>Feature sequence001 400 1797 gene locus_tag LOCUS_00010 400 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1806 2393 gene locus_tag LOCUS_00020 1806 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4000 2390 gene locus_tag LOCUS_00030 4000 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6928 4019 gene locus_tag LOCUS_00040 6928 4019 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_00040 7058 7678 gene locus_tag LOCUS_00050 7058 7678 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_00050 9012 7735 gene locus_tag LOCUS_00060 gene murF 9012 7735 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L7 protein_id gnl|my_center|LOCUS_00060 9344 9009 gene locus_tag LOCUS_00070 9344 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9718 10158 gene locus_tag LOCUS_00080 9718 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10155 10517 gene locus_tag LOCUS_00090 10155 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_00090 10519 10833 gene locus_tag LOCUS_00100 10519 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10833 11882 gene locus_tag LOCUS_00110 gene fjo30 10833 11882 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_00110 11872 12546 gene locus_tag LOCUS_00120 11872 12546 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_00120 13292 12645 gene locus_tag LOCUS_00130 13292 12645 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_00130 13738 13301 gene locus_tag LOCUS_00140 gene msrB 13738 13301 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_00140 14453 13818 gene locus_tag LOCUS_00150 14453 13818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14932 14591 gene locus_tag LOCUS_00160 14932 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15626 14970 gene locus_tag LOCUS_00170 15626 14970 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_00170 17278 15626 gene locus_tag LOCUS_00180 17278 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17866 17711 gene locus_tag LOCUS_00190 gene rpmH 17866 17711 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_00190 19463 18198 gene locus_tag LOCUS_00200 19463 18198 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_00200 20571 19627 gene locus_tag LOCUS_00210 20571 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21665 20772 gene locus_tag LOCUS_00220 21665 20772 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_00220 22182 21667 gene locus_tag LOCUS_00230 gene yceI 22182 21667 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_00230 22320 22796 gene locus_tag LOCUS_00240 22320 22796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22796 23233 gene locus_tag LOCUS_00250 22796 23233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23471 23235 gene locus_tag LOCUS_00260 23471 23235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24124 23543 gene locus_tag LOCUS_00270 24124 23543 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_00270 24554 25396 gene locus_tag LOCUS_00280 24554 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25389 26129 gene locus_tag LOCUS_00290 25389 26129 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016465.1 protein_id gnl|my_center|LOCUS_00290 26131 27234 gene locus_tag LOCUS_00300 26131 27234 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_00300 27231 27794 gene locus_tag LOCUS_00310 27231 27794 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_00310 28951 27806 gene locus_tag LOCUS_00320 28951 27806 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_00320 29504 29001 gene locus_tag LOCUS_00330 gene nadD 29504 29001 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_00330 29671 30033 gene locus_tag LOCUS_00340 29671 30033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30052 30897 gene locus_tag LOCUS_00350 30052 30897 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU3 protein_id gnl|my_center|LOCUS_00350 31046 32857 gene locus_tag LOCUS_00360 31046 32857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32981 32829 gene locus_tag LOCUS_00370 32981 32829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 33044 34261 gene locus_tag LOCUS_00380 33044 34261 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_00380 36782 34425 gene locus_tag LOCUS_00390 gene nrdA 36782 34425 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_00390 37813 36836 gene locus_tag LOCUS_00400 gene nrdB 37813 36836 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_00400 39291 38302 gene locus_tag LOCUS_00410 39291 38302 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_00410 39412 40296 gene locus_tag LOCUS_00420 39412 40296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40293 41117 gene locus_tag LOCUS_00430 40293 41117 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_00430 41259 41855 gene locus_tag LOCUS_00440 gene psd 41259 41855 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_00440 41874 42182 gene locus_tag LOCUS_00450 41874 42182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42306 43358 gene locus_tag LOCUS_00460 42306 43358 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_00460 43371 43598 gene locus_tag LOCUS_00470 43371 43598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 44969 43692 gene locus_tag LOCUS_00480 44969 43692 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_00480 45199 46824 gene locus_tag LOCUS_00490 gene rho 45199 46824 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_00490 47824 46937 gene locus_tag LOCUS_00500 47824 46937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48430 47900 gene locus_tag LOCUS_00510 gene lspA 48430 47900 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_00510 48904 48521 gene locus_tag LOCUS_00520 48904 48521 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_00520 52226 48909 gene locus_tag LOCUS_00530 gene ileS 52226 48909 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_00530 52422 54584 gene locus_tag LOCUS_00540 52422 54584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_00540 54614 56560 gene locus_tag LOCUS_00550 gene dnaG 54614 56560 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_00550 57124 56666 gene locus_tag LOCUS_00560 57124 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57734 57195 gene locus_tag LOCUS_00570 57734 57195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58864 57827 gene locus_tag LOCUS_00580 gene thiL 58864 57827 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_00580 58994 59470 gene locus_tag LOCUS_00590 58994 59470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60161 59553 gene locus_tag LOCUS_00600 gene sodA 60161 59553 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_00600 60376 61728 gene locus_tag LOCUS_00610 60376 61728 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2K0 protein_id gnl|my_center|LOCUS_00610 62913 61765 gene locus_tag LOCUS_00620 62913 61765 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_00620 63351 62917 gene locus_tag LOCUS_00630 63351 62917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 64054 63569 gene locus_tag LOCUS_00640 64054 63569 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_00640 65045 64128 gene locus_tag LOCUS_00650 65045 64128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 65655 65032 gene locus_tag LOCUS_00660 65655 65032 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_00660 65766 65840 gene locus_tag LOCUS_t00010 65766 65840 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 66128 67273 gene locus_tag LOCUS_00670 66128 67273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 >Feature sequence002 <1 671 gene locus_tag LOCUS_00680 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899551.1:multifunctional mycocerosic acid synthase 1424 741 gene locus_tag LOCUS_00690 1424 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 2822 1554 gene locus_tag LOCUS_00700 gene purD 2822 1554 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_00700 2998 6306 gene locus_tag LOCUS_00710 gene secA 2998 6306 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL5 protein_id gnl|my_center|LOCUS_00710 6315 6956 gene locus_tag LOCUS_00720 6315 6956 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_00720 6966 7367 gene locus_tag LOCUS_00730 6966 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7369 8556 gene locus_tag LOCUS_00740 7369 8556 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_00740 8587 9525 gene locus_tag LOCUS_00750 8587 9525 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_00750 10387 9599 gene locus_tag LOCUS_00760 10387 9599 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_00760 10453 11703 gene locus_tag LOCUS_00770 10453 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_00770 11841 13934 gene locus_tag LOCUS_00780 gene recG 11841 13934 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_00780 15246 13981 gene locus_tag LOCUS_00790 15246 13981 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_00790 15687 16889 gene locus_tag LOCUS_00800 15687 16889 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_00800 17899 16916 gene locus_tag LOCUS_00810 17899 16916 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906845.1 protein_id gnl|my_center|LOCUS_00810 18654 17899 gene locus_tag LOCUS_00820 18654 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_00820 20884 18692 gene locus_tag LOCUS_00830 20884 18692 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_00830 21516 21010 gene locus_tag LOCUS_00840 21516 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 22399 21521 gene locus_tag LOCUS_00850 22399 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_00850 22878 22396 gene locus_tag LOCUS_00860 22878 22396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 23954 22881 gene locus_tag LOCUS_00870 23954 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 25244 24075 gene locus_tag LOCUS_00880 25244 24075 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_00880 25338 25745 gene locus_tag LOCUS_00890 gene ygcM 25338 25745 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_00890 28688 25764 gene locus_tag LOCUS_00900 28688 25764 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_00900 30024 28843 gene locus_tag LOCUS_00910 30024 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 31735 30041 gene locus_tag LOCUS_00920 31735 30041 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_00920 32740 31769 gene locus_tag LOCUS_00930 gene rlmN 32740 31769 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_00930 32886 33266 gene locus_tag LOCUS_00940 32886 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 35227 33263 gene locus_tag LOCUS_00950 35227 33263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 36883 35228 gene locus_tag LOCUS_00960 gene recN 36883 35228 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_00960 38056 36983 gene locus_tag LOCUS_00970 gene ctaA 38056 36983 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_00970 38429 38746 gene locus_tag LOCUS_00980 38429 38746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 39978 38728 gene locus_tag LOCUS_00990 39978 38728 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_00990 40181 41428 gene locus_tag LOCUS_01000 40181 41428 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807750.1 protein_id gnl|my_center|LOCUS_01000 42543 41530 gene locus_tag LOCUS_01010 gene batA 42543 41530 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_01010 43444 42533 gene locus_tag LOCUS_01020 43444 42533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 44316 43441 gene locus_tag LOCUS_01030 44316 43441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_01030 45362 44364 gene locus_tag LOCUS_01040 45362 44364 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_01040 47090 45456 gene locus_tag LOCUS_01050 47090 45456 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_01050 47807 47106 gene locus_tag LOCUS_01060 47807 47106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 47833 48873 gene locus_tag LOCUS_01070 47833 48873 CDS product GldB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759865.1 protein_id gnl|my_center|LOCUS_01070 48884 50989 gene locus_tag LOCUS_01080 gene ligA 48884 50989 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66880 protein_id gnl|my_center|LOCUS_01080 54765 51097 gene locus_tag LOCUS_01090 gene purL 54765 51097 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_01090 55327 55989 gene locus_tag LOCUS_01100 55327 55989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 56189 57184 gene locus_tag LOCUS_01110 gene argK 56189 57184 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094315.1 protein_id gnl|my_center|LOCUS_01110 57439 57927 gene locus_tag LOCUS_01120 57439 57927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 57938 59182 gene locus_tag LOCUS_01130 gene nusA 57938 59182 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_01130 59252 61987 gene locus_tag LOCUS_01140 gene infB 59252 61987 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR4 protein_id gnl|my_center|LOCUS_01140 62038 62901 gene locus_tag LOCUS_01150 62038 62901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 62934 63677 gene locus_tag LOCUS_01160 gene uppS 62934 63677 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_01160 >Feature sequence003 491 2524 gene locus_tag LOCUS_01170 491 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2571 3818 gene locus_tag LOCUS_01180 2571 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767593.1 protein_id gnl|my_center|LOCUS_01180 4336 3857 gene locus_tag LOCUS_01190 4336 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5943 4345 gene locus_tag LOCUS_01200 gene rny 5943 4345 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_01200 6302 6009 gene locus_tag LOCUS_01210 6302 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 6600 6304 gene locus_tag LOCUS_01220 6600 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8993 6600 gene locus_tag LOCUS_01230 gene pheT 8993 6600 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA39 protein_id gnl|my_center|LOCUS_01230 9873 9010 gene locus_tag LOCUS_01240 9873 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 11540 9891 gene locus_tag LOCUS_01250 11540 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 11655 12185 gene locus_tag LOCUS_01260 11655 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 12388 14016 gene locus_tag LOCUS_01270 gene pruA 12388 14016 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_01270 14042 14920 gene locus_tag LOCUS_01280 14042 14920 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_01280 14962 15741 gene locus_tag LOCUS_01290 14962 15741 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_01290 15887 17146 gene locus_tag LOCUS_01300 15887 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 17163 18908 gene locus_tag LOCUS_01310 17163 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_01310 20323 19091 gene locus_tag LOCUS_01320 20323 19091 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482463.1 protein_id gnl|my_center|LOCUS_01320 20647 22575 gene locus_tag LOCUS_01330 gene thrS 20647 22575 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_01330 22684 23232 gene locus_tag LOCUS_01340 gene infC 22684 23232 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_01340 23353 23547 gene locus_tag LOCUS_01350 gene rpmI 23353 23547 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_01350 23577 23921 gene locus_tag LOCUS_01360 gene rplT 23577 23921 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_01360 24509 24075 gene locus_tag LOCUS_01370 24509 24075 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123483.1 protein_id gnl|my_center|LOCUS_01370 24564 26438 gene locus_tag LOCUS_01380 24564 26438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 26494 27705 gene locus_tag LOCUS_01390 26494 27705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_01390 28235 27702 gene locus_tag LOCUS_01400 28235 27702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_01400 28234 28800 gene locus_tag LOCUS_01410 28234 28800 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_01410 28864 30171 gene locus_tag LOCUS_01420 gene der 28864 30171 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV3 protein_id gnl|my_center|LOCUS_01420 30240 30506 gene locus_tag LOCUS_01430 30240 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 31183 30740 gene locus_tag LOCUS_01440 31183 30740 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_01440 31207 31977 gene locus_tag LOCUS_01450 31207 31977 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_01450 31974 32987 gene locus_tag LOCUS_01460 31974 32987 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_01460 33964 33038 gene locus_tag LOCUS_01470 gene ribF 33964 33038 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_01470 34685 33951 gene locus_tag LOCUS_01480 gene truB 34685 33951 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_01480 36927 34921 gene locus_tag LOCUS_01490 36927 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 39322 37055 gene locus_tag LOCUS_01500 gene acnA 39322 37055 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_01500 39556 40686 gene locus_tag LOCUS_01510 39556 40686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_01510 41251 40802 gene locus_tag LOCUS_01520 gene rplI 41251 40802 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_01520 41534 41268 gene locus_tag LOCUS_01530 gene rpsR 41534 41268 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_01530 41911 41537 gene locus_tag LOCUS_01540 gene rpsF 41911 41537 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_01540 42487 42029 gene locus_tag LOCUS_01550 42487 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 42542 43822 gene locus_tag LOCUS_01560 gene hadHB 42542 43822 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404210.1 protein_id gnl|my_center|LOCUS_01560 43949 46090 gene locus_tag LOCUS_01570 gene fadJ 43949 46090 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECP7 protein_id gnl|my_center|LOCUS_01570 47299 46214 gene locus_tag LOCUS_01580 47299 46214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 47536 48726 gene locus_tag LOCUS_01590 47536 48726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 48775 49782 gene locus_tag LOCUS_01600 48775 49782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 53321 49839 gene locus_tag LOCUS_01610 53321 49839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_01610 54323 53367 gene locus_tag LOCUS_01620 gene hldD 54323 53367 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_01620 54583 56001 gene locus_tag LOCUS_01630 54583 56001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence004 <1 1166 gene locus_tag LOCUS_01640 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964076.1:arginase 1761 1378 gene locus_tag LOCUS_01650 1761 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 1979 3382 gene locus_tag LOCUS_01660 1979 3382 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_01660 4207 3389 gene locus_tag LOCUS_01670 4207 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 5237 4221 gene locus_tag LOCUS_01680 5237 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5333 6115 gene locus_tag LOCUS_01690 gene crt 5333 6115 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_01690 6302 7693 gene locus_tag LOCUS_01700 gene fumC 6302 7693 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_01700 7745 8821 gene locus_tag LOCUS_01710 gene prfA 7745 8821 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_01710 8841 9143 gene locus_tag LOCUS_01720 8841 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9140 9910 gene locus_tag LOCUS_01730 9140 9910 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43908 protein_id gnl|my_center|LOCUS_01730 12898 10247 gene locus_tag LOCUS_01740 12898 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 14151 12943 gene locus_tag LOCUS_01750 gene hflX 14151 12943 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_01750 14249 14644 gene locus_tag LOCUS_01760 14249 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 15599 14661 gene locus_tag LOCUS_01770 gene rsgA 15599 14661 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_01770 16329 15571 gene locus_tag LOCUS_01780 gene pcrB 16329 15571 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_01780 16792 18165 gene locus_tag LOCUS_01790 gene radA 16792 18165 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_01790 18169 18792 gene locus_tag LOCUS_01800 18169 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_01800 20175 18793 gene locus_tag LOCUS_01810 20175 18793 CDS product putative amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701474.1 protein_id gnl|my_center|LOCUS_01810 20983 20288 gene locus_tag LOCUS_01820 gene rsmI 20983 20288 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_01820 21684 20980 gene locus_tag LOCUS_01830 gene pssA 21684 20980 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_01830 22647 21733 gene locus_tag LOCUS_01840 22647 21733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_01840 24283 22778 gene locus_tag LOCUS_01850 24283 22778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 26976 24331 gene locus_tag LOCUS_01860 26976 24331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 27454 26978 gene locus_tag LOCUS_01870 27454 26978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 28466 27432 gene locus_tag LOCUS_01880 28466 27432 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_01880 28838 28494 gene locus_tag LOCUS_01890 gene panD 28838 28494 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_01890 29697 28861 gene locus_tag LOCUS_01900 gene panC 29697 28861 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR8 protein_id gnl|my_center|LOCUS_01900 30952 29690 gene locus_tag LOCUS_01910 30952 29690 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_01910 33025 31328 gene locus_tag LOCUS_01920 gene pepF 33025 31328 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_01920 33506 33033 gene locus_tag LOCUS_01930 33506 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 34177 33509 gene locus_tag LOCUS_01940 34177 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 34984 34235 gene locus_tag LOCUS_01950 34984 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_01950 35077 35655 gene locus_tag LOCUS_01960 gene clpP 35077 35655 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4T6 protein_id gnl|my_center|LOCUS_01960 35659 36057 gene locus_tag LOCUS_01970 35659 36057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 36156 37649 gene locus_tag LOCUS_01980 gene glpK2 36156 37649 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_01980 37735 38619 gene locus_tag LOCUS_01990 37735 38619 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_01990 38653 39318 gene locus_tag LOCUS_02000 38653 39318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 40975 39272 gene locus_tag LOCUS_02010 40975 39272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_02010 41166 41528 gene locus_tag LOCUS_02020 41166 41528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 41528 42748 gene locus_tag LOCUS_02030 41528 42748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_02030 43927 42902 gene locus_tag LOCUS_02040 43927 42902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 44135 45877 gene locus_tag LOCUS_02050 gene aspS 44135 45877 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_02050 45956 47359 gene locus_tag LOCUS_02060 45956 47359 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_02060 47363 48049 gene locus_tag LOCUS_02070 47363 48049 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_02070 49393 48272 gene locus_tag LOCUS_02080 49393 48272 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_02080 50016 49429 gene locus_tag LOCUS_02090 50016 49429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 50693 50028 gene locus_tag LOCUS_02100 50693 50028 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence005 <1 2199 gene locus_tag LOCUS_02110 <1 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase 3434 2196 gene locus_tag LOCUS_02120 3434 2196 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_02120 4543 3494 gene locus_tag LOCUS_02130 gene queA 4543 3494 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_02130 5692 4631 gene locus_tag LOCUS_02140 gene lysl 5692 4631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_02140 5790 7316 gene locus_tag LOCUS_02150 gene pcd 5790 7316 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_02150 7343 8350 gene locus_tag LOCUS_02160 7343 8350 CDS product glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249726.1 protein_id gnl|my_center|LOCUS_02160 9604 8477 gene locus_tag LOCUS_02170 9604 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_02170 10283 9651 gene locus_tag LOCUS_02180 10283 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10282 10908 gene locus_tag LOCUS_02190 gene pyrE 10282 10908 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040248.1 protein_id gnl|my_center|LOCUS_02190 11912 10914 gene locus_tag LOCUS_02200 11912 10914 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_02200 12682 11909 gene locus_tag LOCUS_02210 12682 11909 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_02210 12821 12630 gene locus_tag LOCUS_02220 12821 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 14173 12788 gene locus_tag LOCUS_02230 14173 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 14208 14834 gene locus_tag LOCUS_02240 14208 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_02240 14824 15621 gene locus_tag LOCUS_02250 14824 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 15699 16280 gene locus_tag LOCUS_02260 15699 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 17854 16316 gene locus_tag LOCUS_02270 17854 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_02270 18801 17881 gene locus_tag LOCUS_02280 18801 17881 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_02280 20089 18974 gene locus_tag LOCUS_02290 20089 18974 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_02290 20212 22788 gene locus_tag LOCUS_02300 20212 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_02300 22790 22999 gene locus_tag LOCUS_02310 22790 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_02310 23009 23986 gene locus_tag LOCUS_02320 23009 23986 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_02320 24147 23983 gene locus_tag LOCUS_02330 24147 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 25521 24196 gene locus_tag LOCUS_02340 gene sufD 25521 24196 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_02340 26311 25559 gene locus_tag LOCUS_02350 gene sufC 26311 25559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_02350 27845 26400 gene locus_tag LOCUS_02360 gene sufB 27845 26400 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958177.1 protein_id gnl|my_center|LOCUS_02360 28624 28019 gene locus_tag LOCUS_02370 28624 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_02370 29735 28617 gene locus_tag LOCUS_02380 gene paaE 29735 28617 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_02380 30183 29770 gene locus_tag LOCUS_02390 gene yqiW 30183 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_02390 30616 30290 gene locus_tag LOCUS_02400 30616 30290 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_02400 30704 31417 gene locus_tag LOCUS_02410 30704 31417 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_02410 31414 32778 gene locus_tag LOCUS_02420 gene dacB 31414 32778 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403836.1 protein_id gnl|my_center|LOCUS_02420 34259 32775 gene locus_tag LOCUS_02430 gene accC 34259 32775 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_02430 34404 35081 gene locus_tag LOCUS_02440 34404 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 35088 35795 gene locus_tag LOCUS_02450 35088 35795 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_02450 35785 36003 gene locus_tag LOCUS_02460 35785 36003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 36033 37445 gene locus_tag LOCUS_02470 36033 37445 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404981.1 protein_id gnl|my_center|LOCUS_02470 38728 37481 gene locus_tag LOCUS_02480 38728 37481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 38823 41198 gene locus_tag LOCUS_02490 38823 41198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 43140 41452 gene locus_tag LOCUS_02500 43140 41452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 44534 43248 gene locus_tag LOCUS_02510 44534 43248 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_02510 <46629 44554 gene locus_tag LOCUS_02520 <46629 44554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791796.1:ABC transporter ATP-binding protein >Feature sequence006 571 1059 gene locus_tag LOCUS_02530 571 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1060 1956 gene locus_tag LOCUS_02540 1060 1956 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_02540 1968 3041 gene locus_tag LOCUS_02550 1968 3041 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_02550 3598 3038 gene locus_tag LOCUS_02560 3598 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3681 4007 gene locus_tag LOCUS_02570 3681 4007 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_02570 4035 5021 gene locus_tag LOCUS_02580 4035 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 5734 5126 gene locus_tag LOCUS_02590 5734 5126 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_02590 5823 7355 gene locus_tag LOCUS_02600 gene gltX 5823 7355 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_02600 7359 7547 gene locus_tag LOCUS_02610 7359 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 7557 7907 gene locus_tag LOCUS_02620 gene dgkA 7557 7907 CDS product undecaprenol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19638 protein_id gnl|my_center|LOCUS_02620 15265 7910 gene locus_tag LOCUS_02630 gene sprA 15265 7910 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_02630 15913 15314 gene locus_tag LOCUS_02640 gene ruvA 15913 15314 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_02640 16077 16847 gene locus_tag LOCUS_02650 gene scpA 16077 16847 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_02650 17605 16850 gene locus_tag LOCUS_02660 17605 16850 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_02660 18238 17651 gene locus_tag LOCUS_02670 gene gldD 18238 17651 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_02670 19523 18231 gene locus_tag LOCUS_02680 19523 18231 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_02680 20056 19598 gene locus_tag LOCUS_02690 20056 19598 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64W20 protein_id gnl|my_center|LOCUS_02690 21072 20071 gene locus_tag LOCUS_02700 21072 20071 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_02700 21320 21607 gene locus_tag LOCUS_02710 gene hupA 21320 21607 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_02710 21620 22429 gene locus_tag LOCUS_02720 21620 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 22652 24196 gene locus_tag LOCUS_02730 22652 24196 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_02730 24202 24912 gene locus_tag LOCUS_02740 24202 24912 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_02740 24958 26829 gene locus_tag LOCUS_02750 24958 26829 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_02750 26842 27156 gene locus_tag LOCUS_02760 26842 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 27571 27167 gene locus_tag LOCUS_02770 27571 27167 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_02770 27636 27962 gene locus_tag LOCUS_02780 gene sufA 27636 27962 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_02780 28987 27959 gene locus_tag LOCUS_02790 28987 27959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 30251 28980 gene locus_tag LOCUS_02800 gene glyA 30251 28980 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_02800 30828 32243 gene locus_tag LOCUS_02810 30828 32243 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_02810 32254 33525 gene locus_tag LOCUS_02820 32254 33525 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_02820 33738 35648 gene locus_tag LOCUS_02830 33738 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 35696 36010 gene locus_tag LOCUS_02840 35696 36010 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_02840 36012 36257 gene locus_tag LOCUS_02850 36012 36257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 36822 36247 gene locus_tag LOCUS_02860 36822 36247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 38521 36836 gene locus_tag LOCUS_02870 38521 36836 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_02870 39330 38614 gene locus_tag LOCUS_02880 39330 38614 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_02880 39778 39374 gene locus_tag LOCUS_02890 39778 39374 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_02890 40005 42176 gene locus_tag LOCUS_02900 40005 42176 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_02900 42227 42571 gene locus_tag LOCUS_02910 42227 42571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence007 532 149 gene locus_tag LOCUS_02920 532 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2634 535 gene locus_tag LOCUS_02930 gene yyaL 2634 535 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_02930 3989 2730 gene locus_tag LOCUS_02940 3989 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6130 4052 gene locus_tag LOCUS_02950 gene metG 6130 4052 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3M1 protein_id gnl|my_center|LOCUS_02950 9269 6201 gene locus_tag LOCUS_02960 9269 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9320 10228 gene locus_tag LOCUS_02970 9320 10228 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_02970 10871 10230 gene locus_tag LOCUS_02980 gene thiE1 10871 10230 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962598.1 protein_id gnl|my_center|LOCUS_02980 11626 12057 gene locus_tag LOCUS_02990 11626 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 13567 12047 gene locus_tag LOCUS_03000 gene asnS 13567 12047 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I6 protein_id gnl|my_center|LOCUS_03000 13731 15203 gene locus_tag LOCUS_03010 gene rpoN 13731 15203 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_03010 15207 15845 gene locus_tag LOCUS_03020 15207 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 18212 15894 gene locus_tag LOCUS_03030 18212 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 19297 18239 gene locus_tag LOCUS_03040 19297 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 19317 20873 gene locus_tag LOCUS_03050 19317 20873 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_03050 21798 20908 gene locus_tag LOCUS_03060 21798 20908 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_03060 21874 23670 gene locus_tag LOCUS_03070 21874 23670 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_03070 23775 25601 gene locus_tag LOCUS_03080 23775 25601 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_03080 25614 27137 gene locus_tag LOCUS_03090 25614 27137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 27144 28487 gene locus_tag LOCUS_03100 27144 28487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 28553 30019 gene locus_tag LOCUS_03110 28553 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 31017 31499 gene locus_tag LOCUS_03120 31017 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 31508 32032 gene locus_tag LOCUS_03130 31508 32032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 32073 33665 gene locus_tag LOCUS_03140 32073 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 35952 33757 gene locus_tag LOCUS_03150 35952 33757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 36180 36923 gene locus_tag LOCUS_03160 gene ung 36180 36923 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_03160 39414 36859 gene locus_tag LOCUS_03170 39414 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 39532 39888 gene locus_tag LOCUS_03180 39532 39888 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_03180 39959 40033 gene locus_tag LOCUS_t00020 39959 40033 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 929 2284 gene locus_tag LOCUS_03190 gene dctD 929 2284 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_03190 3209 2286 gene locus_tag LOCUS_03200 gene rnz 3209 2286 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_03200 3582 3214 gene locus_tag LOCUS_03210 3582 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3762 6299 gene locus_tag LOCUS_03220 gene clpA 3762 6299 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_03220 6438 7343 gene locus_tag LOCUS_03230 gene thyA 6438 7343 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC7 protein_id gnl|my_center|LOCUS_03230 8006 7413 gene locus_tag LOCUS_03240 8006 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_03240 8433 8221 gene locus_tag LOCUS_03250 gene cspC 8433 8221 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_03250 8562 10331 gene locus_tag LOCUS_03260 gene typA 8562 10331 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_03260 11021 10524 gene locus_tag LOCUS_03270 11021 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 11020 12270 gene locus_tag LOCUS_03280 gene fahA 11020 12270 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_03280 12270 12800 gene locus_tag LOCUS_03290 12270 12800 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142306.1 protein_id gnl|my_center|LOCUS_03290 12797 13645 gene locus_tag LOCUS_03300 12797 13645 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_03300 13652 14584 gene locus_tag LOCUS_03310 13652 14584 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_03310 14795 15820 gene locus_tag LOCUS_03320 14795 15820 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_03320 15842 16921 gene locus_tag LOCUS_03330 15842 16921 CDS product 7-dehydrocholesterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958044.1 protein_id gnl|my_center|LOCUS_03330 17112 17879 gene locus_tag LOCUS_03340 17112 17879 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_03340 18706 17909 gene locus_tag LOCUS_03350 18706 17909 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_03350 18832 19137 gene locus_tag LOCUS_03360 18832 19137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 21566 19158 gene locus_tag LOCUS_03370 21566 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 21827 23611 gene locus_tag LOCUS_03380 21827 23611 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_03380 25173 23722 gene locus_tag LOCUS_03390 25173 23722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 26062 25178 gene locus_tag LOCUS_03400 26062 25178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 27508 26081 gene locus_tag LOCUS_03410 27508 26081 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965611.1 protein_id gnl|my_center|LOCUS_03410 28581 27550 gene locus_tag LOCUS_03420 28581 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 29177 28716 gene locus_tag LOCUS_03430 gene rnhA 29177 28716 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_03430 29569 29177 gene locus_tag LOCUS_03440 29569 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 29694 30740 gene locus_tag LOCUS_03450 gene menE 29694 30740 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_03450 31099 30746 gene locus_tag LOCUS_03460 31099 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 33827 31317 gene locus_tag LOCUS_03470 gene valS 33827 31317 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_03470 <37744 34139 gene locus_tag LOCUS_03480 <37744 34139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence009 2005 2985 gene locus_tag LOCUS_03490 2005 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3965 2982 gene locus_tag LOCUS_03500 3965 2982 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_03500 5604 3967 gene locus_tag LOCUS_03510 5604 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 8726 5613 gene locus_tag LOCUS_03520 8726 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_03520 9172 9747 gene locus_tag LOCUS_03530 9172 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 10192 9740 gene locus_tag LOCUS_03540 10192 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_03540 10404 11186 gene locus_tag LOCUS_03550 10404 11186 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_03550 11323 12333 gene locus_tag LOCUS_03560 11323 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 12358 13353 gene locus_tag LOCUS_03570 12358 13353 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_03570 13373 14209 gene locus_tag LOCUS_03580 13373 14209 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_03580 14216 15019 gene locus_tag LOCUS_03590 14216 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_03590 16758 15133 gene locus_tag LOCUS_03600 gene pyrG 16758 15133 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_03600 16862 18532 gene locus_tag LOCUS_03610 16862 18532 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_03610 18962 18546 gene locus_tag LOCUS_03620 18962 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 19224 18994 gene locus_tag LOCUS_03630 19224 18994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_03630 19264 21033 gene locus_tag LOCUS_03640 gene argS 19264 21033 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_03640 21809 21114 gene locus_tag LOCUS_03650 21809 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 23577 21997 gene locus_tag LOCUS_03660 23577 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 24174 23617 gene locus_tag LOCUS_03670 gene pth 24174 23617 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_03670 24813 24187 gene locus_tag LOCUS_03680 gene rplY 24813 24187 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_03680 25764 24820 gene locus_tag LOCUS_03690 gene prsA 25764 24820 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_03690 26038 25965 gene locus_tag LOCUS_t00030 26038 25965 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26912 26091 gene locus_tag LOCUS_03700 26912 26091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 27718 26918 gene locus_tag LOCUS_03710 27718 26918 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_03710 27899 31090 gene locus_tag LOCUS_03720 27899 31090 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_03720 31100 31870 gene locus_tag LOCUS_03730 31100 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 33136 31913 gene locus_tag LOCUS_03740 33136 31913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 33779 33210 gene locus_tag LOCUS_03750 33779 33210 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_03750 34296 33850 gene locus_tag LOCUS_03760 34296 33850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 36653 34623 gene locus_tag LOCUS_03770 36653 34623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 37134 36658 gene locus_tag LOCUS_03780 37134 36658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 37325 37241 gene locus_tag LOCUS_t00040 37325 37241 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 873 1256 gene locus_tag LOCUS_03790 873 1256 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_03790 1369 3588 gene locus_tag LOCUS_03800 1369 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3585 3980 gene locus_tag LOCUS_03810 3585 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3981 4733 gene locus_tag LOCUS_03820 3981 4733 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_03820 4726 5355 gene locus_tag LOCUS_03830 4726 5355 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259683.1 protein_id gnl|my_center|LOCUS_03830 5368 5997 gene locus_tag LOCUS_03840 5368 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 9506 6006 gene locus_tag LOCUS_03850 9506 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9910 9506 gene locus_tag LOCUS_03860 9910 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10903 9956 gene locus_tag LOCUS_03870 10903 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12250 10907 gene locus_tag LOCUS_03880 12250 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 12749 12264 gene locus_tag LOCUS_03890 12749 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 13541 12753 gene locus_tag LOCUS_03900 13541 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 13884 14333 gene locus_tag LOCUS_03910 13884 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 15275 14310 gene locus_tag LOCUS_03920 15275 14310 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_03920 16465 15272 gene locus_tag LOCUS_03930 16465 15272 CDS product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 protein_id gnl|my_center|LOCUS_03930 17573 16452 gene locus_tag LOCUS_03940 17573 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 17713 18690 gene locus_tag LOCUS_03950 gene hpnA 17713 18690 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_03950 18763 19722 gene locus_tag LOCUS_03960 18763 19722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_03960 22229 19809 gene locus_tag LOCUS_03970 22229 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 24100 22661 gene locus_tag LOCUS_03980 24100 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 25556 24093 gene locus_tag LOCUS_03990 gene srfJ 25556 24093 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_03990 26953 25610 gene locus_tag LOCUS_04000 26953 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 30419 26973 gene locus_tag LOCUS_04010 30419 26973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 31356 30508 gene locus_tag LOCUS_04020 31356 30508 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_04020 32760 31378 gene locus_tag LOCUS_04030 32760 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence011 284 2248 gene locus_tag LOCUS_04040 gene gyrB 284 2248 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_04040 2866 2282 gene locus_tag LOCUS_04050 2866 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3941 2934 gene locus_tag LOCUS_04060 3941 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 7483 4004 gene locus_tag LOCUS_04070 7483 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 7611 8969 gene locus_tag LOCUS_04080 7611 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 9082 10839 gene locus_tag LOCUS_04090 gene fadD 9082 10839 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_04090 11462 10995 gene locus_tag LOCUS_04100 11462 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_04100 12305 11556 gene locus_tag LOCUS_04110 12305 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12826 12392 gene locus_tag LOCUS_04120 12826 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 13534 12965 gene locus_tag LOCUS_04130 13534 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 13710 14996 gene locus_tag LOCUS_04140 13710 14996 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9R339 protein_id gnl|my_center|LOCUS_04140 15713 15081 gene locus_tag LOCUS_04150 15713 15081 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_04150 16751 15744 gene locus_tag LOCUS_04160 gene trpS 16751 15744 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH36 protein_id gnl|my_center|LOCUS_04160 16840 17199 gene locus_tag LOCUS_04170 gene gatC 16840 17199 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS7 protein_id gnl|my_center|LOCUS_04170 17196 17879 gene locus_tag LOCUS_04180 17196 17879 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_04180 17892 18545 gene locus_tag LOCUS_04190 17892 18545 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_04190 19459 18542 gene locus_tag LOCUS_04200 gene xerC 19459 18542 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_04200 19525 19944 gene locus_tag LOCUS_04210 gene aroQ 19525 19944 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR7 protein_id gnl|my_center|LOCUS_04210 20923 19946 gene locus_tag LOCUS_04220 gene pdhB 20923 19946 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_04220 21123 21446 gene locus_tag LOCUS_04230 21123 21446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_04230 21457 23466 gene locus_tag LOCUS_04240 21457 23466 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_04240 23470 24735 gene locus_tag LOCUS_04250 gene pyrC 23470 24735 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_04250 24732 24932 gene locus_tag LOCUS_04260 24732 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24936 25889 gene locus_tag LOCUS_04270 24936 25889 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_04270 26609 27367 gene locus_tag LOCUS_04280 26609 27367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 28436 27360 gene locus_tag LOCUS_04290 28436 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107641.1 protein_id gnl|my_center|LOCUS_04290 29263 28460 gene locus_tag LOCUS_04300 gene gumL 29263 28460 CDS product GumL protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037585.1 protein_id gnl|my_center|LOCUS_04300 30102 29260 gene locus_tag LOCUS_04310 30102 29260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 31948 30206 gene locus_tag LOCUS_04320 31948 30206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence012 772 44 gene locus_tag LOCUS_04330 772 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 907 2028 gene locus_tag LOCUS_04340 gene porR 907 2028 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_04340 2025 3326 gene locus_tag LOCUS_04350 gene ugd 2025 3326 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_04350 3330 4313 gene locus_tag LOCUS_04360 3330 4313 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_04360 4319 4891 gene locus_tag LOCUS_04370 4319 4891 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_04370 4895 6184 gene locus_tag LOCUS_04380 gene wbtE 4895 6184 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_04380 6191 7237 gene locus_tag LOCUS_04390 gene rmlB 6191 7237 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_04390 7240 8223 gene locus_tag LOCUS_04400 7240 8223 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_04400 8207 8980 gene locus_tag LOCUS_04410 8207 8980 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_04410 8982 9518 gene locus_tag LOCUS_04420 gene rmlC 8982 9518 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_04420 10062 10286 gene locus_tag LOCUS_04430 10062 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 10365 11375 gene locus_tag LOCUS_04440 10365 11375 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030812.1 protein_id gnl|my_center|LOCUS_04440 12602 11379 gene locus_tag LOCUS_04450 gene ald 12602 11379 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_04450 13033 12620 gene locus_tag LOCUS_04460 13033 12620 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_04460 14589 13036 gene locus_tag LOCUS_04470 gene porX 14589 13036 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_04470 15268 14726 gene locus_tag LOCUS_04480 15268 14726 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_04480 16742 15282 gene locus_tag LOCUS_04490 16742 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16934 18157 gene locus_tag LOCUS_04500 16934 18157 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_04500 18205 19242 gene locus_tag LOCUS_04510 gene lpxD 18205 19242 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_04510 19239 20633 gene locus_tag LOCUS_04520 gene fabZ 19239 20633 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_04520 20633 21424 gene locus_tag LOCUS_04530 gene lpxA 20633 21424 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_04530 21430 22032 gene locus_tag LOCUS_04540 21430 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 22035 22886 gene locus_tag LOCUS_04550 gene fabD 22035 22886 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_04550 23107 23679 gene locus_tag LOCUS_04560 23107 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 25469 23676 gene locus_tag LOCUS_04570 25469 23676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 26133 25507 gene locus_tag LOCUS_04580 26133 25507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_04580 27223 26255 gene locus_tag LOCUS_04590 gene etfA 27223 26255 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_04590 27981 27241 gene locus_tag LOCUS_04600 gene etfB 27981 27241 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_04600 28163 29512 gene locus_tag LOCUS_04610 gene tilS 28163 29512 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7D1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence013 613 362 gene locus_tag LOCUS_04620 gene rpsT 613 362 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A276 protein_id gnl|my_center|LOCUS_04620 821 3550 gene locus_tag LOCUS_04630 gene sucA 821 3550 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_04630 3561 4841 gene locus_tag LOCUS_04640 gene sucB 3561 4841 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_04640 5007 5993 gene locus_tag LOCUS_04650 5007 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5997 6782 gene locus_tag LOCUS_04660 5997 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 6929 9013 gene locus_tag LOCUS_04670 6929 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9035 9601 gene locus_tag LOCUS_04680 9035 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 9722 9943 gene locus_tag LOCUS_04690 9722 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9948 11390 gene locus_tag LOCUS_04700 9948 11390 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_04700 11573 11872 gene locus_tag LOCUS_04710 11573 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 13533 11878 gene locus_tag LOCUS_04720 13533 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14690 13533 gene locus_tag LOCUS_04730 gene hmgA 14690 13533 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_04730 14794 15366 gene locus_tag LOCUS_04740 14794 15366 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_04740 15366 15677 gene locus_tag LOCUS_04750 15366 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 16386 17126 gene locus_tag LOCUS_04760 16386 17126 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_04760 21700 17360 gene locus_tag LOCUS_04770 gene rpoC 21700 17360 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_04770 25543 21731 gene locus_tag LOCUS_04780 gene rpoB 25543 21731 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_04780 25997 25623 gene locus_tag LOCUS_04790 gene rplL 25997 25623 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_04790 26555 26037 gene locus_tag LOCUS_04800 26555 26037 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_04800 27256 26558 gene locus_tag LOCUS_04810 gene rplA 27256 26558 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_04810 27763 27317 gene locus_tag LOCUS_04820 gene rplK 27763 27317 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_04820 28325 27765 gene locus_tag LOCUS_04830 gene nusG 28325 27765 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 protein_id gnl|my_center|LOCUS_04830 28611 28538 gene locus_tag LOCUS_t00050 28611 28538 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 29862 28675 gene locus_tag LOCUS_04840 gene tuf 29862 28675 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_04840 30022 29950 gene locus_tag LOCUS_t00060 30022 29950 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 85 1821 gene locus_tag LOCUS_04850 85 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1910 3691 gene locus_tag LOCUS_04860 1910 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3855 3688 gene locus_tag LOCUS_04870 3855 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5168 4119 gene locus_tag LOCUS_04880 5168 4119 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945949.1 protein_id gnl|my_center|LOCUS_04880 5193 5597 gene locus_tag LOCUS_04890 5193 5597 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_04890 5591 6085 gene locus_tag LOCUS_04900 5591 6085 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_04900 6165 6947 gene locus_tag LOCUS_04910 6165 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 7564 6962 gene locus_tag LOCUS_04920 7564 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7857 9431 gene locus_tag LOCUS_04930 gene choB 7857 9431 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 protein_id gnl|my_center|LOCUS_04930 9553 11064 gene locus_tag LOCUS_04940 9553 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_04940 11302 12174 gene locus_tag LOCUS_04950 gene folD 11302 12174 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 protein_id gnl|my_center|LOCUS_04950 12372 14000 gene locus_tag LOCUS_04960 12372 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 14028 14861 gene locus_tag LOCUS_04970 14028 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 14879 15517 gene locus_tag LOCUS_04980 gene queE 14879 15517 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_04980 15580 17493 gene locus_tag LOCUS_04990 15580 17493 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_04990 17630 19231 gene locus_tag LOCUS_05000 gene pckA1 17630 19231 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_05000 19358 20059 gene locus_tag LOCUS_05010 19358 20059 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_05010 20056 20709 gene locus_tag LOCUS_05020 20056 20709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_05020 21636 20713 gene locus_tag LOCUS_05030 gene pyrD 21636 20713 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_05030 21789 23057 gene locus_tag LOCUS_05040 21789 23057 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_05040 23124 24521 gene locus_tag LOCUS_05050 gene speA 23124 24521 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_05050 24528 24974 gene locus_tag LOCUS_05060 24528 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 25001 26368 gene locus_tag LOCUS_05070 25001 26368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence015 <1 1320 gene locus_tag LOCUS_05080 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964144.1:epimerase 3641 1407 gene locus_tag LOCUS_05090 3641 1407 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_05090 4916 3936 gene locus_tag LOCUS_05100 gene porQ 4916 3936 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_05100 5213 6523 gene locus_tag LOCUS_05110 gene rimO 5213 6523 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_05110 6527 8113 gene locus_tag LOCUS_05120 gene bshC 6527 8113 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_05120 9061 8270 gene locus_tag LOCUS_05130 9061 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 9618 9145 gene locus_tag LOCUS_05140 9618 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_05140 9768 10388 gene locus_tag LOCUS_05150 9768 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 11248 10379 gene locus_tag LOCUS_05160 11248 10379 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668818.1 protein_id gnl|my_center|LOCUS_05160 12432 11251 gene locus_tag LOCUS_05170 gene putA 12432 11251 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_05170 13102 12503 gene locus_tag LOCUS_05180 gene rsmG 13102 12503 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_05180 13710 13105 gene locus_tag LOCUS_05190 gene sigW 13710 13105 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_05190 14794 13697 gene locus_tag LOCUS_05200 14794 13697 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_05200 14793 15923 gene locus_tag LOCUS_05210 gene tgt 14793 15923 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_05210 16016 17032 gene locus_tag LOCUS_05220 16016 17032 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_05220 18584 17046 gene locus_tag LOCUS_05230 gene dnaB 18584 17046 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_05230 19476 18730 gene locus_tag LOCUS_05240 19476 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 19753 20313 gene locus_tag LOCUS_05250 gene ruvC 19753 20313 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_05250 20711 20310 gene locus_tag LOCUS_05260 20711 20310 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_05260 21182 20712 gene locus_tag LOCUS_05270 gene greA 21182 20712 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2N3 protein_id gnl|my_center|LOCUS_05270 22768 21260 gene locus_tag LOCUS_05280 22768 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 26880 22798 gene locus_tag LOCUS_05290 26880 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence016 410 195 gene locus_tag LOCUS_05300 410 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 313 603 gene locus_tag LOCUS_05310 313 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 641 1456 gene locus_tag LOCUS_05320 641 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1465 2742 gene locus_tag LOCUS_05330 gene folC 1465 2742 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_05330 3348 2749 gene locus_tag LOCUS_05340 gene folE 3348 2749 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU5 protein_id gnl|my_center|LOCUS_05340 3811 3404 gene locus_tag LOCUS_05350 gene ygcM 3811 3404 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_05350 3879 4538 gene locus_tag LOCUS_05360 3879 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4535 5038 gene locus_tag LOCUS_05370 4535 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 7791 5089 gene locus_tag LOCUS_05380 7791 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8279 7794 gene locus_tag LOCUS_05390 8279 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 9076 8276 gene locus_tag LOCUS_05400 9076 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 9732 9076 gene locus_tag LOCUS_05410 9732 9076 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096990.1 protein_id gnl|my_center|LOCUS_05410 10447 9755 gene locus_tag LOCUS_05420 gene atoD 10447 9755 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_05420 10794 10444 gene locus_tag LOCUS_05430 10794 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 10851 11510 gene locus_tag LOCUS_05440 10851 11510 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_05440 11987 11499 gene locus_tag LOCUS_05450 11987 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_05450 13116 12256 gene locus_tag LOCUS_05460 gene mvaB 13116 12256 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_05460 13545 13123 gene locus_tag LOCUS_05470 13545 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 13636 14442 gene locus_tag LOCUS_05480 gene murQ 13636 14442 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_05480 14444 15019 gene locus_tag LOCUS_05490 14444 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 16637 15036 gene locus_tag LOCUS_05500 gene prfC 16637 15036 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_05500 17183 16962 gene locus_tag LOCUS_05510 17183 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_05510 17791 17246 gene locus_tag LOCUS_05520 17791 17246 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_05520 19479 17803 gene locus_tag LOCUS_05530 19479 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 21344 19509 gene locus_tag LOCUS_05540 21344 19509 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490750.1 protein_id gnl|my_center|LOCUS_05540 23344 21479 gene locus_tag LOCUS_05550 23344 21479 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_05550 23716 23399 gene locus_tag LOCUS_05560 23716 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 24853 23720 gene locus_tag LOCUS_05570 24853 23720 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_05570 26232 24853 gene locus_tag LOCUS_05580 26232 24853 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_05580 26304 27041 gene locus_tag LOCUS_05590 26304 27041 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_05590 27041 27610 gene locus_tag LOCUS_05600 27041 27610 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence017 554 81 gene locus_tag LOCUS_05610 554 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 protein_id gnl|my_center|LOCUS_05610 1171 557 gene locus_tag LOCUS_05620 1171 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2864 1233 gene locus_tag LOCUS_05630 2864 1233 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_05630 3294 3701 gene locus_tag LOCUS_05640 3294 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3772 4764 gene locus_tag LOCUS_05650 3772 4764 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_05650 5284 4730 gene locus_tag LOCUS_05660 5284 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_05660 6272 5439 gene locus_tag LOCUS_05670 6272 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6547 6975 gene locus_tag LOCUS_05680 6547 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6982 11172 gene locus_tag LOCUS_05690 6982 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 11227 12240 gene locus_tag LOCUS_05700 11227 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 12263 14275 gene locus_tag LOCUS_05710 12263 14275 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_05710 14367 15437 gene locus_tag LOCUS_05720 14367 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 15463 16551 gene locus_tag LOCUS_05730 15463 16551 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJD1 protein_id gnl|my_center|LOCUS_05730 16532 16804 gene locus_tag LOCUS_05740 16532 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16809 17609 gene locus_tag LOCUS_05750 gene pyrF 16809 17609 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_05750 17899 19458 gene locus_tag LOCUS_05760 17899 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 19461 20114 gene locus_tag LOCUS_05770 gene lipB 19461 20114 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8S8 protein_id gnl|my_center|LOCUS_05770 20184 21983 gene locus_tag LOCUS_05780 20184 21983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 24535 22079 gene locus_tag LOCUS_05790 24535 22079 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_05790 25433 24843 gene locus_tag LOCUS_05800 25433 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 26677 25430 gene locus_tag LOCUS_05810 26677 25430 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence018 <1 650 gene locus_tag LOCUS_05820 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962484.1:mevalonate kinase 676 1170 gene locus_tag LOCUS_05830 676 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2201 1311 gene locus_tag LOCUS_05840 2201 1311 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_05840 4611 2329 gene locus_tag LOCUS_05850 4611 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4589 4810 gene locus_tag LOCUS_05860 4589 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4878 5585 gene locus_tag LOCUS_05870 4878 5585 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967172.1 protein_id gnl|my_center|LOCUS_05870 6847 5582 gene locus_tag LOCUS_05880 gene wzx 6847 5582 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119725.1 protein_id gnl|my_center|LOCUS_05880 7437 6844 gene locus_tag LOCUS_05890 7437 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 8016 7438 gene locus_tag LOCUS_05900 8016 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8106 8699 gene locus_tag LOCUS_05910 gene tdk 8106 8699 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_05910 10316 8706 gene locus_tag LOCUS_05920 10316 8706 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_05920 10784 10326 gene locus_tag LOCUS_05930 10784 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11273 12784 gene locus_tag LOCUS_05940 gene rprX 11273 12784 CDS product sensor protein RprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08408 protein_id gnl|my_center|LOCUS_05940 12792 13493 gene locus_tag LOCUS_05950 gene rprY 12792 13493 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_05950 13562 15256 gene locus_tag LOCUS_05960 13562 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 15231 16274 gene locus_tag LOCUS_05970 gene gpsA 15231 16274 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Y4 protein_id gnl|my_center|LOCUS_05970 16277 18649 gene locus_tag LOCUS_05980 gene mutS2 16277 18649 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YQ1 protein_id gnl|my_center|LOCUS_05980 18621 19661 gene locus_tag LOCUS_05990 18621 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 20184 21773 gene locus_tag LOCUS_06000 gene menD 20184 21773 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_06000 21780 22508 gene locus_tag LOCUS_06010 gene ftsE 21780 22508 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_06010 22513 23385 gene locus_tag LOCUS_06020 22513 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 23446 24162 gene locus_tag LOCUS_06030 gene dapB 23446 24162 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_06030 24216 25784 gene locus_tag LOCUS_06040 gene lepB 24216 25784 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_06040 25857 25931 gene locus_tag LOCUS_t00070 25857 25931 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 1094 2290 gene locus_tag LOCUS_06050 gene purT 1094 2290 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDJ0 protein_id gnl|my_center|LOCUS_06050 2427 3458 gene locus_tag LOCUS_06060 gene yceA 2427 3458 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_06060 3957 3460 gene locus_tag LOCUS_06070 3957 3460 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_06070 4079 4951 gene locus_tag LOCUS_06080 4079 4951 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_06080 4952 5212 gene locus_tag LOCUS_06090 4952 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5212 6012 gene locus_tag LOCUS_06100 gene uppP 5212 6012 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_06100 6075 6689 gene locus_tag LOCUS_06110 6075 6689 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_06110 6679 7092 gene locus_tag LOCUS_06120 6679 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7834 7175 gene locus_tag LOCUS_06130 7834 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_06130 8468 7854 gene locus_tag LOCUS_06140 8468 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946140.1 protein_id gnl|my_center|LOCUS_06140 9394 8468 gene locus_tag LOCUS_06150 gene purC 9394 8468 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_06150 13747 9578 gene locus_tag LOCUS_06160 13747 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 14519 13998 gene locus_tag LOCUS_06170 14519 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 14779 15999 gene locus_tag LOCUS_06180 14779 15999 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_06180 17335 16016 gene locus_tag LOCUS_06190 gene dbpA 17335 16016 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_06190 18903 17341 gene locus_tag LOCUS_06200 18903 17341 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_06200 19998 19048 gene locus_tag LOCUS_06210 19998 19048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_06210 21402 20011 gene locus_tag LOCUS_06220 21402 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 21528 23012 gene locus_tag LOCUS_06230 21528 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 23033 23656 gene locus_tag LOCUS_06240 23033 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 23720 23971 gene locus_tag LOCUS_06250 gene rpmB 23720 23971 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_06250 23975 24163 gene locus_tag LOCUS_06260 gene rpmG 23975 24163 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_06260 24166 24333 gene locus_tag LOCUS_06270 24166 24333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 24409 25365 gene locus_tag LOCUS_06280 gene ftsY 24409 25365 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_06280 25446 25521 gene locus_tag LOCUS_t00080 25446 25521 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 151 1305 gene locus_tag LOCUS_06290 151 1305 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_06290 2101 1397 gene locus_tag LOCUS_06300 gene rnc 2101 1397 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV9 protein_id gnl|my_center|LOCUS_06300 3355 2105 gene locus_tag LOCUS_06310 gene fabF 3355 2105 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_06310 3601 3368 gene locus_tag LOCUS_06320 gene acpP 3601 3368 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_06320 3702 4130 gene locus_tag LOCUS_06330 3702 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4151 5596 gene locus_tag LOCUS_06340 gene pykA 4151 5596 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_06340 6664 5648 gene locus_tag LOCUS_06350 6664 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7229 6666 gene locus_tag LOCUS_06360 7229 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8055 7315 gene locus_tag LOCUS_06370 gene lptB 8055 7315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_06370 9737 8052 gene locus_tag LOCUS_06380 gene recJ 9737 8052 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_06380 11096 9738 gene locus_tag LOCUS_06390 gene kmo 11096 9738 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_06390 12587 11139 gene locus_tag LOCUS_06400 12587 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 12736 14670 gene locus_tag LOCUS_06410 12736 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 14772 15467 gene locus_tag LOCUS_06420 gene radC 14772 15467 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_06420 15570 16661 gene locus_tag LOCUS_06430 15570 16661 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_06430 17289 16726 gene locus_tag LOCUS_06440 gene frr 17289 16726 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_06440 18015 17308 gene locus_tag LOCUS_06450 gene pyrH 18015 17308 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_06450 19092 18115 gene locus_tag LOCUS_06460 gene tsf 19092 18115 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH3 protein_id gnl|my_center|LOCUS_06460 19973 19188 gene locus_tag LOCUS_06470 gene rpsB 19973 19188 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P29 protein_id gnl|my_center|LOCUS_06470 20390 20004 gene locus_tag LOCUS_06480 gene rpsI 20390 20004 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBK5 protein_id gnl|my_center|LOCUS_06480 20835 20395 gene locus_tag LOCUS_06490 gene rplM 20835 20395 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_06490 21238 22629 gene locus_tag LOCUS_06500 gene lpdA1 21238 22629 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_06500 22749 23945 gene locus_tag LOCUS_06510 gene rsmB 22749 23945 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_06510 24641 24003 gene locus_tag LOCUS_06520 24641 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 25207 24785 gene locus_tag LOCUS_06530 25207 24785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence021 <1 2985 gene locus_tag LOCUS_06540 <1 2985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 3082 3849 gene locus_tag LOCUS_06550 gene surE 3082 3849 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_06550 3846 4136 gene locus_tag LOCUS_06560 3846 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4136 5221 gene locus_tag LOCUS_06570 gene lpxB 4136 5221 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_06570 5224 5829 gene locus_tag LOCUS_06580 5224 5829 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_06580 5883 7169 gene locus_tag LOCUS_06590 gene metK 5883 7169 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_06590 8346 7231 gene locus_tag LOCUS_06600 8346 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8603 10009 gene locus_tag LOCUS_06610 8603 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 10036 11022 gene locus_tag LOCUS_06620 10036 11022 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_06620 11023 11766 gene locus_tag LOCUS_06630 gene aroE 11023 11766 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_06630 12637 11867 gene locus_tag LOCUS_06640 12637 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887787.1 protein_id gnl|my_center|LOCUS_06640 12844 13314 gene locus_tag LOCUS_06650 12844 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 13814 13311 gene locus_tag LOCUS_06660 gene pyrR 13814 13311 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K6 protein_id gnl|my_center|LOCUS_06660 16234 13811 gene locus_tag LOCUS_06670 16234 13811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 16350 17687 gene locus_tag LOCUS_06680 16350 17687 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_06680 17797 18573 gene locus_tag LOCUS_06690 17797 18573 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_06690 18576 19052 gene locus_tag LOCUS_06700 18576 19052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_06700 20131 19049 gene locus_tag LOCUS_06710 gene yqiG 20131 19049 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_06710 20294 21775 gene locus_tag LOCUS_06720 gene miaB 20294 21775 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_06720 21863 23098 gene locus_tag LOCUS_06730 21863 23098 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_06730 23095 23595 gene locus_tag LOCUS_06740 23095 23595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 23589 24461 gene locus_tag LOCUS_06750 23589 24461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 24464 24811 gene locus_tag LOCUS_06760 24464 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence022 683 276 gene locus_tag LOCUS_06770 683 276 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_06770 2719 689 gene locus_tag LOCUS_06780 2719 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3319 2726 gene locus_tag LOCUS_06790 3319 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_06790 4187 3303 gene locus_tag LOCUS_06800 4187 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 5218 4184 gene locus_tag LOCUS_06810 gene ribD 5218 4184 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_06810 5421 7328 gene locus_tag LOCUS_06820 gene bfmBA 5421 7328 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_06820 8331 7579 gene locus_tag LOCUS_06830 8331 7579 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_06830 9466 8342 gene locus_tag LOCUS_06840 9466 8342 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_06840 9568 11292 gene locus_tag LOCUS_06850 9568 11292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_06850 12158 12901 gene locus_tag LOCUS_06860 12158 12901 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06860 12947 13915 gene locus_tag LOCUS_06870 12947 13915 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_06870 14011 15267 gene locus_tag LOCUS_06880 gene gldK 14011 15267 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_06880 15352 15993 gene locus_tag LOCUS_06890 gene gldL 15352 15993 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_06890 16039 17682 gene locus_tag LOCUS_06900 gene gldM 16039 17682 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_06900 17743 18561 gene locus_tag LOCUS_06910 17743 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 20351 18558 gene locus_tag LOCUS_06920 gene uvrC 20351 18558 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_06920 22641 20356 gene locus_tag LOCUS_06930 gene mrcA 22641 20356 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence023 749 3247 gene locus_tag LOCUS_06940 749 3247 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_06940 3779 4681 gene locus_tag LOCUS_06950 3779 4681 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_06950 4678 5541 gene locus_tag LOCUS_06960 4678 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_06960 5538 6104 gene locus_tag LOCUS_06970 gene gmk 5538 6104 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_06970 7183 6101 gene locus_tag LOCUS_06980 7183 6101 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_06980 7306 9501 gene locus_tag LOCUS_06990 7306 9501 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_06990 10431 9616 gene locus_tag LOCUS_07000 10431 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11353 10556 gene locus_tag LOCUS_07010 11353 10556 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_07010 12447 11395 gene locus_tag LOCUS_07020 gene kynA 12447 11395 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG95 protein_id gnl|my_center|LOCUS_07020 12988 12533 gene locus_tag LOCUS_07030 gene tadA 12988 12533 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_07030 13905 12988 gene locus_tag LOCUS_07040 13905 12988 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_07040 15145 13898 gene locus_tag LOCUS_07050 15145 13898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868206.1 protein_id gnl|my_center|LOCUS_07050 15265 15642 gene locus_tag LOCUS_07060 15265 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 16010 16591 gene locus_tag LOCUS_07070 16010 16591 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_07070 16584 17633 gene locus_tag LOCUS_07080 16584 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 18364 17789 gene locus_tag LOCUS_07090 18364 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_07090 19109 18405 gene locus_tag LOCUS_07100 19109 18405 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_07100 19440 21170 gene locus_tag LOCUS_07110 19440 21170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_07110 21202 23034 gene locus_tag LOCUS_07120 21202 23034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_07120 23095 23388 gene locus_tag LOCUS_07130 23095 23388 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_07130 23452 23817 gene locus_tag LOCUS_07140 23452 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 24121 23837 gene locus_tag LOCUS_07150 24121 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence024 1483 146 gene locus_tag LOCUS_07160 gene nqrF 1483 146 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_07160 2123 1509 gene locus_tag LOCUS_07170 gene nqrE 2123 1509 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_07170 2810 2154 gene locus_tag LOCUS_07180 gene nqrD 2810 2154 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_07180 3549 2821 gene locus_tag LOCUS_07190 gene nqrC 3549 2821 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_07190 4822 3536 gene locus_tag LOCUS_07200 gene nqrB 4822 3536 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_07200 6499 4856 gene locus_tag LOCUS_07210 gene nqrA 6499 4856 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_07210 6706 7314 gene locus_tag LOCUS_07220 6706 7314 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEM4 protein_id gnl|my_center|LOCUS_07220 7471 7845 gene locus_tag LOCUS_07230 7471 7845 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 protein_id gnl|my_center|LOCUS_07230 8717 7851 gene locus_tag LOCUS_07240 8717 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 11054 8721 gene locus_tag LOCUS_07250 gene topA 11054 8721 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X7 protein_id gnl|my_center|LOCUS_07250 11194 12540 gene locus_tag LOCUS_07260 gene purB 11194 12540 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_07260 12595 14484 gene locus_tag LOCUS_07270 gene yidC 12595 14484 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_07270 14599 17682 gene locus_tag LOCUS_07280 14599 17682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 19418 19840 gene locus_tag LOCUS_07290 19418 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 19840 20619 gene locus_tag LOCUS_07300 19840 20619 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_07300 20820 21653 gene locus_tag LOCUS_07310 20820 21653 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_07310 23551 21650 gene locus_tag LOCUS_07320 23551 21650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 <24385 23637 gene locus_tag LOCUS_07330 <24385 23637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJH8:galactose-1-phosphate uridylyltransferase >Feature sequence025 1707 3221 gene locus_tag LOCUS_07340 1707 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3920 3246 gene locus_tag LOCUS_07350 3920 3246 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_07350 4073 5671 gene locus_tag LOCUS_07360 4073 5671 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_07360 5689 6318 gene locus_tag LOCUS_07370 5689 6318 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_07370 6311 6991 gene locus_tag LOCUS_07380 6311 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035630.1 protein_id gnl|my_center|LOCUS_07380 7349 8359 gene locus_tag LOCUS_07390 7349 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 8434 9921 gene locus_tag LOCUS_07400 8434 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11529 9994 gene locus_tag LOCUS_07410 11529 9994 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_07410 14086 11696 gene locus_tag LOCUS_07420 14086 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 18973 14279 gene locus_tag LOCUS_07430 18973 14279 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_07430 19079 20092 gene locus_tag LOCUS_07440 gene tsaD 19079 20092 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_07440 20140 20856 gene locus_tag LOCUS_07450 20140 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 21425 20853 gene locus_tag LOCUS_07460 gene trpG 21425 20853 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_07460 21965 21432 gene locus_tag LOCUS_07470 21965 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 22411 21962 gene locus_tag LOCUS_07480 22411 21962 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_07480 22916 22425 gene locus_tag LOCUS_07490 22916 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 23146 22922 gene locus_tag LOCUS_07500 23146 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 23470 23368 gene locus_tag LOCUS_r00010 23470 23368 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence026 <1 2509 gene locus_tag LOCUS_07510 <1 2509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109118.1:membrane protein 2532 4046 gene locus_tag LOCUS_07520 2532 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4114 5382 gene locus_tag LOCUS_07530 gene rocD 4114 5382 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_07530 6260 5457 gene locus_tag LOCUS_07540 6260 5457 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 protein_id gnl|my_center|LOCUS_07540 7029 6262 gene locus_tag LOCUS_07550 7029 6262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_07550 7766 7026 gene locus_tag LOCUS_07560 7766 7026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_07560 7846 8550 gene locus_tag LOCUS_07570 7846 8550 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_07570 9646 8663 gene locus_tag LOCUS_07580 gene bioB 9646 8663 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_07580 10630 9770 gene locus_tag LOCUS_07590 10630 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_07590 11768 10686 gene locus_tag LOCUS_07600 11768 10686 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_07600 13304 12021 gene locus_tag LOCUS_07610 gene pabB 13304 12021 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_07610 14584 13310 gene locus_tag LOCUS_07620 gene purA 14584 13310 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_07620 14933 14598 gene locus_tag LOCUS_07630 14933 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 15405 14923 gene locus_tag LOCUS_07640 15405 14923 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_07640 17696 15456 gene locus_tag LOCUS_07650 gene relA 17696 15456 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_07650 17861 17943 gene locus_tag LOCUS_t00090 17861 17943 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17992 19347 gene locus_tag LOCUS_07660 17992 19347 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_07660 19359 20036 gene locus_tag LOCUS_07670 gene clpP 19359 20036 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_07670 20067 21308 gene locus_tag LOCUS_07680 gene clpX 20067 21308 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW3 protein_id gnl|my_center|LOCUS_07680 21548 21309 gene locus_tag LOCUS_07690 21548 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence027 462 2348 gene locus_tag LOCUS_07700 462 2348 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_07700 2335 2670 gene locus_tag LOCUS_07710 2335 2670 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_07710 2732 3994 gene locus_tag LOCUS_07720 2732 3994 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_07720 4015 4704 gene locus_tag LOCUS_07730 4015 4704 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_07730 5282 4752 gene locus_tag LOCUS_07740 5282 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 5409 6740 gene locus_tag LOCUS_07750 5409 6740 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_07750 6751 7953 gene locus_tag LOCUS_07760 6751 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8610 7975 gene locus_tag LOCUS_07770 8610 7975 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_07770 8702 12211 gene locus_tag LOCUS_07780 8702 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12290 13162 gene locus_tag LOCUS_07790 12290 13162 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_07790 14149 13166 gene locus_tag LOCUS_07800 gene yrbG 14149 13166 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_07800 14793 14200 gene locus_tag LOCUS_07810 14793 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 14884 16782 gene locus_tag LOCUS_07820 gene purF 14884 16782 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_07820 17178 16852 gene locus_tag LOCUS_07830 17178 16852 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_07830 18233 17181 gene locus_tag LOCUS_07840 18233 17181 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_07840 18546 20471 gene locus_tag LOCUS_07850 18546 20471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence028 700 774 gene locus_tag LOCUS_t00100 700 774 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1914 835 gene locus_tag LOCUS_07860 gene mvaD 1914 835 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_07860 2810 1905 gene locus_tag LOCUS_07870 2810 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_07870 4151 2814 gene locus_tag LOCUS_07880 gene mvaA 4151 2814 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_07880 4699 4220 gene locus_tag LOCUS_07890 gene coaD 4699 4220 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_07890 5250 4705 gene locus_tag LOCUS_07900 5250 4705 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_07900 5999 5247 gene locus_tag LOCUS_07910 5999 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6675 6076 gene locus_tag LOCUS_07920 6675 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6851 8188 gene locus_tag LOCUS_07930 6851 8188 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_07930 8844 8185 gene locus_tag LOCUS_07940 8844 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 8923 11337 gene locus_tag LOCUS_07950 8923 11337 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_07950 11339 11710 gene locus_tag LOCUS_07960 11339 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 13508 11715 gene locus_tag LOCUS_07970 13508 11715 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_07970 14291 13566 gene locus_tag LOCUS_07980 14291 13566 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_07980 14783 14292 gene locus_tag LOCUS_07990 gene bsaA 14783 14292 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IS0 protein_id gnl|my_center|LOCUS_07990 15375 14788 gene locus_tag LOCUS_08000 15375 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_08000 16352 15420 gene locus_tag LOCUS_08010 gene trxB1 16352 15420 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_08010 17360 16371 gene locus_tag LOCUS_08020 17360 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 19744 17396 gene locus_tag LOCUS_08030 19744 17396 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_08030 21591 19948 gene locus_tag LOCUS_08040 gene groL 21591 19948 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_08040 21913 21623 gene locus_tag LOCUS_08050 gene groS 21913 21623 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_08050 >Feature sequence029 269 1357 gene locus_tag LOCUS_08060 269 1357 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_08060 1369 2355 gene locus_tag LOCUS_08070 1369 2355 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_08070 4086 2434 gene locus_tag LOCUS_08080 gene hutU 4086 2434 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 protein_id gnl|my_center|LOCUS_08080 4532 4149 gene locus_tag LOCUS_08090 4532 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5643 4546 gene locus_tag LOCUS_08100 5643 4546 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887230.1 protein_id gnl|my_center|LOCUS_08100 5782 6393 gene locus_tag LOCUS_08110 gene udk 5782 6393 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_08110 11183 6399 gene locus_tag LOCUS_08120 11183 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 12018 11188 gene locus_tag LOCUS_08130 gene prmA 12018 11188 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_08130 12758 12018 gene locus_tag LOCUS_08140 gene tpiA 12758 12018 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC1 protein_id gnl|my_center|LOCUS_08140 13933 12758 gene locus_tag LOCUS_08150 13933 12758 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_08150 14094 14564 gene locus_tag LOCUS_08160 gene ykuK 14094 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34776 protein_id gnl|my_center|LOCUS_08160 14830 16068 gene locus_tag LOCUS_08170 gene hemA 14830 16068 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67314 protein_id gnl|my_center|LOCUS_08170 16044 16958 gene locus_tag LOCUS_08180 gene hemC 16044 16958 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_08180 16963 17658 gene locus_tag LOCUS_08190 16963 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 17655 18686 gene locus_tag LOCUS_08200 gene hemE 17655 18686 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_08200 18690 19607 gene locus_tag LOCUS_08210 gene hemF 18690 19607 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_08210 19607 20581 gene locus_tag LOCUS_08220 gene hemB 19607 20581 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_08220 >Feature sequence030 <1 1845 gene locus_tag LOCUS_08230 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230482.1:carboxypeptidase T 2816 1890 gene locus_tag LOCUS_08240 2816 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5658 2839 gene locus_tag LOCUS_08250 gene carB 5658 2839 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_08250 5750 6898 gene locus_tag LOCUS_08260 5750 6898 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_08260 6895 7980 gene locus_tag LOCUS_08270 6895 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7985 9208 gene locus_tag LOCUS_08280 7985 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9314 10666 gene locus_tag LOCUS_08290 9314 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 10675 11400 gene locus_tag LOCUS_08300 10675 11400 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_08300 11467 12825 gene locus_tag LOCUS_08310 gene rhlE 11467 12825 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_08310 14485 13019 gene locus_tag LOCUS_08320 14485 13019 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_08320 15600 14482 gene locus_tag LOCUS_08330 15600 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_08330 15897 15700 gene locus_tag LOCUS_08340 15897 15700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 16743 16006 gene locus_tag LOCUS_08350 16743 16006 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_08350 17880 16810 gene locus_tag LOCUS_08360 17880 16810 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_08360 19279 17870 gene locus_tag LOCUS_08370 19279 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 20337 19276 gene locus_tag LOCUS_08380 20337 19276 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_08380 20915 20655 gene locus_tag LOCUS_08390 20915 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence031 1417 431 gene locus_tag LOCUS_08400 gene ddl 1417 431 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_08400 1795 3438 gene locus_tag LOCUS_08410 1795 3438 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_08410 3500 3976 gene locus_tag LOCUS_08420 3500 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4496 4739 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgaagaagctccggctgaaga 4925 5479 gene locus_tag LOCUS_08430 4925 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5493 6179 gene locus_tag LOCUS_08440 gene trmD 5493 6179 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_08440 6248 6595 gene locus_tag LOCUS_08450 gene rplS 6248 6595 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YW4 protein_id gnl|my_center|LOCUS_08450 7474 6797 gene locus_tag LOCUS_08460 7474 6797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_08460 8582 7587 gene locus_tag LOCUS_08470 gene gapA 8582 7587 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_08470 9570 8593 gene locus_tag LOCUS_08480 gene pfkA 9570 8593 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_08480 10345 9701 gene locus_tag LOCUS_08490 10345 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11209 10559 gene locus_tag LOCUS_08500 11209 10559 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816215.1 protein_id gnl|my_center|LOCUS_08500 11837 11202 gene locus_tag LOCUS_08510 gene bioD 11837 11202 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_08510 13059 11818 gene locus_tag LOCUS_08520 gene bioF 13059 11818 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_08520 13089 13955 gene locus_tag LOCUS_08530 gene udp 13089 13955 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08530 14556 13963 gene locus_tag LOCUS_08540 14556 13963 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_08540 14987 14553 gene locus_tag LOCUS_08550 14987 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 15032 16153 gene locus_tag LOCUS_08560 gene ilvK 15032 16153 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_08560 16922 16161 gene locus_tag LOCUS_08570 16922 16161 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_08570 17009 17218 gene locus_tag LOCUS_08580 17009 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 18764 17283 gene locus_tag LOCUS_08590 18764 17283 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_08590 19838 18918 gene locus_tag LOCUS_08600 19838 18918 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_08600 >Feature sequence032 3254 2445 gene locus_tag LOCUS_08610 gene fjo11 3254 2445 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_08610 4344 3331 gene locus_tag LOCUS_08620 gene obg 4344 3331 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_08620 4980 4402 gene locus_tag LOCUS_08630 gene adk 4980 4402 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_08630 5081 5251 gene locus_tag LOCUS_08640 5081 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5792 5256 gene locus_tag LOCUS_08650 5792 5256 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_08650 7164 5794 gene locus_tag LOCUS_08660 7164 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 7353 8135 gene locus_tag LOCUS_08670 7353 8135 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_08670 10660 8132 gene locus_tag LOCUS_08680 10660 8132 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_08680 11351 10701 gene locus_tag LOCUS_08690 11351 10701 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD7 protein_id gnl|my_center|LOCUS_08690 11861 11433 gene locus_tag LOCUS_08700 11861 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14089 11975 gene locus_tag LOCUS_08710 gene pnp 14089 11975 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_08710 14431 14159 gene locus_tag LOCUS_08720 gene rpsO 14431 14159 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_08720 15426 14572 gene locus_tag LOCUS_08730 gene accD 15426 14572 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC71 protein_id gnl|my_center|LOCUS_08730 16614 15481 gene locus_tag LOCUS_08740 16614 15481 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_08740 16697 18124 gene locus_tag LOCUS_08750 16697 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence033 <1 3099 gene locus_tag LOCUS_08760 <1 3099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 3169 8514 gene locus_tag LOCUS_08770 3169 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 9582 8569 gene locus_tag LOCUS_08780 9582 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 9772 12390 gene locus_tag LOCUS_08790 gene clpB 9772 12390 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_08790 12460 14856 gene locus_tag LOCUS_08800 gene lon 12460 14856 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_08800 16926 14896 gene locus_tag LOCUS_08810 16926 14896 CDS product 7-beta-(4-carbaxybutanamido)cephalosporanic acid acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403897.1 protein_id gnl|my_center|LOCUS_08810 17547 17014 gene locus_tag LOCUS_08820 gene apt 17547 17014 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGZ0 protein_id gnl|my_center|LOCUS_08820 18458 17544 gene locus_tag LOCUS_08830 18458 17544 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_08830 <19101 18451 gene locus_tag LOCUS_08840 <19101 18451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease >Feature sequence034 363 2624 gene locus_tag LOCUS_08850 gene maeB 363 2624 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_08850 5466 2677 gene locus_tag LOCUS_08860 gene leuS 5466 2677 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_08860 6478 5624 gene locus_tag LOCUS_08870 6478 5624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106346.1 protein_id gnl|my_center|LOCUS_08870 7243 6482 gene locus_tag LOCUS_08880 7243 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_08880 7668 7291 gene locus_tag LOCUS_08890 7668 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7764 9176 gene locus_tag LOCUS_08900 7764 9176 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_08900 9176 10180 gene locus_tag LOCUS_08910 9176 10180 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_08910 10182 10850 gene locus_tag LOCUS_08920 10182 10850 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_08920 10882 11940 gene locus_tag LOCUS_08930 gene lpxK 10882 11940 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_08930 11945 12766 gene locus_tag LOCUS_08940 11945 12766 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_08940 12777 14651 gene locus_tag LOCUS_08950 12777 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 14710 15366 gene locus_tag LOCUS_08960 14710 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 15404 16489 gene locus_tag LOCUS_08970 15404 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence035 1771 215 gene locus_tag LOCUS_08980 1771 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3154 1802 gene locus_tag LOCUS_08990 gene ftsA 3154 1802 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_08990 3940 3164 gene locus_tag LOCUS_09000 3940 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5295 3937 gene locus_tag LOCUS_09010 gene murC 5295 3937 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_09010 6356 5295 gene locus_tag LOCUS_09020 gene murG 6356 5295 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_09020 7607 6399 gene locus_tag LOCUS_09030 7607 6399 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_09030 8975 7629 gene locus_tag LOCUS_09040 gene murD 8975 7629 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_09040 10241 8988 gene locus_tag LOCUS_09050 gene mraY 10241 8988 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_09050 11711 10248 gene locus_tag LOCUS_09060 gene murE 11711 10248 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_09060 13846 11708 gene locus_tag LOCUS_09070 gene ftsI 13846 11708 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_09070 14195 13833 gene locus_tag LOCUS_09080 14195 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 15103 14195 gene locus_tag LOCUS_09090 gene rsmH 15103 14195 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_09090 15580 15110 gene locus_tag LOCUS_09100 gene mraZ 15580 15110 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_09100 15995 16453 gene locus_tag LOCUS_09110 gene smpB 15995 16453 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_09110 <18319 16644 gene locus_tag LOCUS_09120 <18319 16644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KWU4:pyruvate carboxylase >Feature sequence036 <1 1034 gene locus_tag LOCUS_09130 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein 1546 1241 gene locus_tag LOCUS_09140 1546 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2375 1590 gene locus_tag LOCUS_09150 2375 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2634 2864 gene locus_tag LOCUS_09160 2634 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3130 3774 gene locus_tag LOCUS_09170 gene plsC 3130 3774 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_09170 3779 4759 gene locus_tag LOCUS_09180 3779 4759 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_09180 5186 4833 gene locus_tag LOCUS_09190 5186 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5274 8639 gene locus_tag LOCUS_09200 gene mfd 5274 8639 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_09200 11317 8873 gene locus_tag LOCUS_09210 gene priA 11317 8873 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_09210 11517 13028 gene locus_tag LOCUS_09220 gene atpD 11517 13028 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_09220 13054 13302 gene locus_tag LOCUS_09230 13054 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 13428 17180 gene locus_tag LOCUS_09240 13428 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence037 <1 1103 gene locus_tag LOCUS_09250 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963604.1:DUF4856 domain-containing protein 1198 2289 gene locus_tag LOCUS_09260 1198 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2276 3619 gene locus_tag LOCUS_09270 2276 3619 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_09270 3616 6015 gene locus_tag LOCUS_09280 gene fecA 3616 6015 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_09280 6089 7084 gene locus_tag LOCUS_09290 6089 7084 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144392.1 protein_id gnl|my_center|LOCUS_09290 7167 8633 gene locus_tag LOCUS_09300 gene putA 7167 8633 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_09300 9471 8695 gene locus_tag LOCUS_09310 9471 8695 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_09310 9554 9964 gene locus_tag LOCUS_09320 9554 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9980 12445 gene locus_tag LOCUS_09330 9980 12445 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_09330 12442 13224 gene locus_tag LOCUS_09340 12442 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_09340 13343 14092 gene locus_tag LOCUS_09350 13343 14092 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_09350 14108 14674 gene locus_tag LOCUS_09360 14108 14674 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R56 protein_id gnl|my_center|LOCUS_09360 17036 14664 gene locus_tag LOCUS_09370 17036 14664 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence038 320 1339 gene locus_tag LOCUS_09380 320 1339 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_09380 1332 1745 gene locus_tag LOCUS_09390 1332 1745 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_09390 1736 2695 gene locus_tag LOCUS_09400 gene yfkH 1736 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_09400 2795 2882 gene locus_tag LOCUS_t00110 2795 2882 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2933 3397 gene locus_tag LOCUS_09410 2933 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3493 5124 gene locus_tag LOCUS_09420 3493 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_09420 5192 6586 gene locus_tag LOCUS_09430 gene lpdA2 5192 6586 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_09430 7690 6644 gene locus_tag LOCUS_09440 7690 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_09440 8438 7746 gene locus_tag LOCUS_09450 gene truC 8438 7746 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261357.1 protein_id gnl|my_center|LOCUS_09450 9607 8438 gene locus_tag LOCUS_09460 9607 8438 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_09460 9825 11177 gene locus_tag LOCUS_09470 gene gabD 9825 11177 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_09470 11723 11292 gene locus_tag LOCUS_09480 11723 11292 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_09480 13631 11826 gene locus_tag LOCUS_09490 13631 11826 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_09490 15219 14074 gene locus_tag LOCUS_09500 15219 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_09500 <16343 15291 gene locus_tag LOCUS_09510 <16343 15291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXM8:DNA gyrase subunit A >Feature sequence039 1832 1086 gene locus_tag LOCUS_09520 1832 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3570 1825 gene locus_tag LOCUS_09530 3570 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_09530 4573 3563 gene locus_tag LOCUS_09540 4573 3563 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_09540 6085 4616 gene locus_tag LOCUS_09550 6085 4616 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_09550 6234 6857 gene locus_tag LOCUS_09560 gene rnhB 6234 6857 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_09560 10056 6898 gene locus_tag LOCUS_09570 10056 6898 CDS product DNA-dependent ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972514.1 protein_id gnl|my_center|LOCUS_09570 11014 10172 gene locus_tag LOCUS_09580 11014 10172 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_09580 11961 11251 gene locus_tag LOCUS_09590 11961 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 12681 12058 gene locus_tag LOCUS_09600 12681 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 13367 12681 gene locus_tag LOCUS_09610 13367 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 14083 13355 gene locus_tag LOCUS_09620 gene menG 14083 13355 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A005 protein_id gnl|my_center|LOCUS_09620 14201 15061 gene locus_tag LOCUS_09630 gene rfbA 14201 15061 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_09630 15063 16004 gene locus_tag LOCUS_09640 gene galE 15063 16004 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118537.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence040 477 1382 gene locus_tag LOCUS_09650 477 1382 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_09650 1388 1810 gene locus_tag LOCUS_09660 1388 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_09660 1779 1997 gene locus_tag LOCUS_09670 1779 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3653 2370 gene locus_tag LOCUS_09680 gene accC 3653 2370 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_09680 4312 3812 gene locus_tag LOCUS_09690 gene accB 4312 3812 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 protein_id gnl|my_center|LOCUS_09690 4859 4332 gene locus_tag LOCUS_09700 gene efp 4859 4332 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_09700 5991 4999 gene locus_tag LOCUS_09710 gene fabH3 5991 4999 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_09710 6179 6000 gene locus_tag LOCUS_09720 gene rpmF 6179 6000 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_09720 6713 6186 gene locus_tag LOCUS_09730 6713 6186 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_09730 6911 7762 gene locus_tag LOCUS_09740 6911 7762 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_09740 9713 7836 gene locus_tag LOCUS_09750 gene htpG 9713 7836 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9B8 protein_id gnl|my_center|LOCUS_09750 11444 9969 gene locus_tag LOCUS_09760 11444 9969 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_09760 12508 11753 gene locus_tag LOCUS_09770 gene truA 12508 11753 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_09770 12688 13077 gene locus_tag LOCUS_09780 12688 13077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_09780 13257 13520 gene locus_tag LOCUS_09790 13257 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 13579 13653 gene locus_tag LOCUS_t00120 13579 13653 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13839 15920 gene locus_tag LOCUS_09800 13839 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence041 1209 2747 gene locus_tag LOCUS_09810 gene guaA 1209 2747 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_09810 2772 4130 gene locus_tag LOCUS_09820 2772 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4130 5701 gene locus_tag LOCUS_09830 4130 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5818 8889 gene locus_tag LOCUS_09840 5818 8889 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_09840 9260 10105 gene locus_tag LOCUS_09850 gene tktA 9260 10105 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_09850 10259 11494 gene locus_tag LOCUS_09860 10259 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 11491 12852 gene locus_tag LOCUS_09870 11491 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 12855 13820 gene locus_tag LOCUS_09880 gene tktC 12855 13820 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_09880 13822 14034 gene locus_tag LOCUS_09890 13822 14034 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_09890 14141 14587 gene locus_tag LOCUS_09900 14141 14587 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_09900 14709 15854 gene locus_tag LOCUS_09910 gene mauG 14709 15854 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence042 <1 2341 gene locus_tag LOCUS_09920 <1 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor 2553 3350 gene locus_tag LOCUS_09930 2553 3350 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_09930 4313 3486 gene locus_tag LOCUS_09940 4313 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5996 4548 gene locus_tag LOCUS_09950 5996 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_09950 7314 6004 gene locus_tag LOCUS_09960 gene bfmBB 7314 6004 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_09960 7402 7887 gene locus_tag LOCUS_09970 7402 7887 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262753.1 protein_id gnl|my_center|LOCUS_09970 7948 8811 gene locus_tag LOCUS_09980 gene lipA 7948 8811 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_09980 9957 8896 gene locus_tag LOCUS_09990 9957 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11168 9960 gene locus_tag LOCUS_10000 11168 9960 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730899.1 protein_id gnl|my_center|LOCUS_10000 11508 11215 gene locus_tag LOCUS_10010 11508 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 12414 11692 gene locus_tag LOCUS_10020 12414 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_10020 12592 13518 gene locus_tag LOCUS_10030 12592 13518 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_10030 13741 13529 gene locus_tag LOCUS_10040 13741 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 14042 13734 gene locus_tag LOCUS_10050 14042 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 14078 15253 gene locus_tag LOCUS_10060 gene purM 14078 15253 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence043 <1 1256 gene locus_tag LOCUS_10070 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963774.1:T9SS C-terminal target domain-containing protein 1257 2285 gene locus_tag LOCUS_10080 1257 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2370 3821 gene locus_tag LOCUS_10090 2370 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3933 4631 gene locus_tag LOCUS_10100 gene plsC 3933 4631 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW5 protein_id gnl|my_center|LOCUS_10100 4723 5607 gene locus_tag LOCUS_10110 4723 5607 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807005.1 protein_id gnl|my_center|LOCUS_10110 6621 5623 gene locus_tag LOCUS_10120 6621 5623 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_10120 7632 6661 gene locus_tag LOCUS_10130 7632 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8294 7644 gene locus_tag LOCUS_10140 gene lolD 8294 7644 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_10140 8379 9617 gene locus_tag LOCUS_10150 gene sucC 8379 9617 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_10150 9711 11474 gene locus_tag LOCUS_10160 9711 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 12643 11522 gene locus_tag LOCUS_10170 12643 11522 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_10170 13693 12668 gene locus_tag LOCUS_10180 gene menC 13693 12668 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_10180 14585 13686 gene locus_tag LOCUS_10190 gene menA 14585 13686 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 protein_id gnl|my_center|LOCUS_10190 15112 14588 gene locus_tag LOCUS_10200 15112 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence044 1813 1064 gene locus_tag LOCUS_10210 gene coaX 1813 1064 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_10210 3221 1791 gene locus_tag LOCUS_10220 3221 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3960 3286 gene locus_tag LOCUS_10230 3960 3286 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_10230 4008 4769 gene locus_tag LOCUS_10240 4008 4769 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_10240 5770 4943 gene locus_tag LOCUS_10250 5770 4943 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_10250 8515 5819 gene locus_tag LOCUS_10260 gene parC 8515 5819 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_10260 9124 8663 gene locus_tag LOCUS_10270 9124 8663 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_10270 9181 10278 gene locus_tag LOCUS_10280 9181 10278 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_10280 10285 11028 gene locus_tag LOCUS_10290 10285 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_10290 11804 11127 gene locus_tag LOCUS_10300 11804 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 13330 11849 gene locus_tag LOCUS_10310 gene proS 13330 11849 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_10310 >Feature sequence045 114 926 gene locus_tag LOCUS_10320 114 926 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_10320 1637 930 gene locus_tag LOCUS_10330 1637 930 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_10330 2427 1756 gene locus_tag LOCUS_10340 2427 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3437 2442 gene locus_tag LOCUS_10350 gene pdhA 3437 2442 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_10350 3470 4534 gene locus_tag LOCUS_10360 gene recF 3470 4534 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_10360 4534 4821 gene locus_tag LOCUS_10370 4534 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4868 6835 gene locus_tag LOCUS_10380 4868 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6883 7743 gene locus_tag LOCUS_10390 gene rmlD 6883 7743 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_10390 7733 8503 gene locus_tag LOCUS_10400 gene cysQ 7733 8503 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_10400 9053 8526 gene locus_tag LOCUS_10410 gene blc 9053 8526 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 protein_id gnl|my_center|LOCUS_10410 9846 9079 gene locus_tag LOCUS_10420 9846 9079 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797186.1 protein_id gnl|my_center|LOCUS_10420 10134 11471 gene locus_tag LOCUS_10430 gene hisS 10134 11471 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_10430 11477 12955 gene locus_tag LOCUS_10440 gene hutH1 11477 12955 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_10440 13961 13134 gene locus_tag LOCUS_10450 13961 13134 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_10450 14566 14096 gene locus_tag LOCUS_10460 14566 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence046 1143 1643 gene locus_tag LOCUS_10470 gene ribH 1143 1643 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_10470 1630 1866 gene locus_tag LOCUS_10480 1630 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1869 2711 gene locus_tag LOCUS_10490 1869 2711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_10490 2806 4146 gene locus_tag LOCUS_10500 2806 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_10500 4147 5223 gene locus_tag LOCUS_10510 4147 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5216 5725 gene locus_tag LOCUS_10520 gene aroK 5216 5725 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_10520 6315 5788 gene locus_tag LOCUS_10530 6315 5788 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RG2 protein_id gnl|my_center|LOCUS_10530 7886 6300 gene locus_tag LOCUS_10540 7886 6300 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_10540 8708 7896 gene locus_tag LOCUS_10550 gene dapD 8708 7896 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_10550 9153 10382 gene locus_tag LOCUS_10560 9153 10382 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_10560 10462 10535 gene locus_tag LOCUS_t00130 10462 10535 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11014 10571 gene locus_tag LOCUS_10570 11014 10571 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_10570 12743 11004 gene locus_tag LOCUS_10580 12743 11004 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence047 <1 1103 gene locus_tag LOCUS_10590 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107297.1:TonB-dependent receptor 1103 2098 gene locus_tag LOCUS_10600 1103 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5472 2392 gene locus_tag LOCUS_10610 5472 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6368 5577 gene locus_tag LOCUS_10620 6368 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 8832 6418 gene locus_tag LOCUS_10630 8832 6418 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_10630 8964 11267 gene locus_tag LOCUS_10640 8964 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11379 12824 gene locus_tag LOCUS_10650 gene gatB 11379 12824 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61343 protein_id gnl|my_center|LOCUS_10650 >Feature sequence048 1926 1039 gene locus_tag LOCUS_10660 gene atpG 1926 1039 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_10660 3544 1964 gene locus_tag LOCUS_10670 gene atpA 3544 1964 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_10670 4117 3557 gene locus_tag LOCUS_10680 gene atpH 4117 3557 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA5 protein_id gnl|my_center|LOCUS_10680 4623 4129 gene locus_tag LOCUS_10690 gene atpF 4623 4129 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_10690 4929 4711 gene locus_tag LOCUS_10700 4929 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6088 4967 gene locus_tag LOCUS_10710 gene atpB 6088 4967 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_10710 6284 8692 gene locus_tag LOCUS_10720 6284 8692 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964024.1 protein_id gnl|my_center|LOCUS_10720 8794 10038 gene locus_tag LOCUS_10730 8794 10038 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_10730 10031 11296 gene locus_tag LOCUS_10740 10031 11296 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_10740 11306 13066 gene locus_tag LOCUS_10750 11306 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence049 <1 1200 gene locus_tag LOCUS_10760 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY25:UvrABC system protein B 1351 2346 gene locus_tag LOCUS_10770 1351 2346 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_10770 2372 3142 gene locus_tag LOCUS_10780 gene tatC 2372 3142 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_10780 3156 3578 gene locus_tag LOCUS_10790 3156 3578 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_10790 3690 9236 gene locus_tag LOCUS_10800 3690 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9851 9297 gene locus_tag LOCUS_10810 gene tag 9851 9297 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_10810 10435 9851 gene locus_tag LOCUS_10820 10435 9851 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_10820 13157 10449 gene locus_tag LOCUS_10830 13157 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence050 2216 885 gene locus_tag LOCUS_10840 gene ffh 2216 885 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7C3 protein_id gnl|my_center|LOCUS_10840 3808 2354 gene locus_tag LOCUS_10850 gene gapA2 3808 2354 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_10850 4775 3906 gene locus_tag LOCUS_10860 4775 3906 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_10860 4956 5336 gene locus_tag LOCUS_10870 4956 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_10870 5371 6801 gene locus_tag LOCUS_10880 5371 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6794 7444 gene locus_tag LOCUS_10890 6794 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7441 9105 gene locus_tag LOCUS_10900 7441 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_10900 9254 9559 gene locus_tag LOCUS_10910 9254 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 9582 10016 gene locus_tag LOCUS_10920 9582 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 10129 10545 gene locus_tag LOCUS_10930 10129 10545 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_10930 10542 11105 gene locus_tag LOCUS_10940 gene def 10542 11105 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_10940 12180 11110 gene locus_tag LOCUS_10950 gene pdxA 12180 11110 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_10950 <13181 12180 gene locus_tag LOCUS_10960 <13181 12180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJQ9:putative cytosol aminopeptidase >Feature sequence051 693 493 gene locus_tag LOCUS_10970 693 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2203 683 gene locus_tag LOCUS_10980 gene mnmE 2203 683 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_10980 2217 2621 gene locus_tag LOCUS_10990 2217 2621 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_10990 3660 2623 gene locus_tag LOCUS_11000 3660 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4962 3751 gene locus_tag LOCUS_11010 4962 3751 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_11010 5480 4959 gene locus_tag LOCUS_11020 gene dfrA 5480 4959 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_11020 5553 7508 gene locus_tag LOCUS_11030 gene acsA 5553 7508 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_11030 9448 7526 gene locus_tag LOCUS_11040 9448 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 10528 9512 gene locus_tag LOCUS_11050 gene pheS 10528 9512 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_11050 12064 10595 gene locus_tag LOCUS_11060 gene guaB 12064 10595 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_11060 12680 12198 gene locus_tag LOCUS_11070 12680 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence052 255 64 gene locus_tag LOCUS_11080 gene cspC 255 64 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_11080 1007 339 gene locus_tag LOCUS_11090 1007 339 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_11090 1243 2373 gene locus_tag LOCUS_11100 gene rhlE 1243 2373 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS5 protein_id gnl|my_center|LOCUS_11100 3131 2394 gene locus_tag LOCUS_11110 3131 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3228 4421 gene locus_tag LOCUS_11120 gene dinB 3228 4421 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_11120 4423 7392 gene locus_tag LOCUS_11130 4423 7392 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 protein_id gnl|my_center|LOCUS_11130 7669 11109 gene locus_tag LOCUS_11140 7669 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12501 11137 gene locus_tag LOCUS_11150 12501 11137 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence053 932 2899 gene locus_tag LOCUS_11160 932 2899 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_11160 3229 2903 gene locus_tag LOCUS_11170 3229 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3343 4383 gene locus_tag LOCUS_11180 3343 4383 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951397.1 protein_id gnl|my_center|LOCUS_11180 4451 6256 gene locus_tag LOCUS_11190 4451 6256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_11190 8243 6330 gene locus_tag LOCUS_11200 8243 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404346.1 protein_id gnl|my_center|LOCUS_11200 8579 9310 gene locus_tag LOCUS_11210 8579 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 10019 9300 gene locus_tag LOCUS_11220 10019 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_11220 10911 10033 gene locus_tag LOCUS_11230 10911 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11025 12392 gene locus_tag LOCUS_11240 gene nfeD 11025 12392 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881185.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence054 3372 919 gene locus_tag LOCUS_11250 3372 919 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_11250 4073 3375 gene locus_tag LOCUS_11260 4073 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5398 4196 gene locus_tag LOCUS_11270 5398 4196 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_11270 7299 5398 gene locus_tag LOCUS_11280 gene asnB 7299 5398 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_11280 7363 8694 gene locus_tag LOCUS_11290 7363 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9364 8669 gene locus_tag LOCUS_11300 9364 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 10454 9351 gene locus_tag LOCUS_11310 10454 9351 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 protein_id gnl|my_center|LOCUS_11310 11316 10441 gene locus_tag LOCUS_11320 11316 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 12536 11313 gene locus_tag LOCUS_11330 12536 11313 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence055 <1 2023 gene locus_tag LOCUS_11340 <1 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 2046 3269 gene locus_tag LOCUS_11350 gene porV 2046 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_11350 4403 3330 gene locus_tag LOCUS_11360 4403 3330 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_11360 5781 4489 gene locus_tag LOCUS_11370 gene cysN 5781 4489 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_11370 6743 5841 gene locus_tag LOCUS_11380 gene cysD 6743 5841 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_11380 7367 6768 gene locus_tag LOCUS_11390 gene cysC 7367 6768 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_11390 7503 8588 gene locus_tag LOCUS_11400 gene gcvT 7503 8588 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_11400 8610 9041 gene locus_tag LOCUS_11410 8610 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 9099 9383 gene locus_tag LOCUS_11420 9099 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10683 9463 gene locus_tag LOCUS_11430 gene pgk 10683 9463 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_11430 11239 11311 gene locus_tag LOCUS_t00140 11239 11311 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11713 12177 gene locus_tag LOCUS_11440 11713 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence056 2034 34 gene locus_tag LOCUS_11450 gene mcm3 2034 34 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_11450 2166 3341 gene locus_tag LOCUS_11460 2166 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3334 3675 gene locus_tag LOCUS_11470 3334 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_11470 3678 4220 gene locus_tag LOCUS_11480 3678 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 4204 4857 gene locus_tag LOCUS_11490 4204 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 4905 5792 gene locus_tag LOCUS_11500 4905 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5776 6744 gene locus_tag LOCUS_11510 5776 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7523 7005 gene locus_tag LOCUS_11520 7523 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 8393 7746 gene locus_tag LOCUS_11530 8393 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 8457 10364 gene locus_tag LOCUS_11540 8457 10364 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_11540 10491 12143 gene locus_tag LOCUS_11550 gene lysS 10491 12143 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_11550 >Feature sequence057 189 1982 gene locus_tag LOCUS_11560 gene lepA 189 1982 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_11560 2144 2908 gene locus_tag LOCUS_11570 2144 2908 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_11570 4086 2905 gene locus_tag LOCUS_11580 4086 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4629 4177 gene locus_tag LOCUS_11590 4629 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4875 8420 gene locus_tag LOCUS_11600 gene smc 4875 8420 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S457 protein_id gnl|my_center|LOCUS_11600 11871 8497 gene locus_tag LOCUS_11610 11871 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence058 96 23 gene locus_tag LOCUS_t00150 96 23 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 929 363 gene locus_tag LOCUS_11620 929 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2409 916 gene locus_tag LOCUS_11630 gene gpmI 2409 916 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_11630 2554 2949 gene locus_tag LOCUS_11640 2554 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3019 3879 gene locus_tag LOCUS_11650 3019 3879 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_11650 3889 4788 gene locus_tag LOCUS_11660 3889 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_11660 4799 5146 gene locus_tag LOCUS_11670 4799 5146 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_11670 6108 5188 gene locus_tag LOCUS_11680 6108 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6302 7222 gene locus_tag LOCUS_11690 6302 7222 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_11690 7223 7951 gene locus_tag LOCUS_11700 gene gldF 7223 7951 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_11700 8006 9661 gene locus_tag LOCUS_11710 gene gldG 8006 9661 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_11710 9658 10677 gene locus_tag LOCUS_11720 9658 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 10784 11902 gene locus_tag LOCUS_11730 gene dnaN 10784 11902 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_11730 11906 12118 gene locus_tag LOCUS_11740 11906 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence059 1142 186 gene locus_tag LOCUS_11750 gene metF 1142 186 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T1 protein_id gnl|my_center|LOCUS_11750 1247 2233 gene locus_tag LOCUS_11760 1247 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2970 2230 gene locus_tag LOCUS_11770 2970 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_11770 4771 2957 gene locus_tag LOCUS_11780 4771 2957 CDS product aerotolerance-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993033.1 protein_id gnl|my_center|LOCUS_11780 5523 4771 gene locus_tag LOCUS_11790 5523 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6564 5563 gene locus_tag LOCUS_11800 6564 5563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_11800 7023 6643 gene locus_tag LOCUS_11810 gene yjgF 7023 6643 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_11810 7079 7993 gene locus_tag LOCUS_11820 7079 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 8082 9107 gene locus_tag LOCUS_11830 8082 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 10183 9122 gene locus_tag LOCUS_11840 10183 9122 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_11840 11676 10267 gene locus_tag LOCUS_11850 gene gatA 11676 10267 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_11850 11911 11687 gene locus_tag LOCUS_11860 gene tatA 11911 11687 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XY4 protein_id gnl|my_center|LOCUS_11860 >Feature sequence060 <1 958 gene locus_tag LOCUS_11870 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001189365.1:oligoendopeptidase F 1097 1597 gene locus_tag LOCUS_11880 1097 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1602 2246 gene locus_tag LOCUS_11890 gene pdxH 1602 2246 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_11890 2387 2256 gene locus_tag LOCUS_11900 2387 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2757 2488 gene locus_tag LOCUS_11910 gene hupB 2757 2488 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_11910 3033 3797 gene locus_tag LOCUS_11920 gene pcbD 3033 3797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_11920 3794 4453 gene locus_tag LOCUS_11930 3794 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4508 5386 gene locus_tag LOCUS_11940 gene nadK 4508 5386 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_11940 5467 5973 gene locus_tag LOCUS_11950 5467 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6144 8240 gene locus_tag LOCUS_11960 6144 8240 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFW7 protein_id gnl|my_center|LOCUS_11960 8259 8756 gene locus_tag LOCUS_11970 8259 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_11970 8760 9794 gene locus_tag LOCUS_11980 8760 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 9797 10219 gene locus_tag LOCUS_11990 9797 10219 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_11990 10878 10216 gene locus_tag LOCUS_12000 gene trmH 10878 10216 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_12000 <12265 10951 gene locus_tag LOCUS_12010 <12265 10951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963281.1:peptidase M23 >Feature sequence061 252 959 gene locus_tag LOCUS_12020 252 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1097 2074 gene locus_tag LOCUS_12030 1097 2074 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_12030 2109 2939 gene locus_tag LOCUS_12040 2109 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2939 4354 gene locus_tag LOCUS_12050 2939 4354 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_12050 6584 4362 gene locus_tag LOCUS_12060 6584 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 8033 6624 gene locus_tag LOCUS_12070 8033 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_12070 8606 8094 gene locus_tag LOCUS_12080 8606 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9007 9831 gene locus_tag LOCUS_12090 9007 9831 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_12090 9824 11074 gene locus_tag LOCUS_12100 9824 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence062 99 1781 gene locus_tag LOCUS_12110 99 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2707 1838 gene locus_tag LOCUS_12120 2707 1838 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_12120 3745 2723 gene locus_tag LOCUS_12130 gene ruvB 3745 2723 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_12130 6181 3800 gene locus_tag LOCUS_12140 6181 3800 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_12140 6146 6880 gene locus_tag LOCUS_12150 6146 6880 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_12150 7163 6885 gene locus_tag LOCUS_12160 gene clpS 7163 6885 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_12160 7314 8507 gene locus_tag LOCUS_12170 gene aspC1 7314 8507 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_12170 8979 9758 gene locus_tag LOCUS_12180 gene dapF 8979 9758 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_12180 >Feature sequence063 1018 152 gene locus_tag LOCUS_12190 1018 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1320 1015 gene locus_tag LOCUS_12200 1320 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2235 1330 gene locus_tag LOCUS_12210 2235 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3167 2235 gene locus_tag LOCUS_12220 3167 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4137 3157 gene locus_tag LOCUS_12230 4137 3157 CDS product NDP-hexose-3-ketoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202146.1 protein_id gnl|my_center|LOCUS_12230 5552 4140 gene locus_tag LOCUS_12240 5552 4140 CDS product dNDP-4-keto-6-deoxy-glucose-2,3- dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202145.1 protein_id gnl|my_center|LOCUS_12240 6868 5576 gene locus_tag LOCUS_12250 6868 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7749 6892 gene locus_tag LOCUS_12260 7749 6892 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_12260 7981 11406 gene locus_tag LOCUS_12270 7981 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence064 659 2005 gene locus_tag LOCUS_12280 659 2005 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_12280 2166 2930 gene locus_tag LOCUS_12290 2166 2930 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_12290 2927 3637 gene locus_tag LOCUS_12300 2927 3637 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_12300 3638 4099 gene locus_tag LOCUS_12310 3638 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5376 4147 gene locus_tag LOCUS_12320 5376 4147 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764762.1 protein_id gnl|my_center|LOCUS_12320 6161 5439 gene locus_tag LOCUS_12330 6161 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6881 6240 gene locus_tag LOCUS_12340 6881 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7557 6955 gene locus_tag LOCUS_12350 7557 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7737 10589 gene locus_tag LOCUS_12360 gene gcvP 7737 10589 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_12360 10594 11007 gene locus_tag LOCUS_12370 10594 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202918.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence065 1234 242 gene locus_tag LOCUS_12380 1234 242 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_12380 1304 2494 gene locus_tag LOCUS_12390 gene bioF-1 1304 2494 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933608.1 protein_id gnl|my_center|LOCUS_12390 2530 3870 gene locus_tag LOCUS_12400 2530 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4301 3879 gene locus_tag LOCUS_12410 4301 3879 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_12410 4798 4364 gene locus_tag LOCUS_12420 4798 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_12420 4934 7348 gene locus_tag LOCUS_12430 4934 7348 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_12430 7925 7506 gene locus_tag LOCUS_12440 7925 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8092 8703 gene locus_tag LOCUS_12450 8092 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8696 10009 gene locus_tag LOCUS_12460 8696 10009 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence066 2083 398 gene locus_tag LOCUS_12470 2083 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2534 3355 gene locus_tag LOCUS_12480 2534 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4213 3395 gene locus_tag LOCUS_12490 4213 3395 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_12490 4889 4326 gene locus_tag LOCUS_12500 gene yceI 4889 4326 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_12500 5512 4973 gene locus_tag LOCUS_12510 5512 4973 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_12510 6900 5596 gene locus_tag LOCUS_12520 6900 5596 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_12520 7010 7603 gene locus_tag LOCUS_12530 7010 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7626 10121 gene locus_tag LOCUS_12540 gene mur/alr 7626 10121 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence067 <1 852 gene locus_tag LOCUS_12550 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0I8:aspartate carbamoyltransferase 907 2082 gene locus_tag LOCUS_12560 907 2082 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_12560 2079 3269 gene locus_tag LOCUS_12570 2079 3269 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_12570 3266 4483 gene locus_tag LOCUS_12580 gene ribBA 3266 4483 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_12580 4461 5936 gene locus_tag LOCUS_12590 4461 5936 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_12590 5968 6576 gene locus_tag LOCUS_12600 5968 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6599 7465 gene locus_tag LOCUS_12610 6599 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7560 8093 gene locus_tag LOCUS_12620 7560 8093 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762155.1 protein_id gnl|my_center|LOCUS_12620 8093 9568 gene locus_tag LOCUS_12630 gene crtI 8093 9568 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_12630 9573 10409 gene locus_tag LOCUS_12640 gene crtB 9573 10409 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence068 799 272 gene locus_tag LOCUS_12650 799 272 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_12650 1277 906 gene locus_tag LOCUS_12660 1277 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2088 1411 gene locus_tag LOCUS_12670 2088 1411 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_12670 2156 3268 gene locus_tag LOCUS_12680 2156 3268 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_12680 3317 3697 gene locus_tag LOCUS_12690 gene gcvH 3317 3697 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_12690 4336 3719 gene locus_tag LOCUS_12700 gene engB 4336 3719 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T4 protein_id gnl|my_center|LOCUS_12700 5435 4551 gene locus_tag LOCUS_12710 5435 4551 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_12710 8923 5534 gene locus_tag LOCUS_12720 gene icmF 8923 5534 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_12720 9144 9479 gene locus_tag LOCUS_12730 9144 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 9594 10112 gene locus_tag LOCUS_12740 9594 10112 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence069 <1 1334 gene locus_tag LOCUS_12750 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962548.1:quinol:cytochrome C oxidoreductase 1337 2473 gene locus_tag LOCUS_12760 gene ctaC 1337 2473 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_12760 2510 4309 gene locus_tag LOCUS_12770 gene ctaD 2510 4309 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_12770 4315 5217 gene locus_tag LOCUS_12780 gene ctaB 4315 5217 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_12780 5221 5844 gene locus_tag LOCUS_12790 5221 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5851 6537 gene locus_tag LOCUS_12800 5851 6537 CDS product bb3-type cytochrome oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066651.1 protein_id gnl|my_center|LOCUS_12800 6544 6912 gene locus_tag LOCUS_12810 6544 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 7057 7623 gene locus_tag LOCUS_12820 7057 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 7625 8164 gene locus_tag LOCUS_12830 gene yozB 7625 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_12830 8174 8404 gene locus_tag LOCUS_12840 8174 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence070 232 1179 gene locus_tag LOCUS_12850 232 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1934 1176 gene locus_tag LOCUS_12860 1934 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2047 3330 gene locus_tag LOCUS_12870 gene rfbX 2047 3330 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167732.1 protein_id gnl|my_center|LOCUS_12870 4109 3327 gene locus_tag LOCUS_12880 4109 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4669 4106 gene locus_tag LOCUS_12890 4669 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 7494 6727 gene locus_tag LOCUS_12900 7494 6727 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 protein_id gnl|my_center|LOCUS_12900 8219 7491 gene locus_tag LOCUS_12910 8219 7491 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_12910 8815 8219 gene locus_tag LOCUS_12920 gene rluC 8815 8219 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFW2 protein_id gnl|my_center|LOCUS_12920 <10331 8868 gene locus_tag LOCUS_12930 <10331 8868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888951.1:farnesyl-diphosphate synthase >Feature sequence071 530 2845 gene locus_tag LOCUS_12940 530 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2952 5732 gene locus_tag LOCUS_12950 gene polA 2952 5732 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_12950 6698 6892 gene locus_tag LOCUS_12960 6698 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 7727 7149 gene locus_tag LOCUS_12970 7727 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 7861 9765 gene locus_tag LOCUS_12980 7861 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence072 103 777 gene locus_tag LOCUS_12990 103 777 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948701.1 protein_id gnl|my_center|LOCUS_12990 779 1273 gene locus_tag LOCUS_13000 779 1273 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_13000 2026 1289 gene locus_tag LOCUS_13010 2026 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2467 3096 gene locus_tag LOCUS_13020 2467 3096 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_13020 3293 4528 gene locus_tag LOCUS_13030 3293 4528 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_13030 5188 4664 gene locus_tag LOCUS_13040 5188 4664 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_13040 5814 5191 gene locus_tag LOCUS_13050 5814 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5916 6188 gene locus_tag LOCUS_13060 5916 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 6199 6486 gene locus_tag LOCUS_13070 gene fjo15 6199 6486 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_13070 6479 7486 gene locus_tag LOCUS_13080 gene aroB 6479 7486 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_13080 7949 7491 gene locus_tag LOCUS_13090 7949 7491 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_13090 8015 9262 gene locus_tag LOCUS_13100 gene aroA 8015 9262 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YD8 protein_id gnl|my_center|LOCUS_13100 9262 9960 gene locus_tag LOCUS_13110 gene aat 9262 9960 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_13110 >Feature sequence073 402 1448 gene locus_tag LOCUS_13120 402 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1450 3333 gene locus_tag LOCUS_13130 1450 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4701 3418 gene locus_tag LOCUS_13140 4701 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7204 4745 gene locus_tag LOCUS_13150 7204 4745 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_13150 7442 9451 gene locus_tag LOCUS_13160 7442 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence074 929 1708 gene locus_tag LOCUS_13170 929 1708 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071452.1 protein_id gnl|my_center|LOCUS_13170 3674 1827 gene locus_tag LOCUS_13180 gene mutL 3674 1827 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_13180 3991 3677 gene locus_tag LOCUS_13190 3991 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4345 4040 gene locus_tag LOCUS_13200 4345 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_13200 4486 5625 gene locus_tag LOCUS_13210 4486 5625 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_13210 6382 5912 gene locus_tag LOCUS_13220 6382 5912 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_13220 6986 6384 gene locus_tag LOCUS_13230 6986 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7337 6999 gene locus_tag LOCUS_13240 7337 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8189 7365 gene locus_tag LOCUS_13250 8189 7365 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_13250 8339 8250 gene locus_tag LOCUS_t00160 8339 8250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9259 8486 gene locus_tag LOCUS_13260 9259 8486 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence075 568 248 gene locus_tag LOCUS_13270 568 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1014 688 gene locus_tag LOCUS_13280 1014 688 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_13280 1505 1014 gene locus_tag LOCUS_13290 1505 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 2496 1543 gene locus_tag LOCUS_13300 2496 1543 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_13300 3561 2497 gene locus_tag LOCUS_13310 gene vdh 3561 2497 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_13310 3752 5533 gene locus_tag LOCUS_13320 3752 5533 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_13320 5632 6144 gene locus_tag LOCUS_13330 5632 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6221 7318 gene locus_tag LOCUS_13340 gene ychF 6221 7318 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_13340 7358 8575 gene locus_tag LOCUS_13350 gene sufS 7358 8575 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_13350 >Feature sequence076 <1 1139 gene locus_tag LOCUS_13360 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWE2:aspartokinase 4852 1136 gene locus_tag LOCUS_13370 4852 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6265 5300 gene locus_tag LOCUS_13380 6265 5300 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_13380 8428 6290 gene locus_tag LOCUS_13390 gene rnr 8428 6290 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MI0 protein_id gnl|my_center|LOCUS_13390 8577 9035 gene locus_tag LOCUS_13400 8577 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence077 350 222 gene locus_tag LOCUS_13410 350 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1940 369 gene locus_tag LOCUS_13420 1940 369 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_13420 2405 1956 gene locus_tag LOCUS_13430 2405 1956 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_13430 3978 2509 gene locus_tag LOCUS_13440 3978 2509 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_13440 5330 3990 gene locus_tag LOCUS_13450 5330 3990 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_13450 5441 5514 gene locus_tag LOCUS_t00170 5441 5514 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5610 6632 gene locus_tag LOCUS_13460 5610 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6634 7821 gene locus_tag LOCUS_13470 6634 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7850 8632 gene locus_tag LOCUS_13480 7850 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 8652 9203 gene locus_tag LOCUS_13490 8652 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence078 1304 771 gene locus_tag LOCUS_13500 1304 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2267 1305 gene locus_tag LOCUS_13510 gene accA 2267 1305 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG09 protein_id gnl|my_center|LOCUS_13510 2951 2316 gene locus_tag LOCUS_13520 2951 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5398 3122 gene locus_tag LOCUS_13530 gene uvrD 5398 3122 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_13530 5498 5653 gene locus_tag LOCUS_13540 5498 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5637 8168 gene locus_tag LOCUS_13550 5637 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 8292 8942 gene locus_tag LOCUS_13560 8292 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence079 1178 36 gene locus_tag LOCUS_13570 1178 36 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_13570 2713 1295 gene locus_tag LOCUS_13580 2713 1295 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_13580 3224 2778 gene locus_tag LOCUS_13590 3224 2778 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_13590 3348 3746 gene locus_tag LOCUS_13600 3348 3746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_13600 3904 4269 gene locus_tag LOCUS_13610 3904 4269 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_13610 5656 4328 gene locus_tag LOCUS_13620 5656 4328 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_13620 5753 6238 gene locus_tag LOCUS_13630 gene cdd 5753 6238 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence080 790 146 gene locus_tag LOCUS_13640 gene speE 790 146 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_13640 1125 790 gene locus_tag LOCUS_13650 1125 790 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_13650 2447 1476 gene locus_tag LOCUS_13660 2447 1476 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_13660 2549 5161 gene locus_tag LOCUS_13670 gene alaS 2549 5161 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_13670 5186 5845 gene locus_tag LOCUS_13680 5186 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6335 5916 gene locus_tag LOCUS_13690 6335 5916 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45083 protein_id gnl|my_center|LOCUS_13690 6885 6367 gene locus_tag LOCUS_13700 gene dcd 6885 6367 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97N13 protein_id gnl|my_center|LOCUS_13700 7001 7366 gene locus_tag LOCUS_13710 7001 7366 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_13710 7363 7893 gene locus_tag LOCUS_13720 7363 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8905 7898 gene locus_tag LOCUS_13730 gene fbp 8905 7898 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT2 protein_id gnl|my_center|LOCUS_13730 >Feature sequence081 275 469 gene locus_tag LOCUS_13740 275 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_13740 549 2291 gene locus_tag LOCUS_13750 gene ygaD 549 2291 CDS product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 protein_id gnl|my_center|LOCUS_13750 2472 3242 gene locus_tag LOCUS_13760 2472 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_13760 3334 3660 gene locus_tag LOCUS_13770 3334 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7545 4051 gene locus_tag LOCUS_13780 gene dnaE 7545 4051 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_13780 8530 7802 gene locus_tag LOCUS_13790 8530 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence082 1488 793 gene locus_tag LOCUS_13800 1488 793 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_13800 2494 1505 gene locus_tag LOCUS_13810 2494 1505 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582913.1 protein_id gnl|my_center|LOCUS_13810 6150 2497 gene locus_tag LOCUS_13820 6150 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6832 6251 gene locus_tag LOCUS_13830 6832 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7202 8416 gene locus_tag LOCUS_13840 gene actA 7202 8416 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence083 765 349 gene locus_tag LOCUS_13850 gene ndk 765 349 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_13850 855 1859 gene locus_tag LOCUS_13860 gene fjo19 855 1859 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_13860 1924 2622 gene locus_tag LOCUS_13870 1924 2622 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_13870 2649 3683 gene locus_tag LOCUS_13880 gene ppiB 2649 3683 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963994.1 protein_id gnl|my_center|LOCUS_13880 3796 5058 gene locus_tag LOCUS_13890 gene erg3 3796 5058 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_13890 6415 5111 gene locus_tag LOCUS_13900 gene tyrS 6415 5111 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_13900 7192 6494 gene locus_tag LOCUS_13910 gene pcm 7192 6494 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_13910 7304 8704 gene locus_tag LOCUS_13920 7304 8704 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence084 4770 2536 gene locus_tag LOCUS_13930 4770 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 6128 4872 gene locus_tag LOCUS_13940 6128 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_13940 8488 6260 gene locus_tag LOCUS_13950 gene icd 8488 6260 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 protein_id gnl|my_center|LOCUS_13950 8487 8657 gene locus_tag LOCUS_13960 8487 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence085 133 2349 gene locus_tag LOCUS_13970 133 2349 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_13970 2368 2796 gene locus_tag LOCUS_13980 2368 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2799 3008 gene locus_tag LOCUS_13990 2799 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4096 3080 gene locus_tag LOCUS_14000 gene speB 4096 3080 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_14000 5474 4065 gene locus_tag LOCUS_14010 gene gltP 5474 4065 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_14010 6553 5471 gene locus_tag LOCUS_14020 gene aroC 6553 5471 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_14020 7936 6698 gene locus_tag LOCUS_14030 gene gcdH 7936 6698 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_14030 8002 8361 gene locus_tag LOCUS_14040 gene folB 8002 8361 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_14040 8532 8603 gene locus_tag LOCUS_t00180 8532 8603 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 2260 785 gene locus_tag LOCUS_14050 gene cysS 2260 785 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_14050 3281 2358 gene locus_tag LOCUS_14060 3281 2358 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_14060 3425 3676 gene locus_tag LOCUS_14070 gene rpmE 3425 3676 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_14070 5396 3906 gene locus_tag LOCUS_14080 gene gldJ 5396 3906 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_14080 6453 5443 gene locus_tag LOCUS_14090 6453 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence087 977 252 gene locus_tag LOCUS_14100 977 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_14100 1636 1070 gene locus_tag LOCUS_14110 gene yxaF 1636 1070 CDS product putative HTH-type transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42105 protein_id gnl|my_center|LOCUS_14110 3316 1715 gene locus_tag LOCUS_14120 3316 1715 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_14120 3727 5244 gene locus_tag LOCUS_14130 3727 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6357 5260 gene locus_tag LOCUS_14140 6357 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 6481 6714 gene locus_tag LOCUS_14150 6481 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6906 7640 gene locus_tag LOCUS_14160 gene acdS 6906 7640 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence088 1180 467 gene locus_tag LOCUS_14170 1180 467 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_14170 1985 1185 gene locus_tag LOCUS_14180 1985 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2156 4585 gene locus_tag LOCUS_14190 2156 4585 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_14190 4691 5869 gene locus_tag LOCUS_14200 4691 5869 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_14200 5962 7773 gene locus_tag LOCUS_14210 5962 7773 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_14210 8163 7924 gene locus_tag LOCUS_14220 8163 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence089 2487 2801 gene locus_tag LOCUS_14230 2487 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2811 3422 gene locus_tag LOCUS_14240 2811 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3598 4650 gene locus_tag LOCUS_14250 3598 4650 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_14250 5818 4625 gene locus_tag LOCUS_14260 5818 4625 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108616.1 protein_id gnl|my_center|LOCUS_14260 6652 5846 gene locus_tag LOCUS_14270 gene murI 6652 5846 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_14270 7174 6665 gene locus_tag LOCUS_14280 7174 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7781 7242 gene locus_tag LOCUS_14290 7781 7242 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_14290 <8329 7768 gene locus_tag LOCUS_14300 <8329 7768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964195.1:outer membrane protein assembly factor BamA >Feature sequence090 927 2471 gene locus_tag LOCUS_14310 gene pccB 927 2471 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_14310 2558 4123 gene locus_tag LOCUS_14320 2558 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4776 4120 gene locus_tag LOCUS_14330 4776 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 7225 4793 gene locus_tag LOCUS_14340 gene ftsK 7225 4793 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence091 3 821 gene locus_tag LOCUS_14350 3 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1802 825 gene locus_tag LOCUS_14360 gene queG 1802 825 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_14360 2005 2553 gene locus_tag LOCUS_14370 gene grpE 2005 2553 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_14370 2589 3722 gene locus_tag LOCUS_14380 gene dnaJ 2589 3722 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_14380 3961 4824 gene locus_tag LOCUS_14390 3961 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6143 4821 gene locus_tag LOCUS_14400 6143 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_14400 7378 6143 gene locus_tag LOCUS_14410 7378 6143 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence092 291 1382 gene locus_tag LOCUS_14420 gene carA 291 1382 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_14420 1394 2683 gene locus_tag LOCUS_14430 gene eno2 1394 2683 CDS product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 protein_id gnl|my_center|LOCUS_14430 2689 3471 gene locus_tag LOCUS_14440 gene lgt 2689 3471 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_14440 5035 3494 gene locus_tag LOCUS_14450 5035 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5378 5016 gene locus_tag LOCUS_14460 5378 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5973 5380 gene locus_tag LOCUS_14470 5973 5380 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_14470 6072 7049 gene locus_tag LOCUS_14480 6072 7049 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_14480 7359 7144 gene locus_tag LOCUS_14490 7359 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence093 1233 487 gene locus_tag LOCUS_14500 1233 487 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_14500 2016 1480 gene locus_tag LOCUS_14510 2016 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2961 2092 gene locus_tag LOCUS_14520 gene sucD 2961 2092 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_14520 5359 3251 gene locus_tag LOCUS_14530 5359 3251 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_14530 5358 6176 gene locus_tag LOCUS_14540 5358 6176 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 protein_id gnl|my_center|LOCUS_14540 6176 6577 gene locus_tag LOCUS_14550 6176 6577 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_14550 6589 7446 gene locus_tag LOCUS_14560 6589 7446 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence094 1089 712 gene locus_tag LOCUS_14570 gene msrB 1089 712 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7W8 protein_id gnl|my_center|LOCUS_14570 3247 1103 gene locus_tag LOCUS_14580 3247 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3994 3341 gene locus_tag LOCUS_14590 3994 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14590 4448 3957 gene locus_tag LOCUS_14600 gene folK 4448 3957 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_14600 4568 6280 gene locus_tag LOCUS_14610 gene sppA 4568 6280 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_14610 6372 6812 gene locus_tag LOCUS_14620 6372 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence095 <1 612 gene locus_tag LOCUS_14630 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378318.1:undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase 605 979 gene locus_tag LOCUS_14640 605 979 CDS product camphor resistance protein CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_14640 979 1842 gene locus_tag LOCUS_14650 979 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2079 3944 gene locus_tag LOCUS_14660 2079 3944 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_14660 3945 4745 gene locus_tag LOCUS_14670 3945 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4711 6069 gene locus_tag LOCUS_14680 4711 6069 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_14680 6070 7038 gene locus_tag LOCUS_14690 6070 7038 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence096 1058 6 gene locus_tag LOCUS_14700 1058 6 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1F4 protein_id gnl|my_center|LOCUS_14700 2035 1058 gene locus_tag LOCUS_14710 2035 1058 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_14710 2077 2469 gene locus_tag LOCUS_14720 2077 2469 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_14720 3467 2466 gene locus_tag LOCUS_14730 gene capI 3467 2466 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_14730 5443 3530 gene locus_tag LOCUS_14740 5443 3530 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence097 1536 3185 gene locus_tag LOCUS_14750 gene glpD 1536 3185 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18158 protein_id gnl|my_center|LOCUS_14750 4731 3175 gene locus_tag LOCUS_14760 4731 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 6593 4731 gene locus_tag LOCUS_14770 gene mnmG 6593 4731 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_14770 >Feature sequence098 1078 632 gene locus_tag LOCUS_14780 1078 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1518 1096 gene locus_tag LOCUS_14790 1518 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2963 1656 gene locus_tag LOCUS_14800 gene ahcY 2963 1656 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_14800 3618 3019 gene locus_tag LOCUS_14810 3618 3019 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233023.1 protein_id gnl|my_center|LOCUS_14810 3683 4762 gene locus_tag LOCUS_14820 3683 4762 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_14820 6285 4759 gene locus_tag LOCUS_14830 6285 4759 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence099 1210 2130 gene locus_tag LOCUS_14840 gene mdh 1210 2130 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P62 protein_id gnl|my_center|LOCUS_14840 2243 3694 gene locus_tag LOCUS_14850 2243 3694 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_14850 3831 5045 gene locus_tag LOCUS_14860 gene bioA 3831 5045 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883674.1 protein_id gnl|my_center|LOCUS_14860 5697 5095 gene locus_tag LOCUS_14870 5697 5095 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_14870 6396 5803 gene locus_tag LOCUS_14880 gene coaE 6396 5803 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence100 1063 1770 gene locus_tag LOCUS_14890 1063 1770 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_14890 2662 1799 gene locus_tag LOCUS_14900 2662 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_14900 4297 2693 gene locus_tag LOCUS_14910 4297 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5441 4398 gene locus_tag LOCUS_14920 5441 4398 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_14920 <6575 5562 gene locus_tag LOCUS_14930 <6575 5562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein >Feature sequence101 <1 597 gene locus_tag LOCUS_14940 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964506.1:rod shape-determining protein MreC 587 1099 gene locus_tag LOCUS_14950 587 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1089 2936 gene locus_tag LOCUS_14960 1089 2936 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_14960 2933 4378 gene locus_tag LOCUS_14970 2933 4378 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_14970 4491 4754 gene locus_tag LOCUS_14980 4491 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5297 4830 gene locus_tag LOCUS_14990 5297 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6296 5346 gene locus_tag LOCUS_15000 6296 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence102 470 1393 gene locus_tag LOCUS_15010 470 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3816 1462 gene locus_tag LOCUS_15020 3816 1462 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_15020 4769 4149 gene locus_tag LOCUS_15030 4769 4149 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_15030 5398 4766 gene locus_tag LOCUS_15040 5398 4766 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence103 582 806 gene locus_tag LOCUS_15050 582 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 926 1165 gene locus_tag LOCUS_15060 926 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1186 2244 gene locus_tag LOCUS_15070 1186 2244 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 protein_id gnl|my_center|LOCUS_15070 2273 3172 gene locus_tag LOCUS_15080 2273 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_15080 4096 3185 gene locus_tag LOCUS_15090 4096 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_15090 4502 4185 gene locus_tag LOCUS_15100 4502 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4672 5601 gene locus_tag LOCUS_15110 4672 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5598 6302 gene locus_tag LOCUS_15120 5598 6302 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405430.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence104 154 1191 gene locus_tag LOCUS_15130 154 1191 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_15130 1204 1788 gene locus_tag LOCUS_15140 gene gmhA 1204 1788 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AI36 protein_id gnl|my_center|LOCUS_15140 1772 2317 gene locus_tag LOCUS_15150 gene gmhB 1772 2317 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAI7 protein_id gnl|my_center|LOCUS_15150 2792 3319 gene locus_tag LOCUS_15160 gene sdhC 2792 3319 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_15160 3332 5335 gene locus_tag LOCUS_15170 gene sdhA 3332 5335 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_15170 5379 6128 gene locus_tag LOCUS_15180 gene sdhB 5379 6128 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence105 359 1387 gene locus_tag LOCUS_15190 359 1387 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869633.1 protein_id gnl|my_center|LOCUS_15190 2885 1401 gene locus_tag LOCUS_15200 2885 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5233 2909 gene locus_tag LOCUS_15210 5233 2909 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_15210 5783 5223 gene locus_tag LOCUS_15220 5783 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence106 3673 4977 gene locus_tag LOCUS_15230 3673 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence107 93 1391 gene locus_tag LOCUS_15240 gene phrB1 93 1391 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_15240 1416 2132 gene locus_tag LOCUS_15250 1416 2132 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 protein_id gnl|my_center|LOCUS_15250 2255 3532 gene locus_tag LOCUS_15260 gene pdhC 2255 3532 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_15260 4639 3623 gene locus_tag LOCUS_15270 gene ltaE 4639 3623 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_15270 5145 4636 gene locus_tag LOCUS_15280 5145 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5621 5148 gene locus_tag LOCUS_15290 gene rlmH 5621 5148 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_15290 5745 6068 gene locus_tag LOCUS_15300 5745 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence108 164 1057 gene locus_tag LOCUS_15310 gene parB 164 1057 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_15310 1068 1667 gene locus_tag LOCUS_15320 1068 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1687 2100 gene locus_tag LOCUS_15330 1687 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049417.1 protein_id gnl|my_center|LOCUS_15330 3083 2136 gene locus_tag LOCUS_15340 3083 2136 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_15340 3122 3889 gene locus_tag LOCUS_15350 gene fjo14 3122 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_15350 4022 4783 gene locus_tag LOCUS_15360 gene phnP 4022 4783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence109 466 3531 gene locus_tag LOCUS_15370 gene lacZ 466 3531 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_15370 3593 5212 gene locus_tag LOCUS_15380 3593 5212 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_15380 <5824 5290 gene locus_tag LOCUS_15390 <5824 5290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964437.1:FAD-dependent oxidoreductase >Feature sequence110 905 570 gene locus_tag LOCUS_15400 gene ogt2 905 570 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_15400 1637 933 gene locus_tag LOCUS_15410 gene trmB 1637 933 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_15410 1827 5516 gene locus_tag LOCUS_15420 1827 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence111 2802 919 gene locus_tag LOCUS_15430 2802 919 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_15430 <5629 3129 gene locus_tag LOCUS_15440 <5629 3129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXX6:UvrABC system protein A >Feature sequence112 95 20 gene locus_tag LOCUS_t00190 95 20 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 199 117 gene locus_tag LOCUS_t00200 199 117 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 282 206 gene locus_tag LOCUS_t00210 282 206 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 800 498 gene locus_tag LOCUS_15450 800 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1689 814 gene locus_tag LOCUS_15460 gene xerC 1689 814 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_15460 1975 1778 gene locus_tag LOCUS_15470 gene rpsU 1975 1778 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_15470 3242 2103 gene locus_tag LOCUS_15480 3242 2103 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence113 1651 38 gene locus_tag LOCUS_15490 1651 38 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_15490 4775 1959 gene locus_tag LOCUS_15500 4775 1959 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963047.1 protein_id gnl|my_center|LOCUS_15500 5474 4878 gene locus_tag LOCUS_15510 5474 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence114 5294 1431 gene locus_tag LOCUS_15520 5294 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence115 <1 3009 gene locus_tag LOCUS_15530 <1 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 3058 4212 gene locus_tag LOCUS_15540 3058 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_15540 4462 5385 gene locus_tag LOCUS_15550 gene miaA 4462 5385 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_15550 >Feature sequence116 485 1345 gene locus_tag LOCUS_15560 gene menB 485 1345 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_15560 1455 3731 gene locus_tag LOCUS_15570 gene katG 1455 3731 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q939D2 protein_id gnl|my_center|LOCUS_15570 4325 3861 gene locus_tag LOCUS_15580 4325 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence117 472 1014 gene locus_tag LOCUS_15590 472 1014 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_15590 1849 1034 gene locus_tag LOCUS_15600 1849 1034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_15600 2115 2594 gene locus_tag LOCUS_15610 2115 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_15610 2766 3890 gene locus_tag LOCUS_15620 2766 3890 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_15620 4306 4860 gene locus_tag LOCUS_15630 gene pyrR1 4306 4860 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence118 425 1165 gene locus_tag LOCUS_15640 gene pdxJ 425 1165 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_15640 1162 1935 gene locus_tag LOCUS_15650 1162 1935 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_15650 2180 1932 gene locus_tag LOCUS_15660 2180 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2871 2173 gene locus_tag LOCUS_15670 2871 2173 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence119 >Feature sequence120 243 1745 gene locus_tag LOCUS_15680 243 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1797 3251 gene locus_tag LOCUS_15690 1797 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3254 4261 gene locus_tag LOCUS_15700 gene murB 3254 4261 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_15700 >Feature sequence121 877 326 gene locus_tag LOCUS_15710 877 326 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_15710 2134 905 gene locus_tag LOCUS_15720 2134 905 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_15720 <4634 2137 gene locus_tag LOCUS_15730 <4634 2137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962756.1:T9SS C-terminal target domain-containing protein >Feature sequence122 4180 671 gene locus_tag LOCUS_15740 4180 671 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence123 1578 145 gene locus_tag LOCUS_15750 gene dnaA 1578 145 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_15750 2595 1657 gene locus_tag LOCUS_15760 2595 1657 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_15760 3328 2588 gene locus_tag LOCUS_15770 3328 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_15770 3855 3328 gene locus_tag LOCUS_15780 3855 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3917 4267 gene locus_tag LOCUS_15790 3917 4267 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_15790 4277 4420 gene locus_tag LOCUS_15800 4277 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence124 615 1394 gene locus_tag LOCUS_15810 gene rsmA 615 1394 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y97 protein_id gnl|my_center|LOCUS_15810 1394 2323 gene locus_tag LOCUS_15820 1394 2323 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence125 <1 595 gene locus_tag LOCUS_15830 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000767556.1:exodeoxyribonuclease III 693 1718 gene locus_tag LOCUS_15840 gene recA 693 1718 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_15840 3838 1874 gene locus_tag LOCUS_15850 3838 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4065 3868 gene locus_tag LOCUS_15860 4065 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence126 1776 2624 gene locus_tag LOCUS_15870 gene prmC 1776 2624 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_15870 >Feature sequence127 <3989 1451 gene locus_tag LOCUS_15880 <3989 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:Fe-S-cluster-containing hydrogenase >Feature sequence128 <1 1056 gene locus_tag LOCUS_15890 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A998:CinA-like protein 1105 1872 gene locus_tag LOCUS_15900 1105 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2071 3084 gene locus_tag LOCUS_15910 2071 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence129 2521 3159 gene locus_tag LOCUS_15920 2521 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence130 <1 1623 gene locus_tag LOCUS_15930 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022291.1:asparagine synthetase B 2233 3198 gene locus_tag LOCUS_15940 2233 3198 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence131 <1 932 gene locus_tag LOCUS_15950 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963881.1:aspartate aminotransferase family protein 919 1869 gene locus_tag LOCUS_15960 919 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2984 1866 gene locus_tag LOCUS_15970 2984 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3373 3032 gene locus_tag LOCUS_15980 gene ytxJ 3373 3032 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence132 180 10 gene locus_tag LOCUS_15990 180 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 437 249 gene locus_tag LOCUS_16000 437 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3099 886 gene locus_tag LOCUS_16010 3099 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence133 521 1534 gene locus_tag LOCUS_16020 521 1534 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_16020 1876 3114 gene locus_tag LOCUS_16030 1876 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence134 >Feature sequence135 122 1225 gene locus_tag LOCUS_16040 122 1225 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_16040 1309 1650 gene locus_tag LOCUS_16050 1309 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1885 2682 gene locus_tag LOCUS_16060 1885 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence136 >Feature sequence137 1653 2531 gene locus_tag LOCUS_16070 gene ykuF 1653 2531 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_16070 3133 2672 gene locus_tag LOCUS_16080 3133 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence138 492 2966 gene locus_tag LOCUS_16090 492 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence139 621 283 gene locus_tag LOCUS_16100 621 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 899 654 gene locus_tag LOCUS_16110 899 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2743 1355 gene locus_tag LOCUS_16120 2743 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3218 2748 gene locus_tag LOCUS_16130 3218 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence140 1117 2469 gene locus_tag LOCUS_16140 gene gdhA 1117 2469 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_16140 >Feature sequence141 2502 250 gene locus_tag LOCUS_16150 2502 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence142 19 249 gene locus_tag LOCUS_16160 19 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 492 1238 gene locus_tag LOCUS_16170 492 1238 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_16170 2354 2767 gene locus_tag LOCUS_16180 2354 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence143 2019 2714 gene locus_tag LOCUS_16190 2019 2714 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence144 <2876 500 gene locus_tag LOCUS_16200 <2876 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWN3:DNA mismatch repair protein MutS >Feature sequence145 1130 366 gene locus_tag LOCUS_16210 1130 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962437.1 protein_id gnl|my_center|LOCUS_16210 1854 1144 gene locus_tag LOCUS_16220 gene lpxH 1854 1144 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_16220 2533 1889 gene locus_tag LOCUS_16230 2533 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence146 <1 712 gene locus_tag LOCUS_16240 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141921.1:phytoene dehydrogenase 709 1395 gene locus_tag LOCUS_16250 709 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1459 2625 gene locus_tag LOCUS_16260 1459 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence147 239 559 gene locus_tag LOCUS_16270 239 559 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_16270 1251 694 gene locus_tag LOCUS_16280 gene bsaA 1251 694 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_16280 >Feature sequence148 472 1815 gene locus_tag LOCUS_16290 472 1815 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_16290 1957 1875 gene locus_tag LOCUS_t00220 1957 1875 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence149 888 16 gene locus_tag LOCUS_16300 888 16 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_16300 1777 989 gene locus_tag LOCUS_16310 1777 989 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence150 <1 1183 gene locus_tag LOCUS_16320 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H296:bifunctional purine biosynthesis protein PurH 1199 2227 gene locus_tag LOCUS_16330 gene mreB 1199 2227 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence151 <1 691 gene locus_tag LOCUS_16340 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262233.1:permease 688 1215 gene locus_tag LOCUS_16350 gene haaO 688 1215 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_16350 >Feature sequence152 1497 217 gene locus_tag LOCUS_16360 1497 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1557 2033 gene locus_tag LOCUS_16370 1557 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence153 >Feature sequence154 1698 763 gene locus_tag LOCUS_16380 1698 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_16380 2200 1850 gene locus_tag LOCUS_16390 2200 1850 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence155 >Feature sequence156 <1 542 gene locus_tag LOCUS_16400 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403392.1:NAD-dependent dehydratase 564 1442 gene locus_tag LOCUS_16410 564 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence157 1089 2069 gene locus_tag LOCUS_16420 gene rlmF 1089 2069 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU40 protein_id gnl|my_center|LOCUS_16420 >Feature sequence158 >Feature sequence159 1903 983 gene locus_tag LOCUS_16430 1903 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 1212 1078 gene locus_tag LOCUS_16440 1212 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence164