tag LOCUS_31180 gene fabA 100184 100699 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV9 protein_id gnl|my_center|LOCUS_31180 100704 101930 gene locus_tag LOCUS_31190 gene fabB 100704 101930 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_31190 103151 101958 gene locus_tag LOCUS_31200 103151 101958 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_31200 103690 103160 gene locus_tag LOCUS_31210 103690 103160 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_31210 104564 103683 gene locus_tag LOCUS_31220 104564 103683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 105141 104620 gene locus_tag LOCUS_31230 gene ssb 105141 104620 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_31230 106541 105318 gene locus_tag LOCUS_31240 106541 105318 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_31240 106716 109562 gene locus_tag LOCUS_31250 gene uvrA 106716 109562 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_31250 110026 109637 gene locus_tag LOCUS_31260 gene rplQ 110026 109637 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52761 protein_id gnl|my_center|LOCUS_31260 111120 110116 gene locus_tag LOCUS_31270 gene rpoA 111120 110116 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMR8 protein_id gnl|my_center|LOCUS_31270 111777 111157 gene locus_tag LOCUS_31280 gene rpsD 111777 111157 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 protein_id gnl|my_center|LOCUS_31280 112191 111799 gene locus_tag LOCUS_31290 gene rpsK 112191 111799 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_31290 112623 112267 gene locus_tag LOCUS_31300 gene rpsM 112623 112267 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_31300 114248 112920 gene locus_tag LOCUS_31310 gene secY 114248 112920 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V1 protein_id gnl|my_center|LOCUS_31310 114695 114249 gene locus_tag LOCUS_31320 gene rplO 114695 114249 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS08 protein_id gnl|my_center|LOCUS_31320 114881 114699 gene locus_tag LOCUS_31330 gene rpmD 114881 114699 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK52 protein_id gnl|my_center|LOCUS_31330 115412 114900 gene locus_tag LOCUS_31340 gene rpsE 115412 114900 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_31340 115772 115422 gene locus_tag LOCUS_31350 gene rplR 115772 115422 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_31350 116309 115782 gene locus_tag LOCUS_31360 gene rplF 116309 115782 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_31360 116735 116340 gene locus_tag LOCUS_31370 gene rpsH 116735 116340 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_31370 117073 116768 gene locus_tag LOCUS_31380 gene rpsN 117073 116768 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V8 protein_id gnl|my_center|LOCUS_31380 117626 117087 gene locus_tag LOCUS_31390 gene rplE 117626 117087 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_31390 117975 117661 gene locus_tag LOCUS_31400 gene rplX 117975 117661 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W0 protein_id gnl|my_center|LOCUS_31400 118370 118002 gene locus_tag LOCUS_31410 gene rplN 118370 118002 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CLU5 protein_id gnl|my_center|LOCUS_31410 118689 118423 gene locus_tag LOCUS_31420 gene rpsQ 118689 118423 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ3 protein_id gnl|my_center|LOCUS_31420 118883 118692 gene locus_tag LOCUS_31430 gene rpmC 118883 118692 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNZ2 protein_id gnl|my_center|LOCUS_31430 119296 118883 gene locus_tag LOCUS_31440 gene rplP 119296 118883 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_31440 119976 119308 gene locus_tag LOCUS_31450 gene rpsC 119976 119308 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_31450 120332 119994 gene locus_tag LOCUS_31460 gene rplV 120332 119994 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889W6 protein_id gnl|my_center|LOCUS_31460 120634 120359 gene locus_tag LOCUS_31470 gene rpsS 120634 120359 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 protein_id gnl|my_center|LOCUS_31470 121500 120673 gene locus_tag LOCUS_31480 gene rplB 121500 120673 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_31480 121811 121515 gene locus_tag LOCUS_31490 gene rplW 121811 121515 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 protein_id gnl|my_center|LOCUS_31490 122425 121808 gene locus_tag LOCUS_31500 gene rplD 122425 121808 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60730 protein_id gnl|my_center|LOCUS_31500 123079 122444 gene locus_tag LOCUS_31510 gene rplC 123079 122444 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T13 protein_id gnl|my_center|LOCUS_31510 123510 123199 gene locus_tag LOCUS_31520 gene rpsJ 123510 123199 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP3 protein_id gnl|my_center|LOCUS_31520 124070 123756 gene locus_tag LOCUS_31530 124070 123756 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707324.1 protein_id gnl|my_center|LOCUS_31530 124324 124085 gene locus_tag LOCUS_31540 124324 124085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 protein_id gnl|my_center|LOCUS_31540 124520 124915 gene locus_tag LOCUS_31550 124520 124915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence16 141 791 gene locus_tag LOCUS_31560 141 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 751 1095 gene locus_tag LOCUS_31570 751 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1481 1864 gene locus_tag LOCUS_31580 1481 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3475 2282 gene locus_tag LOCUS_31590 3475 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 3993 5609 gene locus_tag LOCUS_31600 3993 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706558.1 protein_id gnl|my_center|LOCUS_31600 5727 6836 gene locus_tag LOCUS_31610 5727 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 7312 6965 gene locus_tag LOCUS_31620 7312 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 7978 7391 gene locus_tag LOCUS_31630 7978 7391 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975294.1 protein_id gnl|my_center|LOCUS_31630 9786 8119 gene locus_tag LOCUS_31640 9786 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 10175 12004 gene locus_tag LOCUS_31650 10175 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 13442 12015 gene locus_tag LOCUS_31660 13442 12015 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_31660 13686 15374 gene locus_tag LOCUS_31670 13686 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 15972 15391 gene locus_tag LOCUS_31680 15972 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 18065 16104 gene locus_tag LOCUS_31690 18065 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_31690 18722 18099 gene locus_tag LOCUS_31700 18722 18099 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_31700 19660 18764 gene locus_tag LOCUS_31710 19660 18764 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_31710 19719 20312 gene locus_tag LOCUS_31720 19719 20312 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885M2 protein_id gnl|my_center|LOCUS_31720 20345 20644 gene locus_tag LOCUS_31730 20345 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707245.1 protein_id gnl|my_center|LOCUS_31730 20712 21401 gene locus_tag LOCUS_31740 20712 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 21412 21975 gene locus_tag LOCUS_31750 gene ppiA 21412 21975 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XT6 protein_id gnl|my_center|LOCUS_31750 21981 22745 gene locus_tag LOCUS_31760 gene pdxJ 21981 22745 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_31760 22745 23278 gene locus_tag LOCUS_31770 22745 23278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 23778 23275 gene locus_tag LOCUS_31780 23778 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 24080 25060 gene locus_tag LOCUS_31790 gene dusC 24080 25060 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG7 protein_id gnl|my_center|LOCUS_31790 25719 25066 gene locus_tag LOCUS_31800 25719 25066 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_31800 26810 25833 gene locus_tag LOCUS_31810 26810 25833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 27277 28572 gene locus_tag LOCUS_31820 27277 28572 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_31820 29678 28569 gene locus_tag LOCUS_31830 gene leuB 29678 28569 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ26 protein_id gnl|my_center|LOCUS_31830 31387 29828 gene locus_tag LOCUS_31840 gene ilvX 31387 29828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_31840 32795 31419 gene locus_tag LOCUS_31850 32795 31419 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_31850 34475 32865 gene locus_tag LOCUS_31860 34475 32865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810157.1 protein_id gnl|my_center|LOCUS_31860 35842 34472 gene locus_tag LOCUS_31870 35842 34472 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_31870 36823 35846 gene locus_tag LOCUS_31880 gene oppB 36823 35846 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_31880 39027 36826 gene locus_tag LOCUS_31890 gene hbpA 39027 36826 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_31890 39127 39255 gene locus_tag LOCUS_31900 39127 39255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 39394 40665 gene locus_tag LOCUS_31910 39394 40665 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_31910 40781 43984 gene locus_tag LOCUS_31920 40781 43984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 44088 44882 gene locus_tag LOCUS_31930 44088 44882 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_31930 44886 46322 gene locus_tag LOCUS_31940 44886 46322 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_31940 46312 47010 gene locus_tag LOCUS_31950 46312 47010 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205176.1 protein_id gnl|my_center|LOCUS_31950 47651 47079 gene locus_tag LOCUS_31960 47651 47079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_31960 48767 47763 gene locus_tag LOCUS_31970 gene gap 48767 47763 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67161 protein_id gnl|my_center|LOCUS_31970 49786 48764 gene locus_tag LOCUS_31980 gene gapA 49786 48764 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_31980 50383 49964 gene locus_tag LOCUS_31990 50383 49964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 51864 50557 gene locus_tag LOCUS_32000 51864 50557 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035604.1 protein_id gnl|my_center|LOCUS_32000 52175 53701 gene locus_tag LOCUS_32010 52175 53701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 53710 54264 gene locus_tag LOCUS_32020 53710 54264 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_32020 54301 55062 gene locus_tag LOCUS_32030 54301 55062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946218.1 protein_id gnl|my_center|LOCUS_32030 55059 56903 gene locus_tag LOCUS_32040 55059 56903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 57008 58816 gene locus_tag LOCUS_32050 gene atuH 57008 58816 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_32050 60126 58813 gene locus_tag LOCUS_32060 60126 58813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 60678 60151 gene locus_tag LOCUS_32070 60678 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 60869 62296 gene locus_tag LOCUS_32080 60869 62296 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 protein_id gnl|my_center|LOCUS_32080 63110 62337 gene locus_tag LOCUS_32090 gene fpr 63110 62337 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_32090 63225 64112 gene locus_tag LOCUS_32100 63225 64112 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_32100 64644 64129 gene locus_tag LOCUS_32110 64644 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 64763 65554 gene locus_tag LOCUS_32120 64763 65554 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_32120 67181 65568 gene locus_tag LOCUS_32130 gene ybiT 67181 65568 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 protein_id gnl|my_center|LOCUS_32130 68689 67310 gene locus_tag LOCUS_32140 gene dbpA 68689 67310 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_32140 68875 69900 gene locus_tag LOCUS_32150 68875 69900 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889219.1 protein_id gnl|my_center|LOCUS_32150 71202 69949 gene locus_tag LOCUS_32160 71202 69949 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_32160 72442 71240 gene locus_tag LOCUS_32170 72442 71240 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_32170 73259 72594 gene locus_tag LOCUS_32180 73259 72594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 73565 73969 gene locus_tag LOCUS_32190 73565 73969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 74020 74595 gene locus_tag LOCUS_32200 74020 74595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 74687 76084 gene locus_tag LOCUS_32210 gene gadA 74687 76084 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5Y7 protein_id gnl|my_center|LOCUS_32210 76008 76958 gene locus_tag LOCUS_32220 76008 76958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 77089 77613 gene locus_tag LOCUS_32230 77089 77613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 77664 78536 gene locus_tag LOCUS_32240 77664 78536 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_32240 78558 78953 gene locus_tag LOCUS_32250 78558 78953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 80601 79006 gene locus_tag LOCUS_32260 80601 79006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_32260 82084 80738 gene locus_tag LOCUS_32270 82084 80738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_32270 82306 82956 gene locus_tag LOCUS_32280 82306 82956 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948655.1 protein_id gnl|my_center|LOCUS_32280 85927 83129 gene locus_tag LOCUS_32290 85927 83129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 89088 86032 gene locus_tag LOCUS_32300 89088 86032 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_32300 89872 89516 gene locus_tag LOCUS_32310 89872 89516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 90157 90486 gene locus_tag LOCUS_32320 90157 90486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 90688 90891 gene locus_tag LOCUS_32330 90688 90891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 91057 91452 gene locus_tag LOCUS_32340 91057 91452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 91907 92935 gene locus_tag LOCUS_32350 91907 92935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 93053 95353 gene locus_tag LOCUS_32360 gene fyuA 93053 95353 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_32360 95551 97977 gene locus_tag LOCUS_32370 95551 97977 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_32370 99443 98001 gene locus_tag LOCUS_32380 gene cls 99443 98001 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 protein_id gnl|my_center|LOCUS_32380 101623 99569 gene locus_tag LOCUS_32390 gene nicT 101623 99569 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_32390 101859 102281 gene locus_tag LOCUS_32400 101859 102281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 102275 103195 gene locus_tag LOCUS_32410 102275 103195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 103409 103762 gene locus_tag LOCUS_32420 103409 103762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 103976 106576 gene locus_tag LOCUS_32430 103976 106576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence17 264 1394 gene locus_tag LOCUS_32440 264 1394 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 protein_id gnl|my_center|LOCUS_32440 1396 4548 gene locus_tag LOCUS_32450 1396 4548 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_32450 4545 5186 gene locus_tag LOCUS_32460 4545 5186 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_32460 5414 7057 gene locus_tag LOCUS_32470 5414 7057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083388.1 protein_id gnl|my_center|LOCUS_32470 7228 7650 gene locus_tag LOCUS_32480 7228 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 7765 8265 gene locus_tag LOCUS_32490 7765 8265 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886918.1 protein_id gnl|my_center|LOCUS_32490 8303 8512 gene locus_tag LOCUS_32500 8303 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 8615 9721 gene locus_tag LOCUS_32510 8615 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_32510 9859 9783 gene locus_tag LOCUS_t00300 9859 9783 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11055 10033 gene locus_tag LOCUS_32520 11055 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 11430 11355 gene locus_tag LOCUS_t00310 11430 11355 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11657 12517 gene locus_tag LOCUS_32530 11657 12517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 13646 12507 gene locus_tag LOCUS_32540 13646 12507 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAZ9 protein_id gnl|my_center|LOCUS_32540 13918 13842 gene locus_tag LOCUS_t00320 13918 13842 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14179 15024 gene locus_tag LOCUS_32550 gene folD 14179 15024 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_32550 16494 15112 gene locus_tag LOCUS_32560 gene cysS 16494 15112 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8J0 protein_id gnl|my_center|LOCUS_32560 18166 16505 gene locus_tag LOCUS_32570 gene glnS 18166 16505 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_32570 18375 18872 gene locus_tag LOCUS_32580 gene ppiB 18375 18872 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_32580 19719 19093 gene locus_tag LOCUS_32590 19719 19093 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_32590 20186 19716 gene locus_tag LOCUS_32600 20186 19716 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404500.1 protein_id gnl|my_center|LOCUS_32600 20381 22996 gene locus_tag LOCUS_32610 gene acnB 20381 22996 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V5 protein_id gnl|my_center|LOCUS_32610 25109 23085 gene locus_tag LOCUS_32620 gene tgpA 25109 23085 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_32620 26110 25106 gene locus_tag LOCUS_32630 26110 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_32630 27050 26121 gene locus_tag LOCUS_32640 27050 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_32640 28272 27079 gene locus_tag LOCUS_32650 gene metZ 28272 27079 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_32650 29802 28282 gene locus_tag LOCUS_32660 gene purF 29802 28282 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_32660 30346 29828 gene locus_tag LOCUS_32670 gene dedE 30346 29828 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 protein_id gnl|my_center|LOCUS_32670 30980 30372 gene locus_tag LOCUS_32680 30980 30372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 32311 30977 gene locus_tag LOCUS_32690 gene folC 32311 30977 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_32690 33245 32304 gene locus_tag LOCUS_32700 gene accD 33245 32304 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_32700 34155 33337 gene locus_tag LOCUS_32710 gene trpA 34155 33337 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_32710 35398 34178 gene locus_tag LOCUS_32720 gene trpB 35398 34178 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_32720 36041 35388 gene locus_tag LOCUS_32730 gene trpF 36041 35388 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_32730 36825 36103 gene locus_tag LOCUS_32740 gene truA 36825 36103 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN7 protein_id gnl|my_center|LOCUS_32740 36727 36942 gene locus_tag LOCUS_32750 36727 36942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 39262 36953 gene locus_tag LOCUS_32760 39262 36953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 40546 39521 gene locus_tag LOCUS_32770 gene asd 40546 39521 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 protein_id gnl|my_center|LOCUS_32770 41252 40593 gene locus_tag LOCUS_32780 gene leuD 41252 40593 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_32780 42683 41265 gene locus_tag LOCUS_32790 gene leuC 42683 41265 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_32790 42803 43687 gene locus_tag LOCUS_32800 42803 43687 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_32800 44169 43684 gene locus_tag LOCUS_32810 44169 43684 CDS product PaaI thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265983.1 protein_id gnl|my_center|LOCUS_32810 44680 44183 gene locus_tag LOCUS_32820 44680 44183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 44782 45807 gene locus_tag LOCUS_32830 44782 45807 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_32830 48224 46056 gene locus_tag LOCUS_32840 gene rlmL 48224 46056 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 protein_id gnl|my_center|LOCUS_32840 49041 48304 gene locus_tag LOCUS_32850 49041 48304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 50182 49061 gene locus_tag LOCUS_32860 50182 49061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 50787 50161 gene locus_tag LOCUS_32870 50787 50161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 51133 52017 gene locus_tag LOCUS_32880 51133 52017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 52149 54752 gene locus_tag LOCUS_32890 gene ppdK 52149 54752 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_32890 56331 54799 gene locus_tag LOCUS_32900 56331 54799 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013532.1 protein_id gnl|my_center|LOCUS_32900 56558 57736 gene locus_tag LOCUS_32910 gene agxT 56558 57736 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_32910 58747 57746 gene locus_tag LOCUS_32920 58747 57746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_32920 59016 58747 gene locus_tag LOCUS_32930 59016 58747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 62701 58985 gene locus_tag LOCUS_32940 62701 58985 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595689.1 protein_id gnl|my_center|LOCUS_32940 64473 62698 gene locus_tag LOCUS_32950 64473 62698 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072177.1 protein_id gnl|my_center|LOCUS_32950 65090 64470 gene locus_tag LOCUS_32960 gene pmtA 65090 64470 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_32960 66478 65294 gene locus_tag LOCUS_32970 66478 65294 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 protein_id gnl|my_center|LOCUS_32970 66782 66552 gene locus_tag LOCUS_32980 66782 66552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 67623 66880 gene locus_tag LOCUS_32990 67623 66880 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_32990 67751 68719 gene locus_tag LOCUS_33000 67751 68719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 68812 69144 gene locus_tag LOCUS_33010 68812 69144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 69149 70300 gene locus_tag LOCUS_33020 69149 70300 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_33020 71980 70328 gene locus_tag LOCUS_33030 71980 70328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 73824 72115 gene locus_tag LOCUS_33040 73824 72115 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074413.1 protein_id gnl|my_center|LOCUS_33040 75010 73886 gene locus_tag LOCUS_33050 gene acd 75010 73886 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_33050 76255 75020 gene locus_tag LOCUS_33060 76255 75020 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_33060 76512 76279 gene locus_tag LOCUS_33070 76512 76279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 76599 76964 gene locus_tag LOCUS_33080 76599 76964 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_33080 77295 77687 gene locus_tag LOCUS_33090 77295 77687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 78415 77735 gene locus_tag LOCUS_33100 78415 77735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404594.1 protein_id gnl|my_center|LOCUS_33100 79082 78405 gene locus_tag LOCUS_33110 79082 78405 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_33110 80038 79082 gene locus_tag LOCUS_33120 80038 79082 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_33120 81993 80095 gene locus_tag LOCUS_33130 gene slt 81993 80095 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 protein_id gnl|my_center|LOCUS_33130 82771 82202 gene locus_tag LOCUS_33140 82771 82202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 84048 82768 gene locus_tag LOCUS_33150 gene hcaE 84048 82768 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MJF0 protein_id gnl|my_center|LOCUS_33150 84173 84829 gene locus_tag LOCUS_33160 84173 84829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 85248 84826 gene locus_tag LOCUS_33170 85248 84826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 85525 87033 gene locus_tag LOCUS_33180 85525 87033 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG1 protein_id gnl|my_center|LOCUS_33180 87193 87269 gene locus_tag LOCUS_t00330 87193 87269 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 10 771 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtagttccctctctcaccccggatgactacaat 1167 835 gene locus_tag LOCUS_33190 gene cas2 1167 835 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73QW4 protein_id gnl|my_center|LOCUS_33190 1290 1520 gene locus_tag LOCUS_33200 1290 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 1575 1802 gene locus_tag LOCUS_33210 1575 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 5311 2093 gene locus_tag LOCUS_33220 gene cas9 5311 2093 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P897 protein_id gnl|my_center|LOCUS_33220 6414 7307 gene locus_tag LOCUS_33230 6414 7307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260364.1 protein_id gnl|my_center|LOCUS_33230 7729 7932 gene locus_tag LOCUS_33240 gene rmf 7729 7932 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF9 protein_id gnl|my_center|LOCUS_33240 8296 8868 gene locus_tag LOCUS_33250 8296 8868 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXI9 protein_id gnl|my_center|LOCUS_33250 13830 8977 gene locus_tag LOCUS_33260 gene gdhB 13830 8977 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 protein_id gnl|my_center|LOCUS_33260 14065 15021 gene locus_tag LOCUS_33270 14065 15021 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_33270 15029 15970 gene locus_tag LOCUS_33280 15029 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_33280 15967 16443 gene locus_tag LOCUS_33290 15967 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 16440 17486 gene locus_tag LOCUS_33300 16440 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_33300 17483 19435 gene locus_tag LOCUS_33310 17483 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 19419 21146 gene locus_tag LOCUS_33320 19419 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_33320 21417 21211 gene locus_tag LOCUS_33330 gene cspA 21417 21211 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_33330 21667 21503 gene locus_tag LOCUS_33340 21667 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 24448 21791 gene locus_tag LOCUS_33350 gene pepN 24448 21791 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_33350 25289 24453 gene locus_tag LOCUS_33360 25289 24453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_33360 25544 25290 gene locus_tag LOCUS_33370 25544 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_33370 26418 25561 gene locus_tag LOCUS_33380 26418 25561 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_33380 27302 26418 gene locus_tag LOCUS_33390 gene nadK 27302 26418 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 protein_id gnl|my_center|LOCUS_33390 27433 28323 gene locus_tag LOCUS_33400 27433 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 protein_id gnl|my_center|LOCUS_33400 28406 29281 gene locus_tag LOCUS_33410 28406 29281 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_33410 29295 29693 gene locus_tag LOCUS_33420 29295 29693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_33420 30044 29856 gene locus_tag LOCUS_33430 30044 29856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 31216 30338 gene locus_tag LOCUS_33440 31216 30338 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_33440 31686 31270 gene locus_tag LOCUS_33450 31686 31270 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_33450 32475 31732 gene locus_tag LOCUS_33460 32475 31732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_33460 33828 32482 gene locus_tag LOCUS_33470 33828 32482 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_33470 34650 33931 gene locus_tag LOCUS_33480 34650 33931 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538235.1 protein_id gnl|my_center|LOCUS_33480 34803 36872 gene locus_tag LOCUS_33490 34803 36872 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_33490 36956 38464 gene locus_tag LOCUS_33500 36956 38464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 40454 38490 gene locus_tag LOCUS_33510 40454 38490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 40921 42387 gene locus_tag LOCUS_33520 40921 42387 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908220.1 protein_id gnl|my_center|LOCUS_33520 43066 42416 gene locus_tag LOCUS_33530 gene azoR3 43066 42416 CDS product FMN-dependent NADH-azoreductase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ17 protein_id gnl|my_center|LOCUS_33530 44113 43250 gene locus_tag LOCUS_33540 gene dcyD 44113 43250 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_33540 45147 44158 gene locus_tag LOCUS_33550 gene lipA 45147 44158 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_33550 45310 46035 gene locus_tag LOCUS_33560 gene frdC 45310 46035 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06912 protein_id gnl|my_center|LOCUS_33560 46039 48021 gene locus_tag LOCUS_33570 gene frdA 46039 48021 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070758.1 protein_id gnl|my_center|LOCUS_33570 48018 48767 gene locus_tag LOCUS_33580 gene frdB 48018 48767 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06914 protein_id gnl|my_center|LOCUS_33580 50137 48764 gene locus_tag LOCUS_33590 50137 48764 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 protein_id gnl|my_center|LOCUS_33590 50420 50788 gene locus_tag LOCUS_33600 50420 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 50754 51374 gene locus_tag LOCUS_33610 50754 51374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 52744 51458 gene locus_tag LOCUS_33620 52744 51458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 55565 52755 gene locus_tag LOCUS_33630 55565 52755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 57920 55581 gene locus_tag LOCUS_33640 57920 55581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 59175 58306 gene locus_tag LOCUS_33650 59175 58306 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_33650 61625 59172 gene locus_tag LOCUS_33660 gene fadE 61625 59172 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_33660 62963 61785 gene locus_tag LOCUS_33670 gene yhhT 62963 61785 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 protein_id gnl|my_center|LOCUS_33670 63800 63009 gene locus_tag LOCUS_33680 gene gloB 63800 63009 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_33680 64042 65460 gene locus_tag LOCUS_33690 64042 65460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_33690 65496 67250 gene locus_tag LOCUS_33700 65496 67250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 69108 67279 gene locus_tag LOCUS_33710 69108 67279 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_33710 69688 69233 gene locus_tag LOCUS_33720 69688 69233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 70913 69972 gene locus_tag LOCUS_33730 70913 69972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33730 71315 72310 gene locus_tag LOCUS_33740 71315 72310 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_33740 73156 72323 gene locus_tag LOCUS_33750 73156 72323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 74682 73207 gene locus_tag LOCUS_33760 74682 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 74971 74765 gene locus_tag LOCUS_33770 74971 74765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 75526 75161 gene locus_tag LOCUS_33780 75526 75161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 75886 76332 gene locus_tag LOCUS_33790 gene mscL 75886 76332 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD14 protein_id gnl|my_center|LOCUS_33790 77483 76392 gene locus_tag LOCUS_33800 77483 76392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022099.1 protein_id gnl|my_center|LOCUS_33800 77710 78027 gene locus_tag LOCUS_33810 77710 78027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 78164 78772 gene locus_tag LOCUS_33820 78164 78772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 80222 78882 gene locus_tag LOCUS_33830 gene rhlE 80222 78882 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_33830 80503 80318 gene locus_tag LOCUS_33840 80503 80318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 80922 80506 gene locus_tag LOCUS_33850 80922 80506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458018.1 protein_id gnl|my_center|LOCUS_33850 81658 81002 gene locus_tag LOCUS_33860 81658 81002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33860 82756 81665 gene locus_tag LOCUS_33870 82756 81665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33870 82987 82778 gene locus_tag LOCUS_33880 82987 82778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_33880 83264 83977 gene locus_tag LOCUS_33890 83264 83977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 84945 84184 gene locus_tag LOCUS_33900 84945 84184 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_33900 85330 85599 gene locus_tag LOCUS_33910 85330 85599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 85766 86638 gene locus_tag LOCUS_33920 gene aes 85766 86638 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence19 2713 1709 gene locus_tag LOCUS_33930 2713 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3055 4071 gene locus_tag LOCUS_33940 3055 4071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_33940 4306 4980 gene locus_tag LOCUS_33950 4306 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 5051 6367 gene locus_tag LOCUS_33960 5051 6367 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_33960 6649 6491 gene locus_tag LOCUS_33970 6649 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 6629 7204 gene locus_tag LOCUS_33980 6629 7204 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 protein_id gnl|my_center|LOCUS_33980 7444 8427 gene locus_tag LOCUS_33990 7444 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 8494 9933 gene locus_tag LOCUS_34000 gene calB 8494 9933 CDS product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C8 protein_id gnl|my_center|LOCUS_34000 10830 10036 gene locus_tag LOCUS_34010 10830 10036 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933431.1 protein_id gnl|my_center|LOCUS_34010 10922 11530 gene locus_tag LOCUS_34020 10922 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 11657 12478 gene locus_tag LOCUS_34030 11657 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 13693 12536 gene locus_tag LOCUS_34040 13693 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140031.1 protein_id gnl|my_center|LOCUS_34040 13867 14865 gene locus_tag LOCUS_34050 13867 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 14937 15908 gene locus_tag LOCUS_34060 14937 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 15970 16653 gene locus_tag LOCUS_34070 gene fnr 15970 16653 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036975.1 protein_id gnl|my_center|LOCUS_34070 17379 16744 gene locus_tag LOCUS_34080 17379 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 17472 18170 gene locus_tag LOCUS_34090 17472 18170 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537831.1 protein_id gnl|my_center|LOCUS_34090 18170 19111 gene locus_tag LOCUS_34100 18170 19111 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537829.1 protein_id gnl|my_center|LOCUS_34100 19108 20037 gene locus_tag LOCUS_34110 19108 20037 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384693.1 protein_id gnl|my_center|LOCUS_34110 20047 20826 gene locus_tag LOCUS_34120 20047 20826 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064405.1 protein_id gnl|my_center|LOCUS_34120 20819 21706 gene locus_tag LOCUS_34130 20819 21706 CDS product isocitrate lyase family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_34130 21706 22656 gene locus_tag LOCUS_34140 21706 22656 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_34140 22653 23675 gene locus_tag LOCUS_34150 22653 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141688.1 protein_id gnl|my_center|LOCUS_34150 24678 23731 gene locus_tag LOCUS_34160 gene hmgCl 24678 23731 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_34160 24794 25987 gene locus_tag LOCUS_34170 24794 25987 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_34170 26612 25998 gene locus_tag LOCUS_34180 gene leuD 26612 25998 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AI8 protein_id gnl|my_center|LOCUS_34180 28045 26612 gene locus_tag LOCUS_34190 gene leuC1 28045 26612 CDS product 3-isopropylmalate dehydratase large subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X98 protein_id gnl|my_center|LOCUS_34190 29120 28131 gene locus_tag LOCUS_34200 29120 28131 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_34200 29244 30143 gene locus_tag LOCUS_34210 29244 30143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 30152 31069 gene locus_tag LOCUS_34220 gene hmgL 30152 31069 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 protein_id gnl|my_center|LOCUS_34220 32288 31074 gene locus_tag LOCUS_34230 32288 31074 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_34230 33101 32676 gene locus_tag LOCUS_34240 33101 32676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 33216 34631 gene locus_tag LOCUS_34250 gene putP 33216 34631 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_34250 35795 34632 gene locus_tag LOCUS_34260 35795 34632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140031.1 protein_id gnl|my_center|LOCUS_34260 35983 38562 gene locus_tag LOCUS_34270 35983 38562 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390090.1 protein_id gnl|my_center|LOCUS_34270 38697 39320 gene locus_tag LOCUS_34280 38697 39320 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_34280 39677 39336 gene locus_tag LOCUS_34290 39677 39336 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409542.1 protein_id gnl|my_center|LOCUS_34290 40944 39799 gene locus_tag LOCUS_34300 40944 39799 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028836.1 protein_id gnl|my_center|LOCUS_34300 41266 41772 gene locus_tag LOCUS_34310 41266 41772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 43586 41877 gene locus_tag LOCUS_34320 43586 41877 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_34320 43696 44790 gene locus_tag LOCUS_34330 43696 44790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 45043 44738 gene locus_tag LOCUS_34340 45043 44738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 45111 47261 gene locus_tag LOCUS_34350 45111 47261 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_34350 47364 47870 gene locus_tag LOCUS_34360 gene ftn 47364 47870 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK9 protein_id gnl|my_center|LOCUS_34360 47931 48869 gene locus_tag LOCUS_34370 gene zitB 47931 48869 CDS product cation efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_34370 49519 48878 gene locus_tag LOCUS_34380 49519 48878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 49730 51211 gene locus_tag LOCUS_34390 49730 51211 CDS product endoglycosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224247.1 protein_id gnl|my_center|LOCUS_34390 52225 51230 gene locus_tag LOCUS_34400 52225 51230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 53635 52301 gene locus_tag LOCUS_34410 53635 52301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918796.1 protein_id gnl|my_center|LOCUS_34410 53849 53652 gene locus_tag LOCUS_34420 53849 53652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 53841 54809 gene locus_tag LOCUS_34430 53841 54809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 54858 55220 gene locus_tag LOCUS_34440 54858 55220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067137.1 protein_id gnl|my_center|LOCUS_34440 55410 55550 gene locus_tag LOCUS_34450 55410 55550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 56015 55587 gene locus_tag LOCUS_34460 56015 55587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 56165 57784 gene locus_tag LOCUS_34470 56165 57784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 57804 58772 gene locus_tag LOCUS_34480 57804 58772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086271.1 protein_id gnl|my_center|LOCUS_34480 58859 59386 gene locus_tag LOCUS_34490 58859 59386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957322.1 protein_id gnl|my_center|LOCUS_34490 59513 59869 gene locus_tag LOCUS_34500 59513 59869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_34500 59964 61463 gene locus_tag LOCUS_34510 59964 61463 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143678.1 protein_id gnl|my_center|LOCUS_34510 63078 61456 gene locus_tag LOCUS_34520 63078 61456 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_34520 63380 64969 gene locus_tag LOCUS_34530 63380 64969 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_34530 65473 64988 gene locus_tag LOCUS_34540 65473 64988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 65903 65619 gene locus_tag LOCUS_34550 65903 65619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 66701 66015 gene locus_tag LOCUS_34560 gene baeR 66701 66015 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815798.1 protein_id gnl|my_center|LOCUS_34560 68146 66698 gene locus_tag LOCUS_34570 68146 66698 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675178.1 protein_id gnl|my_center|LOCUS_34570 68614 68159 gene locus_tag LOCUS_34580 68614 68159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 69742 68762 gene locus_tag LOCUS_34590 69742 68762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 69949 71574 gene locus_tag LOCUS_34600 69949 71574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 71767 72168 gene locus_tag LOCUS_34610 71767 72168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 72188 72550 gene locus_tag LOCUS_34620 72188 72550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_34620 73604 72540 gene locus_tag LOCUS_34630 73604 72540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022099.1 protein_id gnl|my_center|LOCUS_34630 74573 73764 gene locus_tag LOCUS_34640 74573 73764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 75247 74843 gene locus_tag LOCUS_34650 75247 74843 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AD90 protein_id gnl|my_center|LOCUS_34650 76590 75262 gene locus_tag LOCUS_34660 76590 75262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 78384 76654 gene locus_tag LOCUS_34670 78384 76654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence20 891 289 gene locus_tag LOCUS_34680 gene msrQ 891 289 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PA99 protein_id gnl|my_center|LOCUS_34680 1904 891 gene locus_tag LOCUS_34690 gene msrP 1904 891 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA4 protein_id gnl|my_center|LOCUS_34690 2840 1965 gene locus_tag LOCUS_34700 gene pssA 2840 1965 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_34700 3773 2865 gene locus_tag LOCUS_34710 gene ilvY 3773 2865 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 protein_id gnl|my_center|LOCUS_34710 3893 5365 gene locus_tag LOCUS_34720 gene ilvC 3893 5365 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_34720 6180 5689 gene locus_tag LOCUS_34730 gene ilvH 6180 5689 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_34730 7927 6182 gene locus_tag LOCUS_34740 gene ilvI 7927 6182 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_34740 8276 8866 gene locus_tag LOCUS_34750 8276 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 11521 8936 gene locus_tag LOCUS_34760 gene clpB 11521 8936 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 protein_id gnl|my_center|LOCUS_34760 12394 11633 gene locus_tag LOCUS_34770 12394 11633 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_34770 13349 12369 gene locus_tag LOCUS_34780 gene rluD 13349 12369 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33640 protein_id gnl|my_center|LOCUS_34780 13456 14325 gene locus_tag LOCUS_34790 gene bamD 13456 14325 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 protein_id gnl|my_center|LOCUS_34790 15985 14354 gene locus_tag LOCUS_34800 gene nadE 15985 14354 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_34800 16123 17748 gene locus_tag LOCUS_34810 gene pilS 16123 17748 CDS product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 protein_id gnl|my_center|LOCUS_34810 17748 19127 gene locus_tag LOCUS_34820 17748 19127 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266589.1 protein_id gnl|my_center|LOCUS_34820 19651 19208 gene locus_tag LOCUS_34830 19651 19208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 22939 19688 gene locus_tag LOCUS_34840 22939 19688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 23442 22954 gene locus_tag LOCUS_34850 23442 22954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 24489 23503 gene locus_tag LOCUS_34860 gene pilW 24489 23503 CDS product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_34860 25151 24510 gene locus_tag LOCUS_34870 25151 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 25699 25136 gene locus_tag LOCUS_34880 25699 25136 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_34880 26773 25823 gene locus_tag LOCUS_34890 gene ispH 26773 25823 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ1 protein_id gnl|my_center|LOCUS_34890 27284 26835 gene locus_tag LOCUS_34900 27284 26835 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_34900 27814 27284 gene locus_tag LOCUS_34910 gene lspA 27814 27284 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_34910 30587 27783 gene locus_tag LOCUS_34920 gene ileS 30587 27783 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI4 protein_id gnl|my_center|LOCUS_34920 31537 30605 gene locus_tag LOCUS_34930 gene ribF 31537 30605 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_34930 33264 31669 gene locus_tag LOCUS_34940 gene mviN 33264 31669 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_34940 33908 33288 gene locus_tag LOCUS_34950 33908 33288 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 protein_id gnl|my_center|LOCUS_34950 34918 33905 gene locus_tag LOCUS_34960 gene pyrB 34918 33905 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_34960 36474 35026 gene locus_tag LOCUS_34970 gene sbcB 36474 35026 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_34970 37990 36467 gene locus_tag LOCUS_34980 37990 36467 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_34980 38879 38097 gene locus_tag LOCUS_34990 38879 38097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 39606 38986 gene locus_tag LOCUS_35000 39606 38986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_35000 41427 39757 gene locus_tag LOCUS_35010 gene groL 41427 39757 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 protein_id gnl|my_center|LOCUS_35010 41781 41491 gene locus_tag LOCUS_35020 gene groS 41781 41491 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP19 protein_id gnl|my_center|LOCUS_35020 42419 41991 gene locus_tag LOCUS_35030 42419 41991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 42547 42861 gene locus_tag LOCUS_35040 42547 42861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 43782 42892 gene locus_tag LOCUS_35050 43782 42892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 44863 43940 gene locus_tag LOCUS_35060 44863 43940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 45141 49640 gene locus_tag LOCUS_35070 45141 49640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 49977 49807 gene locus_tag LOCUS_35080 49977 49807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 51602 52945 gene locus_tag LOCUS_35090 51602 52945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 53063 53965 gene locus_tag LOCUS_35100 53063 53965 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH6 protein_id gnl|my_center|LOCUS_35100 54822 53971 gene locus_tag LOCUS_35110 54822 53971 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_35110 54903 55475 gene locus_tag LOCUS_35120 gene tag 54903 55475 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_35120 55515 56885 gene locus_tag LOCUS_35130 55515 56885 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_35130 56991 58295 gene locus_tag LOCUS_35140 56991 58295 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921028.1 protein_id gnl|my_center|LOCUS_35140 58311 59168 gene locus_tag LOCUS_35150 58311 59168 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_35150 59716 59165 gene locus_tag LOCUS_35160 gene gpm 59716 59165 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_35160 60441 59734 gene locus_tag LOCUS_35170 60441 59734 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_35170 62243 60441 gene locus_tag LOCUS_35180 gene aceK 62243 60441 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM4 protein_id gnl|my_center|LOCUS_35180 63290 62250 gene locus_tag LOCUS_35190 63290 62250 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_35190 64339 63485 gene locus_tag LOCUS_35200 gene ybbN 64339 63485 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037937.1 protein_id gnl|my_center|LOCUS_35200 65224 64421 gene locus_tag LOCUS_35210 gene dapB 65224 64421 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 protein_id gnl|my_center|LOCUS_35210 66351 65221 gene locus_tag LOCUS_35220 gene dnaJ 66351 65221 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP1 protein_id gnl|my_center|LOCUS_35220 68398 66467 gene locus_tag LOCUS_35230 gene dnaK 68398 66467 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP7 protein_id gnl|my_center|LOCUS_35230 69151 68567 gene locus_tag LOCUS_35240 gene grpE 69151 68567 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP6 protein_id gnl|my_center|LOCUS_35240 70365 69328 gene locus_tag LOCUS_35250 gene hrcA 70365 69328 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_35250 70508 72163 gene locus_tag LOCUS_35260 gene recN 70508 72163 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WN8 protein_id gnl|my_center|LOCUS_35260 72657 72232 gene locus_tag LOCUS_35270 gene fur 72657 72232 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 protein_id gnl|my_center|LOCUS_35270 72732 73139 gene locus_tag LOCUS_35280 72732 73139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 73501 73172 gene locus_tag LOCUS_35290 73501 73172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 73925 73494 gene locus_tag LOCUS_35300 73925 73494 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600190.1 protein_id gnl|my_center|LOCUS_35300 75302 73950 gene locus_tag LOCUS_35310 75302 73950 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_35310 75414 75905 gene locus_tag LOCUS_35320 gene smpB 75414 75905 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV40 protein_id gnl|my_center|LOCUS_35320 76355 80140 gene locus_tag LOCUS_35330 76355 80140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence21 410 1315 gene locus_tag LOCUS_35340 gene czcD 410 1315 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_35340 1857 2375 gene locus_tag LOCUS_35350 1857 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402896.1 protein_id gnl|my_center|LOCUS_35350 2411 2977 gene locus_tag LOCUS_35360 2411 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 4640 3813 gene locus_tag LOCUS_35370 4640 3813 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883951.1 protein_id gnl|my_center|LOCUS_35370 6130 4664 gene locus_tag LOCUS_35380 gene aldA 6130 4664 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_35380 6948 6175 gene locus_tag LOCUS_35390 6948 6175 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140119.1 protein_id gnl|my_center|LOCUS_35390 7845 6964 gene locus_tag LOCUS_35400 7845 6964 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNY3 protein_id gnl|my_center|LOCUS_35400 7951 8997 gene locus_tag LOCUS_35410 7951 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 9010 9411 gene locus_tag LOCUS_35420 9010 9411 CDS product putative 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701963.1 protein_id gnl|my_center|LOCUS_35420 9654 9421 gene locus_tag LOCUS_35430 9654 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 10450 9635 gene locus_tag LOCUS_35440 gene fdhD 10450 9635 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_35440 12683 10443 gene locus_tag LOCUS_35450 gene fdsA 12683 10443 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35450 13292 12744 gene locus_tag LOCUS_35460 13292 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35460 14820 13294 gene locus_tag LOCUS_35470 14820 13294 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_35470 15278 14817 gene locus_tag LOCUS_35480 gene fdsG 15278 14817 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 protein_id gnl|my_center|LOCUS_35480 16384 15278 gene locus_tag LOCUS_35490 16384 15278 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_35490 16506 17381 gene locus_tag LOCUS_35500 16506 17381 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_35500 17540 18547 gene locus_tag LOCUS_35510 17540 18547 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_35510 19155 18598 gene locus_tag LOCUS_35520 19155 18598 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369652.1 protein_id gnl|my_center|LOCUS_35520 20121 19465 gene locus_tag LOCUS_35530 20121 19465 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_35530 20592 20167 gene locus_tag LOCUS_35540 20592 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 21423 20680 gene locus_tag LOCUS_35550 21423 20680 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_35550 22376 21534 gene locus_tag LOCUS_35560 22376 21534 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_35560 22656 23303 gene locus_tag LOCUS_35570 22656 23303 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 protein_id gnl|my_center|LOCUS_35570 23416 24312 gene locus_tag LOCUS_35580 23416 24312 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_35580 24418 25332 gene locus_tag LOCUS_35590 gene galE 24418 25332 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45291 protein_id gnl|my_center|LOCUS_35590 26765 25371 gene locus_tag LOCUS_35600 26765 25371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704906.1 protein_id gnl|my_center|LOCUS_35600 28000 26837 gene locus_tag LOCUS_35610 28000 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 29188 28244 gene locus_tag LOCUS_35620 29188 28244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 29976 29296 gene locus_tag LOCUS_35630 gene folE 29976 29296 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E4 protein_id gnl|my_center|LOCUS_35630 35769 30157 gene locus_tag LOCUS_35640 35769 30157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 37960 36545 gene locus_tag LOCUS_35650 37960 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 38213 38046 gene locus_tag LOCUS_35660 38213 38046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 38476 39663 gene locus_tag LOCUS_35670 38476 39663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_35670 39775 41046 gene locus_tag LOCUS_35680 39775 41046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704109.1 protein_id gnl|my_center|LOCUS_35680 41103 41924 gene locus_tag LOCUS_35690 41103 41924 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_35690 41978 42328 gene locus_tag LOCUS_35700 41978 42328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 42372 43934 gene locus_tag LOCUS_35710 42372 43934 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 protein_id gnl|my_center|LOCUS_35710 43977 44225 gene locus_tag LOCUS_35720 43977 44225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 44412 46190 gene locus_tag LOCUS_35730 44412 46190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_35730 46216 47601 gene locus_tag LOCUS_35740 46216 47601 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_35740 47683 48210 gene locus_tag LOCUS_35750 47683 48210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 48203 48589 gene locus_tag LOCUS_35760 48203 48589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 48602 49093 gene locus_tag LOCUS_35770 48602 49093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 49348 49791 gene locus_tag LOCUS_35780 49348 49791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 50361 49945 gene locus_tag LOCUS_35790 50361 49945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 51050 50523 gene locus_tag LOCUS_35800 51050 50523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 51476 52204 gene locus_tag LOCUS_35810 51476 52204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 55092 52336 gene locus_tag LOCUS_35820 55092 52336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 56591 55323 gene locus_tag LOCUS_35830 56591 55323 CDS product cytochrome P450 steroid C27-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_35830 58190 56751 gene locus_tag LOCUS_35840 58190 56751 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_35840 58339 59595 gene locus_tag LOCUS_35850 58339 59595 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917952.1 protein_id gnl|my_center|LOCUS_35850 60534 59659 gene locus_tag LOCUS_35860 60534 59659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 62824 60740 gene locus_tag LOCUS_35870 gene fusA2 62824 60740 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 protein_id gnl|my_center|LOCUS_35870 63106 63948 gene locus_tag LOCUS_35880 63106 63948 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189208.1 protein_id gnl|my_center|LOCUS_35880 65883 63967 gene locus_tag LOCUS_35890 65883 63967 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_35890 67006 65930 gene locus_tag LOCUS_35900 67006 65930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_35900 67220 68686 gene locus_tag LOCUS_35910 gene glcD 67220 68686 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_35910 68679 69764 gene locus_tag LOCUS_35920 gene glcE 68679 69764 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943052.1 protein_id gnl|my_center|LOCUS_35920 69778 71013 gene locus_tag LOCUS_35930 gene glcF 69778 71013 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R29 protein_id gnl|my_center|LOCUS_35930 71063 71497 gene locus_tag LOCUS_35940 71063 71497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 72336 71530 gene locus_tag LOCUS_35950 72336 71530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 72828 72592 gene locus_tag LOCUS_35960 72828 72592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 75107 72828 gene locus_tag LOCUS_35970 75107 72828 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272564.1 protein_id gnl|my_center|LOCUS_35970 75234 75731 gene locus_tag LOCUS_35980 75234 75731 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265579.1 protein_id gnl|my_center|LOCUS_35980 75964 >76987 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtagttccctctctcaccccggatgactacaat >Feature sequence22 83 439 gene locus_tag LOCUS_35990 83 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 436 792 gene locus_tag LOCUS_36000 436 792 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 protein_id gnl|my_center|LOCUS_36000 880 2421 gene locus_tag LOCUS_36010 880 2421 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381397.1 protein_id gnl|my_center|LOCUS_36010 3242 2781 gene locus_tag LOCUS_36020 3242 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702665.1 protein_id gnl|my_center|LOCUS_36020 5299 3311 gene locus_tag LOCUS_36030 gene hppA1 5299 3311 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_36030 5400 6242 gene locus_tag LOCUS_36040 5400 6242 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNZ7 protein_id gnl|my_center|LOCUS_36040 6361 8292 gene locus_tag LOCUS_36050 gene mnmG 6361 8292 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 protein_id gnl|my_center|LOCUS_36050 8294 8920 gene locus_tag LOCUS_36060 gene rsmG 8294 8920 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT10 protein_id gnl|my_center|LOCUS_36060 9003 9767 gene locus_tag LOCUS_36070 9003 9767 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458453.1 protein_id gnl|my_center|LOCUS_36070 9800 10699 gene locus_tag LOCUS_36080 9800 10699 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_36080 11011 11400 gene locus_tag LOCUS_36090 11011 11400 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555989.1 protein_id gnl|my_center|LOCUS_36090 11423 12304 gene locus_tag LOCUS_36100 gene atpB 11423 12304 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_36100 12353 12583 gene locus_tag LOCUS_36110 gene atpE 12353 12583 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY3 protein_id gnl|my_center|LOCUS_36110 12649 13119 gene locus_tag LOCUS_36120 gene atpF 12649 13119 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL20 protein_id gnl|my_center|LOCUS_36120 13132 13668 gene locus_tag LOCUS_36130 gene atpH 13132 13668 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_36130 13699 15243 gene locus_tag LOCUS_36140 gene atpA 13699 15243 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 protein_id gnl|my_center|LOCUS_36140 15259 16122 gene locus_tag LOCUS_36150 gene atpG 15259 16122 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_36150 16143 17627 gene locus_tag LOCUS_36160 gene atpD 16143 17627 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_36160 17671 18099 gene locus_tag LOCUS_36170 gene atpC 17671 18099 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_36170 18285 19655 gene locus_tag LOCUS_36180 gene glmU 18285 19655 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT22 protein_id gnl|my_center|LOCUS_36180 19658 21487 gene locus_tag LOCUS_36190 gene glmS 19658 21487 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 protein_id gnl|my_center|LOCUS_36190 22102 21497 gene locus_tag LOCUS_36200 22102 21497 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640024.1 protein_id gnl|my_center|LOCUS_36200 22888 22139 gene locus_tag LOCUS_36210 22888 22139 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_36210 23022 23474 gene locus_tag LOCUS_36220 23022 23474 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097204.1 protein_id gnl|my_center|LOCUS_36220 23968 23600 gene locus_tag LOCUS_36230 23968 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 25145 24051 gene locus_tag LOCUS_36240 25145 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 25289 27439 gene locus_tag LOCUS_36250 gene uvrD 25289 27439 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_36250 27467 28627 gene locus_tag LOCUS_36260 27467 28627 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_36260 29129 28737 gene locus_tag LOCUS_36270 29129 28737 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_36270 30542 29184 gene locus_tag LOCUS_36280 30542 29184 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_36280 31057 30542 gene locus_tag LOCUS_36290 31057 30542 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_36290 31159 31938 gene locus_tag LOCUS_36300 31159 31938 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_36300 33132 31960 gene locus_tag LOCUS_36310 33132 31960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_36310 33994 33125 gene locus_tag LOCUS_36320 gene ubiA 33994 33125 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB4 protein_id gnl|my_center|LOCUS_36320 34681 34028 gene locus_tag LOCUS_36330 34681 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 34896 36266 gene locus_tag LOCUS_36340 gene rubB 34896 36266 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 protein_id gnl|my_center|LOCUS_36340 36295 36843 gene locus_tag LOCUS_36350 36295 36843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_36350 39040 36974 gene locus_tag LOCUS_36360 gene recG 39040 36974 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL3 protein_id gnl|my_center|LOCUS_36360 39948 39046 gene locus_tag LOCUS_36370 gene oxyR 39948 39046 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_36370 40004 40870 gene locus_tag LOCUS_36380 40004 40870 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_36380 42054 40894 gene locus_tag LOCUS_36390 42054 40894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 42477 42094 gene locus_tag LOCUS_36400 42477 42094 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_36400 44611 42494 gene locus_tag LOCUS_36410 gene spoT 44611 42494 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_36410 44925 44665 gene locus_tag LOCUS_36420 gene rpoZ 44925 44665 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM1 protein_id gnl|my_center|LOCUS_36420 45754 45137 gene locus_tag LOCUS_36430 gene gmk 45754 45137 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_36430 46633 45767 gene locus_tag LOCUS_36440 46633 45767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_36440 46953 46630 gene locus_tag LOCUS_36450 46953 46630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 46882 47601 gene locus_tag LOCUS_36460 gene rph 46882 47601 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_36460 48385 47621 gene locus_tag LOCUS_36470 gene xth 48385 47621 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946385.1 protein_id gnl|my_center|LOCUS_36470 48647 49282 gene locus_tag LOCUS_36480 gene pyrE 48647 49282 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGJ9 protein_id gnl|my_center|LOCUS_36480 49349 49978 gene locus_tag LOCUS_36490 49349 49978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769563.1 protein_id gnl|my_center|LOCUS_36490 50634 50053 gene locus_tag LOCUS_36500 gene slmA 50634 50053 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_36500 51693 50791 gene locus_tag LOCUS_36510 gene argB 51693 50791 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_36510 54358 51740 gene locus_tag LOCUS_36520 54358 51740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 55702 54512 gene locus_tag LOCUS_36530 gene coaBC 55702 54512 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_36530 >Feature sequence23 1724 429 gene locus_tag LOCUS_36540 gene tyrS 1724 429 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E424 protein_id gnl|my_center|LOCUS_36540 1883 3298 gene locus_tag LOCUS_36550 1883 3298 CDS product family M23 zinc metallopeptidase with OapA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_36550 3300 4451 gene locus_tag LOCUS_36560 gene anmK 3300 4451 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_36560 4801 4448 gene locus_tag LOCUS_36570 gene erpA 4801 4448 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_36570 5330 4872 gene locus_tag LOCUS_36580 5330 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 6057 5317 gene locus_tag LOCUS_36590 6057 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 7103 6072 gene locus_tag LOCUS_36600 gene argC 7103 6072 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 protein_id gnl|my_center|LOCUS_36600 7267 9000 gene locus_tag LOCUS_36610 7267 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 9033 9452 gene locus_tag LOCUS_36620 9033 9452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_36620 10077 9493 gene locus_tag LOCUS_36630 10077 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 10214 11443 gene locus_tag LOCUS_36640 10214 11443 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_36640 11939 14905 gene locus_tag LOCUS_36650 11939 14905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 14979 15767 gene locus_tag LOCUS_36660 gene lgt 14979 15767 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1A4 protein_id gnl|my_center|LOCUS_36660 15868 16803 gene locus_tag LOCUS_36670 15868 16803 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_36670 16800 17642 gene locus_tag LOCUS_36680 16800 17642 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_36680 17655 18881 gene locus_tag LOCUS_36690 17655 18881 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_36690 18887 20653 gene locus_tag LOCUS_36700 18887 20653 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_36700 20928 22208 gene locus_tag LOCUS_36710 gene hemL 20928 22208 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY9 protein_id gnl|my_center|LOCUS_36710 22223 23236 gene locus_tag LOCUS_36720 gene hemB 22223 23236 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_36720 23244 23852 gene locus_tag LOCUS_36730 23244 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 23943 25139 gene locus_tag LOCUS_36740 23943 25139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 25740 25168 gene locus_tag LOCUS_36750 25740 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 25937 27451 gene locus_tag LOCUS_36760 25937 27451 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_36760 30476 27432 gene locus_tag LOCUS_36770 30476 27432 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 protein_id gnl|my_center|LOCUS_36770 31638 30499 gene locus_tag LOCUS_36780 31638 30499 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_36780 32172 31741 gene locus_tag LOCUS_36790 32172 31741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 34433 32175 gene locus_tag LOCUS_36800 gene mrcB 34433 32175 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_36800 34600 35601 gene locus_tag LOCUS_36810 34600 35601 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_36810 37963 35609 gene locus_tag LOCUS_36820 gene polB 37963 35609 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2L1 protein_id gnl|my_center|LOCUS_36820 38100 38444 gene locus_tag LOCUS_36830 38100 38444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 protein_id gnl|my_center|LOCUS_36830 39524 38499 gene locus_tag LOCUS_36840 39524 38499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_36840 39999 39538 gene locus_tag LOCUS_36850 39999 39538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073653.1 protein_id gnl|my_center|LOCUS_36850 40275 40021 gene locus_tag LOCUS_36860 40275 40021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 40163 41944 gene locus_tag LOCUS_36870 40163 41944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 42158 42601 gene locus_tag LOCUS_36880 gene aroQ1 42158 42601 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_36880 42623 43090 gene locus_tag LOCUS_36890 42623 43090 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 protein_id gnl|my_center|LOCUS_36890 43127 44473 gene locus_tag LOCUS_36900 gene accC 43127 44473 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_36900 44519 45412 gene locus_tag LOCUS_36910 gene prmA 44519 45412 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67689 protein_id gnl|my_center|LOCUS_36910 45609 46595 gene locus_tag LOCUS_36920 gene dusB 45609 46595 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN38 protein_id gnl|my_center|LOCUS_36920 46592 46915 gene locus_tag LOCUS_36930 46592 46915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 46929 48503 gene locus_tag LOCUS_36940 gene purH 46929 48503 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KT0 protein_id gnl|my_center|LOCUS_36940 48697 49980 gene locus_tag LOCUS_36950 gene purD 48697 49980 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV81 protein_id gnl|my_center|LOCUS_36950 50023 50667 gene locus_tag LOCUS_36960 gene coq7 50023 50667 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z8 protein_id gnl|my_center|LOCUS_36960 52116 51685 gene locus_tag LOCUS_36970 52116 51685 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_36970 52236 52880 gene locus_tag LOCUS_36980 52236 52880 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401959.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence24 736 158 gene locus_tag LOCUS_36990 gene infC 736 158 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG6 protein_id gnl|my_center|LOCUS_36990 2621 696 gene locus_tag LOCUS_37000 gene thrS 2621 696 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883H9 protein_id gnl|my_center|LOCUS_37000 4789 2771 gene locus_tag LOCUS_37010 gene uvrB 4789 2771 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 protein_id gnl|my_center|LOCUS_37010 4946 5021 gene locus_tag LOCUS_t00340 4946 5021 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7792 5183 gene locus_tag LOCUS_37020 7792 5183 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920555.1 protein_id gnl|my_center|LOCUS_37020 11033 7881 gene locus_tag LOCUS_37030 11033 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 11298 12287 gene locus_tag LOCUS_37040 gene xynB 11298 12287 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038153.1 protein_id gnl|my_center|LOCUS_37040 12347 13003 gene locus_tag LOCUS_37050 12347 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 13148 13591 gene locus_tag LOCUS_37060 13148 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 13588 14334 gene locus_tag LOCUS_37070 13588 14334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_37070 14328 14561 gene locus_tag LOCUS_37080 14328 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 14645 14962 gene locus_tag LOCUS_37090 14645 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 15010 16785 gene locus_tag LOCUS_37100 15010 16785 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974357.1 protein_id gnl|my_center|LOCUS_37100 16906 18267 gene locus_tag LOCUS_37110 16906 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_37110 20226 18322 gene locus_tag LOCUS_37120 20226 18322 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533629.1 protein_id gnl|my_center|LOCUS_37120 20617 20787 gene locus_tag LOCUS_37130 20617 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 21374 26395 gene locus_tag LOCUS_37140 21374 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 26521 26937 gene locus_tag LOCUS_37150 26521 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 29026 27005 gene locus_tag LOCUS_37160 gene wbfY 29026 27005 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_37160 30088 29102 gene locus_tag LOCUS_37170 gene wbpL 30088 29102 CDS product glycosyltransferase WbpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 protein_id gnl|my_center|LOCUS_37170 31026 30085 gene locus_tag LOCUS_37180 31026 30085 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_37180 31494 31090 gene locus_tag LOCUS_37190 31494 31090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 32385 31690 gene locus_tag LOCUS_37200 gene pyrF 32385 31690 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEI4 protein_id gnl|my_center|LOCUS_37200 32690 32382 gene locus_tag LOCUS_37210 32690 32382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 33069 32773 gene locus_tag LOCUS_37220 gene ihfB 33069 32773 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N46 protein_id gnl|my_center|LOCUS_37220 34939 33266 gene locus_tag LOCUS_37230 gene rpsA 34939 33266 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_37230 35783 35103 gene locus_tag LOCUS_37240 gene cmk 35783 35103 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 protein_id gnl|my_center|LOCUS_37240 37094 35790 gene locus_tag LOCUS_37250 37094 35790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37250 38013 37105 gene locus_tag LOCUS_37260 38013 37105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 39014 38022 gene locus_tag LOCUS_37270 39014 38022 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_37270 38934 39122 gene locus_tag LOCUS_37280 38934 39122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 40228 39149 gene locus_tag LOCUS_37290 gene serC 40228 39149 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_37290 42913 40265 gene locus_tag LOCUS_37300 gene gyrA 42913 40265 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T6 protein_id gnl|my_center|LOCUS_37300 43231 44571 gene locus_tag LOCUS_37310 43231 44571 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_37310 44568 45278 gene locus_tag LOCUS_37320 gene ubiG 44568 45278 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_37320 45278 45982 gene locus_tag LOCUS_37330 gene gph2 45278 45982 CDS product phosphoglycolate phosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ62 protein_id gnl|my_center|LOCUS_37330 45979 46737 gene locus_tag LOCUS_37340 45979 46737 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_37340 47779 46811 gene locus_tag LOCUS_37350 47779 46811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 48973 47786 gene locus_tag LOCUS_37360 48973 47786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 49886 48975 gene locus_tag LOCUS_37370 49886 48975 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_37370 50164 50240 gene locus_tag LOCUS_t00350 50164 50240 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence25 269 1351 gene locus_tag LOCUS_37380 269 1351 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_37380 1362 1772 gene locus_tag LOCUS_37390 1362 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972585.1 protein_id gnl|my_center|LOCUS_37390 2019 2411 gene locus_tag LOCUS_37400 2019 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 2870 3115 gene locus_tag LOCUS_37410 2870 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 3112 4230 gene locus_tag LOCUS_37420 3112 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 4984 4367 gene locus_tag LOCUS_37430 gene ureG 4984 4367 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E731 protein_id gnl|my_center|LOCUS_37430 5643 5026 gene locus_tag LOCUS_37440 gene ureF 5643 5026 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 protein_id gnl|my_center|LOCUS_37440 5915 5694 gene locus_tag LOCUS_37450 5915 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 6391 5942 gene locus_tag LOCUS_37460 gene ureE 6391 5942 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQM6 protein_id gnl|my_center|LOCUS_37460 8107 6401 gene locus_tag LOCUS_37470 gene ureC2 8107 6401 CDS product urease subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN06 protein_id gnl|my_center|LOCUS_37470 8437 8117 gene locus_tag LOCUS_37480 gene ureB 8437 8117 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RL4 protein_id gnl|my_center|LOCUS_37480 8749 8447 gene locus_tag LOCUS_37490 gene ureA 8749 8447 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK85 protein_id gnl|my_center|LOCUS_37490 9707 8775 gene locus_tag LOCUS_37500 gene ureD 9707 8775 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E725 protein_id gnl|my_center|LOCUS_37500 10067 9717 gene locus_tag LOCUS_37510 10067 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_37510 11411 10176 gene locus_tag LOCUS_37520 gene fmdA 11411 10176 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_37520 12195 11506 gene locus_tag LOCUS_37530 12195 11506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 protein_id gnl|my_center|LOCUS_37530 12980 12228 gene locus_tag LOCUS_37540 12980 12228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_37540 14176 13025 gene locus_tag LOCUS_37550 14176 13025 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 protein_id gnl|my_center|LOCUS_37550 15145 14222 gene locus_tag LOCUS_37560 15145 14222 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_37560 16621 15353 gene locus_tag LOCUS_37570 16621 15353 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 protein_id gnl|my_center|LOCUS_37570 16978 20361 gene locus_tag LOCUS_37580 16978 20361 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_37580 20351 21253 gene locus_tag LOCUS_37590 20351 21253 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888247.1 protein_id gnl|my_center|LOCUS_37590 21787 21287 gene locus_tag LOCUS_37600 21787 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 21980 23104 gene locus_tag LOCUS_37610 21980 23104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 23449 23769 gene locus_tag LOCUS_37620 23449 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 24959 23880 gene locus_tag LOCUS_37630 gene dcyD 24959 23880 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBR4 protein_id gnl|my_center|LOCUS_37630 26442 25264 gene locus_tag LOCUS_37640 26442 25264 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_37640 27208 26444 gene locus_tag LOCUS_37650 27208 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114806.1 protein_id gnl|my_center|LOCUS_37650 28527 27211 gene locus_tag LOCUS_37660 28527 27211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943329.1 protein_id gnl|my_center|LOCUS_37660 30117 28630 gene locus_tag LOCUS_37670 30117 28630 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728258.1 protein_id gnl|my_center|LOCUS_37670 30231 30467 gene locus_tag LOCUS_37680 30231 30467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 30766 30966 gene locus_tag LOCUS_37690 30766 30966 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_37690 32061 31012 gene locus_tag LOCUS_37700 32061 31012 CDS product 3-ketosteroid-9-alpha-hydroxylase oxygenase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728642.1 protein_id gnl|my_center|LOCUS_37700 33773 32058 gene locus_tag LOCUS_37710 33773 32058 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419253.1 protein_id gnl|my_center|LOCUS_37710 33950 34969 gene locus_tag LOCUS_37720 gene gutB 33950 34969 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 protein_id gnl|my_center|LOCUS_37720 35009 35833 gene locus_tag LOCUS_37730 35009 35833 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529196.1 protein_id gnl|my_center|LOCUS_37730 36493 35852 gene locus_tag LOCUS_37740 36493 35852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 36641 38365 gene locus_tag LOCUS_37750 36641 38365 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454668.1 protein_id gnl|my_center|LOCUS_37750 39142 38393 gene locus_tag LOCUS_37760 39142 38393 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_37760 39926 39159 gene locus_tag LOCUS_37770 39926 39159 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_37770 40950 40033 gene locus_tag LOCUS_37780 40950 40033 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207908.1 protein_id gnl|my_center|LOCUS_37780 42030 41260 gene locus_tag LOCUS_37790 42030 41260 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_37790 42874 42038 gene locus_tag LOCUS_37800 42874 42038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 43319 42867 gene locus_tag LOCUS_37810 43319 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 43387 44415 gene locus_tag LOCUS_37820 43387 44415 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_37820 44556 45002 gene locus_tag LOCUS_37830 44556 45002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 45006 46202 gene locus_tag LOCUS_37840 45006 46202 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730847.1 protein_id gnl|my_center|LOCUS_37840 46262 47029 gene locus_tag LOCUS_37850 46262 47029 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_37850 48038 47124 gene locus_tag LOCUS_37860 gene fabG 48038 47124 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_37860 49229 48054 gene locus_tag LOCUS_37870 49229 48054 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730961.1 protein_id gnl|my_center|LOCUS_37870 49502 49969 gene locus_tag LOCUS_37880 49502 49969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence26 <1 870 gene locus_tag LOCUS_37890 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001188880.1:membrane protein 949 1374 gene locus_tag LOCUS_37900 949 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 1461 2291 gene locus_tag LOCUS_37910 1461 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 2790 2314 gene locus_tag LOCUS_37920 gene bfrB 2790 2314 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_37920 3150 2947 gene locus_tag LOCUS_37930 3150 2947 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396478.1 protein_id gnl|my_center|LOCUS_37930 3358 3434 gene locus_tag LOCUS_t00360 3358 3434 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3528 3983 gene locus_tag LOCUS_37940 gene rimP 3528 3983 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_37940 4012 5505 gene locus_tag LOCUS_37950 gene nusA 4012 5505 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_37950 5559 8273 gene locus_tag LOCUS_37960 gene infB 5559 8273 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_37960 8298 8696 gene locus_tag LOCUS_37970 gene rbfA 8298 8696 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 protein_id gnl|my_center|LOCUS_37970 8699 9628 gene locus_tag LOCUS_37980 gene truB 8699 9628 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72154 protein_id gnl|my_center|LOCUS_37980 9721 9990 gene locus_tag LOCUS_37990 gene rpsO 9721 9990 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ7 protein_id gnl|my_center|LOCUS_37990 10056 12182 gene locus_tag LOCUS_38000 gene pnp 10056 12182 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_38000 12599 13840 gene locus_tag LOCUS_38010 12599 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 13898 14521 gene locus_tag LOCUS_38020 gene nasT 13898 14521 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 protein_id gnl|my_center|LOCUS_38020 14514 15701 gene locus_tag LOCUS_38030 14514 15701 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_38030 15979 17367 gene locus_tag LOCUS_38040 15979 17367 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_38040 17402 18394 gene locus_tag LOCUS_38050 17402 18394 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_38050 18411 19313 gene locus_tag LOCUS_38060 18411 19313 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367094.1 protein_id gnl|my_center|LOCUS_38060 19317 20540 gene locus_tag LOCUS_38070 19317 20540 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085592.1 protein_id gnl|my_center|LOCUS_38070 20558 23080 gene locus_tag LOCUS_38080 gene nirB 20558 23080 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104464.1 protein_id gnl|my_center|LOCUS_38080 23094 23441 gene locus_tag LOCUS_38090 23094 23441 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 protein_id gnl|my_center|LOCUS_38090 23513 26071 gene locus_tag LOCUS_38100 gene narB 23513 26071 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_38100 28021 26090 gene locus_tag LOCUS_38110 gene acsA2 28021 26090 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_38110 29015 28128 gene locus_tag LOCUS_38120 gene panC 29015 28128 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_38120 30076 29285 gene locus_tag LOCUS_38130 gene panB 30076 29285 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_38130 30828 30133 gene locus_tag LOCUS_38140 gene dck 30828 30133 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_38140 31351 30818 gene locus_tag LOCUS_38150 31351 30818 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_38150 32694 31348 gene locus_tag LOCUS_38160 gene pcnB 32694 31348 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 protein_id gnl|my_center|LOCUS_38160 34611 33187 gene locus_tag LOCUS_38170 gene cbrB 34611 33187 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_38170 37668 34690 gene locus_tag LOCUS_38180 gene cbrA 37668 34690 CDS product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_38180 37834 37658 gene locus_tag LOCUS_38190 37834 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552060.1 protein_id gnl|my_center|LOCUS_38190 38831 37926 gene locus_tag LOCUS_38200 gene gluQ 38831 37926 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6E8 protein_id gnl|my_center|LOCUS_38200 39358 38852 gene locus_tag LOCUS_38210 gene dksA 39358 38852 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY79 protein_id gnl|my_center|LOCUS_38210 39561 40748 gene locus_tag LOCUS_38220 39561 40748 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 protein_id gnl|my_center|LOCUS_38220 41117 40803 gene locus_tag LOCUS_38230 41117 40803 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246097.1 protein_id gnl|my_center|LOCUS_38230 >Feature sequence27 1437 835 gene locus_tag LOCUS_38240 1437 835 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_38240 2312 1557 gene locus_tag LOCUS_38250 2312 1557 CDS product transcriptional regulator FNR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 protein_id gnl|my_center|LOCUS_38250 3820 2384 gene locus_tag LOCUS_38260 gene hemN 3820 2384 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RM6 protein_id gnl|my_center|LOCUS_38260 5148 3973 gene locus_tag LOCUS_38270 5148 3973 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731366.1 protein_id gnl|my_center|LOCUS_38270 9282 5161 gene locus_tag LOCUS_38280 9282 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 10208 9432 gene locus_tag LOCUS_38290 10208 9432 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_38290 10429 11106 gene locus_tag LOCUS_38300 10429 11106 CDS product F420-dependent NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_38300 11147 11914 gene locus_tag LOCUS_38310 11147 11914 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_38310 11914 12876 gene locus_tag LOCUS_38320 11914 12876 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_38320 12881 13612 gene locus_tag LOCUS_38330 12881 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 13612 16158 gene locus_tag LOCUS_38340 gene fbiC 13612 16158 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730333.1 protein_id gnl|my_center|LOCUS_38340 16176 16880 gene locus_tag LOCUS_38350 gene ung 16176 16880 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_38350 17861 16929 gene locus_tag LOCUS_38360 17861 16929 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF0 protein_id gnl|my_center|LOCUS_38360 18016 18309 gene locus_tag LOCUS_38370 18016 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPD1 protein_id gnl|my_center|LOCUS_38370 20277 18682 gene locus_tag LOCUS_38380 gene nadB 20277 18682 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_38380 20542 21141 gene locus_tag LOCUS_38390 gene algU 20542 21141 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_38390 21223 21846 gene locus_tag LOCUS_38400 21223 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 21858 22991 gene locus_tag LOCUS_38410 21858 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 22993 23469 gene locus_tag LOCUS_38420 gene mucC 22993 23469 CDS product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_38420 23514 24917 gene locus_tag LOCUS_38430 gene mucD 23514 24917 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_38430 25077 26876 gene locus_tag LOCUS_38440 gene lepA 25077 26876 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 protein_id gnl|my_center|LOCUS_38440 26880 27725 gene locus_tag LOCUS_38450 gene lepB 26880 27725 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_38450 27754 28167 gene locus_tag LOCUS_38460 27754 28167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 28171 28851 gene locus_tag LOCUS_38470 gene rnc 28171 28851 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB2 protein_id gnl|my_center|LOCUS_38470 28841 29749 gene locus_tag LOCUS_38480 gene era 28841 29749 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE2 protein_id gnl|my_center|LOCUS_38480 29776 30612 gene locus_tag LOCUS_38490 gene recO 29776 30612 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX7 protein_id gnl|my_center|LOCUS_38490 30609 30983 gene locus_tag LOCUS_38500 gene acpS 30609 30983 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB6 protein_id gnl|my_center|LOCUS_38500 31075 31971 gene locus_tag LOCUS_38510 31075 31971 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_38510 31983 34211 gene locus_tag LOCUS_38520 gene relA 31983 34211 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_38520 34222 35040 gene locus_tag LOCUS_38530 34222 35040 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 protein_id gnl|my_center|LOCUS_38530 35166 35813 gene locus_tag LOCUS_38540 gene adk 35166 35813 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWV2 protein_id gnl|my_center|LOCUS_38540 >Feature sequence28 1015 1704 gene locus_tag LOCUS_38550 1015 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 2714 2502 gene locus_tag LOCUS_38560 2714 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 2796 3017 gene locus_tag LOCUS_38570 2796 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 3082 3360 gene locus_tag LOCUS_38580 3082 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3465 4466 gene locus_tag LOCUS_38590 3465 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 4576 5178 gene locus_tag LOCUS_38600 4576 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 5178 5621 gene locus_tag LOCUS_38610 5178 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 6052 5726 gene locus_tag LOCUS_38620 6052 5726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_38620 6482 6045 gene locus_tag LOCUS_38630 6482 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 9021 8110 gene locus_tag LOCUS_38640 9021 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 9495 9067 gene locus_tag LOCUS_38650 9495 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 11845 9485 gene locus_tag LOCUS_38660 gene fyuA 11845 9485 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_38660 11978 12826 gene locus_tag LOCUS_38670 11978 12826 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537711.1 protein_id gnl|my_center|LOCUS_38670 13159 13713 gene locus_tag LOCUS_38680 13159 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 13713 15518 gene locus_tag LOCUS_38690 13713 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 16397 15582 gene locus_tag LOCUS_38700 16397 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 16639 17265 gene locus_tag LOCUS_38710 16639 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 17319 17648 gene locus_tag LOCUS_38720 17319 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 18597 17686 gene locus_tag LOCUS_38730 gene glsA 18597 17686 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_38730 20143 18635 gene locus_tag LOCUS_38740 20143 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225305.1 protein_id gnl|my_center|LOCUS_38740 20527 21222 gene locus_tag LOCUS_38750 gene oprG 20527 21222 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_38750 22063 21353 gene locus_tag LOCUS_38760 22063 21353 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_38760 22263 22060 gene locus_tag LOCUS_38770 22263 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_38770 24695 22242 gene locus_tag LOCUS_38780 24695 22242 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_38780 25176 24679 gene locus_tag LOCUS_38790 gene ccoH 25176 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_38790 26582 25173 gene locus_tag LOCUS_38800 26582 25173 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_38800 27545 26667 gene locus_tag LOCUS_38810 gene ccoP1 27545 26667 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3G5 protein_id gnl|my_center|LOCUS_38810 27717 27538 gene locus_tag LOCUS_38820 27717 27538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 28341 27733 gene locus_tag LOCUS_38830 gene ccoO1 28341 27733 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_38830 <29006 28352 gene locus_tag LOCUS_38840 <29006 28352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881190.1:cytochrome c oxidase, cbb3-type subunit I >Feature sequence29 75 680 gene locus_tag LOCUS_38850 75 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 1872 718 gene locus_tag LOCUS_38860 1872 718 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142694.1 protein_id gnl|my_center|LOCUS_38860 2118 2924 gene locus_tag LOCUS_38870 2118 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403429.1 protein_id gnl|my_center|LOCUS_38870 2971 3867 gene locus_tag LOCUS_38880 2971 3867 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207526.1 protein_id gnl|my_center|LOCUS_38880 3915 5768 gene locus_tag LOCUS_38890 3915 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_38890 6019 7299 gene locus_tag LOCUS_38900 6019 7299 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_38900 7402 8445 gene locus_tag LOCUS_38910 7402 8445 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728253.1 protein_id gnl|my_center|LOCUS_38910 8641 9081 gene locus_tag LOCUS_38920 8641 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 9617 9291 gene locus_tag LOCUS_38930 9617 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 11283 9664 gene locus_tag LOCUS_38940 11283 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 12071 13027 gene locus_tag LOCUS_38950 12071 13027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 13095 13304 gene locus_tag LOCUS_38960 13095 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 13620 15170 gene locus_tag LOCUS_38970 13620 15170 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070558.1 protein_id gnl|my_center|LOCUS_38970 15447 16136 gene locus_tag LOCUS_38980 15447 16136 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109966.1 protein_id gnl|my_center|LOCUS_38980 17362 16517 gene locus_tag LOCUS_38990 17362 16517 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_38990 18489 18076 gene locus_tag LOCUS_39000 18489 18076 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_39000 18908 18699 gene locus_tag LOCUS_39010 18908 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 18907 22074 gene locus_tag LOCUS_39020 18907 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 22214 22537 gene locus_tag LOCUS_39030 22214 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39030 23656 22721 gene locus_tag LOCUS_39040 23656 22721 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_39040 24200 23952 gene locus_tag LOCUS_39050 24200 23952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 24637 24410 gene locus_tag LOCUS_39060 24637 24410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 24887 25123 gene locus_tag LOCUS_39070 24887 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 25123 25416 gene locus_tag LOCUS_39080 25123 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence30 292 1692 gene locus_tag LOCUS_39090 292 1692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_39090 1727 2656 gene locus_tag LOCUS_39100 1727 2656 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970849.1 protein_id gnl|my_center|LOCUS_39100 2768 3694 gene locus_tag LOCUS_39110 2768 3694 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_39110 4187 5290 gene locus_tag LOCUS_39120 4187 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_39120 5311 7707 gene locus_tag LOCUS_39130 5311 7707 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_39130 7860 8630 gene locus_tag LOCUS_39140 7860 8630 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_39140 8627 10015 gene locus_tag LOCUS_39150 8627 10015 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707200.1 protein_id gnl|my_center|LOCUS_39150 10012 10563 gene locus_tag LOCUS_39160 10012 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263090.1 protein_id gnl|my_center|LOCUS_39160 10560 10970 gene locus_tag LOCUS_39170 10560 10970 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_39170 10985 11674 gene locus_tag LOCUS_39180 10985 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 11664 13457 gene locus_tag LOCUS_39190 11664 13457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 13661 15394 gene locus_tag LOCUS_39200 13661 15394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 15987 15484 gene locus_tag LOCUS_39210 15987 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 16702 16127 gene locus_tag LOCUS_39220 16702 16127 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_39220 17913 16891 gene locus_tag LOCUS_39230 17913 16891 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038491.1 protein_id gnl|my_center|LOCUS_39230 19721 17910 gene locus_tag LOCUS_39240 gene atmA 19721 17910 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_39240 20981 19833 gene locus_tag LOCUS_39250 20981 19833 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_39250 22179 20992 gene locus_tag LOCUS_39260 22179 20992 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_39260 22960 22196 gene locus_tag LOCUS_39270 22960 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 23218 23808 gene locus_tag LOCUS_39280 gene gst 23218 23808 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_39280 23847 24881 gene locus_tag LOCUS_39290 23847 24881 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence31 202 127 gene locus_tag LOCUS_t00370 202 127 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1514 318 gene locus_tag LOCUS_39300 1514 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2354 1656 gene locus_tag LOCUS_39310 gene queC 2354 1656 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y44 protein_id gnl|my_center|LOCUS_39310 3028 2369 gene locus_tag LOCUS_39320 gene queE 3028 2369 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 protein_id gnl|my_center|LOCUS_39320 4095 3097 gene locus_tag LOCUS_39330 4095 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4632 4099 gene locus_tag LOCUS_39340 4632 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 6042 4744 gene locus_tag LOCUS_39350 gene tolB 6042 4744 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y40 protein_id gnl|my_center|LOCUS_39350 6854 6042 gene locus_tag LOCUS_39360 6854 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 7270 6851 gene locus_tag LOCUS_39370 gene tolR 7270 6851 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50599 protein_id gnl|my_center|LOCUS_39370 7987 7277 gene locus_tag LOCUS_39380 gene tolQ 7987 7277 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_39380 8425 8006 gene locus_tag LOCUS_39390 8425 8006 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406122.1 protein_id gnl|my_center|LOCUS_39390 9486 8422 gene locus_tag LOCUS_39400 gene ruvB 9486 8422 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 protein_id gnl|my_center|LOCUS_39400 10114 9497 gene locus_tag LOCUS_39410 gene ruvA 10114 9497 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF2 protein_id gnl|my_center|LOCUS_39410 10647 10129 gene locus_tag LOCUS_39420 gene ruvC 10647 10129 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU1 protein_id gnl|my_center|LOCUS_39420 12700 10916 gene locus_tag LOCUS_39430 gene aspS 12700 10916 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51422 protein_id gnl|my_center|LOCUS_39430 13076 12750 gene locus_tag LOCUS_39440 13076 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 13667 13266 gene locus_tag LOCUS_39450 13667 13266 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_39450 14011 15720 gene locus_tag LOCUS_39460 gene proS 14011 15720 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 protein_id gnl|my_center|LOCUS_39460 16812 15766 gene locus_tag LOCUS_39470 16812 15766 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_39470 17092 17943 gene locus_tag LOCUS_39480 17092 17943 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 protein_id gnl|my_center|LOCUS_39480 18107 19450 gene locus_tag LOCUS_39490 18107 19450 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532930.1 protein_id gnl|my_center|LOCUS_39490 19658 20839 gene locus_tag LOCUS_39500 19658 20839 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 protein_id gnl|my_center|LOCUS_39500 20864 21349 gene locus_tag LOCUS_39510 gene gpo 20864 21349 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_39510 22938 21355 gene locus_tag LOCUS_39520 gene prfC 22938 21355 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI9 protein_id gnl|my_center|LOCUS_39520 >Feature sequence32 1108 1929 gene locus_tag LOCUS_39530 gene intI 1108 1929 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_39530 1932 5045 gene locus_tag LOCUS_39540 gene dnaE2 1932 5045 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q2 protein_id gnl|my_center|LOCUS_39540 5292 7217 gene locus_tag LOCUS_39550 5292 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_39550 8544 7324 gene locus_tag LOCUS_39560 gene argG 8544 7324 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_39560 8689 9741 gene locus_tag LOCUS_39570 gene pyrC 8689 9741 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72170 protein_id gnl|my_center|LOCUS_39570 9738 10373 gene locus_tag LOCUS_39580 gene rnt 9738 10373 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_39580 10979 10383 gene locus_tag LOCUS_39590 10979 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_39590 11254 10976 gene locus_tag LOCUS_39600 11254 10976 CDS product UPF0153 protein PA1578.1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58040 protein_id gnl|my_center|LOCUS_39600 13883 11238 gene locus_tag LOCUS_39610 13883 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 15262 13880 gene locus_tag LOCUS_39620 gene mpl 15262 13880 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX07 protein_id gnl|my_center|LOCUS_39620 15447 16709 gene locus_tag LOCUS_39630 gene pfp 15447 16709 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_39630 16838 17482 gene locus_tag LOCUS_39640 gene ppa 16838 17482 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84777 protein_id gnl|my_center|LOCUS_39640 >Feature sequence33 98 343 gene locus_tag LOCUS_39650 98 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 1384 434 gene locus_tag LOCUS_39660 1384 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 4987 1880 gene locus_tag LOCUS_39670 4987 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 6849 4984 gene locus_tag LOCUS_39680 6849 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 7306 7118 gene locus_tag LOCUS_39690 7306 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 7671 7369 gene locus_tag LOCUS_39700 7671 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 8044 7814 gene locus_tag LOCUS_39710 8044 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 8999 8154 gene locus_tag LOCUS_39720 8999 8154 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_39720 9778 9038 gene locus_tag LOCUS_39730 gene ucpA1 9778 9038 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_39730 10648 9782 gene locus_tag LOCUS_39740 10648 9782 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 protein_id gnl|my_center|LOCUS_39740 11669 10650 gene locus_tag LOCUS_39750 11669 10650 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_39750 12873 11674 gene locus_tag LOCUS_39760 12873 11674 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_39760 13187 12870 gene locus_tag LOCUS_39770 13187 12870 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266256.1 protein_id gnl|my_center|LOCUS_39770 14694 15893 gene locus_tag LOCUS_39780 14694 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 16315 16130 gene locus_tag LOCUS_39790 16315 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence34 1716 715 gene locus_tag LOCUS_39800 1716 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 1930 3702 gene locus_tag LOCUS_39810 1930 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 >Feature sequence35 142 564 gene locus_tag LOCUS_39820 142 564 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886859.1 protein_id gnl|my_center|LOCUS_39820 566 2935 gene locus_tag LOCUS_39830 566 2935 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_39830 <3815 3297 gene locus_tag LOCUS_39840 <3815 3297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213770.1:conjugal transfer protein TraG