COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1550802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(534..1790) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 1995..2912 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene lysR1 CDS 2970..3356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3444..4310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4559..4792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4941..6248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6402..7526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(7950..8588) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8585..9634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10827..11588) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12122..13021 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH6 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(13084..13833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(14016..14207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 14172..14360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 14371..15819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(15932..16339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 16621..17655 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(17703..18653) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18758..19903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(20170..21192) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6H7 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene mhpE CDS complement(21215..22111) product acetaldehyde dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH39 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(22137..22931) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(22944..23786) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23865..24728) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(24833..26035) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(26101..26598) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene ntaB CDS complement(26706..27614) product iron-dependent extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(27629..29221) product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene fadD3 CDS 29439..30314 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 30337..31158 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 31181..31663 product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 31683..32864 product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 32878..33984 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 34002..34760 product putative enoyl-CoA hydratase EchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 34785..35948 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 35977..37041 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 37043..38191 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene atoB CDS 38439..39320 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39450..40658 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene acd CDS 40663..41865 product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 42065..42856 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene fabG CDS 42871..43332 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 43571..44773 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 44914..46623 product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNU9 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 46663..47409 product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701961.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 47614..48828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 49077..49517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(49562..50239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 50646..51536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(51585..53144) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(53349..53888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 54372..55523 product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene waaG CDS 55520..56341 product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF7 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rfaP CDS 56331..57137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 57091..57924 product exoV-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(57936..58778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(58881..59612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(59947..60450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(60519..61211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(61208..65128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(65466..66227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 66594..67298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 67418..69514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 69536..70207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(70195..70851) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 71097..71285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 71336..71764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 71966..74731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 74810..75478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 75619..75969 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 76014..76307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 76531..76827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 77016..78350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 78656..79015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 79055..79219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 79318..79722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 79865..80323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(80349..80576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 81015..81425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 81502..81843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 81938..82330 product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 82474..82878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 83063..83449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(83747..87016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 87716..88387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(88352..89317) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(89325..90707) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 90808..92427 product putative amidohydrolase YtcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34355 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene ytcJ CDS 92429..93019 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(93135..94718) product phosphodiesterase/alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 95419..95967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 96351..96869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 97168..97662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 98190..99941 product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 99938..100744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 100752..101639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 101644..103773 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 103801..104637 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 104634..106370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 106466..107488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 107485..111915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 112180..112677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 112815..113072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 113152..113694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 113793..114224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 114472..114894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 114916..115152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 115121..115570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(115765..116304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 note possible pseudo, internal stop codon CDS complement(116394..118130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 118455..119429 product epimerase family protein YfcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77775 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene yfcH CDS 119500..120096 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 120416..123175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 123348..123782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 123829..124263 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(124415..125050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 125256..125435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 125458..126174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 126207..126785 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 126841..127131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(127301..127561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 127610..127993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 128056..128751 product ubiE/COQ5 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(128839..130383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 130712..131194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(131271..131993) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 132145..132744 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(132842..133663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(133871..134698) product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702806.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 134814..135422 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 135546..135941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 135960..136517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 136663..137319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 137488..137679 product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 137691..139223 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(139239..139817) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(140090..141805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 142607..143497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 143552..143797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 143942..144553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 144676..145068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 145236..147515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 147555..148190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 148254..148733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 148816..149283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(149375..150190) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 150398..151564 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(151705..152643) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197652.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 152795..153658 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 153720..154634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 154709..155065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(155051..155929) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 156037..156468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 156468..156689 product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A468 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 156713..157327 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene gst CDS complement(157413..159395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 159813..160739 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 160745..161473 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(161583..163802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(163959..164186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(164244..165566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(165563..166411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(166422..169004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 169131..169460 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 169481..170260 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 170330..170854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 170977..171750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(171801..172862) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 172985..174580 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 174602..175288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(175364..175846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(176038..177399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(177683..178663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 179083..179820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(179925..180497) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ2 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene efp CDS complement(180559..181692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(181718..182200) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(182365..183096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(183247..183954) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 184404..186782 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(186838..188049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(188284..189414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 189777..190067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 190231..191376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 191395..192234 product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTI5 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rlmJ CDS complement(192286..194247) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM27 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene pcrA CDS 194309..194824 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 194935..195780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(195874..198987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(199343..203485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(203731..204714) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene adiY CDS complement(205062..206564) product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 206876..207526 product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMD5 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(207532..208659) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene yhhT CDS 208608..208799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(208852..209394) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(209530..211383) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V83 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene ilvD CDS complement(211708..212295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(212339..213676) product NrfA- nitrite reduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(213700..215709) product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene nirB CDS complement(215807..216295) product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(216699..217724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(217880..219565) product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(219633..220850) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(220864..221700) product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBU7 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(221727..222683) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 223026..225560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(225599..226816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918495.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(226853..227701) product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(227724..228725) product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(228770..230146) product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(230546..231190) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene nasT CDS 231610..232773 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 232895..233983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(234017..234793) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 235272..236888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(236910..237557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 237664..239136 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 239129..239635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 239632..240702 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EL66 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene dcyD CDS 240750..241571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 241721..242302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 242503..243141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(243201..245021) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene mmgC CDS 245309..245647 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 245711..246277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 246424..246792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(246799..249390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 249657..250883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 251046..252485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(252497..253378) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(253386..254936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(255266..255562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 255986..256558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 256572..258068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 258040..259725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 259820..261037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 261055..261816 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 261874..262923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 263235..263780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 263835..265124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 265462..266256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 266253..269141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(269163..270398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 270628..271839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(271833..272723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(272820..273671) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene yneD CDS 274209..274769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(274799..275854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(275851..277338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 277545..279590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 279869..282112 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene parC CDS complement(282199..282489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 282693..288983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 288976..290103 product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene draG CDS 290273..291226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 291268..292260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 292409..293815 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 294082..296355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(296546..297583) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(297811..298203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 298388..299599 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(299671..300987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(301104..306716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(306876..307646) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 307951..308694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 308868..309896 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 309997..310908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(310956..312008) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 312116..312994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 313280..314344 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(314427..315170) product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE14 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene spoU CDS 315332..317440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 317385..318713 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 318862..321672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(321795..322343) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene orn CDS 322554..323567 product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL3 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene rsgA CDS 324314..325321 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 325460..326599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 326659..327336 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104623.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 327326..328258 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH9 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene mtnP CDS 328327..329283 product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 329277..330227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 330248..330505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 330522..332243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 332323..333420 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 333443..333976 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 333969..335114 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 335114..336463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 336466..337116 product putative phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 337195..337788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 337807..340176 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 340421..342166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 342242..343081 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene rhdA CDS 343107..343967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(344001..345002) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS6 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene epmA CDS complement(345042..345605) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene efp CDS 345634..346647 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene yjeK CDS 346794..348632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 348789..350864 product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene fimX CDS complement(350913..352175) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 352301..353281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 353281..354306 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene tqsA CDS complement(354329..355390) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VI8 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene queG CDS 355555..357108 product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene nnr CDS 357099..357575 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene yjeE CDS 357734..359002 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 359066..361000 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL8 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene mutL CDS 361004..361987 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene miaA CDS 362080..362349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 362480..363784 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene hflX CDS 363948..365084 product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene hflK CDS 365084..365974 product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene hflC CDS 366100..367281 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VJ8 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene hisZ CDS 367250..368605 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene purA CDS complement(368700..369071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 369250..370092 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene hdtR CDS complement(370152..370370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(370592..374002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 374741..377290 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM7 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rnr CDS 377335..378087 product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG60 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rlmB CDS 378315..378737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 378754..379065 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB82 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene priB CDS 379093..379320 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ0 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rpsR CDS 379340..380173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 380228..380677 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIT1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene rplI CDS 380959..382347 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN3 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene dnaB CDS 382347..383426 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL98 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene alr-2 CDS 383475..383858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 383943..385301 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96963 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene radA CDS complement(385344..385709) product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG8 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 386100..386321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(386738..388408) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 388445..389833 product conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 390045..391319 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene glyA CDS complement(391358..391576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 391643..392101 product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889R0 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene nrdR CDS 392208..393335 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY0 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 393340..394005 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene ribC CDS 394102..395232 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene ribB CDS 395285..395761 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ribH CDS 395772..396230 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene nusB CDS 396236..397243 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene thiL CDS 397280..397762 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene pgpA CDS complement(397909..401064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(401116..401484) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene cheY-1 CDS complement(401600..402592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(402641..403240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(403247..404137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(404449..406365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(406540..407232) product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228280.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(407327..409243) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene dxs CDS complement(409390..410328) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ispA CDS complement(410337..410591) product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWY5 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene xseB CDS 410746..411504 product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 411522..412769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 413207..414247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 414485..415165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(415297..415572) product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE12 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene minE CDS complement(415569..416384) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ6 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene minD CDS complement(416532..417272) product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ7 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene minC CDS complement(417537..418202) product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene coq7 CDS 418329..419813 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 419934..420974 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene oruR CDS complement(420971..423712) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 423650..423808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(424003..425031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 425172..427367 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene gidA CDS 427959..428783 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(428853..430145) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene purD CDS complement(430221..431789) product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KT0 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene purH CDS complement(432079..432414) product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW0 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(432411..433166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(433604..435169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(435454..436335) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRC9 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene prmA CDS complement(436429..437775) product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene accC CDS complement(437791..438300) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene accB CDS complement(438310..438753) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS6 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene aroQ CDS complement(439011..440906) product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD7 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene dsbD CDS 441204..443141 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 443191..444192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(444290..444817) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWZ6 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene ppa CDS 445206..445595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(445693..446031) product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene nirD-2 CDS complement(446049..448613) product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene nirB CDS complement(449022..451700) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene nasA CDS complement(451751..453037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 453514..454983 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene crnA CDS 455032..456756 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(456761..458029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 458124..459377 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(459464..460729) product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C58 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene pfp CDS 460952..461479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 461529..462932 product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYS2 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene mpl CDS 463390..463848 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 463857..465563 product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 465568..469410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 469407..472526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(472556..473572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 473853..474122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 474425..474682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 474804..475472 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene pcm CDS 475484..476095 product Smr domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(476143..477249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(477342..478148) product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene hmuV CDS complement(478148..479203) product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(479196..480068) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(480065..481147) product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(481173..482351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(482367..484283) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 484537..484980 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 485012..487075 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(487127..487864) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(488145..488366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(488384..489259) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(489506..492391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 492786..493424 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(493627..495846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 496035..496865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(496872..497144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(497222..499159) product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene acsA2 CDS complement(499251..500105) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene panC CDS complement(500105..500908) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q5 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene panB CDS complement(501000..501500) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(501595..502965) product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV72 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene pcnB CDS complement(503912..505318) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(505392..508349) product two-component sensor CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene cbrA CDS complement(508564..509460) product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV75 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene gluQ CDS complement(509714..510166) product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD14 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene dksA CDS 510529..511734 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY78 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 511731..512432 product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG4 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene sfsA CDS 512587..513702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 513775..515394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(515483..516328) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(516303..518648) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 518799..519878 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(519862..520386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(520488..522011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(522101..522499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 522654..523250 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 523345..524577 product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(524685..525959) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene cph2 CDS complement(526298..527578) product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 527848..528069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 528291..528884 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(528937..530307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(530310..531362) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX25 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene lipA CDS complement(531359..531949) product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN83 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene lipB CDS complement(532127..532396) product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(532415..533293) product cytochrome c551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(533361..534536) product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene dacC CDS complement(534616..535506) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V6 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rlpA CDS complement(535609..536682) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(536699..537844) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rodA CDS complement(537837..539651) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene pbpA CDS complement(539792..540259) product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6V2 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rlmH CDS complement(540299..540643) product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rsfS CDS complement(540648..541331) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN91 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene nadD CDS complement(541309..542565) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene proA CDS complement(542711..543550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(543630..543956) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(544219..546183) product colicin I receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17315 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene cirA CDS 546620..548557 product energy taxis-modulating methyl-accepting chemotaxis protein with Cache_1 sensory domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 548654..549721 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261837.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene hmuU CDS 549718..550491 product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN36 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene hmuV CDS complement(550498..551349) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(551493..552275) product cAMP-binding protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene cbpA CDS complement(552503..553495) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 553604..556291 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene mrcB CDS 556292..556780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(556785..557537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(557737..558177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(558212..559495) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48247 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene hemL CDS complement(559539..560171) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene thiE CDS complement(560199..561041) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene thiD CDS 561130..562857 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 563112..563531 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 563894..565366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 565604..567247 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 567325..568047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(568073..568609) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 568838..569440 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(569460..569960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(570117..571493) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(571675..572121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(572248..573555) product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene pleD CDS 573872..574684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 574688..575464 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 575461..575721 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 575732..575983 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9B5 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene acpP CDS 575988..576578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 576663..578504 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 578501..579319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 579312..580250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 note possible pseudo, frameshifted CDS 580267..581856 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 581853..582272 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 582273..582884 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK97 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 582862..585321 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 585321..586562 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 586643..587185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 587178..588446 product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 588413..588928 product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 588925..589665 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene fabG CDS 589665..590894 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene fabF CDS complement(590929..591243) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 591432..592478 product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WBQ7 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene lifO CDS 592623..593615 product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 594004..594285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 594393..595736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(595787..597451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 597667..598431 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 598644..599054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 599076..600077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 600108..606509 product GlyGly-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(606514..608571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(608727..609572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 609750..611672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 611763..612281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 612330..613664 product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 613755..614696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 614798..618328 product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene icmF1 CDS 618328..619113 product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 619127..619852 product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 619852..620133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(620291..620779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 621055..621609 product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU7 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 621723..622310 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(622343..622774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(622824..624803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 624990..625472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(625629..625814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 626059..626457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 626459..626710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 626777..627139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 627539..628651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 628792..629409 product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 629508..630149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 630243..630764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(630867..631766) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(631878..632462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 632617..633456 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 633467..634363 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 634484..636202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 636224..637063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 637060..638598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 638602..639411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 639429..640634 product KlaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(640757..640972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 641349..641720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 641810..642376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 642403..642768 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 642863..643372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 643418..643840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 643893..644255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 644381..644887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 645006..645683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(645831..646559) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 646697..648319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 648353..650284 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 650363..650767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 650785..651132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(651186..651869) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 652005..652853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 652869..654617 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 654636..655544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(655502..656197) product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 656336..656647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(656654..658012) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene creD CDS 658210..658584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 658809..660167 product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(660183..661466) product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 661816..664284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 664340..665146 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene paaG CDS 665223..665588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 665778..667781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(667858..668658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(668855..669457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 669686..671050 product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 671069..672493 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 672704..675073 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(675106..675903) product putative steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(675926..677008) product steroid Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908631.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(677042..677974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(678105..679304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 679835..681886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 681899..682285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(682431..682838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 683256..684596 product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(684679..685023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(685231..685770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(685913..688600) product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(688711..689856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(689820..691649) product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene impG CDS complement(691659..692156) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(692162..693664) product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(693837..695330) product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(695330..695845) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(695935..697089) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 697308..698240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 698474..699586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(699664..700305) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 700499..700960 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene mgsA CDS 701030..701653 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(701743..703368) product methyl-accepting chemotaxis protein CtpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA3 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene ctpH CDS complement(703538..705037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(705050..705748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(705745..706092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(706587..708029) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(708156..708326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 709019..710395 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene nhaD CDS complement(710472..711212) product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 711499..712068 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 712167..712865 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene yjdF CDS 712942..713262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(713311..714726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(714730..715665) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(715833..716621) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 716873..717103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(717145..717828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 718009..719178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(719111..720067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 720366..721211 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 721409..722359 product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I469 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene cobD CDS complement(722390..723127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(723131..724885) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(725241..726716) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ64 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene cobQ CDS complement(726754..729444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 note possible pseudo, internal stop codon, frameshifted CDS complement(729458..730477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 note possible pseudo, internal stop codon, frameshifted CDS 730855..731889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 731879..732868 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 732980..735577 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene ladS CDS 735676..736239 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 736236..737486 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene moeA2 CDS complement(737641..738150) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 738517..739149 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(739263..739574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(739743..740393) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene narL CDS complement(740390..742246) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD66 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene narX CDS 742654..744261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 744364..748119 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene narG CDS 748132..749667 product respiratory nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene narH CDS 749672..750409 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene narJ CDS 750420..751103 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene narI CDS 751282..752109 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXD5 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 752136..753191 product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZU05 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene moaA CDS complement(753200..753799) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(753796..754491) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene dnr CDS complement(754674..755882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 755776..756039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 756078..756944 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 757087..757650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 757769..758683 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 758840..760012 product protein NnrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(760136..761482) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 761756..762730 product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLT7 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene corA CDS 762818..763696 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 763842..766220 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene ladS CDS complement(766234..767463) product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(767665..768873) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene alkB CDS complement(768918..769958) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 770146..771177 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 771358..772317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(772357..773823) product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 774209..775111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 775112..775642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(775662..777152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 777335..779947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(779995..780630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(780630..781736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(782098..782706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 783020..784399 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 784405..785733 product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 785733..788921 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 788918..789607 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 789604..790929 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105000.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(790940..791410) product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(791412..792251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405355.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(792375..793094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 793294..793695 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(793774..795006) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene yuxH CDS 795372..796988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(796996..798333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(798381..799898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 800416..802005 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(802157..803506) product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene norM CDS 803865..806615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 806939..807343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 807670..808851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 808908..810056 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KM68 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene sbcD CDS 810053..813115 product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB9 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene sbcC CDS 813249..814877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941180.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 814880..815287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 815384..816016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(816090..816731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(817222..818901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 tRNA complement(819132..819208) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(819263..821140) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMF1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene rpoD CDS complement(821324..823135) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene dnaG CDS complement(823145..823639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(823700..823915) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V8 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rpsU CDS 824238..825257 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K2 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene ygjD CDS complement(825276..825875) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW7 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene plsY CDS 826058..826414 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene folB CDS 826415..826906 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(826936..827694) product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(827777..829027) product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7ND45 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene cca CDS 829376..830266 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene pagO CDS complement(830312..831208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 831322..831948 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(832029..832673) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSH2 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene fabR CDS 833046..834419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 834474..836459 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(836598..838247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 838463..838711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 838748..839506 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 839915..841153 product membrane-bound lytic murein transglycosylase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44049 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene mltC CDS 841331..841858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(841896..843242) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene adcK4 CDS 843832..844650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 844647..845603 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(845686..846990) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 847264..848574 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene yfeW CDS 848744..848914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(849269..851398) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 851678..852073 product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 852308..853174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 853306..854511 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 854544..855695 product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(855775..856101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(856283..857119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 tRNA 857356..857440 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(857661..858002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(858030..858194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(858434..859429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 859978..861495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(861642..863969) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 864170..864721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 865356..866075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(866086..866748) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 866984..867943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 868122..868952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(868972..869361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(869354..870340) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene rrmA CDS complement(870409..871542) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4H5 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene dapE CDS complement(871746..872498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(872691..873038) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene yffB CDS complement(873113..873937) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG0 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene dapD CDS complement(873960..875156) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(875170..877863) product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene glnD CDS complement(877872..878642) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene map CDS 879157..879915 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG3 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene rpsB CDS 880043..880930 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene tsf CDS 881100..881837 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene pyrH CDS 881843..882400 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82853 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene frr CDS 882480..883241 product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY2 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene uppS CDS 883246..884055 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene cdsA-1 CDS 884052..885266 product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N7 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene dxr CDS 885328..886686 product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 886730..889105 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene opr86 CDS 889192..889665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 889690..890712 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene lpxD CDS 890831..891274 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR7 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene fabZ CDS 891271..892038 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene lpxA CDS 892100..893266 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene lpxB CDS 893271..893906 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rnhB CDS 893931..897398 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene dnaE CDS 897568..898521 product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ2 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene accA CDS 898641..899426 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 899541..900251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(900395..902509) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 902966..903952 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(904148..905365) product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene fabB CDS complement(905455..905970) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV9 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene fabA CDS 906438..908450 product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene ccmF CDS 908450..909031 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene dsbE CDS 909031..909528 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 909564..910844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 911094..912566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 912931..913581 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene adk CDS 914342..915166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(915214..915831) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8E3 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene mobA CDS 915941..916714 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 916809..917261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 917266..918069 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene uppP CDS 918208..918597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 918638..919444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(919478..921982) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXW7 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene plsB CDS 922372..923295 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 923298..924032 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 924046..926007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 926135..927490 product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHJ7 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene tilS CDS 927600..929240 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene pyrG CDS 929313..930188 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWQ9 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene kdsA CDS 930214..931512 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene eno CDS 931681..931992 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M2 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene ftsB CDS 932086..932736 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ2 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene ispD CDS 932823..933302 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene ispF CDS 933380..934435 product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene truD CDS 934512..935246 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene pcm CDS 935325..936260 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 936383..937192 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 937268..938350 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rpoS CDS complement(939424..939747) product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene fdxA CDS complement(939878..942460) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY08 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene mutS CDS 942687..943250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 943347..944375 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene recA CDS complement(944401..945330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(945475..945621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 945598..950406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 950599..952008 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene hemN CDS 952162..952917 product transcriptional activator protein anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23926 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene anr CDS 953087..953395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 953626..954063 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGK5 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene fkpB CDS complement(954088..954282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639145.2 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(954305..956716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 957091..957816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 958103..959047 product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 959092..959559 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 959594..960070 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56647 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene recX CDS 960159..962765 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene alaS CDS 962900..964120 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene lysC CDS 964450..964638 product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBS3 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene csrA tRNA 964803..964894 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 965025..965101 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 965478..965732 product oxaloacetate decarboxylase gamma chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3E4 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene oadG2 CDS 965786..967579 product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 967595..968896 product putative oxaloacetate decarboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTU5 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene oadB CDS complement(969036..969449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(969631..971514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(971653..972648) product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene hemH1 CDS 972834..973313 product putative peroxiredoxin bcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44411 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene bcp CDS complement(973637..975331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 975445..976329 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(976298..977041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 tRNA complement(977263..977339) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 977563..978735 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 978747..979871 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 980020..981006 product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 980987..981727 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 981757..982377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(982401..983195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 983188..983340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(983337..983834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(984049..984354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(984510..985283) product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885A9 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 985468..986418 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 986437..987309 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244386.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene cheR-2 CDS 987509..987913 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q2 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene flgB CDS 987916..988359 product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR0 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 988387..989067 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQR1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 989086..990411 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene flgE CDS 990546..991286 product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Z7 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene flgF CDS 991392..992177 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P7 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene flgG CDS 992227..992907 product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P6 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene flgH CDS 992933..994057 product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4P5 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene flgI CDS 994062..995210 product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene flgJ CDS 995248..997278 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene flgK CDS 997293..998534 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene flgL CDS 998691..1000343 product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene fliC CDS 1000782..1002437 product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene fliC CDS 1002537..1002995 product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene flaG CDS 1003097..1004533 product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y151 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene fliD CDS 1004554..1004973 product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene fliS CDS 1004948..1005286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 1005306..1006520 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(1006487..1006708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 1006856..1008826 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rcsC CDS 1008866..1009981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 1010024..1010842 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene tkt CDS 1010829..1011803 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(1011870..1013786) product acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(1013847..1014812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(1014970..1015620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(1015624..1017321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(1017562..1017987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 1018243..1018485 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 1018523..1019950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 1019943..1020989 product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 1020979..1022190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 1022260..1022721 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLY7 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene fabZ CDS 1022734..1024377 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 1024355..1024744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 1024749..1025477 product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67610 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene fabG CDS complement(1025579..1026853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(1026837..1028162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(1028194..1029351) product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 1029891..1031333 product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene fleQ CDS 1031611..1032852 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 1032879..1034231 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 1034541..1034873 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51462 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene fliE CDS 1034900..1036627 product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQT3 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 1036680..1037669 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene fliG CDS 1037669..1038622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 1038619..1039968 product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene fliI CDS 1039994..1040431 product flagellar FliJ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQM9 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene fliJ CDS 1040736..1041017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 1041077..1041439 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene cheY CDS 1041507..1043651 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 1043681..1044244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 1044231..1044350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 1044353..1046890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 1046930..1047805 product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1A6 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene cheR CDS 1047802..1048467 product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene cheD1 CDS 1048489..1049571 product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9J7 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene cheB1 CDS 1049581..1050495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1050648..1050950 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1051007..1052752 product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1052830..1053177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1053499..1054014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1054279..1055316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1055537..1056418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1056510..1056881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 1056934..1058097 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1058142..1058378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1058375..1058752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1058755..1059321) product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1059403..1059852) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1060057..1061256) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1061527..1062765) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1063291..1064061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(1064058..1064381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(1064432..1064791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1065043..1065573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1065685..1066503 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1066599..1067837) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(1068013..1069191) product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene gcdH CDS 1069565..1070704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1070788..1071600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1071882..1072607 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1072670..1073584 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1073944..1074471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(1074533..1077493) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene preP2 CDS 1077800..1078798 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1078795..1079481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1079548..1080252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1080570..1081643 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1081780..1082430) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1082714..1083550 product exonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene xthA CDS 1083637..1086096 product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFJ8 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1086100..1086966) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene tesB CDS complement(1087201..1089186) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1089555..1090574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1090674..1091720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1092149..1094281 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1094321..1095019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1095411..1096361) product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ95 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene dusC CDS 1096858..1097598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1098076..1100310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1100541..1102625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1102645..1103913) product nitrite extrusion protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene narK1 CDS 1104262..1105737 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene crnA CDS 1105861..1107651 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1107690..1108811) product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1109006..1109329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1109481..1111349 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1111358..1111537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1111659..1112243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1112332..1113288) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1113288..1114820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1114817..1115347) product ATP-dependent Zn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1115543..1116208) product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1116265..1116897) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGL4 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1116894..1119731) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD0 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene rapA CDS complement(1119801..1120400) product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1120706..1121947 product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene serA CDS complement(1122041..1122610) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1122874..1125609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1125714..1126601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1126994..1128535) product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene pnbA CDS 1128842..1129957 product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1130030..1131268 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1131440..1132009 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1132245..1133300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1133416..1133658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1133939..1135537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1135584..1135979 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1136028..1136264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1136517..1138340 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365019.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1138505..1139083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1139083..1140030 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1140123..1140680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1140720..1141490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1141469..1142236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1142313..1144304 product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECS1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene topB CDS complement(1144540..1147653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1147973..1148815) product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q60049 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene nox CDS 1149197..1150102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1150194..1151252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1151282..1151446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1151443..1152804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1152828..1153628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1153636..1154211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1154231..1154995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1155007..1156134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1156149..1156607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1156631..1157098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1157101..1159272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1159422..1161779) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1162047..1162919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1162969..1168308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1168297..1169061) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1169357..1170280) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1170434..1171099 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1171222..1172067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1172331..1174673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1174833..1175876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1176139..1176957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1177011..1177604 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1177719..1178480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1178646..1179875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105922.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 1179875..1180399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1180414..1181265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1181359..1182411 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1182876..1190738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1190946..1191809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1191995..1192990) product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene oruR CDS complement(1193038..1194816) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1194997..1195590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1195593..1196465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1196607..1200581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1200655..1201023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1201077..1201220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1201275..1201880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1202004..1202690 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1202842..1203165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1203532..1204380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1204425..1205444) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene arcB CDS 1205787..1208495 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1208502..1208885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1208988..1209410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1209598..1210116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1210302..1211741) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1211912..1212778 product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1212814..1213296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1213400..1214797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1214976..1215134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1215147..1216355) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA2 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene rtcB CDS complement(1216853..1218178) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1218272..1218514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1218519..1219442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1219662..1220333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1220463..1220969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1221098..1222354 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1222382..1222918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1222911..1225004) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1225231..1226175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1226174..1226422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1226415..1227257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1227282..1229660) product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN6 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1229844..1230125 product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1230249..1232072) product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene deaD-1 CDS complement(1232292..1233569) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene metY CDS complement(1233744..1234208) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1234244..1235173) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1235388..1237421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1237999..1240353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1240328..1241749) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1241930..1242751 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1242802..1243212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1243402..1244079) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1244099..1245535) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1245810..1247294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1247409..1248329 product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1248333..1249553 product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene mauG CDS 1249580..1250458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1250472..1251245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1251294..1251926) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1252152..1252991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1252999..1255293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1255622..1256059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1256094..1258436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1258426..1259229) product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1259226..1259807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1259800..1260450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1260428..1262380) product chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1262377..1263612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1263697..1264383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1264556..1264762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1264851..1265321 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ3 transl_table 11 codon_start 1 locus_tag LOCUS_10750 tRNA complement(1265478..1265554) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(1265736..1266563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1266755..1267957 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1268082..1268672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1268820..1271180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1271232..1272179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1272210..1272938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1273308..1274336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1274365..1275003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1275355..1276569 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1276677..1277342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1277366..1277665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene yciL CDS complement(1277668..1278276) product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NVM4 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene yciB CDS 1278362..1279270 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1279286..1279906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1280077..1281291 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene trpS CDS 1281308..1282219 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1282226..1283437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1283728..1284570 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene rluB CDS complement(1284597..1285553) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1286031..1286780) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1286877..1287545) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1287549..1288271) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T9 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene ubiG CDS complement(1288276..1289640) product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1289791..1290864 product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ65 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene mtnA CDS 1291087..1293792 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH96 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene gyrA CDS 1293806..1294885 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885T5 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene serC CDS 1294894..1295994 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1296057..1297160 product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene hisC2 CDS 1297157..1299385 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene aroA CDS 1299387..1300097 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ70 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene cmk CDS 1300369..1302042 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene rpsA CDS 1302249..1303082 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene ephD CDS 1303204..1305642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1305698..1306321 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1306297..1306884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1306937..1307365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1307365..1309458) product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene prc CDS 1309880..1311544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1311635..1312192 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1312223..1312519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1312532..1313551) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene fadB5 CDS 1314486..1315997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1316012..1316446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1316522..1319227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1319314..1320339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1320373..1320753 product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1320934..1321722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1321825..1323009) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene ltp1 CDS complement(1323039..1323941) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1324147..1325280) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1325689..1326711 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1326737..1328413) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1328454..1328750) product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1328783..1329817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1330035..1331942) product heme ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene uup CDS complement(1332087..1334591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1334584..1335321) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1335464..1336138 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene tesA CDS complement(1336240..1337463) product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1337621..1339066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1339503..1339817 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ99 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene ihfB CDS 1339956..1340264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1340268..1341443 product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVL7 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene lapB CDS 1341498..1342190 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58644 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene pyrF CDS 1342324..1342620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1342720..1343394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1343840..1346284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1346298..1347239 product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1347269..1348480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1348473..1349693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1350069..1350785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1350818..1352725 product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1352834..1353928 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1353919..1354776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1354773..1355402 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1355380..1356312 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1356638..1357330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1357305..1358306 product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1358593..1359141 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene rfbC CDS 1360688..1362631 product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene wbfY CDS 1362725..1364047 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene ugd CDS complement(1364107..1366212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1366432..1367286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1367761..1368435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1368532..1369680 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1369680..1370642 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001779971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1370650..1371414 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1371417..1372151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1372151..1373101 product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene rfbN CDS 1373240..1375129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 tRNA complement(1375362..1375437) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 1375724..1377739 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72174 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene uvrB CDS 1377853..1378860 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene uge tRNA 1378920..1378996 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 1379261..1379740 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene infC CDS 1379800..1379994 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene rpmI CDS 1380028..1380387 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A481 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene rplT CDS 1380541..1381557 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene pheS CDS 1381645..1384023 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A4 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene pheT CDS 1384026..1384331 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51472 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene ihfA CDS 1384309..1384668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251427.2 transl_table 11 codon_start 1 locus_tag LOCUS_11740 tRNA 1384848..1384924 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 1385983..1386246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1386261..1386731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1387669..1388820) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1389091..1389375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1390240..1390989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 note possible pseudo, frameshifted CDS 1391103..1391576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1391857..1392738) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1392823..1393686) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1393952..1394842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1394839..1398201 product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1398191..1399699 product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1399696..1400883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1400894..1401880 product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1401893..1402498 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 repeat_region 1402673..1409122 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaactgcctcataggcagcttagaaa CDS 1409976..1410203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1410464..1410931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1411143..1411358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1411436..1412050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1412559..1412792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1412876..1417642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1418283..1418444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1418885..1419211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1419389..1419643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1420169..1420699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1420696..1420866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1421193..1425428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1425468..1426535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1426517..1427698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1428177..1428617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1428958..1431012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1431016..1431846) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1432346..1432537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1433207..1433503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1433825..1434988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1435315..1435635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1435611..1435946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1436102..1436533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1437031..1437327) product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110728.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1437625..1438611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1438755..1439882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1439899..1441239) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene yfhA CDS complement(1441250..1441723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1441716..1443164) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1443328..1443879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1443898..1444500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1444497..1444820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1444925..1445533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1446166..1446420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1446487..1447068 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1447271..1447615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1447649..1448107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1448302..1449579) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1449961..1450641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1451043..1451237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1451807..1454299) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1454471..1454743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1454995..1456380 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene fumC CDS complement(1456427..1457281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1457421..1459751) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1459828..1460565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1460789..1461190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1461207..1462226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1462315..1463109 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1463429..1463833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1464005..1465324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1465919..1466290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1466304..1467110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1467259..1467453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1467901..1473072 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1473670..1474416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1474885..1475118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1475344..1475631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1475857..1476039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1476161..1476568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1476908..1477423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 note possible pseudo, internal stop codon, frameshifted CDS complement(1477424..1477642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 note possible pseudo, internal stop codon CDS complement(1477912..1478139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1478477..1479868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1479936..1480178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1481530..1481943) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1482273..1482485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1482648..1482953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 1482934..1483665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1483693..1484043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1484545..1485012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1485253..1485438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1485528..1485851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1486059..1486400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1486565..1486894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1486932..1487276) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1487245..1487505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1487562..1487822) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E847 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1488614..1490671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1490900..1492135) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene lipL CDS 1492326..1493003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1493020..1493952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1494178..1495686) product methylamine utilization protein MauG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1496121..1496558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1496698..1498569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1498569..1500476 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1500502..1501287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1501297..1501503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1501903..1502289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1502598..1503923) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene lipL CDS 1504173..1504871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1504955..1505932) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1506187..1506606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1506712..1508550) product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1509009..1510973) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene mccC1 CDS complement(1510992..1511804) product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene atuE CDS complement(1511810..1512979) product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene atuD CDS complement(1513025..1514641) product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene atuC CDS complement(1514644..1515522) product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene atuB CDS complement(1515565..1517361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene atuA CDS 1517599..1518225 product atu genes repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene atuR CDS 1518596..1519300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 tRNA 1519536..1519611 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 1519732..1519808 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(1519811..1519981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1520307..1521326) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1521660..1523279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1523299..1524285 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene dcyD CDS 1524300..1525184 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZC0 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene nadK CDS 1525187..1526164 product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1526258..1526467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1526466..1528118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1528216..1528485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1528501..1529004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1529091..1531763 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene pepN CDS complement(1531760..1531945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1532352..1533746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1533812..1534858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1534883..1537192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1537218..1539959) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1540407..1542125 product putative peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1542152..1542943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1543290..1543991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1544592..1545056) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1545195..1545500) product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1546211..1546795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 note possible pseudo, frameshifted CDS complement(1547750..1548241) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1548285..1548965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1549041..1549532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1549688..1549948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1550048..1550533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 sequence02 source 1..773279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(717..1517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1546..4035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(4343..5638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(5850..6257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(6570..6986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 7349..8683 product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene nhaA CDS complement(8680..9375) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(9433..10428) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 10633..11742 product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene frmA CDS complement(12061..13476) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 13641..13946 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 14214..14729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(14746..15783) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(15789..16703) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene rimK CDS complement(17042..18730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(18793..19995) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(20134..20601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 20831..23200 product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(23209..24150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(24147..25031) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(25090..25590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(25722..26579) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(26592..27437) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4D9 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene pstA2 CDS complement(27430..28344) product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9I6 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene pstC CDS complement(28375..29250) product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(29240..29806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(29797..30843) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 31119..31403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(31489..32289) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(32286..34457) product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 35216..35887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(35943..36200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(36393..36791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 36900..38804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(38801..39028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(39021..39656) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 40125..40898 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene fpr CDS complement(40931..41893) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene yeaP CDS complement(42066..43316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(43313..43861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(43874..44284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 44531..45430 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(45559..46542) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(46548..47918) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 48040..49065 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550651.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(49131..50543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 50836..51675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(51684..52349) product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(52418..53329) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(53344..55692) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(55749..56102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(56104..57639) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(57636..58664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(58750..60285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(60282..60947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(60944..61720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(61725..62744) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(62782..63084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(63129..64352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(64349..65290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(65340..66230) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(66227..67042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(67027..68130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(69144..70067) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(70096..72774) product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(72965..73690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(74122..76806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(76849..79851) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene ladS CDS complement(79965..80771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 80884..81897 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(81910..83790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 83985..84893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(84932..87514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(87609..88607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(88686..89651) product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene kcnb2 CDS complement(89734..90168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(90165..91874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(91880..92335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(92412..93320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 93541..94326 product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(94339..94959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(94956..97325) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 97571..98503 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(98507..101296) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(101664..101876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(102009..102899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 102898..103167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 103173..103865 product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 103996..105249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(105290..106237) product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene dhmA1 CDS complement(106325..106909) product HTH-type transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P75952 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene comR CDS complement(107088..108590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(108709..110328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(110353..112068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 112260..112898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(112929..113582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(113586..114380) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene dltE CDS 114645..115598 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 115660..117210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(117207..117818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 117971..118999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 119075..119779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(119776..120588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(120592..121344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(121589..122344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(122356..123087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(123179..123580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(123685..125205) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(125198..125920) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene drrA CDS complement(126045..126425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 126621..127415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 127618..128493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 128603..130159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(130170..131231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 131554..132516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 132587..132790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(132958..133206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 133642..134118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(134144..134680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022045.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(134673..135980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(135984..136535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(136555..137739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(137919..139226) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 139504..141444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 141536..142678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(142901..143281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(143353..143973) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(144028..145944) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(145999..147705) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(147718..147987) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 148332..150290 product acetyl-coenzyme A synthetase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I558 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene acsA1 CDS complement(150387..150878) product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(150966..151313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(151397..151810) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(151960..153498) product putative phosphate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26024 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 154020..155078 product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 155132..156316 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 156349..156984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 157010..158464 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 158637..159497 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 159646..160143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 160190..161086 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 161158..163278 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 163390..167124 product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6M5 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 167126..168124 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 168435..170033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 170166..171140 product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460932.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(171252..171422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 171704..172567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(172713..173255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene yaiL CDS 173637..174002 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene cheY CDS 174072..174365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 174499..176055 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene fadD CDS 176118..177788 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 177812..178483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 178615..179742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 179887..180909 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene appY CDS 181236..182141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 182283..183707 product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(183781..184245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 184719..185288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 185334..186131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 186124..188052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(188091..188666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(188659..189561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 190015..192234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 192859..195063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(195079..196080) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 196283..197719 product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C8 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene calB CDS 197889..199160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(199170..199955) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(199952..200650) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene fbpC CDS 200811..202850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 202927..203364 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 203455..206658 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 206697..208025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 208146..209093 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(211130..211939) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene mhpC CDS complement(211944..212543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(212543..213472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 213650..214582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 214751..215509 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074300.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(215598..216875) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 217067..217675 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 217941..218900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 218933..220696 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 220709..222358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 222363..222944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 222981..224645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(224680..225666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 226365..227006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 227269..228597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(228616..230547) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(230699..231904) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(231925..234351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(234465..235136) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(235314..236489) product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene fadA CDS complement(236515..238662) product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ2 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene fadB CDS complement(238961..241534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 241767..242768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 242758..243252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 243405..244259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(244314..245654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(245651..246349) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 246552..246995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 247096..248295 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(248357..248986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(249439..250329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 250523..253264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(253408..254544) product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene phaC1 CDS complement(254688..255041) product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(255069..257351) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 257578..258639 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I534 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene dinB CDS complement(258628..261591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(261639..262214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(262512..265745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(265958..267880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(267890..270079) product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(270380..270613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 270790..272307 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(272337..276017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(276021..277211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(277528..277977) product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(278020..279750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 280164..281441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(281513..283306) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 283402..284382 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 284465..285892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 285889..288996 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 289271..290362 product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene oruR CDS 290956..293268 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene ladS CDS 293321..293731 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(293808..294059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(294571..295065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(295153..295701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(295866..297977) product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(298205..298636) product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(298814..301969) product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071738.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 302219..304591 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ladS CDS complement(304663..306522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 306895..307413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 307442..310525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(310609..311439) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(311528..311779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(311968..314220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(314207..317506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(317503..320763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(321131..321550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(321813..322346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(322486..322881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 323596..324522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 324754..326367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(326510..326947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 327545..329251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(329274..330224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(330576..331622) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene oruR CDS 331767..333239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(333315..334436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 334545..335480 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene lyrS CDS 335568..336890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 337030..337917 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(337991..338872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(339031..344349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(344451..346538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(346575..347207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 347573..347983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 348010..348714 product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 348817..349143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 349426..350784 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(350806..351867) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene oruR CDS complement(351957..354284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 354454..354828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(354840..355316) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(355352..356128) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 356215..358110 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(358194..358988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 359325..360602 product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(360979..361164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 361166..363115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(363232..364005) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 364198..365175 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 365328..366104 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(366168..366977) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 367195..367380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(367427..368500) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 368729..370102 product FAD-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 370192..370521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 370543..371121 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404500.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(371127..371444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 371655..372470 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(372555..374141) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGD6 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene prfC CDS complement(374262..375161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(375154..375927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(376106..376597) product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene rimI CDS complement(376607..377491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(377592..379139) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene leuA CDS complement(379576..381228) product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30718 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene groL CDS complement(381294..381584) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene groS CDS complement(381855..382424) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene fsxA CDS complement(382453..383226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 383554..384315 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 384467..384781 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene atl1 CDS 385185..386483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 386554..387531 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 387622..388584 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZP04 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(388634..388921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(388998..389192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 389191..389739 product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 389776..390285 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene cobU CDS 390298..391365 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I465 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene cobT CDS 391375..392025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(392038..393909) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 394308..394508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 394816..395304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(395491..397140) product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD7 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene aceF CDS complement(397186..399846) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene aceE CDS complement(400247..401137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(401231..401800) product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene ampD CDS complement(401925..404411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 404817..406148 product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 406156..406998 product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30819 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene nadC CDS 407243..408952 product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene pilB CDS 408955..410214 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 410224..411132 product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22610 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene pilD CDS 411189..411788 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888U3 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene coaE CDS 411791..411994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(412046..412387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(412456..413106) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 413323..414531 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 414562..415656 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 415675..415977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 415989..416303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 416463..419300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(419313..419933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(419908..420966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(420978..422210) product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene argJ CDS complement(422332..425049) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene secA CDS complement(425263..426111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 426317..426784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(426852..427766) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene lpxC CDS complement(427905..429065) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WZ0 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene ftsZ CDS complement(429187..430500) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene ftsA CDS complement(430478..431320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(431324..432241) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNZ2 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene ddl CDS complement(432241..433683) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene murC CDS complement(433676..434767) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW01 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene murG CDS complement(434764..435993) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene ftsW CDS complement(435995..437383) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY3 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene murD CDS complement(437391..438473) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene mraY CDS complement(438473..439849) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SG8 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene murF CDS complement(439867..441378) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F28 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene murE CDS complement(441378..443093) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene ftsI CDS complement(443090..443377) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ6 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene ftsL CDS complement(443401..444339) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNY2 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene rsmH CDS complement(444336..444794) product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX20 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene mraZ CDS complement(445564..446409) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45298 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene rsmI CDS 446458..448434 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 448346..448726 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY5 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 448860..449450 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene gmhA CDS 449454..450038 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(450165..450584) product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene sspB CDS complement(450638..451270) product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene sspA CDS complement(451400..452059) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene petC CDS complement(452059..453309) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(453309..453908) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(454160..454546) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPA4 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene rpsI CDS complement(454565..454993) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene rplM CDS 455359..456399 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(456473..457573) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene zapE CDS complement(457698..458360) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 458487..459029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 459256..459687 product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(459737..460954) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene sat CDS complement(461063..461821) product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 461928..463067 product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(463200..464282) product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE0 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene hisC1 CDS complement(464340..465647) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene hisD CDS complement(465819..466475) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW8 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene hisG CDS complement(466502..467764) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene murA CDS complement(467833..468072) product acid stress protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9W6 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene ibaG CDS complement(468272..468580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(468607..469068) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(469071..469853) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(469850..470665) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 470917..471876 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 471891..472865 product arabinose 5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW0 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene kdsD CDS 472931..473479 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 473481..474056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 474034..474714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 474707..475432 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 475663..477339 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LE2 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 477509..477814 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 477863..478315 product nitrogen regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV4 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene ptsN CDS 478414..479265 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 479311..479583 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene ptsH CDS 479750..481108 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 481293..481874 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(481950..483284) product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene pmbA CDS 483392..483925 product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU8 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(483972..485408) product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene tldD CDS complement(485504..486388) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(486385..490629) product TIGR02099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(490684..492156) product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene cafA CDS complement(492228..492821) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU3 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(492840..493328) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU2 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene mreD CDS complement(493321..494130) product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVU1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene mreC CDS complement(494281..495321) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 495640..495927 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS0 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene gatC CDS 495991..497448 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT8 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene gatA CDS 497505..498950 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS6 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene gatB CDS complement(499125..499874) product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene thiF CDS complement(499889..500725) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T2 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene prmC CDS complement(500728..501810) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43917 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene prfA CDS complement(501840..503159) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene hemA CDS 503456..505195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 505214..505864 product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene lolB CDS 505861..506739 product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene ispE tRNA 506829..506903 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 506955..507905 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C6 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene prs CDS 507975..508601 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene rplY CDS complement(508807..508935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 508918..509301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 509315..510406 product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene ychF tRNA 510498..510574 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(510735..510974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(511152..511490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 511641..511859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 512116..513336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 513350..514927 product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene coxA CDS 514979..515554 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene ctaG CDS 515584..516480 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene coxC CDS complement(516586..516867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 517116..517763 product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I722 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 517770..518423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482681.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 518428..519444 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 519441..520385 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P7 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene cyoE CDS 520558..522243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(522247..523428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(523534..524376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(524443..525435) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(525432..526286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(526334..526930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 527128..529281 product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene bifA CDS 529493..530674 product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(530766..532499) product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene fabY CDS 532736..533725 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 533988..535010 product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947985.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 535156..536250 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 536240..537271 product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 537268..538383 product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYJ0 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(538459..538974) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(539044..541824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(542043..542774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(542777..543562) product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKV2 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene cmoM CDS 543848..544063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(544092..544466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(544608..545498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(545607..546371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(546512..546745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(546912..548339) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(548391..548843) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(548875..550038) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 550289..551320 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 551345..551617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(551736..554327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 554507..554905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(554929..555660) product nitroreductase NfnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6D0 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene nfnB CDS complement(555692..556237) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(556301..557311) product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882V6 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene moaA CDS complement(557351..558214) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(558307..560547) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene relA CDS complement(560557..561888) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene rlmD CDS complement(561952..562764) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(562825..563574) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 564069..566831 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ42 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(566840..567508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(567505..569013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(569150..569527) product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LP3 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene acpS CDS complement(569524..570264) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G5 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene pdxJ CDS complement(570261..571016) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A286 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene recO CDS complement(571034..571939) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX8 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene era CDS complement(571946..572626) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPB0 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene rnc CDS complement(572630..573004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(573059..573874) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene lepB CDS complement(573878..575563) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G8 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene lepA CDS 575624..575815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(575876..577267) product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(577510..577998) product positive regulator for alginate biosynthesis MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene mucC CDS complement(578064..579029) product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(579051..579749) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MJG9 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene rseA CDS complement(579831..580403) product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene algU CDS complement(580409..580720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 580782..582407 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene nadB CDS complement(582430..582693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(582893..583075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 583334..584338 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 584491..585333 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 585477..586358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 586370..587218 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(587297..588187) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYA3 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene mmsB CDS complement(588210..589388) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(589466..590242) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(590239..591399) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene ivdC CDS complement(591437..592942) product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene ivdB CDS 593125..594006 product MmsAB operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28809 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene mmsR CDS complement(594046..594756) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene ung CDS complement(594821..595501) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(595679..596341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(596652..597794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 598093..598908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(598975..600483) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886S6 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene lysS CDS complement(600501..601352) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A290 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene prfB note possible pseudo, frameshifted CDS complement(601726..603465) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(603639..604724) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene thrC CDS complement(604763..606076) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene hom CDS complement(606073..607272) product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(607532..608422) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene dsbC CDS complement(608547..609500) product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ6 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene xerD CDS complement(609557..609922) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rplS CDS complement(610058..610813) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene trmD CDS complement(610877..611401) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ0 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene rimM CDS complement(611443..611694) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH72 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene rpsP CDS complement(611956..613347) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG22 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene ffh CDS 613901..614707 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 614812..616086 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(616067..616918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(617023..618441) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(618610..619608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(619642..620823) product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886V7 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene purT CDS complement(620841..621044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(621121..621645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40882 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(621664..622245) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 622693..623040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 623182..623739 product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 623924..626425 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene ladS CDS complement(626442..626759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(626811..630710) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXN2 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene purL CDS complement(630970..632127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 632569..634029 product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene mltF CDS complement(634092..634613) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene tadA CDS complement(634622..636190) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene guaA CDS complement(636295..637764) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene guaB CDS complement(637841..639601) product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(639747..640145) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(640344..640901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(640888..641115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(641105..641473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(641470..642129) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene rpoE CDS complement(642180..644090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(644217..645458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(645539..646228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(646266..647228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(647419..648333) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 648620..650269 product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR71 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(650323..651234) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(651352..651828) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 652178..654268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 654464..656017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 656127..656861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 657107..657556 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 657909..658421 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 658433..658888 product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene pilV CDS 658885..659997 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 660008..660556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 660576..664274 product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 664291..664581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 664759..666435 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706813.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(666478..667800) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(668004..668900) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 669116..669778 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(669869..670396) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092435.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(670529..671425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(671514..674510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(674707..675624) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 675806..677023 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190545.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 677034..677891 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 677955..679022 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 679035..679727 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 679742..680512 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 680895..681581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 681757..683433 product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 683585..684250 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 684281..685591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 685729..686340 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene btuR CDS complement(686405..687901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(688063..688947) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(689154..689756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(689753..690070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 690175..690387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(690464..691342) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 691458..692819 product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S09 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene xseA CDS 692942..693868 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene gcvA CDS 693934..696342 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 696415..697416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(697462..697959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(697979..699241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 699441..701276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(701347..701994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(702088..702573) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 702897..704345 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene sufB CDS 704361..705119 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 705119..706477 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene sufD CDS 706474..707724 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW0 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 707755..708111 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene ydiC CDS 708113..708667 product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 708672..709109 product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(709117..710760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 710956..712050 product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene oruR CDS complement(712056..713987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(714141..715004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(715071..716294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(716304..716930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(716955..717488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(717790..719028) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(719025..719675) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(719678..721213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(721213..722628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(722751..723872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 724458..725483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(725593..729282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(729424..730068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(730714..732123) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ8 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene der CDS complement(732120..733271) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene bamB CDS complement(733312..733971) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene yfgM CDS complement(733983..735263) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKS3 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene hisS CDS complement(735328..736452) product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z0 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ispG CDS complement(736506..737621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(737618..738406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(738403..739542) product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51385 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene rlmN CDS complement(739657..740088) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59636 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene ndk CDS complement(740229..741431) product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI8 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene iscS CDS complement(741449..741943) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene iscR CDS complement(742122..742943) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene cysE CDS complement(742983..743804) product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene trmJ CDS 744022..744828 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI4 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene suhB CDS complement(745318..747657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 747795..749906 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(749955..750878) product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY6 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene secF CDS complement(750901..752757) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene secD CDS complement(752856..753194) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(753398..754519) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH9 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene tgt CDS complement(754624..755673) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM2 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene queA tRNA 755921..756007 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(756758..757816) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(757813..758925) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 759039..760526 product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene pepA CDS 760552..760989 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 760995..761774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 761971..764805 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI0 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene valS CDS 764897..766036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 766106..767455 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene gdhA CDS 767455..768096 product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 768090..768995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(769022..769915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 770951..771793 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 771839..772087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(772151..772903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 sequence03 source 1..670896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(657..1457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(1500..2147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2153..2953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 3067..3378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 3602..4339 product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(4364..5359) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 5503..6414 product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(6443..8269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51484 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(8409..9800) product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59647 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene norB CDS complement(9812..10252) product nitric oxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59646 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene norC CDS complement(10428..10805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(10863..11648) product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene nirQ CDS complement(11668..12102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 12277..13878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 13880..15607 product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene nirS CDS 15674..15982 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 15979..16344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 16480..17661 product protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51480 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene nirF CDS 17664..18134 product protein NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95412 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene nirD CDS 18125..18667 product protein NirL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95413 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene nirL CDS 18640..19083 product protein NirG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95414 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene nirG CDS 19058..19570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 note possible pseudo, frameshifted CDS 19580..20761 product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene nirJ CDS 20962..22509 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene nirN CDS complement(22779..23330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 23667..25298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 note possible pseudo, internal stop codon CDS 25335..25706 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 25706..27355 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(27373..28821) product Trk system potassium uptake protein TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN7 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene trkH CDS complement(28830..30203) product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene trkA CDS complement(30301..31665) product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A9 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene rsmB CDS complement(31655..32608) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW9 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene fmt CDS complement(32669..33184) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene def CDS 33352..34476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(34701..35615) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 35770..36966 product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103023.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 37124..37378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 37378..37956 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A5 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene tsaC CDS 37959..38873 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ2 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene hemF CDS 38883..39695 product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43904 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene aroE CDS 39737..41773 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 41773..42012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 42116..42859 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 42995..45022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(45053..46615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 46807..47820 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene adiY CDS complement(47850..48233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(48281..50848) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 51031..51273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(51363..52235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(52239..53048) product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(53041..53883) product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT73 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene znuC CDS 54002..55117 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(55103..55390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 55609..57111 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055092.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 57140..58216 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918656.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 58501..60192 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(60320..61051) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 61328..64078 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(64341..64958) product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZT0 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene engB CDS 65157..65465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 65507..66145 product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene cc4 CDS 66303..66959 product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene dsbA CDS 67202..68038 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 68183..69865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(69900..70703) product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(70722..71666) product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(71729..72220) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 72371..73279 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(73488..73856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(73939..76026) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZZ8 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene recG CDS complement(76023..76946) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 77052..77915 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(78040..78420) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(78437..80560) product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene spoT CDS complement(80647..80883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(80988..81599) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene gmk CDS complement(81653..82519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 82707..83423 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene rph CDS 83532..84188 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQU5 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene pyrE CDS 84558..85100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(85125..85724) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene slmA CDS complement(85740..86669) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD5 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene argB CDS complement(86772..89447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(89528..90739) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene coaC CDS 90875..91549 product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 91705..91941 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM34 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene rpmB CDS 91953..92108 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene rpmG CDS 92365..93591 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene yuxH CDS complement(93600..94307) product putative TetR-family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 94434..95534 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 95580..96410 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(96415..98379) product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene hyuA CDS 98447..99265 product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN2 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene mutM CDS 99402..99719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(99817..101517) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(101600..101851) product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene fdx1 CDS complement(101935..102414) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene coaD CDS 102574..103269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 103363..103749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(103756..105828) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BV4 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(105825..106256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 106617..108914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(108909..109466) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(109517..110368) product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene lpxL CDS complement(110513..112117) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(112180..112767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(112817..114271) product putative coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C8 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene calB CDS 114776..115468 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(115542..116435) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(116540..118423) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(118625..119668) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 119876..122773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 122911..124641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(124638..125300) product glycerol metabolism activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29369 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene agmR CDS complement(125308..125736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(125767..126369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(126606..126854) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 127048..127608 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(127615..128211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(128358..129953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(129968..134572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(134673..135281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(135259..136074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 136385..136813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(136891..138030) product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene phaC1 CDS complement(138381..138752) product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948237.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 138895..141066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 141135..141902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 141911..142216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 142508..143959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 143956..144756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 144756..148388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 148435..149598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(149595..150791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(151173..153203) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 153452..153922 product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene cycB CDS 153934..154374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(154367..155287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 155493..156053 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 156841..157758 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRM4 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene ureD CDS 157800..158102 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN10 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene ureA CDS 158142..158447 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UG2 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene ureB CDS 158520..160220 product urease subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN06 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene ureC2 CDS 160264..160806 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQM6 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene ureE CDS 160796..161485 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E730 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene ureF CDS 161724..162332 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene ureG CDS 162831..164135 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 164279..165922 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972307.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 165925..167166 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 167177..167947 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 167963..168658 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 168907..169905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 170359..171036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(171138..172202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(172419..174422) product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTQ8 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene rep CDS 174640..175413 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 175795..176997 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene caiA CDS 177004..178017 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 178014..178415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 178440..179129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(179205..179948) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 180324..181841 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 181985..182722 product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NBM1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene cmoA CDS 182719..183693 product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XG5 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene cmoB CDS 183797..184453 product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 184475..184957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(184959..185213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(185343..185600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 185741..187741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 187756..188937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(189081..191411) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH5 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(191408..191641) product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(191891..193402) product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(193516..194424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(194526..194789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 195135..195473 product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene glnK CDS 195530..196789 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 197008..197484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 197623..198102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(198152..199018) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene speE CDS 199120..201018 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU5 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene speA CDS complement(201020..201661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 201705..202130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 202393..202614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(202699..203418) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(203482..204387) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44818 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene xerC CDS complement(204442..205182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(205179..206009) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51564 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene dapF CDS complement(206029..207309) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVL7 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene lysA CDS complement(207601..210483) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene cyaA CDS complement(210559..211119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(211241..212050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 212355..215084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(215332..216726) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene argH CDS 216943..218058 product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 218067..218819 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 218926..219858 product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8T5 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene hemC CDS 219862..220674 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene hemD CDS 220676..221941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 221955..223205 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene hemY CDS complement(223233..224273) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(224362..225627) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene rho CDS complement(225916..226239) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene trxA CDS 226533..228041 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene ppx CDS complement(228083..230182) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S646 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene ppk CDS complement(230207..231166) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene hemB CDS 231405..232538 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121077.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 232621..233277 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 233471..233995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(233992..234720) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene ubiX CDS 234754..236217 product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene ubiD CDS 236221..237216 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305130.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 237222..238172 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(238142..238516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 239014..239427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(239490..240095) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQM0 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(240303..241298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(241425..243356) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(243514..244662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 245130..245894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(245959..246921) product vegetatible incompatibility protein HET-E-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261072.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(247042..247518) product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene rsd CDS complement(248011..248508) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene dsbB CDS complement(248655..248879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(249223..250791) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene gshA CDS complement(250815..253160) product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(253332..255548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(255693..258863) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(258856..260091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 261491..262138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 262327..263124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(263087..263458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 264020..264877 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene amgR CDS 264928..265104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 265028..266275 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096258.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene amgS note possible pseudo, frameshifted CDS complement(266378..267133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 267268..267672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 267669..268904 product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 269069..270097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 270087..270878 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 270882..271319 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 271586..272434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(272412..273641) product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVH4 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene rlmG CDS complement(273712..275316) product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ7 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene pckA CDS complement(275316..276203) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTZ6 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene hslO CDS complement(276230..276646) product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CFW8 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene hslR CDS complement(276648..277322) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 277420..277911 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene nudE note possible pseudo, frameshifted CDS 277926..278744 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105469.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene cysQ CDS 278808..280736 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(280789..281376) product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(281420..281977) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(282034..282690) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSJ9 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 282863..283153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 283140..283388 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168081.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 283436..283654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 283766..284704 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(284741..286141) product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(286138..287001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 287132..287650 product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(287671..289248) product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene yhcX CDS complement(289469..290146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(290261..292558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(292587..293783) product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461085.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 294009..294392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86237 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(294409..294804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(294834..295325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(295351..295683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(296020..298623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(298722..299471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(299568..300734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 301244..304609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 304992..306656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 306774..307010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 307151..307435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(308561..308953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(308950..309177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(309810..310025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(310156..311130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(311151..312194) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 tRNA complement(312545..312620) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(312702..312941) product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(312987..314051) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene mutY CDS 314328..317372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 317501..318094 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene hisB CDS 318181..318825 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene hisH CDS 318865..319602 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene hisA CDS 319656..320429 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UG4 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene hisF CDS complement(320452..321399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 321648..322547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 322591..323637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(323720..326131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(326446..327351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(327439..328800) product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(329026..330198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(330491..332032) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene gpmI CDS 332307..332729 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 332737..333006 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU55 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene grx CDS 333077..333568 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR3 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene secB CDS 333650..334114 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGJ7 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene trmL CDS 334347..334676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(334681..338052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 338493..339584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 339759..340550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 340605..341048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 341327..341680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(341814..342221) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(342281..342619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(342693..343157) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 343525..345231 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPL1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene leuA CDS complement(345316..346776) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene ntrC CDS complement(346763..347887) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene ntrB CDS complement(348319..348900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(349102..349506) product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC3 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene ectC CDS complement(349612..351636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(351699..352925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(353196..354605) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU65 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene glnA CDS complement(355050..355280) product response regulator SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920728.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(355281..356294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 356560..358368 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene typA CDS 358601..359359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 359502..360251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 360513..360680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 360867..361073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 361228..361488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 361902..362180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(362272..362637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(362830..363552) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB2 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 364070..365797 product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 365888..368776 product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 368915..369364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(369406..370365) product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH7 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 370528..370968 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene dtd CDS 371104..373893 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 373886..377410 product nuclease/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(377433..377729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(377754..378917) product putative NADP-dependent oxidoreductase YfmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34812 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene yfmJ CDS complement(378995..380164) product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224790.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene mhpD CDS complement(380181..381254) product 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(381258..382940) product 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77397 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene mhpA CDS 383414..384514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 384511..385275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(385257..387194) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene asnB CDS 387518..387928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(387962..388216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 388157..389113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 389121..391412 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(391560..392711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(392924..393766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(394072..394848) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene tatC CDS complement(394937..395389) product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH0 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene tatB CDS complement(395397..395651) product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R4 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene tatA CDS complement(395661..395993) product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene hisE CDS complement(396019..397662) product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene ubiB CDS complement(397698..398363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(398363..399112) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ubiE CDS complement(399223..399609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247553.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(399705..401057) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V00 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene hslU CDS complement(401084..401623) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene hslV CDS complement(401708..402262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(402262..404016) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene argS CDS complement(404238..407393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(407514..409862) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC9 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene priA CDS 409957..410175 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Z0 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene rpmE CDS 410288..411127 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 411328..412587 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(412711..415266) product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_405138.2 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene mrcA CDS 415475..416539 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 416539..417105 product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene pilN CDS 417105..417698 product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene pilO CDS 417703..418239 product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene pilP CDS 418270..420387 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 420398..420919 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L67 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene aroK CDS 421017..422105 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene aroB CDS 422277..423956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 424021..428481 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene gltB CDS 428598..430016 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene gltD CDS 430108..431175 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V23 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene hemE CDS complement(431163..431777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(431805..432626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(432721..433260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(433353..434897) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(434900..436174) product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG0 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(436206..438128) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(438433..439245) product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene apaH CDS complement(439270..439659) product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U6 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene apaG CDS complement(439699..440517) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG5 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene rsmA CDS complement(440514..441533) product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58715 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene pdxA1 CDS complement(441533..442837) product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene surA CDS complement(442942..445260) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U2 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene lptD CDS 445733..446791 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946057.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 446915..447562 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 447622..448473 product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E861 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene djlA CDS complement(448501..449100) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107293.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(449260..450339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 450503..451177 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A31 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene rpe CDS 451209..451871 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A30 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 452205..453692 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20580 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene trpE CDS 453796..454374 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(454515..454820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(454845..455681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 456024..457442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 457620..458654 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene trpD CDS 458691..459494 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20577 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene trpC CDS 459697..459885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(459952..460584) product cyclic AMP receptor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55222 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene vfr CDS 460868..461290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 461290..461706 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 461809..462621 product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z9 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene speD CDS complement(462734..463363) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 463634..465124 product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143678.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(465140..466507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 466724..467833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(467857..468798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(468962..469588) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087753.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 469725..470393 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene dsbA CDS complement(470409..471110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 471749..473056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 473260..473670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 473806..474651 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(474742..474924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 475185..475922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 475951..476769 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(476800..477291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(477488..478303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 478673..479650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(479766..481142) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene pbeF CDS complement(481202..482269) product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(482474..483883) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(484051..484926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(484907..485440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 485666..487075 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(487236..487736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 488046..489956 product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705127.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 490060..490419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(490459..491100) product anti-ECF sigma factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene chrR CDS complement(491067..491663) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 491835..493283 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene phr CDS 493280..494230 product delta 9 acyl-lipid fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene desC CDS 494232..494720 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 494813..496087 product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 496084..496974 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036522.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 497048..498352 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene cfa CDS 498345..499163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 499186..500037 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 500031..500633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(500687..501556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(501956..502738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(502929..504200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 504274..504483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(504605..506857) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 507131..508582 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene ibeB CDS 508589..509788 product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974634.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 509785..512895 product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene czcA CDS complement(512934..514445) product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(514784..516040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 516377..518131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 518191..518484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 518538..518906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 519000..519551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 519552..519821 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene ptsH CDS 519884..520255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 520498..524265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 524386..524553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 524785..526116 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090914.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 526522..526992 product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 527512..528408 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene echA2 CDS 528448..529053 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816251.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 529071..530246 product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 530448..530786 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533389.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 530776..532044 product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(532320..532874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 transl_table 11 codon_start 1 locus_tag LOCUS_24430 tRNA complement(532894..532969) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(532974..533047) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(533148..533223) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(533302..533377) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 533878..534483 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(534900..537122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 537492..539408 product bifunctional glutathionylspermidine amidase/glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 539882..541393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(541454..542425) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene ncd-2 CDS complement(542504..543184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 543602..544702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(544768..545343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(545369..546217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(546343..548175) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104918.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(548177..551782) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(551914..552552) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(552600..553316) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(553332..554120) product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(554117..554935) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(555001..556077) product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 556649..558271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 558310..560130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(560216..560950) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064078.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(560951..563038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(563267..563905) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L6 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene folE CDS complement(564223..565065) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(565062..566585) product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 566735..567490 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(567462..568505) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 568629..569486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(569497..570990) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 571726..573501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(573548..574927) product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(575187..576197) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene yesN CDS complement(576287..576964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 577078..578013 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205322.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 578243..580258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 580280..583819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 583914..586601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 586598..587077 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 587082..588050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 588269..588901 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 gene tcsR CDS 588919..590688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 590825..591370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 591439..592272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(592335..592712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(593031..593864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 594419..595036 product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 595277..595486 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 595729..597981 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NH8 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene rnr CDS 598208..598588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 598504..599655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 600013..601326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(601400..602071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 tmRNA complement(602477..602830) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(602912..603385) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene smpB CDS 603611..605035 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 605037..605357 product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68561 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(605420..605785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 605960..606373 product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03456 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene fur CDS complement(606375..608042) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene recN CDS 608223..609272 product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene hrcA CDS 609360..609962 product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKI6 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene grpE CDS 610160..612094 product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene dnaK CDS 612190..613323 product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene dnaJ CDS 613363..614187 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WP2 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene dapB CDS 614550..615683 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene carA CDS 615756..618977 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 618974..619450 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene greA CDS complement(619573..619890) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377487.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 620012..620662 product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene rlmE CDS 620813..622750 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene ftsH CDS 622774..623598 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ6 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 623625..624962 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene glmM CDS 625039..625806 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV51 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene tpiA CDS 625816..626319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 tRNA 626373..626458 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 626710..627711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 tRNA 627775..627851 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 628030..628500 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene rimP CDS 628534..630039 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene nusA CDS 630074..632761 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene infB CDS 632804..633211 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR3 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene rbfA CDS 633215..634138 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX7 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene truB CDS 634212..634481 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE0 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene rpsO CDS 634853..636973 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene pnp CDS 637312..638007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(638078..638758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(639117..640151) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene holA CDS complement(640158..640685) product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX32 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene lptE CDS complement(640690..643275) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ0 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene leuS CDS 643386..644147 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(644155..645705) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZI86 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene lnt CDS complement(645735..646577) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(646574..647095) product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6U4 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene ybeY CDS complement(647114..648160) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(648401..649738) product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51470 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene miaB CDS 649956..650549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 650569..651126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 651289..651978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 652234..653928 product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 654108..654989 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256670.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 655077..655391 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157881.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene yqjZ CDS complement(655388..657586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(658227..658616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(658625..659626) product tyrosine protein kinase:aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(659626..660654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(660790..661227) product TIGR00701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(661276..663009) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 663212..664249 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z3 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene argC CDS 664281..665066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085249.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 665050..665547 product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 665631..665984 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene erpA CDS 666056..666541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(666571..667674) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EX9 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene anmK CDS complement(667677..669080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 669378..670604 product tyrosine--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LY8 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene tyrS2 sequence04 source 1..612645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(434..1192) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 1180..1374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(1405..1680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(1797..3572) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 3784..5217 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 5265..6209 product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(6246..6944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 7068..7895 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X038 transl_table 11 codon_start 1 locus_tag LOCUS_25620 tRNA 8042..8129 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 8331..8969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 9072..9785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(9895..10320) product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(10461..11807) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 12096..12935 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 13127..13942 product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(14012..14254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(14287..15168) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(15238..17421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 17609..18742 product 2-methyl-aconitate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW4 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene prpF CDS complement(18756..19541) product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(19646..20227) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 20286..21233 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 21359..21577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 21679..21888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(21905..22483) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene tag CDS complement(22498..23358) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 23724..24416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 24398..24598 product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CX1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(24613..25410) product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 25639..28059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 28230..28556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(28598..29068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482653.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(29190..29711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 30159..31166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(31299..31817) product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(31814..32650) product 2-oxoglutarate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(32647..34365) product 2-oxoglutarate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(34468..34848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(34892..38560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 38806..39285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(39338..42172) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(42292..44175) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(44172..44744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 45072..46322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 46451..46702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 tRNA complement(46951..47026) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(47221..48381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(48534..51746) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(51750..52772) product resistance-nodulation-cell division efflux membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(53001..53975) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(54004..54342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 tRNA complement(54688..54763) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(54912..56432) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene gltX CDS 56656..57660 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(57702..59906) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 60191..60904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(60971..62257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(62559..63506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(63508..64995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(65338..66261) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene glsA CDS complement(66265..66984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 67711..70140 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(70193..75436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(75436..76110) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(76167..77324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(77538..78347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(78656..79645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 80664..80966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(81061..82137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 82460..84694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 84914..85630 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(85749..89225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(89285..89914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(90705..91814) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 92493..93362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(93383..93931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 94085..94822 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 95047..96063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 96063..96977 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 97219..98739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 99097..100014 product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene dusA CDS 100075..101034 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY9 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene tal CDS 101052..101522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(101558..102103) product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(102108..103298) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 103579..103893 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(104036..104806) product VacJ-like lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(105019..105675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(105735..106496) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(106501..107361) product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(107376..107819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(108265..109407) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(109570..110586) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(110676..114602) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(114871..116535) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene fadD1 CDS 117208..118218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 118360..118836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(118916..120091) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(120113..120955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 121350..122318 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ7 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(122360..122743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(122750..125209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(125206..126000) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(126005..126475) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(126491..129202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(129354..129755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(129820..130275) product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(130287..130547) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I449 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(130572..131726) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene rnd CDS complement(131855..133000) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(133173..133769) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF8 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene recR CDS complement(133778..134101) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I0 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(134170..136143) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene dnaX CDS 136656..137141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(137160..138836) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene glnS CDS 139274..141004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 141261..142913 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(143003..143884) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene pcbD CDS complement(143984..145282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(145310..151171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 151970..153166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932751.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(153281..153847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(153924..156368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(156361..157059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(157071..157670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(157916..158560) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 158823..159941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 159978..160844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(160848..161705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551439.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 162327..163355 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene appY CDS complement(163406..163738) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(163862..165340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(166299..167834) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260923.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene rmuC CDS complement(167895..168689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(168721..169068) product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene pilZ CDS complement(169172..170188) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene holB CDS complement(170185..170823) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZN8 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene tmk CDS complement(170839..171927) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770618.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(171912..172769) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene pabC CDS complement(172770..174014) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA2 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene fabF1 CDS complement(174234..174473) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX6 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene acpP CDS complement(174639..175379) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene fabG CDS complement(175394..176335) product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH3 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene fabD CDS complement(176461..177396) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX9 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene plsX CDS complement(177471..177653) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E41 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene rpmF CDS complement(177679..178236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 178430..179008 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 179142..179777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(179876..180934) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(180962..181660) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(181657..182619) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene rluC CDS 183849..186914 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM8 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene rne CDS complement(187098..188129) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY7 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene murB CDS complement(188173..188649) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene ptpA CDS complement(188649..189413) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R14 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene kdsB CDS complement(189445..190470) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene lpxK CDS complement(190475..190888) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(190891..191517) product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(191633..194029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 194179..194754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(194768..195469) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL7 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene lolD CDS complement(195462..196706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 196940..197536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251679.2 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 197619..197906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 197949..199034 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene aguA CDS 199037..199933 product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 199939..200676 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 200684..201784 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 201845..202765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 202921..203538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(203583..203957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(203954..205351) product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57112 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene sthA CDS complement(205539..205772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(205837..206889) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNZ0 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene apbE CDS complement(206903..208132) product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene nqrF CDS complement(208154..208765) product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene nqrE CDS complement(208779..209441) product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene nqrD CDS complement(209444..210253) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene nqrC CDS complement(210246..211448) product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene nqrB CDS complement(211452..212789) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene nqrA CDS complement(213253..214698) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884J0 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene gap-2 CDS 215061..215690 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(215665..218205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(218421..219083) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(219083..220147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(220380..220817) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 221148..222422 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 222427..223296 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 223310..223747 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 223823..224590 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(224734..225447) product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene purC CDS complement(225461..226249) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(226249..227220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(227363..228241) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene dapA CDS 228531..229058 product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368263.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 229112..229606 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene bcp CDS complement(229751..230848) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(230880..231116) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 231493..232869 product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(232882..233943) product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene nadA tRNA complement(234156..234231) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(234361..235014) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y44 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene queC CDS complement(235042..235686) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Z3 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene queE CDS complement(235759..236607) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(236616..237179) product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene pal CDS complement(237258..238559) product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50601 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene tolB CDS complement(238580..239386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(239394..239834) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene tolR CDS complement(239834..240532) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(240597..240989) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(240999..242066) product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51426 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene ruvB CDS complement(242170..242787) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene ruvA CDS complement(242793..243317) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene ruvC CDS complement(243554..244303) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH19 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(244322..246103) product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y31 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene aspS CDS complement(246182..246442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 246652..247908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 248190..248621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 248881..250611 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA5 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene proS CDS 250611..251195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(251214..252191) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190237.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(252192..252830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 note possible pseudo, frameshifted CDS complement(252827..253192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 note possible pseudo, frameshifted CDS complement(253631..255148) product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(255262..256185) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene ephC CDS 256482..258053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(258050..259324) product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 259481..259828 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H8 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene yfgD CDS 259833..260438 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 260438..260839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 260869..261564 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 261561..262538 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 262528..264126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 264113..265501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 265498..266475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 266472..267815 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 267834..268310 product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261761.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(268412..268621) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(269102..270118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(270212..271195) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 271467..272522 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLF5 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene glk CDS 272702..274417 product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 274496..275278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 275327..275860 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 275937..277397 product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 277378..277896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(277886..278917) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene rr07 CDS complement(279041..281593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(281627..284491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(284497..284949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(285090..285785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86235 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(285853..286416) product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(286435..287757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 288181..289236 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM24 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene purM CDS 289274..289969 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 transl_table 11 codon_start 1 locus_tag LOCUS_28050 gene purN CDS 289982..291181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(291202..292368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(292371..292979) product UPF0441 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGH1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(292991..293407) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(293428..294075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(294068..295114) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(295124..295846) product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(295821..296210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(296536..297105) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene dcd CDS complement(297243..298082) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK7 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 298298..300340 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N07 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene metG CDS 300535..301119 product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B6 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene rnfA CDS 301129..301725 product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ3 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene rnfB CDS 301722..303929 product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT88 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 303935..304987 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6Q8 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene rsxD CDS 304993..305667 product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 305657..306370 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB5 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 306389..307024 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM8 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene nth CDS 307075..307278 product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 307291..307635 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 307724..308389 product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 308946..309806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 310508..313660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 313731..316280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(316472..317131) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704552.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(317145..317528) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0Q1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene gloA CDS complement(317702..319804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(319876..321855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(322065..323288) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene argG CDS complement(323509..324369) product smf-dependent flagellar motor protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene motY CDS 324528..325160 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLK2 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene rnt CDS complement(325246..325848) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 326273..327034 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(327035..328648) product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121082.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(328735..330135) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQR5 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene asnC CDS complement(330225..332618) product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(333122..333430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 333661..334722 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene potD CDS 334736..337243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(337297..337938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(338009..338617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(338766..339923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(340189..340512) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(340635..342749) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(342793..344286) product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene hyuB CDS 344306..344584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 344655..346955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(347078..347995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 348471..349676 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene argD CDS 349706..350626 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPJ1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene argF CDS complement(350716..352197) product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene glpK1 CDS 352402..353187 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene glpR CDS 353551..355149 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52111 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene glpD CDS 355300..356220 product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene metR CDS complement(356291..357910) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(357935..358672) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene rstA CDS 359365..362214 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4I1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene nrdA CDS 362294..363643 product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPL5 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene nrdB CDS 364099..365097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(365092..366378) product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene gltP CDS complement(366404..367597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(367588..367818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(367815..368312) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(368343..369164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(369134..369880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(370126..373563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 373852..375195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 375206..377869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 377885..379492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 379813..380751 product general secretion pathway protein GspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 380748..382442 product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 382448..384532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 384529..386226 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 386229..387431 product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene pilC CDS 387445..389082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 389075..389710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 389700..390404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 390391..391557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 391538..392239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 392484..393149 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(393250..395283) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(395457..396713) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene lipL CDS complement(396917..397255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 397642..398424 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 398508..399470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 399545..400690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 400961..401869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 402006..404801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 405021..405872 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 406007..408211 product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(408227..408664) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810241.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 408831..409685 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW87 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene purU1 CDS 409932..412844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 413107..415434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(415549..415911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 416095..417345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 417741..420167 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene ladS CDS complement(420241..421605) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(421605..422282) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene phoP CDS complement(422359..422628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(422805..423353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(423518..424363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 425037..426650 product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFS2 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene pckA CDS 426712..426918 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528379.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 427232..428062 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 428107..428376 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ES0 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene acyP CDS complement(428440..429534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(429860..431125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(431188..432297) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(432371..433729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(434004..436142) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(436204..437415) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 438037..438258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 438438..439145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 439193..440509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 440629..443322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 443349..444392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(444497..444928) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(445134..446573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(446681..449332) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene ppc CDS complement(449498..451393) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(451713..452330) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(452807..453970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(453973..454140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(454161..455036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 455204..457309 product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene mnmC CDS 457358..457747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(457744..458277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(458391..459323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(459313..460140) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(460137..461249) product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 461644..463776 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(463820..464062) product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNW8 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(464152..465030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(465068..465664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704659.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(465648..466364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(466354..468396) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL9 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene ligA CDS complement(468538..469713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(469840..473340) product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene smc CDS 473786..474637 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL6 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene cysZ CDS complement(474727..475380) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(475719..475892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 475874..479692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(479743..480093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(480340..480783) product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene ccmE CDS complement(480780..480986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(480998..481741) product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene ccmC CDS complement(481767..482468) product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI32 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene ccmB CDS complement(482465..483208) product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD58 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene ccmA CDS 483403..484161 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 484340..486649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 486656..487021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(487018..487467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 487907..488509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 488543..489487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 489585..490640 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 490689..493409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(493465..494952) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene gltD CDS complement(494971..499578) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882068.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(500224..500556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(501288..502184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458844.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(502272..502823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(502966..503685) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(503795..505093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(505432..506247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 506442..507065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(507187..508095) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405562.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(508330..511443) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene acrB CDS complement(511449..512654) product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(512678..513259) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(513469..513870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37496 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene yybH CDS 514206..515147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(515302..515724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(516024..516491) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RM9 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(516539..517147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021157.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(517540..518394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(518459..521365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(521614..522231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(522278..523564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(523601..524203) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(524232..525032) product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94549 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene fadB CDS complement(525240..525815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(525847..526758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 526981..527847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(527967..528911) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S040 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene rho CDS 529382..531172 product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(531161..531505) product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406715.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(531654..532613) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(532610..533074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702426.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(533130..534104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(534250..534882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(535251..536681) product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702784.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(536751..537092) product putative ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702785.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 537260..538309 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene oruR CDS complement(538529..538819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(538936..539358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(539425..540282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(540234..540704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(540785..542311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(542338..542883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(542998..543603) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(543738..544985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 545455..546282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(546366..547727) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(547738..549030) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(549033..550301) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(550369..551529) product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(551862..552428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 552730..553587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(553749..555053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(555918..557132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(557286..558320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(558332..559408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 559437..559664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(559759..561231) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(561250..561717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(562021..562629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 562753..564270 product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 564667..565602 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 565644..567161 product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene hapE CDS complement(567247..567477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(567540..568076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 568214..569302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 569277..569792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 570039..570926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 570923..572353 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 572334..572756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 572800..574026 product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 574023..575669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 575822..576862 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(576953..577582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(577788..579104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(579163..579741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(579848..580159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(580483..580998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(581529..581942) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(582022..582333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(582399..583580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(583648..584445) product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(584681..585319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(585375..585731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(585882..586622) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(586752..587714) product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene yrbG CDS complement(587800..588780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(588959..589888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(589971..590330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(590327..590536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(590738..591139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(592003..592191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 note possible pseudo, internal stop codon CDS complement(592286..592573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(592802..593377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(593501..593926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(594151..594798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 note possible pseudo, frameshifted CDS 595338..595784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 595895..596650 product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530221.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(597143..597535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 597683..598225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(598547..598945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 599015..599614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(599750..600352) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 600494..600787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(601283..601603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(602115..602654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(602806..603339) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(603444..603791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(603730..603942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(604363..604809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(604933..605574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(606192..606545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(606603..606791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(606904..607377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(607467..608276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(608473..609183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(609429..609929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(610095..610925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(611144..612082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 sequence05 source 1..555497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..3323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 3385..4626 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene cph2 CDS 4801..6009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 6112..6927 product NAD-dependent protein deacylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene cobB2 CDS complement(6962..7492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(7782..8987) product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(9043..9756) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(9760..9975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(9986..12364) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(12576..13085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261907.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(13115..14560) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(14676..15557) product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS22 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(15554..15745) product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(15749..16363) product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene ccoO1 CDS complement(16375..17805) product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene ccoN2 CDS 18220..18558 product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene glnK CDS 18604..19920 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500B0 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 20366..20758 product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 20936..21787 product putative dehydrogenase/dehydratase, MaoC family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 21916..22971 product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCB8 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene rlmM CDS complement(23118..23414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 23730..24827 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene ampG4 CDS 24870..25118 product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3F3 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene tusA CDS complement(25208..25903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 26331..26867 product transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 26956..27411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 27411..28091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 28088..28603 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZY5 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene greB CDS 28671..29363 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 29357..30418 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene apbE CDS 30539..33034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 33275..35131 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1J9 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene ftsH CDS 35180..37600 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(37609..39168) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705467.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 39650..40174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 40181..41797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 41832..43508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(43617..44072) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDN4 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene dut CDS 44317..45093 product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(45059..47224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(47235..48047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(48116..48676) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(48720..49634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(49631..50134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(50131..50658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(50685..51380) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(51593..51937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(51937..53091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(53078..56461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 56886..57680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 note possible pseudo, frameshifted CDS 57726..58619 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 58642..59793 product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W9 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene pdxB CDS complement(59847..60044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 60458..61576 product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(61660..62544) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC4 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene htpX CDS 62651..63562 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(63531..63962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(63972..65195) product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314686.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 65376..65792 product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM0 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene msrB CDS complement(65756..65992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 66270..66755 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I017 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 66801..67295 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918799.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(67404..68180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 tRNA 68425..68500 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 68783..71113 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene ladS CDS complement(71139..72272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 72472..74445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 75015..75839 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15493 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene lipA CDS 76184..78340 product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 78306..79073 product ribonucleotide reductase system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 79264..80103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 80213..81691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 81817..83505 product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 83581..85377 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene atmA CDS 85617..87473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(87583..88605) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene oruR CDS 88970..90559 product putative ABC transporter ATP-binding protein YbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9U3 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene ybiT CDS complement(90577..92670) product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(92862..93881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(94163..95761) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MII8 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(95944..97251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 97607..99232 product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 99351..101084 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57321 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene ilvI CDS complement(101081..102109) product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene oruR CDS 102447..103358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 103724..108166 product magnesium chelatase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875990.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 108188..108718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 108718..109014 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(109069..109716) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene hmgA CDS complement(109704..110690) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene fahA CDS complement(110687..111859) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene hmgA CDS complement(111856..112938) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(113230..114504) product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(114985..115695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 115694..115909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(116086..117714) product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72151 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene fliC CDS complement(118102..120279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(120316..122487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 123020..124435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 124632..125210 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQM0 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(125218..125643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(125808..126302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 126758..127993 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920947.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 128018..129217 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene fadA CDS 129236..130216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 130308..131114 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 131124..132233 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192972.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 132251..133804 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(133812..135173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 135301..135522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(135464..136618) product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955540.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(136709..138037) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS95 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene rimO CDS 138655..140493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(140611..141132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(142674..143672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 144730..178881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 178935..179804 product foldase protein PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJ34 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene prsA CDS 179805..180698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 180711..186674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 186708..193466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 193478..194374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 194364..194765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(194795..195253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 195270..198476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 198473..199504 product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X574 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene xerD CDS 199501..199779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 199776..200144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 200770..200997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 201096..201299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 201405..205619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 205622..206416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 206447..206911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(206954..207676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(208410..209315) product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(209690..211330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 211731..212426 product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94548 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene fadR CDS 212447..213595 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088351.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 213656..214804 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207707.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(214825..216534) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 216853..218142 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene ndh CDS 218253..219713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 219969..220973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 221052..222107 product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene hpnA tRNA 222164..222239 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(222328..222549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(222729..223634) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(223636..226002) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(225995..226741) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105801.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 226977..227636 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene gpmA CDS 227865..228776 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 228781..229554 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP13 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 229640..230467 product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWV5 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene queF CDS complement(230587..234486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 234826..235557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 note possible pseudo, frameshifted CDS 235469..236050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 note possible pseudo, frameshifted CDS complement(236055..237557) product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(237570..238970) product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene cyaB CDS complement(239191..239910) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2H9 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene nfi CDS 240239..240802 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(240799..240984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(241141..241974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 242841..243332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 note possible pseudo, internal stop codon, frameshifted CDS 243362..244162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 244264..244683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 244696..245100 product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262786.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene csgF CDS 245112..246194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(246240..247565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(247735..250032) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene ladS CDS 250314..251384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 251867..252943 product 2,3-dihydroxybiphenyl 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 252963..253934 product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224790.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene mhpD CDS 254000..255766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 255769..257490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 257641..259197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 259306..259962 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014162.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 259990..260664 product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 260839..261948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(261950..262261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 262643..263323 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263107.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 263326..265641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 265641..268994 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 269112..269909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 270103..270504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 270642..270992 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881362.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 271085..271711 product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene hlY-III CDS 271776..272252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 272310..273506 product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG33 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene nhaA CDS complement(273594..275291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(275415..276815) product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(277387..277962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 278140..279261 product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(279352..280044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(280468..283578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 283737..285407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 285502..287079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 287072..290305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(290329..293673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(293692..295410) product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454701.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 296570..297778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 297864..300125 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 300155..300895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 300892..303384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 303394..304326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 304348..307038 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 307234..308133 product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261497.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene ybfF CDS 308552..311323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 311570..313828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(313839..314324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 314644..315606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 315606..316199 product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene pilE CDS 316399..316647 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070492.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 316714..317196 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 317317..317937 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene fklB CDS 317952..318347 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 318352..318621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 318707..320476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(320560..321312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(321382..323541) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene recQ CDS complement(323550..323912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(323923..324471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 324674..325351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(325381..326751) product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(326772..327359) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 327550..328752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(328855..330684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 331066..332118 product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene oruR CDS complement(332208..332522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 332903..334885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 334967..335371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 335593..337302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(337424..338920) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 339206..339829 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 339881..340297 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730854.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 340291..342561 product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS8 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene tmcA CDS complement(342579..342959) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(342974..343669) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022244.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(343706..344545) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UEN7 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(344561..344836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869489.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 344938..345795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 345870..348308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 348410..350551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(350678..351115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(351138..353360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(353522..354451) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535091.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 354657..355826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 355823..356485 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 356498..357181 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 357191..358282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(358312..359172) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 359591..359845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263313.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 359854..360549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(360567..361439) product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085900.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(361445..362992) product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QK7 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(363004..363477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 363476..364636 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 364930..365130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(365276..366088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 366319..367173 product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 367219..367695 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218702.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(367743..370367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 370506..371525 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(371558..374308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(374380..376050) product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X3 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene aarF CDS 376258..377385 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 377500..378315 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 378406..378801 product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene zntR CDS 379188..380243 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 380294..381472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(381556..382719) product porin P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05695 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene oprP CDS 382830..383603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(383711..386011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(386193..386597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(386794..388362) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(388369..389967) product FAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(389970..391568) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 391716..392744 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 392822..394321 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083637.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 394458..394760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 394876..395172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066895.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(395285..397237) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene fadH1 CDS 397236..397517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 397486..398145 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene msrA CDS 398287..400992 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKV9 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene malT CDS complement(401146..402225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 402673..403707 product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(403771..404553) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(404583..405365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(405549..406118) product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 406963..407712 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene etfB CDS 407712..408641 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene etfA-2 CDS 408939..411449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 411894..412904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 413086..414459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 414456..415094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 415436..415918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 415911..417449 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 417526..419337 product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(419349..419693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 419807..420268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(420371..422272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(422751..424484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(424847..426364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 427313..435967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 436400..448954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 448951..458181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 458294..460072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 460334..471832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 472141..473373 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 473387..474565 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(474648..475838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 476410..489624 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103865.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene pvsA CDS 489691..490959 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene ectB CDS 491101..492438 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680701.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 492718..493554 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 493856..495547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 495544..498900 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 498994..500094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(500154..501119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 501589..501870 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 501901..503604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 503702..504514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 504517..505236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 505282..505530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 505549..506355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 506410..507738 product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531963.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 507759..509456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 509447..510340 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812713.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 510333..511292 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 511294..511638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 511698..513224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 513229..513759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 513795..514430 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS 514490..515212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(515267..516547) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene gltA CDS 517221..517607 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene sdhC CDS 517601..517969 product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUX3 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 517973..519745 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D5 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene sdhA CDS 519758..520465 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316554.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene sdhB CDS 520796..523633 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene sucA CDS 523671..524927 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene sucB CDS 524976..526418 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene lpdG CDS 526651..527814 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJK9 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene sucC CDS 527816..528688 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN7 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene sucD CDS complement(528760..531159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(531159..531662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(531990..532532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 532735..534084 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(534140..534832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947331.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(534846..535274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 535699..536175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 536190..537323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(537402..538946) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MII8 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(538962..539384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(539381..540823) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(540839..542032) product amino acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373777.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(542134..542994) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 543130..543840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 543876..544355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 544352..544783 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(544786..545430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(545434..546855) product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(546892..547668) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 548031..549956 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3C5 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene htpG CDS 550125..550448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 550608..551651 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A8 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene gpsA CDS 551697..551981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 551997..552464 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene sixA CDS 552634..554361 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 554468..555352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972447.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 sequence06 source 1..518315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 678..1688 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(1685..2890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(3355..4086) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK7 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene rsmE CDS complement(4156..5508) product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I693 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene bioA CDS complement(5624..6484) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V72 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene metF CDS complement(6586..7974) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ92 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene ahcY CDS complement(8031..9191) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene metK CDS complement(9208..10209) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(10320..13133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 13435..15432 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene tktA tRNA 13535..13625 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 15432..16466 product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene epD CDS 16543..17709 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y4 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene pgk CDS 17747..18811 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene fba CDS 18954..19922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 19976..20674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(20671..21507) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 21687..22343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(22418..23647) product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382085.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene serA CDS 23852..25246 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 25246..25908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 26229..28169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 28201..28671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 28713..29786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 29801..31234 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079285.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(31244..31504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(31534..32148) product cytochrome C oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(32248..32910) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UK7 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene rpiA CDS 33038..34567 product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene ilvA1 CDS complement(35330..35965) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LM0 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(36192..36506) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTW3 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene zapA CDS complement(36503..36718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 36877..37596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 37604..38956 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene pepP CDS 39051..40361 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene ubiH CDS 40358..41602 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 41785..42126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 42252..43616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 43882..44967 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX5 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene gcvT CDS 45059..45457 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene gcvH CDS 45588..46949 product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ95 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene gcvPA CDS 46959..48422 product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ97 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene gcvPB CDS complement(48541..49428) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 49546..50754 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 50988..51842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(51848..52930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(52927..53586) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 53739..56267 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QF8 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene hypF CDS 56277..56525 product hydrogenase assembly protein HupF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene hypC CDS 56528..57670 product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQJ7 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene hypD CDS 57657..58694 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703266.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 58709..59056 product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene hypA CDS 59225..60097 product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene hypB CDS 60317..60811 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene rppH CDS 60943..63276 product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene ptsP CDS complement(63292..64119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 64427..65215 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene lgt CDS 65301..66134 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDS3 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene thyA CDS 66145..66654 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7Z3 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene folA CDS 66647..69505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 69517..70257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(70396..71472) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(71742..72092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(72300..72665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 72983..76234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(76275..76637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(76684..78747) product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(78752..79447) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 79636..82095 product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 82095..82703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 82806..83291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(83331..83927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(84047..84229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(84295..85611) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(85780..87156) product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22567 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene argA CDS complement(87208..90363) product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGC8 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 90590..92395 product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene xcpR CDS 92504..92686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(92805..93389) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101303.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 93539..94147 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 94167..94835 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 94966..96108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 96327..96926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(96891..97850) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene appY CDS 98309..99163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 99228..100883 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 101094..102596 product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R086 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 102732..104165 product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 104180..105013 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 105145..106635 product UPF0061 protein R00982 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RB2 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 106816..108066 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230085.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 108068..109801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 109915..112908 product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ33 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene glnE CDS 112948..113166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 113380..114831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 114846..115865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 115852..117543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 117750..119792 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103757.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 120090..121628 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(121638..121910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(121938..122522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268478.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(122519..123586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268479.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 124096..125016 product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene ilvE CDS 125035..126084 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266459.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 126091..127158 product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 127551..128087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 128078..128683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768758.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(128824..130620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(130655..131803) product UDP-glucose--(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene waaG CDS complement(132024..132710) product peptide aspartate b-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948165.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(132747..133493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 133737..134342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(134359..135525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206813.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 135713..136702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 136820..138262 product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VF4 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene hldE CDS 138262..140118 product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene msbA CDS complement(140128..141093) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 141413..143950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(143971..144771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(144771..145982) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105257.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 146088..147383 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175941.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene kdtA CDS 147558..149435 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ2 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene thiC CDS 149623..150249 product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707476.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 150251..150742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 150901..151716 product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ03 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene cpdA CDS 151863..152387 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817214.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 152406..154298 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene parE CDS 154446..154721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 154984..156201 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81H80 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(156233..156913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(158070..159182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(159193..164721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970454.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(164721..165578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(165686..167668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 168264..168653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 168727..168999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 169134..170372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(170680..171033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(171210..171689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 172390..173022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 173257..174579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640087.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(174828..175310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(175310..175666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(175840..176154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(176167..179430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 179341..179643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 179745..180191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 180442..182199 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 182392..183717 product hypothetical cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 183724..184554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(184608..184868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(185006..186010) product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJ72 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rlmF CDS complement(186125..187069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(187066..187953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(187957..190017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(190167..191270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(191671..193161) product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228753.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(193227..194237) product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene hpnA CDS 194385..195026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 195063..196004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(196159..197430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(197618..198076) product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 198343..201441 product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 gene pflD CDS 201445..202362 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 202503..204602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 204801..205310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(205440..206411) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704948.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 206536..206844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(206934..207875) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086953.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 208017..208310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 208397..209857 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209480.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 209854..210048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 210147..210773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(210800..211243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(211432..212592) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 212794..213552 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 213559..215835 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 215832..216356 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 216509..217732 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 218330..220096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(220193..221794) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLT4 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 222008..222208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 222420..222989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 223081..223710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(223882..224757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(224764..225666) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(225663..227156) product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKB5 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(227328..228254) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(228426..229844) product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGS2 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(230049..230873) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(230880..231839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(231820..233295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 233406..236348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 236402..237682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(237720..238304) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261513.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 238426..239061 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 239111..239587 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0C0 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(239610..241706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(241940..243352) product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKB5 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 243749..244525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(244737..244982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 245159..245944 product transcriptional regulator of eicosapentaenoic acid synthesis PfaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071760.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene pfaR CDS 246107..253045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 note possible pseudo, frameshifted CDS 253138..253935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 note possible pseudo, frameshifted CDS 253932..256484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 256477..263958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 263959..265611 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene pfaD CDS 265876..266613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 266836..267369 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene pilE CDS 267576..268106 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene pilE CDS complement(268209..269120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 269238..270143 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(270262..270840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 270996..271835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI89 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(271869..273311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(273393..273746) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 274035..274157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 274237..274368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(274489..275106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(275145..276437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(276449..277342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(277376..279976) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 280322..281539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230416.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 281625..282440 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(282541..282855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 283237..284469 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 284466..284762 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSF1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene glpE CDS 284799..285200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(285272..287242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(287449..288024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(288177..289559) product Na+/H+ antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 290285..291472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 291647..292738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(292766..293722) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(293746..294945) product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704422.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 295055..295708 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 295764..296597 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene ephD CDS complement(296637..297689) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661226.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 297918..298535 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM60 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene fabR CDS complement(298553..300094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(300075..300941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 301076..302362 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF20 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene lamB CDS 302638..304215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(304272..305579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(305719..305988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 305972..306121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 306851..309667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 309664..311472 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(311481..311906) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969131.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(311928..312827) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(312838..313689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 314132..314680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(314677..316365) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(316745..318466) product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(318450..318722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708739.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(318769..320250) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118365.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(320247..321758) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(321755..322111) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(322119..322559) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(322556..323122) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328224.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(323152..323454) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(323461..323742) product pH regulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(323745..324215) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 324599..324895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(324906..326075) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene cph2 CDS 326308..326748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 326938..328116 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918664.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(328174..330204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(330309..331472) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098203.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 331719..332339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(332380..332964) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 333151..334005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(334033..336840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 337524..338165 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 338174..339553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 339626..340342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 340354..340974 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 341070..341501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(341533..342465) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMP9 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene rdgC CDS 342540..343469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(343566..344963) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene pntB CDS complement(344976..345260) product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(345253..346422) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene pntA CDS 346725..348278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 348488..349381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 349422..350057 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45273 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene ribE CDS 350285..351658 product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67207 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 352117..358785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 358782..359924 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 359927..360712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 360722..362824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 362814..363845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 363874..365478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 365471..366163 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 366399..368390 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene ladS CDS 368387..369121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(369158..371059) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 371155..372447 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 372573..373358 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene ygdL CDS 373366..374130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(374142..375200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(375272..375961) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVA1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 376103..376711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(376974..378692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(379328..380110) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(380120..380644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(380654..381829) product putative lipid transfer protein or keto acyl-CoA thiolase Ltp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701370.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(381829..382275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701369.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(382289..383248) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(383604..384851) product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 385150..385470 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(385605..387077) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(387219..387863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(388528..390141) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene caiC CDS 390580..392298 product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 392331..393179 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene yneD CDS 393306..394481 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 394512..395663 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(395729..396547) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(396553..397833) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106432.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(397903..398967) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(398970..399869) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(399869..400690) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088703.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(401058..401378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 401689..403911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 403934..404866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 404866..405951 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 406044..406589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 406640..408127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 408199..408960 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene speA CDS complement(409127..411526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(411822..412307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(412393..414108) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072065.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 414325..416127 product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 416204..416974 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene fabG CDS 417189..417944 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709509.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 418082..418489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(418615..418968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701948.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 419351..420457 product putative oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700834.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 420550..421002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 421031..421909 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 421996..422760 product putative steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703552.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(422841..423335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(423328..424350) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(424621..425643) product retinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402797.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(425869..427128) product putative sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704696.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(427145..428392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(428389..429060) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MT8 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene cysC CDS 429381..430022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 430054..431595 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 431617..432195 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730078.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(432290..432880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(432944..433600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(433839..434588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(434769..436847) product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS complement(436947..438026) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(438246..439664) product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 439936..440439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(440526..441926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 442415..443584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(443656..445947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(446158..446811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 446929..448320 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888358.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 448388..449020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(449121..450626) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(450680..451177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(451501..452724) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(452832..453677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(453682..454296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(454340..456025) product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701956.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 456225..456803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 456921..458633 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887524.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 458671..460332 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKK9 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 460507..461526 product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene oruR CDS 461650..462819 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888P7 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 462954..463640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 463713..464765 product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035475.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene cdh CDS 464783..465766 product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene hpnA CDS 465898..466251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 466255..466734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(466920..467486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(468251..468838) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313946.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene ybcL CDS complement(468977..469699) product tRNA pseudouridine synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943781.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene truC CDS complement(469726..470529) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879821.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(470565..471203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 471430..473829 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 473976..475211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(475287..476249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(476517..478778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(478961..480910) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(481225..482259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(482327..483340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(483830..485068) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(485115..485894) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(485900..486901) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene adiY CDS 487474..488637 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 488680..489765 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 489874..491412 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266601.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 491574..493172 product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 493218..494042 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887263.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 494042..496075 product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555739.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 496139..497281 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 497371..498159 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897328.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 498297..499238 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(499674..499841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(499907..501010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 501736..501993 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8M1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 501981..502298 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(502388..503548) product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(503585..504565) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene cmaX CDS 504798..505385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(505491..505970) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene slyD CDS complement(506216..506569) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477812.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(506605..507504) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AQ99 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene dapD CDS complement(507706..508395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(508614..509999) product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene dbpA CDS complement(510129..510335) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(510581..511384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(511487..512416) product polyhydroxybutyrate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 512718..513749 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550651.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 513789..514163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 514203..514574 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(514610..514858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(514905..515237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(515289..515858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(515896..516297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(516342..516554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 516799..517494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085279.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(517605..518018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 sequence07 source 1..432527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..696 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106475.1:IS30 family transposase locus_tag LOCUS_38770 CDS complement(693..1445) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477515.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 1572..2339 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 2970..3515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 3587..3910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 4011..4625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 4711..5136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 5403..5807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 5895..6161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 6176..6679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(6697..7734) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene oruR CDS 7851..10868 product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878946.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(10948..11514) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642469.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(11635..12363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101171.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(12735..13742) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene adiY CDS 13981..16290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(16364..17410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 17656..19437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(19485..20165) product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X2 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(20299..22533) product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 22810..23310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 23357..24145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 24145..24978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 24978..26426 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263604.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 26423..26851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 26851..27255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 27267..27917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 27919..29346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 29336..29905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071418.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(29913..32363) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene ladS CDS complement(32472..34730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 34915..35682 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708364.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 35811..38018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 38036..41044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(41172..41603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(42025..43683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 44714..45085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071262.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(45235..46539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 46695..46817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 46807..47259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 47659..49089 product insulin-cleaving metalloproteinase outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112765.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene icmP CDS 49143..50633 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104986.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 50645..51730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102644.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 51732..52889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261813.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 53058..53591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 53794..55518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(55620..57212) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene rtcR CDS 57514..58740 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVK1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene rtcB CDS 58867..59910 product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58127 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene rtcA CDS 60767..61666 product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920253.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 61747..63042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 63032..63256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 63253..64197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 64502..65218 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 65329..66015 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(66123..66329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(66396..66596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 67189..68142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(68250..68732) product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 69065..70699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 71022..72059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(72250..74673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(74730..75332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(75633..76670) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932944.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(76704..76886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(76919..77665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(77662..79065) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(79213..79941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(80075..81202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 81485..82798 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIR0 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene glgC CDS 82831..86733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(86900..87292) product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708393.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 87624..91919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 92044..92694 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(92805..93689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(93949..95034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(95130..95336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 95776..99102 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 99108..100373 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIR0 transl_table 11 codon_start 1 locus_tag LOCUS_39550 gene glgC CDS 100363..102258 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX35 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 102255..107339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 107336..109309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS 109543..112779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS 112836..113645 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108234.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS 113700..114098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(114344..119524) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 tRNA complement(119724..119810) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 120038..121162 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(121239..122585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(122726..123976) product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene yfeW CDS 124165..125196 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(125253..125456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 125857..128415 product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG52 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(128432..130768) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene ladS CDS 131235..132002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 132249..133109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(133118..134176) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021661.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(134218..134850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(134886..135503) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925186.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(135516..135947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(135956..137440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 137741..138388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872644.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(138444..139823) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS complement(139845..141536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(141514..142791) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene glgC CDS 143174..145369 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR72 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene glgB CDS 145371..146846 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHN2 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene glgA CDS 146903..148783 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037137.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(148815..149906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(150197..151378) product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene agxT CDS complement(151554..153539) product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(153543..155597) product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072001.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene liuD CDS complement(155616..156428) product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072002.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene liuC CDS complement(156435..158042) product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762555.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(158082..159251) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene liuA CDS complement(159248..159661) product liu genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene liuR CDS 160056..162392 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 162477..163289 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 163444..164850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 165031..167298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 167403..168200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 168197..168685 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W7 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(168703..170013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(170289..171269) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 transl_table 11 codon_start 1 locus_tag LOCUS_39990 gene mdh CDS 171497..172642 product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(172678..172986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 173234..173551 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene bolA CDS 173673..174248 product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073380.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 174241..175188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(175203..175622) product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ01 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(175681..176670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 176889..177590 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 177705..178502 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene cysE CDS 178757..179866 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893450.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 179885..181090 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 181235..184297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(184406..184681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 184864..185814 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PG9 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene ttcA CDS 185851..187080 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 187202..188167 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 gene nahR CDS complement(188270..190996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 191448..193349 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(193412..194104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(194307..196481) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene glcB CDS complement(196649..197458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS complement(197512..198033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(198187..198669) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(198713..199897) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(199894..201261) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI51 transl_table 11 codon_start 1 locus_tag LOCUS_40240 gene purB CDS complement(201349..201990) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene hflD CDS complement(202000..203112) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK0 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene mnmA CDS complement(203109..203624) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(203859..204590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 204773..205249 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXJ9 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene moaC CDS 205286..205534 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH70 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene moaD CDS 205527..205994 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191688.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene moaE CDS complement(206104..206829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(206851..207030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 206947..208209 product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene icd CDS complement(208440..208736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 209008..209379 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene clpS CDS 209419..211686 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene clpA CDS complement(211850..212068) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK8 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene infA CDS complement(212224..214953) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS complement(215139..215846) product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS3 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene ate CDS complement(216024..216800) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene aat CDS complement(216911..217864) product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q99 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 218001..219068 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 219196..221583 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M3 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene ftsK CDS 221713..222375 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3U0 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene lolA CDS 222419..223825 product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 223938..224321 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene crcB CDS 224418..225701 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene serS CDS 225729..227114 product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL6 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene cysG CDS 227310..228950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 228925..229755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(229763..230779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(230813..231151) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0N0 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(231177..231449) product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene dsrH CDS complement(231452..231811) product protein TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJB7 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene tusC CDS complement(231813..232202) product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NDV3 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene tusD CDS complement(232265..232939) product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 tRNA complement(233152..233241) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(233312..234871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 235129..235785 product response regulator GacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52376 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene gacA CDS 235796..237631 product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X7 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene uvrC CDS 237673..238251 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene pgsA tRNA 238371..238446 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 238542..238615 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 238655..238741 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 239756..240877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 241468..242595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 242843..243550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(243609..245117) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(246175..247146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(247176..248060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 248271..248537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(248456..250354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 250678..251778 product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene des6 CDS 252577..254175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 254505..254936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 254944..255294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(255377..256417) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene adiY CDS 256830..258821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(258959..259906) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene appY CDS 260333..261172 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 261231..262151 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069734.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(262166..262465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(262467..264266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(264649..266313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 266389..267216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 267476..269203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 269341..270384 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(270406..271431) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS complement(271437..272570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(272574..274571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 274871..276523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 276535..277479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(277571..279778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 280299..280718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 note possible pseudo, frameshifted CDS complement(280872..282074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 282401..283048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 283590..285023 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 285099..286532 product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene putP CDS complement(286543..287832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(287829..289532) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 gene hscC CDS 289951..291081 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 291119..294235 product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 294294..295661 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 295727..297127 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 297124..298299 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 298296..299015 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(299022..300314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(300394..301737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 302026..303309 product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071852.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(303412..304581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 304706..305206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 305359..306144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970721.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(306271..307038) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MK1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene ubiG CDS complement(307104..308513) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268469.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 308757..310406 product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057811.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(310518..311492) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 311733..312626 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 312747..313052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(313117..314586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(314586..317417) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 317858..318658 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 318788..319828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 319952..324163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(324160..324714) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 324852..326351 product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 326491..328146 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 328263..329285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404145.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 329309..330796 product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(330812..332170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(332314..334077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 334442..335290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 335303..336253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 336370..344007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 344023..344478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(344462..344782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 345254..345595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 345600..346538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(346577..347401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 348347..349174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 349318..349575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 350775..351137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 351104..351403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 351539..352234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 352323..352754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 352879..353787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 354127..354462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 354495..360692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 361104..362075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(362182..364764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(364767..365204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271117.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(365194..366456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882133.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS complement(366680..367357) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 367518..369140 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS complement(369158..370426) product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702676.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 370730..371698 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene acoA CDS 371713..372723 product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene acoB CDS 372725..373966 product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C893 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 374278..375735 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088017.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS 375820..376278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 376338..377006 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(377076..377990) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(378317..379072) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 379231..380271 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 380306..381562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(381653..382561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(382721..383290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(383380..383661) product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(383664..384434) product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(384437..385231) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(385669..386121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 386422..387375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 387410..388309 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMA9 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene rfbA CDS 388322..388870 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920703.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene rfbC CDS 388915..389808 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene rmlD CDS 389811..390887 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU24 transl_table 11 codon_start 1 locus_tag LOCUS_41720 gene rmlB CDS complement(390921..392198) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene wbpO CDS 392523..393935 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 394019..394633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS 394651..396189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 396199..396936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 396977..398254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 398336..399166 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 399240..400181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 400178..402004 product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 402130..403218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 403275..404744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 404752..405924 product phosphatidylinositol glycan-class A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 405921..406502 product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176631.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 406502..407233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 407861..408364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(408549..408833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS 409012..409896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(409849..410610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(411047..412708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120060.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(412741..414270) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940936.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(414286..415404) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(415425..417308) product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 417726..418718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 418906..420267 product capsular polysaccharide biosynthesis protein CapK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 420299..421249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(421284..422390) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(422452..423711) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(423838..426348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(426492..427883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS complement(428074..428847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(429135..431816) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(431922..432191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42040 sequence08 source 1..334776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 570..1001 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 1094..1816 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947453.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 1803..2684 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765844.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(2763..3230) product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(3445..4350) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877313.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(4501..6525) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428541.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene mcm2 CDS complement(6544..7731) product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161599.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(7824..9491) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene caiA CDS complement(9541..10980) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(11377..12198) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 12475..13374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 13736..14716 product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884P8 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene prmB CDS 14919..16016 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3U6 transl_table 11 codon_start 1 locus_tag LOCUS_42170 gene aroC CDS 16035..17222 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 17280..17897 product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC0 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene mtnB CDS 17911..18465 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I341 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene mtnD CDS 18476..19162 product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQ36 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene mtnC CDS 19164..19571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(19663..20538) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS 20685..22097 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene leuC CDS 22097..22744 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 transl_table 11 codon_start 1 locus_tag LOCUS_42250 gene leuD CDS 22788..23867 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUZ4 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene leuB CDS 23893..24915 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR3 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene asd CDS 25177..28170 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267157.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 28277..29092 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87016 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene truA CDS 29161..29781 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59649 transl_table 11 codon_start 1 locus_tag LOCUS_42300 gene trpF CDS 29774..30988 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 transl_table 11 codon_start 1 locus_tag LOCUS_42310 gene trpB CDS 31013..31813 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 transl_table 11 codon_start 1 locus_tag LOCUS_42320 gene trpA CDS 31834..32706 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 transl_table 11 codon_start 1 locus_tag LOCUS_42330 gene accD CDS 32746..34104 product bifunctional protein FolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL78 transl_table 11 codon_start 1 locus_tag LOCUS_42340 gene folC CDS 34089..34781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147893.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 34886..35404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 35430..36953 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene purF CDS 36965..38161 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene metZ CDS complement(38213..38401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS 38509..39444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS 39769..40410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 40932..42446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 42583..43545 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 43548..44975 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 44978..46285 product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS 46312..47052 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(47117..49702) product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V5 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene acnB CDS complement(50043..50927) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 51045..51671 product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene miaE CDS complement(51761..52486) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YP9 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene lpxH CDS complement(52493..53002) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene ppiB CDS complement(53112..53966) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene folD tRNA 54162..54238 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 54282..54358 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 54446..54521 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 54643..55956 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM8 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene tig CDS 56203..56841 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM7 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene clpP CDS 56963..58267 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene clpX CDS complement(58243..58479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS 58465..60873 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T9 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene lon CDS 61186..61461 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 transl_table 11 codon_start 1 locus_tag LOCUS_42580 gene hupB tRNA 61556..61632 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 61800..63683 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2T8 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene ppiD CDS complement(63751..64542) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(64685..66283) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087940.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(66283..67308) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS complement(67314..68399) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(68410..70230) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(70290..72200) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS 72461..74188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(74193..75884) product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(75961..76743) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YS8 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene gloB CDS 77790..78503 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene dnaQ CDS 78841..80538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene fimL CDS 80586..81413 product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 81432..82082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 82196..83245 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402788.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 83305..84309 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(84314..85480) product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 85386..85577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(85637..86134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(86127..87779) product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene cysI CDS complement(88009..88239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 88486..89082 product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene nfuA CDS complement(89268..90341) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y7 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 90556..91473 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(91450..91875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 92148..92666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(92712..93419) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNM0 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 93667..94638 product CysB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene cysB CDS complement(94782..95117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(95134..95862) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene cysH CDS 96104..96721 product phosphoserine phosphatase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Y2 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene thrH CDS complement(96758..98149) product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211081.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene pabB CDS complement(98207..99025) product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q9 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 99279..101654 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2W9 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene ppsA CDS 101885..102799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 102975..105425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(105491..107929) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene ladS CDS complement(108074..108307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 108465..109496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 109650..111515 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 112234..113121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 113442..114905 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894508.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS 115222..117891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 117998..118513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 118510..119124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(119269..119550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 119898..122579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS 122717..124318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(124363..127875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS 128292..128864 product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ6 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene ectA CDS 128861..130168 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 gene ectB CDS complement(130303..131982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 132180..133001 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104307.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene modA CDS 133001..133681 product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene modC CDS 133724..134821 product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4U7 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene modD CDS complement(134834..135874) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 136220..137080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(137148..137672) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(137850..140081) product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene idh CDS complement(140469..143132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(143669..144880) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070878.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(144906..145931) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 transl_table 11 codon_start 1 locus_tag LOCUS_43200 gene gapA CDS 146614..147468 product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390563.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 147502..148287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(148374..149474) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(149588..150730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS 150966..152087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(152231..152914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(153143..153868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(154027..155118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(155225..155932) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(155976..157082) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(157273..158583) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS complement(158636..159442) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 159563..160366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 160363..161175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 161389..162147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551753.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 162144..164543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205575.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS 164543..165214 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064407.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 165297..166073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(166137..167267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(167562..168539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(168972..169751) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 gene znuB CDS complement(169748..170644) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070905.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene znuA CDS complement(170657..171961) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(172673..173242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894486.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(173270..175666) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(175663..177966) product putative squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55348 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene shc CDS complement(178349..181480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(182055..183269) product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 transl_table 11 codon_start 1 locus_tag LOCUS_43480 gene rimK CDS 183686..185491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 185647..187635 product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 187821..188678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 188682..194987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 195059..197932 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117769.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 197969..199759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 199916..202126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 202263..202490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(202692..203549) product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS complement(203566..205053) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(205288..205914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 206020..206928 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 207034..207279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(208201..209220) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 209445..209609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(209658..210983) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(210967..211821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(211808..212635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 212823..212942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(212939..214288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 214287..214469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(214502..214870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(214900..215886) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 216021..216761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS 216886..218889 product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E216 transl_table 11 codon_start 1 locus_tag LOCUS_43730 gene btuB CDS complement(219186..220148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(220604..221371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(221368..222402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(222454..224295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS 224537..225226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(225418..226407) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731363.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS complement(226677..227912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(227972..228646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(228643..229344) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(229341..229943) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 230248..230619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 230965..231243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073474.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 231302..232321 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NF75 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene gapA CDS complement(232497..233543) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 gene oruR CDS 233763..234254 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731118.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 234272..234781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 235008..236471 product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 236525..237979 product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 237995..239035 product putative lipase/esterase LipN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704000.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 239028..239810 product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704675.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 239833..240516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 240529..242277 product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene atuH CDS 242292..243542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230416.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 243559..244965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(245288..246007) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120197.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS 246100..247035 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120198.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 gene ephA CDS complement(247095..247973) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 248086..249180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(249386..250693) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642921.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(252013..252243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 252580..253272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 253324..253992 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(254366..255526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS complement(255889..256221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 256671..257366 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 258028..258804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 258874..260022 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106295.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(260062..260247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 260337..261005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 261002..262960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 262971..263951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS 265040..265462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 266564..266944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 266941..268782 product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925242.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 gene pcoA CDS 268797..269564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 269625..269921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 270022..270573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 270615..270983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 271125..271970 product putative transcriptional regulator, AraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700820.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 272031..274196 product putative molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704598.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS 274852..275976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 275988..276533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 276619..277686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 277776..278138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS 278889..280319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS 280316..282100 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 282112..285237 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 gene cusA CDS 285389..286540 product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769406.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene clS CDS complement(286622..287089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 287578..288378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS 288390..288707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(289159..289590) product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968193.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(289645..292785) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 gene cusA CDS complement(292778..294088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(294081..295421) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(295544..296182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(296247..297635) product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660215.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene gltP CDS complement(297711..298508) product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED57 transl_table 11 codon_start 1 locus_tag LOCUS_44410 gene pflA CDS complement(298508..300790) product formate acetyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09373 transl_table 11 codon_start 1 locus_tag LOCUS_44420 gene pflB CDS complement(300793..301848) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(301867..302100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 303820..304230 product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 gene zntR CDS 304309..306624 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS 306654..307007 product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 307016..307375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 307362..307694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 307706..308356 product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 308367..308816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 308895..309257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS 309289..310800 product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 310797..311717 product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 311714..313069 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 313081..313539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS 313539..314306 product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 314322..315050 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 315050..317530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 317520..318677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 318724..319338 product LemA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705671.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 319338..320048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS 320048..320665 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381663.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 320713..321720 product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 321717..322676 product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51222 transl_table 11 codon_start 1 locus_tag LOCUS_44650 gene hflC CDS 322813..324072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 324187..325338 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963766.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 gene napA CDS 325382..325834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 325940..327193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948086.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 327221..327712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS 327822..328085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 328170..329510 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(329598..330224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(330217..330594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(330594..331283) product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064598.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS complement(331294..333879) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS complement(333900..334340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 sequence09 source 1..244721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1672..1980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(2095..3309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(3499..3663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 3821..6145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(6180..6983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS 7479..7844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(7841..8275) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 8489..9118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS complement(9252..10283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(10327..12666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS complement(12656..13069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS complement(13345..14046) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719783.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS 14293..14712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 14861..16192 product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS complement(16236..16832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS 16946..18076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS complement(18120..19304) product alcohol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 gene dhaT CDS complement(19307..19846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(20076..20369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(20400..21284) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(21284..23836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(23937..27308) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(27343..28275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(28272..29729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(29916..30098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 30093..32453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 32712..34316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 34571..35071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(35144..35935) product rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 gene rhlG CDS complement(35990..37108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS complement(37108..37797) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036039.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 gene vanR CDS complement(37907..39061) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 gene acadL CDS complement(39438..40652) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(40653..41309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 41566..42765 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810799.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 43061..43990 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810801.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 gene hmgL CDS 44197..44967 product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 44977..46332 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS 46345..46878 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS 46880..47290 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS 47287..47901 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZF0 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS 48071..49243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 49240..50211 product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267120.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS 50351..50989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 50989..51582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS 51672..53309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 53296..54003 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 54206..55162 product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 transl_table 11 codon_start 1 locus_tag LOCUS_45250 gene glyQ CDS 55175..57241 product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 transl_table 11 codon_start 1 locus_tag LOCUS_45260 gene glyS CDS 57242..57820 product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 transl_table 11 codon_start 1 locus_tag LOCUS_45270 gene gmhB CDS complement(57838..58098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 58117..58566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS complement(58753..61170) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 transl_table 11 codon_start 1 locus_tag LOCUS_45300 gene gyrB CDS complement(61217..62323) product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U5 transl_table 11 codon_start 1 locus_tag LOCUS_45310 gene recF CDS complement(62327..63430) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(63464..64843) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK3 transl_table 11 codon_start 1 locus_tag LOCUS_45330 gene dnaA CDS 65802..66188 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT05 transl_table 11 codon_start 1 locus_tag LOCUS_45340 gene rnpA CDS 66217..66468 product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q812M8 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS 66478..68172 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT06 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene yidC CDS 68262..69641 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVJ2 transl_table 11 codon_start 1 locus_tag LOCUS_45370 gene mnmE CDS 69776..71659 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT09 transl_table 11 codon_start 1 locus_tag LOCUS_45380 gene mnmG CDS 71675..72319 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTS5 transl_table 11 codon_start 1 locus_tag LOCUS_45390 gene rsmG CDS 72344..73138 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 gene parA CDS 73198..74091 product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 gene spoOJ CDS 74224..74676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 74829..75551 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 transl_table 11 codon_start 1 locus_tag LOCUS_45430 gene atpB CDS 75602..75841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS 75900..76370 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT16 transl_table 11 codon_start 1 locus_tag LOCUS_45450 gene atpF CDS 76382..76918 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL21 transl_table 11 codon_start 1 locus_tag LOCUS_45460 gene atpH CDS 76930..78471 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT18 transl_table 11 codon_start 1 locus_tag LOCUS_45470 gene atpA CDS 78531..79391 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 transl_table 11 codon_start 1 locus_tag LOCUS_45480 gene atpG CDS 79453..80850 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C0 transl_table 11 codon_start 1 locus_tag LOCUS_45490 gene atpD CDS 80871..81296 product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 transl_table 11 codon_start 1 locus_tag LOCUS_45500 gene atpC CDS 81429..82805 product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 transl_table 11 codon_start 1 locus_tag LOCUS_45510 gene glmU CDS 82824..84650 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT8 transl_table 11 codon_start 1 locus_tag LOCUS_45520 gene glmS CDS 84667..84888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(85012..86043) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS 86144..86860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS 86874..87710 product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702266.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 87818..89416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(89790..89990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS 90333..91442 product adenosine monophosphate-protein transferase SoFic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9K5 transl_table 11 codon_start 1 locus_tag LOCUS_45590 gene fic CDS complement(91738..92301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS complement(92314..99381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(99486..104669) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS complement(104669..107413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 107659..108798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(108816..111065) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(111157..112470) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(112460..112966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS complement(113016..114710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS complement(114732..115175) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS complement(115900..116316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS 116559..117854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS complement(117919..118422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS complement(118437..119999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS complement(120402..121763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS complement(121799..123784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS 124116..126266 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 transl_table 11 codon_start 1 locus_tag LOCUS_45760 gene uvrD CDS 126305..127459 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(127578..127976) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene yciA CDS complement(128121..129500) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS complement(129501..130073) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 130374..131375 product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 transl_table 11 codon_start 1 locus_tag LOCUS_45810 gene pstS CDS 131476..133740 product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS 133757..135418 product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 transl_table 11 codon_start 1 locus_tag LOCUS_45830 gene pstA CDS 135489..136373 product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 transl_table 11 codon_start 1 locus_tag LOCUS_45840 gene pstB CDS 136452..137186 product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51547 transl_table 11 codon_start 1 locus_tag LOCUS_45850 gene phoU CDS complement(137220..137819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 137978..138460 product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4S5 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(138457..139794) product phosphate regulon sensor protein PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23621 transl_table 11 codon_start 1 locus_tag LOCUS_45880 gene phoR CDS complement(139921..140610) product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 transl_table 11 codon_start 1 locus_tag LOCUS_45890 gene phoB CDS complement(140793..141470) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87U39 transl_table 11 codon_start 1 locus_tag LOCUS_45900 gene ubiA CDS complement(141807..142280) product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F94 transl_table 11 codon_start 1 locus_tag LOCUS_45910 gene ubiC CDS 142559..142723 product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLB6 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS 142766..143914 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 144107..144400 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTL0 transl_table 11 codon_start 1 locus_tag LOCUS_45940 gene hupA CDS 144397..144780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269382.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS 145118..145993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS complement(146076..147467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS complement(147598..148191) product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKW9 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS complement(148188..149759) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS complement(149770..151173) product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 151268..152542 product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6C1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 gene ftsY CDS 152556..153260 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 gene ftsE CDS 153257..154294 product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(154340..155506) product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 transl_table 11 codon_start 1 locus_tag LOCUS_46040 gene lifO CDS complement(155528..156355) product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478884.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(156327..156530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 156994..157848 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 transl_table 11 codon_start 1 locus_tag LOCUS_46070 gene rpoH CDS 157972..158340 product UPF0382 membrane protein YwdK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39619 transl_table 11 codon_start 1 locus_tag LOCUS_46080 gene ywdK CDS 158507..158719 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 gene thiS CDS 158806..159588 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6B4 transl_table 11 codon_start 1 locus_tag LOCUS_46100 gene thiG CDS 159599..160300 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 transl_table 11 codon_start 1 locus_tag LOCUS_46110 gene trmB CDS 160487..163501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS complement(163498..164751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS complement(164871..166037) product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(166034..166639) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS complement(166820..167275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS complement(167281..167871) product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(167873..169069) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V90 transl_table 11 codon_start 1 locus_tag LOCUS_46180 gene metX CDS complement(169133..171124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(171175..171471) product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LJ3 transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS complement(171477..172028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS complement(172282..173091) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 transl_table 11 codon_start 1 locus_tag LOCUS_46220 gene proC CDS complement(173141..173845) product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 174192..175226 product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 transl_table 11 codon_start 1 locus_tag LOCUS_46240 gene pilT CDS 175337..176476 product twitching motility protein PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 gene pilU CDS 176760..177941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS 178134..180071 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS complement(180083..180778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS complement(180974..181630) product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM75 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS 181717..182997 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339622.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS complement(183131..184441) product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 transl_table 11 codon_start 1 locus_tag LOCUS_46310 gene pyrC' CDS complement(184438..185439) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 transl_table 11 codon_start 1 locus_tag LOCUS_46320 gene pyrB CDS complement(185503..186006) product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VA0 transl_table 11 codon_start 1 locus_tag LOCUS_46330 gene pyrR CDS complement(186003..186383) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY0 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS complement(186489..187067) product UPF0301 protein AlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ16 transl_table 11 codon_start 1 locus_tag LOCUS_46350 gene algH CDS complement(187128..188033) product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 gene tonB3 CDS complement(188067..189023) product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 transl_table 11 codon_start 1 locus_tag LOCUS_46370 gene gshB CDS 189312..189695 product protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46384 transl_table 11 codon_start 1 locus_tag LOCUS_46380 gene pilG CDS 189780..190142 product protein PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43501 transl_table 11 codon_start 1 locus_tag LOCUS_46390 gene pilH CDS 190155..190694 product protein PilI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43502 transl_table 11 codon_start 1 locus_tag LOCUS_46400 gene pilI CDS 191098..193161 product protein PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42257 transl_table 11 codon_start 1 locus_tag LOCUS_46410 gene pilJ CDS 193197..194060 product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 gene pilK CDS 194076..200603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS 200605..201660 product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 transl_table 11 codon_start 1 locus_tag LOCUS_46440 gene chpB CDS 201689..202141 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 gene chpC CDS complement(202263..204509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(204555..205673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 205888..206112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS complement(206092..206802) product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V71 transl_table 11 codon_start 1 locus_tag LOCUS_46490 gene phnC CDS complement(206868..207716) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 gene phnD CDS complement(207754..208863) product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKA0 transl_table 11 codon_start 1 locus_tag LOCUS_46510 gene selU CDS 209134..210513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS 210792..212969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 213015..214490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 214595..216370 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 transl_table 11 codon_start 1 locus_tag LOCUS_46550 gene atsA CDS 216420..217313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205700.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(217444..218310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 218871..220298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS 220431..221300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS complement(221297..221869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 222110..224584 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228464.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS complement(224643..225890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 226413..228449 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS complement(228491..229141) product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS 229420..230784 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 transl_table 11 codon_start 1 locus_tag LOCUS_46650 gene rhlE CDS complement(230912..231118) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS complement(231327..231716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(231756..232277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 232520..233098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS complement(233241..233441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 233658..234374 product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K87 transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS complement(234447..234800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(234819..235211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS 235425..236471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS 236461..237807 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(237903..238373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS 238615..240000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS complement(240433..241032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(241114..241569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(242191..242499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS complement(242740..243432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 243586..243765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS complement(243827..244009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46830 sequence10 source 1..176144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 451..1341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS 1344..1751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 2045..2752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS 2770..3609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496952.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 CDS 3749..4084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS 4247..4558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS 4755..5279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS complement(5530..5853) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS complement(6023..6385) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707113.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS complement(6484..7203) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090575.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS complement(7230..7835) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974933.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 gene gst15 CDS 8014..8787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(8779..10386) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946539.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 10539..11549 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 gene rrp12 CDS complement(11602..13611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS complement(13898..14392) product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL0 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(14505..16949) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 gene ladS CDS 17113..17916 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI17 transl_table 11 codon_start 1 locus_tag LOCUS_47010 gene cobS CDS 18087..20312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 20459..21124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS complement(21146..21373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS complement(21472..22266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(22614..25013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(25376..26926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(27220..28797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103375.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS complement(28983..29438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS complement(29464..32913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 33127..33639 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS complement(33657..34577) product cation-efflux pump FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTL0 transl_table 11 codon_start 1 locus_tag LOCUS_47120 gene fieF CDS complement(34620..35930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS 36140..37030 product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX92 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS 37027..37581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS 37954..40095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47160 note possible pseudo, frameshifted CDS 40248..42557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 42890..43897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS 43894..44997 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104670.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS 45155..46564 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 46684..47541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS 47696..48181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS 48386..48583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS 48587..50191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS complement(50214..50984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS complement(51012..52136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS complement(52309..53352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS complement(53475..55130) product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 gene ilvB CDS complement(55347..56138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS complement(56135..56587) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS complement(56743..57333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS complement(57433..59298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353215.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS complement(59388..60725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 60968..62170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 62564..63694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS 63953..65185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 65724..66026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(66051..67481) product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKA7 transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS complement(67641..68510) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531321.1 transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS complement(68518..69600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 70211..70519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 70734..71021 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 71047..71898 product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS 71898..72656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS 72649..73134 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS 73131..73790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(74420..75340) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS 75486..76550 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(76830..77417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS complement(77432..78226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS complement(78427..78846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS complement(78878..82024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS complement(82146..82640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS complement(82734..83384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS complement(83432..83992) product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947723.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS complement(84068..84259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS complement(84731..85951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS complement(86190..86933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS complement(87016..87639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(88166..88900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(89149..89580) product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMY3 transl_table 11 codon_start 1 locus_tag LOCUS_47610 gene vapC CDS complement(89577..89816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(90049..91443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 91713..91916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS complement(91996..92955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(93192..94070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS 94229..95248 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192764.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(95256..95552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS 95770..96690 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS 96690..97535 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704324.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS complement(97566..98378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS complement(98384..98614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS complement(98620..99117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS 99385..100695 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS 100790..101995 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(102107..103111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS complement(103214..104158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(104624..105775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS complement(105781..107859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS complement(108126..108863) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS complement(108975..110231) product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705738.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS complement(110407..111993) product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206603.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 112115..113140 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206604.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS complement(113195..114616) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX62 transl_table 11 codon_start 1 locus_tag LOCUS_47840 gene pykF CDS 114829..115398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 115726..116472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS 116857..118989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(119042..124183) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 124398..125558 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(125573..129748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(129881..135604) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS complement(135739..136278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS complement(136504..137187) product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701727.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS complement(137360..138160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS complement(138704..139717) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 140049..142409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(142479..143804) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS complement(143810..144280) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(144386..144856) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969348.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS complement(144967..146046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS complement(146054..146443) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(146517..147368) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 gene yneD CDS complement(147580..148407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(148553..149479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(149668..150231) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 gene dhc CDS complement(150242..150658) product cytochrome c-type protein SHP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81238 transl_table 11 codon_start 1 locus_tag LOCUS_48060 gene shp CDS complement(150673..150843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS complement(150868..151452) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS 151652..153727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS 153737..154618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706562.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS 154599..155687 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(155723..156790) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 gene adiY CDS 156974..157870 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528656.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS 157902..159017 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E48 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(159053..159781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS complement(159792..160592) product transport-related membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530212.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS complement(160603..160953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(160950..162284) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS complement(162268..162942) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS complement(163021..163698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(163711..164529) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS complement(164519..166834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(166818..167342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(167352..167537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS complement(167671..169527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 169706..171076 product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS complement(171089..172162) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS 172348..174108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205567.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 174142..174942 product short-chain dehydrogenase/reductase SDR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS 174939..175919 product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705110.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 sequence11 source 1..133646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..729) product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702265.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS 885..1733 product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702266.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(1856..3241) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS 3576..4490 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(4412..5356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205721.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(5549..9295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(9534..10790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS 13150..13437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS 13652..14758 product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQK0 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 14862..15998 product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVM7 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS 15995..16900 product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105439.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 gene potH CDS 16897..17712 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS complement(17719..18024) product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS complement(18059..18760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS complement(18922..20130) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 20637..21665 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 gene potD CDS 21662..24061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48470 CDS complement(24084..24701) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS 24967..26253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS 26371..26964 product PhnA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS 27213..29657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS 29713..30552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS 30557..32284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS 32314..34362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS 34419..36335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 36346..40131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 40113..41489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS 41486..42421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS 42425..42565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS 42562..43542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS 44468..44785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS 44800..45234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS complement(45408..46088) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 46541..48604 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS 48665..49111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS complement(49123..50163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 50331..50579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS complement(50696..51394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS complement(51587..52438) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 transl_table 11 codon_start 1 locus_tag LOCUS_48690 gene frmB CDS 52819..53922 product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1K8 transl_table 11 codon_start 1 locus_tag LOCUS_48700 gene rsgA CDS 54197..55369 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS 55369..55653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS 56130..57647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS 57764..58321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS 58644..59051 product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230664.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 59395..59790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS complement(59857..61323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS complement(61579..63666) product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPM5 transl_table 11 codon_start 1 locus_tag LOCUS_48780 gene fusA2 CDS 64071..64649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(64685..65920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS complement(66174..67562) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 gene cabC1 CDS 67759..67932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS complement(67966..68598) product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS complement(68622..69590) product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 gene hprA CDS complement(69596..70441) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974754.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS complement(70487..71206) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS 71417..72907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS 73124..74098 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941474.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS complement(74116..74895) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 gene dltE CDS 75075..75842 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN3 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS 75852..76865 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 gene rr07 CDS 77073..79265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS complement(79282..80145) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS complement(80167..81510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS complement(81554..82132) product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022063.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 gene miaE CDS complement(82134..82394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS complement(82649..84436) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 84728..86548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS 86743..87897 product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS 88015..89532 product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 gene abfD CDS 89813..90508 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS 90524..91891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49020 CDS 91892..94513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS 94603..95730 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS 95748..96473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073675.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 CDS complement(96568..97566) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS 97670..98605 product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ8 transl_table 11 codon_start 1 locus_tag LOCUS_49070 gene lpxL CDS complement(98602..99456) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS 99821..101611 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 gene acdB CDS 101797..102489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(102529..103089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(103294..104040) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS complement(104204..105109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS 105451..106236 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 transl_table 11 codon_start 1 locus_tag LOCUS_49140 gene menB CDS complement(106301..107680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(107847..108764) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK90 transl_table 11 codon_start 1 locus_tag LOCUS_49160 gene murI CDS complement(108757..111231) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS complement(111259..112950) product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477565.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS complement(113093..113956) product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070899.1 transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS 114395..115393 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 gene rr07 CDS complement(115428..116234) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS complement(116227..119070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(119342..121390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS 121638..122321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS complement(122318..123319) product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS complement(123334..124719) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 124718..124909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS complement(124817..125404) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS complement(125504..126487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS complement(126882..128303) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 128635..129915 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 gene fadI CDS 130177..132213 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS 132308..132916 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 sequence12 source 1..125433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..633 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 transl_table 11 codon_start 1 locus_tag LOCUS_49340 gene rpsJ CDS 681..1316 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY4 transl_table 11 codon_start 1 locus_tag LOCUS_49350 gene rplC CDS 1336..1938 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 transl_table 11 codon_start 1 locus_tag LOCUS_49360 gene rplD CDS 1935..2234 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD7 transl_table 11 codon_start 1 locus_tag LOCUS_49370 gene rplW CDS 2246..3073 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD8 transl_table 11 codon_start 1 locus_tag LOCUS_49380 gene rplB CDS 3097..3372 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF25 transl_table 11 codon_start 1 locus_tag LOCUS_49390 gene rpsS CDS 3381..3716 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMP9 transl_table 11 codon_start 1 locus_tag LOCUS_49400 gene rplV CDS 3729..4412 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 transl_table 11 codon_start 1 locus_tag LOCUS_49410 gene rpsC CDS 4424..4837 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 transl_table 11 codon_start 1 locus_tag LOCUS_49420 gene rplP CDS 4837..5031 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK61 transl_table 11 codon_start 1 locus_tag LOCUS_49430 gene rpmC CDS 5038..5307 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ3 transl_table 11 codon_start 1 locus_tag LOCUS_49440 gene rpsQ CDS 5358..5726 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMQ4 transl_table 11 codon_start 1 locus_tag LOCUS_49450 gene rplN CDS 5743..6057 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK58 transl_table 11 codon_start 1 locus_tag LOCUS_49460 gene rplX CDS 6092..6631 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44346 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene rplE CDS 6650..6955 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE8 transl_table 11 codon_start 1 locus_tag LOCUS_49480 gene rpsN CDS 6975..7367 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF35 transl_table 11 codon_start 1 locus_tag LOCUS_49490 gene rpsH CDS 7381..7914 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 transl_table 11 codon_start 1 locus_tag LOCUS_49500 gene rplF CDS 7934..8281 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 transl_table 11 codon_start 1 locus_tag LOCUS_49510 gene rplR CDS 8292..8792 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ15 transl_table 11 codon_start 1 locus_tag LOCUS_49520 gene rpsE CDS 8796..8984 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF39 transl_table 11 codon_start 1 locus_tag LOCUS_49530 gene rpmD CDS 8986..9420 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP03 transl_table 11 codon_start 1 locus_tag LOCUS_49540 gene rplO CDS 9431..10771 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889V1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 gene secY CDS 11032..11388 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 transl_table 11 codon_start 1 locus_tag LOCUS_49560 gene rpsM CDS 11413..11808 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 transl_table 11 codon_start 1 locus_tag LOCUS_49570 gene rpsK CDS 11823..12443 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52759 transl_table 11 codon_start 1 locus_tag LOCUS_49580 gene rpsD CDS 12468..13472 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 transl_table 11 codon_start 1 locus_tag LOCUS_49590 gene rpoA CDS 13557..13940 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E888 transl_table 11 codon_start 1 locus_tag LOCUS_49600 gene rplQ CDS complement(14082..16910) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 transl_table 11 codon_start 1 locus_tag LOCUS_49610 gene uvrA CDS 17056..18426 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS 18515..19033 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDH5 transl_table 11 codon_start 1 locus_tag LOCUS_49630 gene ssb CDS complement(19139..19927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS 20132..20908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS 21129..22088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS 22118..24088 product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 transl_table 11 codon_start 1 locus_tag LOCUS_49670 gene xcpQ CDS 24215..25576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS 25746..26735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS complement(26872..27894) product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I632 transl_table 11 codon_start 1 locus_tag LOCUS_49700 gene srkA CDS complement(27931..28401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS 29002..30072 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA8 transl_table 11 codon_start 1 locus_tag LOCUS_49720 gene bioB CDS 30202..31395 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A97 transl_table 11 codon_start 1 locus_tag LOCUS_49730 gene bioF CDS 31392..32231 product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSF8 transl_table 11 codon_start 1 locus_tag LOCUS_49740 gene bioH CDS 32228..33022 product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A95 transl_table 11 codon_start 1 locus_tag LOCUS_49750 gene bioC CDS 33019..33705 product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB2 transl_table 11 codon_start 1 locus_tag LOCUS_49760 gene bioD CDS 33918..34151 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS 34164..35144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS 35250..36659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS complement(36694..38535) product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS 38794..39660 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085862.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS 39780..40370 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 40500..41990 product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 42749..44551 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS complement(44689..45987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 46604..47512 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS 47603..48055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS complement(48134..48481) product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 gene hcaC CDS complement(48632..49465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS 49667..50329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702901.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS 50489..51493 product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727696.1 transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS 51787..53556 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MRU5 transl_table 11 codon_start 1 locus_tag LOCUS_49920 gene ilvB CDS complement(53689..54885) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE5 transl_table 11 codon_start 1 locus_tag LOCUS_49930 gene rhlB CDS complement(54908..55510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS complement(55498..56643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS complement(56691..58910) product oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS complement(58944..59465) product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS complement(59645..60253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS complement(60262..60447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 60603..63047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(63192..63506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS 63786..64985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247022.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(64982..65428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS complement(65441..67420) product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS complement(67439..67831) product sulfur reduction protein DsrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573038.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS complement(67852..68445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS complement(68670..69266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(69429..69596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS complement(69600..70373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 70482..71510 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 71595..73670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS 73904..74860 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 transl_table 11 codon_start 1 locus_tag LOCUS_50120 gene folE2 CDS complement(74970..75995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS 75924..76325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS complement(76675..78597) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 transl_table 11 codon_start 1 locus_tag LOCUS_50150 gene thrS CDS complement(78754..79596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 gene queD CDS 79862..81055 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360017.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 81151..81582 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS 81582..82724 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 CDS 82749..83354 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFJ7 transl_table 11 codon_start 1 locus_tag LOCUS_50200 gene def-2 CDS complement(83389..83859) product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 CDS complement(83856..85250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS complement(85257..86144) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141348.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS complement(86183..86749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS complement(87284..87475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS 87535..87972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS complement(88072..89040) product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 gene ispB CDS 89448..89759 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUT0 transl_table 11 codon_start 1 locus_tag LOCUS_50280 gene rplU CDS 89790..90050 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB81 transl_table 11 codon_start 1 locus_tag LOCUS_50290 gene rpmA CDS 90262..91449 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYK1 transl_table 11 codon_start 1 locus_tag LOCUS_50300 gene obg CDS 91499..92647 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 transl_table 11 codon_start 1 locus_tag LOCUS_50310 gene proB CDS complement(92731..92994) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ7 transl_table 11 codon_start 1 locus_tag LOCUS_50320 gene rpsT CDS 93362..94885 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S92 transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS 95018..95953 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 transl_table 11 codon_start 1 locus_tag LOCUS_50340 gene ribF CDS 95975..98785 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 transl_table 11 codon_start 1 locus_tag LOCUS_50350 gene ileS CDS 98862..99389 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ3 transl_table 11 codon_start 1 locus_tag LOCUS_50360 gene lspA CDS 99400..99864 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS 99888..100820 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 gene ispH CDS 100922..101305 product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704653.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS 101503..102063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS 102074..102802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS 103442..106969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS complement(107066..107623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS 107794..108903 product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS complement(108989..110386) product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 transl_table 11 codon_start 1 locus_tag LOCUS_50450 gene pilR CDS complement(110389..112041) product sensor protein PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33639 transl_table 11 codon_start 1 locus_tag LOCUS_50460 gene pilS CDS complement(112050..112310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS 112338..112499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS 112481..114127 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 gene nadE CDS complement(114200..115030) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33641 transl_table 11 codon_start 1 locus_tag LOCUS_50500 gene bamD CDS 115045..116154 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH8 transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS 116147..116896 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889C3 transl_table 11 codon_start 1 locus_tag LOCUS_50520 CDS 117019..119592 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVN5 transl_table 11 codon_start 1 locus_tag LOCUS_50530 gene clpB CDS complement(119664..120143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 120662..122383 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 transl_table 11 codon_start 1 locus_tag LOCUS_50550 gene ilvI CDS 122386..122877 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 transl_table 11 codon_start 1 locus_tag LOCUS_50560 gene ilvH CDS 122933..123949 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA2 transl_table 11 codon_start 1 locus_tag LOCUS_50570 gene ilvC CDS 124064..124933 product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 gene pssA sequence13 source 1..80607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1533..2825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS complement(3088..3951) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 gene trx CDS complement(3987..4526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS complement(5123..5527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS 5738..9214 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 transl_table 11 codon_start 1 locus_tag LOCUS_50630 gene mfd CDS 9218..10108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS complement(10179..10937) product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS complement(10940..11497) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS complement(11504..12622) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS complement(12686..13735) product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRA9 transl_table 11 codon_start 1 locus_tag LOCUS_50680 gene nagZ CDS complement(13782..14273) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(14366..14995) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 gene psrA CDS complement(15119..16303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS 16901..17224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS 17484..18086 product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRT9 transl_table 11 codon_start 1 locus_tag LOCUS_50730 gene lexA CDS complement(18110..18364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS complement(18611..19138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS complement(19345..21972) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZJ5 transl_table 11 codon_start 1 locus_tag LOCUS_50760 gene topA CDS 22462..23271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50770 CDS complement(23330..23836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 23983..24423 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZI9 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(24467..25186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS 25374..25970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS complement(25962..26780) product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS 26883..27113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(27153..28553) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS 28826..30205 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946789.1 transl_table 11 codon_start 1 locus_tag LOCUS_50850 gene atpD CDS 30202..30609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 30606..30881 product F0F1 ATP synthase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946787.1 transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 30878..31567 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWN4 transl_table 11 codon_start 1 locus_tag LOCUS_50880 gene atpB CDS 31570..31836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS 31847..32599 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWN6 transl_table 11 codon_start 1 locus_tag LOCUS_50900 gene atpF CDS 32589..34043 product ATP synthase subunit alpha 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWN7 transl_table 11 codon_start 1 locus_tag LOCUS_50910 gene atpA1 CDS 34040..34861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS complement(34880..37489) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 37639..38478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS 38490..39941 product DNA repair nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036300.1 transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS 39914..43108 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881T7 transl_table 11 codon_start 1 locus_tag LOCUS_50960 gene dnaE2 CDS 43383..45635 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(45682..46482) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705927.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(46638..47210) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CP4 transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS complement(47400..48074) product outer membrane protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS 48229..48687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS complement(48718..49656) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 49886..51112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS 51133..51957 product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267411.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS complement(52033..52761) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS complement(52803..53405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS complement(53535..53831) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408502.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(53961..55244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS 55482..56495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS complement(56503..58104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS complement(58115..60250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(60338..62539) product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZG0 transl_table 11 codon_start 1 locus_tag LOCUS_51120 gene rlmL CDS 62826..63032 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUM2 transl_table 11 codon_start 1 locus_tag LOCUS_51130 gene rmf CDS complement(63303..64313) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZF8 transl_table 11 codon_start 1 locus_tag LOCUS_51140 gene pyrD CDS complement(64358..64585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS complement(64715..69547) product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZE0 transl_table 11 codon_start 1 locus_tag LOCUS_51160 gene gdhB CDS 69988..70959 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS 70970..71959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 71956..72423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 72420..73502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 73747..75417 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267198.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS 75411..77126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS complement(77607..78656) product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 gene intI CDS 79604..80029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51240 sequence14 source 1..80344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4783 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267345.1:non-ribosomal peptide synthetase locus_tag LOCUS_51250 CDS 4770..6653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS 6895..7524 product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS 7567..10566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 10563..11540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS 12228..13628 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263307.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 gene cusC CDS 13618..14919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS 14912..18055 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 gene cusA CDS 18144..19163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113944.1 transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS 19236..21593 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 gene ladS CDS complement(21821..23290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 23627..24667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 24670..25788 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS 25959..27794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS 28076..29488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS complement(29644..30534) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS 30720..31250 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYZ3 transl_table 11 codon_start 1 locus_tag LOCUS_51410 gene purE CDS 31250..32365 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY0 transl_table 11 codon_start 1 locus_tag LOCUS_51420 gene purK CDS 32391..33014 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS 33057..34100 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW0 transl_table 11 codon_start 1 locus_tag LOCUS_51440 gene pyrC CDS 34274..34951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS complement(34962..36716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS complement(36981..39395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS 39715..40575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(40605..41114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942952.1 transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS complement(41149..42081) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 transl_table 11 codon_start 1 locus_tag LOCUS_51500 CDS complement(42103..43035) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS complement(43032..45767) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 CDS complement(45928..46884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51530 CDS complement(46934..48619) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS 48805..49782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS complement(49815..50081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS complement(50324..51070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS complement(51099..51584) product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728751.1 transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS complement(51808..52314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 52517..52921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS 52977..54248 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109388.1 transl_table 11 codon_start 1 locus_tag LOCUS_51610 CDS 54309..55304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS 55315..58437 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS complement(58580..58873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS complement(59053..59940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS complement(59952..60650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS complement(60664..60843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51670 CDS complement(60843..63911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS complement(63999..65195) product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS complement(65343..66551) product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS 66676..67239 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223770.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS 67255..67590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS complement(67703..68563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(68571..69203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(69388..70800) product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS complement(70844..71638) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS 71848..72852 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 gene oruR CDS complement(72818..73501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS 73834..75069 product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 CDS 76067..76855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS complement(77028..79541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552316.1 transl_table 11 codon_start 1 locus_tag LOCUS_51810 sequence15 source 1..80165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 CDS complement(1083..1457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS complement(1698..2759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS complement(2797..3075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS complement(3139..3378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_944506.1 transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS complement(3393..6539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51870 CDS 6626..8392 product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 transl_table 11 codon_start 1 locus_tag LOCUS_51880 gene fha1 CDS 8385..8906 product type VI secretion lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114612.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS 9063..10397 product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS 10400..11482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS 11475..15035 product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 gene icmF1 tRNA 15417..15504 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 15877..18612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS complement(18632..20044) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 gene yegQ CDS 20599..21114 product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_248954.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 gene hcpC CDS complement(21197..22012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS 22230..23072 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 CDS 23172..24020 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS 24225..25865 product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097814.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS 25884..26372 product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS 26411..27898 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261636.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS 27986..28402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105491.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS 28406..30190 product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480666.1 transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS 30154..31137 product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS 31236..32933 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480672.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(32973..34592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS 34744..35571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS 35701..36261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS 36283..37749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52090 CDS 37751..38620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52100 CDS 38620..39099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52110 CDS 39096..39593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS 39627..41402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 41448..42065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52140 CDS 42072..43235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS 43238..43732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS 43829..44704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS 44701..45564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS complement(45600..45896) product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499010.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS 46120..46383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS 46581..48731 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881828.1 transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS 49075..49566 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS 49579..50637 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51465 transl_table 11 codon_start 1 locus_tag LOCUS_52230 gene fliM CDS 50641..51090 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51466 transl_table 11 codon_start 1 locus_tag LOCUS_52240 gene fliN CDS 51192..51821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS 51814..52617 product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51468 transl_table 11 codon_start 1 locus_tag LOCUS_52260 gene fliP CDS 52627..52896 product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 gene fliQ CDS 52901..53677 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 transl_table 11 codon_start 1 locus_tag LOCUS_52280 gene fliR CDS 53718..54851 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 gene flhB CDS 54963..57308 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 gene ladS CDS 57522..59645 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 gene flhA CDS 59729..61318 product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881782.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 gene flhF CDS 61384..62205 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD64 transl_table 11 codon_start 1 locus_tag LOCUS_52330 gene fleN CDS 62208..62945 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV3 transl_table 11 codon_start 1 locus_tag LOCUS_52340 gene fliA CDS 63214..63600 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316827.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS 63627..64406 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQV5 transl_table 11 codon_start 1 locus_tag LOCUS_52360 CDS 64417..66729 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 CDS 66764..67891 product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87125 transl_table 11 codon_start 1 locus_tag LOCUS_52380 gene cheB1 CDS 67895..68638 product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 gene motA-1 CDS 68644..69708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 69708..70508 product plasmid partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 CDS 70585..71925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS 72150..72632 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370201.1 transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS 72716..73195 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 transl_table 11 codon_start 1 locus_tag LOCUS_52440 gene cheW-2 CDS 73243..73662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS 73995..74711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS 74805..75326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS 75535..76422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS 76556..78202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267045.1 transl_table 11 codon_start 1 locus_tag LOCUS_52490 CDS 78334..79062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52500 CDS 79121..79624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52510 sequence16 source 1..64980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(6415..9804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS 10303..11499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52530 CDS complement(11512..12285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS 12555..14300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS 14780..15688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS 15735..16262 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198315.1 transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS complement(16273..16500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS 16852..19179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS complement(19184..19582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS complement(19698..20804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS 21426..23909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS complement(23976..25328) product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 transl_table 11 codon_start 1 locus_tag LOCUS_52630 gene gor CDS complement(25388..26872) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 gene glsF CDS complement(27163..27786) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS complement(27953..28111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS 28416..29432 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS 29504..29854 product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770109.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS 29866..30564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS complement(30611..31825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52700 CDS complement(31896..33167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52710 CDS complement(33349..33711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52720 CDS complement(33821..34585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS complement(34588..36453) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_52740 gene gspA CDS complement(36528..37055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS complement(37055..38416) product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 transl_table 11 codon_start 1 locus_tag LOCUS_52760 gene gspL CDS complement(38454..39413) product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00518 transl_table 11 codon_start 1 locus_tag LOCUS_52770 gene xcpX CDS complement(39427..40095) product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00517 transl_table 11 codon_start 1 locus_tag LOCUS_52780 gene xcpW CDS complement(40151..40549) product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070568.1 transl_table 11 codon_start 1 locus_tag LOCUS_52790 gene gspI CDS complement(40539..41246) product type II secretion system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00515 transl_table 11 codon_start 1 locus_tag LOCUS_52800 gene xcpU CDS complement(41247..41711) product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00514 transl_table 11 codon_start 1 locus_tag LOCUS_52810 gene xcpT CDS complement(41738..42952) product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 transl_table 11 codon_start 1 locus_tag LOCUS_52820 gene xcpS CDS complement(42954..44513) product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 transl_table 11 codon_start 1 locus_tag LOCUS_52830 gene xcpR CDS 45035..46030 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 gene galE CDS 46060..46719 product putative 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703848.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS 46722..48362 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH1 transl_table 11 codon_start 1 locus_tag LOCUS_52860 gene pgi CDS complement(48491..49324) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 transl_table 11 codon_start 1 locus_tag LOCUS_52870 gene galU CDS 49701..51116 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U679 transl_table 11 codon_start 1 locus_tag LOCUS_52880 gene zwf CDS 51116..51820 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688731.1 transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS 51915..53735 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222315.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 gene edd CDS 53774..54397 product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 transl_table 11 codon_start 1 locus_tag LOCUS_52910 gene eda CDS complement(54478..54891) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 transl_table 11 codon_start 1 locus_tag LOCUS_52920 gene mceE CDS 55211..57361 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS 57364..58335 product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 CDS 58560..60857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS 60866..62926 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS 62939..64312 product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 transl_table 11 codon_start 1 locus_tag LOCUS_52970 sequence17 source 1..35355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..1173 product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS 1234..2388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771824.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS complement(4289..4657) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368395.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(4750..5715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS complement(5972..7312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS complement(7370..7900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS 8020..8862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS 8915..9964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS 10018..11460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 11460..12791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS complement(12877..13164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS 13232..13924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS 13924..14658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS 14866..16071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 16148..16327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS complement(16510..17778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS complement(17782..19188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS complement(19283..20824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53150 note possible pseudo, frameshifted CDS complement(21023..21826) product putative o-antigen/lipopolysaccharide transport ATP-binding protein ABC transporter RfbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700957.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS complement(21829..22638) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 gene rfbD CDS complement(22670..23776) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125437.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 gene glf CDS complement(23852..25465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS 26067..27005 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986993.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 CDS complement(27128..27634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53210 CDS 28460..28846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53220 CDS complement(29526..29717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53230 CDS 29778..30068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53240 CDS 30073..31257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS 32268..34217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53260 sequence18 source 1..31846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..1631) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 transl_table 11 codon_start 1 locus_tag LOCUS_53270 gene cabC1 CDS complement(1774..2025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53280 note possible pseudo, frameshifted CDS complement(2172..2447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308614.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 CDS 2555..3466 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS complement(3644..4642) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS complement(4648..5511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700821.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS 6187..8157 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266151.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 CDS complement(8168..8593) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS 8655..9569 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS complement(9863..10567) product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS complement(10744..11160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53370 note possible pseudo, internal stop codon CDS complement(11245..11580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53380 note possible pseudo, internal stop codon CDS complement(11758..14955) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS complement(14996..16258) product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS complement(16278..17519) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS complement(17580..17735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53420 CDS 17929..18117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS complement(18331..19338) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039584.1 transl_table 11 codon_start 1 locus_tag LOCUS_53440 CDS 19545..20594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53450 CDS complement(21093..21902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53460 CDS complement(22239..23885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS complement(24554..25501) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 gene yeaP CDS complement(25895..27190) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS complement(27295..27852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53500 CDS 27987..28193 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS complement(28539..28760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53520 CDS complement(28955..29530) product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122464.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS complement(29527..29787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS complement(30130..30912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_53550 sequence19 source 1..15707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..2303) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX0 transl_table 11 codon_start 1 locus_tag LOCUS_53560 gene fusA CDS complement(2350..2820) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X5 transl_table 11 codon_start 1 locus_tag LOCUS_53570 gene rpsG CDS complement(2917..3291) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 transl_table 11 codon_start 1 locus_tag LOCUS_53580 gene rpsL CDS complement(3460..7665) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 transl_table 11 codon_start 1 locus_tag LOCUS_53590 gene rpoC CDS complement(7737..11807) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 transl_table 11 codon_start 1 locus_tag LOCUS_53600 gene rpoB CDS complement(12062..12439) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ1 transl_table 11 codon_start 1 locus_tag LOCUS_53610 gene rplL CDS complement(12492..13016) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID4 transl_table 11 codon_start 1 locus_tag LOCUS_53620 gene rplJ CDS complement(13226..13921) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP8 transl_table 11 codon_start 1 locus_tag LOCUS_53630 gene rplA CDS complement(13923..14354) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP7 transl_table 11 codon_start 1 locus_tag LOCUS_53640 gene rplK CDS complement(14448..14981) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 transl_table 11 codon_start 1 locus_tag LOCUS_53650 gene nusG CDS complement(14997..15371) product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC3 transl_table 11 codon_start 1 locus_tag LOCUS_53660 gene secE tRNA complement(15431..15506) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 sequence20 source 1..11651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..531 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83DM4:transaldolase locus_tag LOCUS_53670 CDS 572..1600 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 transl_table 11 codon_start 1 locus_tag LOCUS_53680 CDS 1600..2610 product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS 2610..4163 product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7G1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS 4176..5096 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957732.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS 5093..6379 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957733.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS 6392..7291 product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 transl_table 11 codon_start 1 locus_tag LOCUS_53730 CDS 7294..7947 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 transl_table 11 codon_start 1 locus_tag LOCUS_53740 CDS 7950..8843 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS 8854..9951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53760 CDS 10012..10737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53770 sequence21 source 1..10296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..8493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS 9837..10043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53790 sequence22 source 1..10142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(681..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53800 CDS complement(2876..3130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS complement(3045..4661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 CDS complement(5035..5796) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWM8 transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS complement(5793..6740) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 gene yadG CDS complement(6877..7122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS 7466..8071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS 8068..9447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS 9491..9883 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821665.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 sequence23 source 1..8528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 437..826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS 965..1405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53900 CDS 1543..2040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53910 CDS 2227..2763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53920 CDS 2890..3216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53930 CDS 3839..4117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS 4259..4906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53950 CDS 5074..6387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53960 CDS 6885..7172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53970 note possible pseudo, internal stop codon CDS 7197..7526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53980 note possible pseudo, internal stop codon CDS 7678..8187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53990 sequence24 source 1..7684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1130..1324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS 1266..2846 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105077.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS 2843..4945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105078.1 transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS 4977..5372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS complement(5417..6715) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS 7410..7679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54050 sequence25 source 1..7294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 974..1267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54060 CDS 1504..1758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54070 CDS 1903..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54080 CDS 2396..2725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS complement(3664..3846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS complement(4318..4521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS 4747..5115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036913.1 transl_table 11 codon_start 1 locus_tag LOCUS_54120 CDS 5687..6136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS 6278..6817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54140 sequence26 source 1..6199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(148..915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020323.1 transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS complement(1045..1371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964515.1 transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS complement(1397..1834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS 2631..3536 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118252.1 transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS 3591..3818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS 3812..4588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS complement(4865..5281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54210 CDS complement(5509..6015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54220 sequence27 source 1..5905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141321.1 transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS complement(1014..2399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54240 CDS complement(2548..3009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54250 CDS complement(3154..3465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS complement(3595..4200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS complement(4681..5058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS complement(5198..5656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54290 sequence28 source 1..5635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54300 CDS complement(556..1554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935873.1 transl_table 11 codon_start 1 locus_tag LOCUS_54310 CDS complement(1950..2111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54320 CDS 2368..3276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54330 CDS 3236..3532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54340 CDS complement(3657..5525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54350 sequence29 source 1..5567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(515..1639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54360 CDS 3019..3504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54370 CDS complement(3501..4157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS complement(4900..5397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54390 sequence30 source 1..5130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..1185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54400 CDS complement(1175..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477284.1 transl_table 11 codon_start 1 locus_tag LOCUS_54410 CDS complement(1830..4439) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS complement(4432..4596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS complement(4674..4805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54440 sequence31 source 1..4724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 CDS complement(649..945) product plasmid stabilization protein ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS complement(942..1184) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 transl_table 11 codon_start 1 locus_tag LOCUS_54470 CDS 1422..2480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS 2621..2929 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143846.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS 3064..3792 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477748.1 transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS 3837..4259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54510 sequence32 source 1..4583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1298..1630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 2155..2406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS 2901..3266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS 3552..4073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54550 sequence33 source 1..4383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54560 CDS 971..1264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54570 CDS 1432..1923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54580 CDS 2052..2522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS 3611..4027 product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_54600 sequence34 source 1..4302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1713..1904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS 2008..2421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS 2561..2860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS 3468..3752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54640 sequence35 source 1..4151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 461..622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54650 CDS 1092..1286 product DUF2191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS 1283..1684 product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 transl_table 11 codon_start 1 locus_tag LOCUS_54670 gene vapC CDS complement(1805..2164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS complement(2297..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS complement(2974..3291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54700 sequence36 source 1..3925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 680..1060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS 1567..2025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54720 CDS 2262..2609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400923.1 transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS complement(2714..2848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54740 sequence37 source 1..3863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1214..2053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54750 CDS complement(2050..2415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54760 CDS complement(2415..2738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54770 sequence38 source 1..3657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS 599..844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS 1048..1461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS 1695..2336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104309.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 CDS 2470..2850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS 3019..3492 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224554.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 sequence39 source 1..3632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(254..329) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(361..434) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(472..556) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(603..678) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(717..1568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS complement(1595..2329) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX0 transl_table 11 codon_start 1 locus_tag LOCUS_54850 gene coaX CDS complement(2326..3297) product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB4 transl_table 11 codon_start 1 locus_tag LOCUS_54860 gene birA sequence40 source 1..3561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 663..1340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS 1303..2859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54880 sequence41 source 1..3295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..3137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54890 sequence42 source 1..3173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(286..615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS complement(759..1481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS complement(2490..2792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54920 CDS 2911..3069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54930 sequence43 source 1..3122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(826..1800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54940 sequence44 source 1..3110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 38..367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54950 CDS 534..1208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS 1493..1876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS 2018..2320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS 2341..2670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 2784..3092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55000 sequence45 source 1..2980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS 2024..2353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS 2514..2777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55030 sequence46 source 1..2835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(619..1044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS complement(1547..2086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS complement(2224..2685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55060 sequence47 source 1..2781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(635..2299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55070 sequence48 source 1..2765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1462..1851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55080 CDS complement(2004..2483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS 2557..2715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55100 sequence49 source 1..2357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 529..846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS 1414..1851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55120 sequence50 source 1..2348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 795..1355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55130 sequence51 source 1..2329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence52 source 1..2152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..359 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH74 transl_table 11 codon_start 1 locus_tag LOCUS_55140 gene rubA CDS 502..1521 product putative family 20 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HI37 transl_table 11 codon_start 1 locus_tag LOCUS_55150 sequence53 source 1..2085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227008.1 transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS complement(1014..1379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55170 CDS complement(1533..1928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55180 sequence54 source 1..2021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 transl_table 11 codon_start 1 locus_tag LOCUS_55190 sequence55 source 1..1941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55200 CDS 701..859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55210 CDS complement(970..1644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55220 sequence56 source 1..1936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(242..592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS complement(630..914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55240 sequence57 source 1..1821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55250 sequence58 source 1..1742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS complement(612..776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55270 CDS complement(871..1476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55280 sequence59 source 1..1730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263497.1 transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS 698..949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55300 sequence60 source 1..1690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55310 CDS complement(478..936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS complement(1080..1529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55330 sequence61 source 1..1679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..1447 product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608644.1 transl_table 11 codon_start 1 locus_tag LOCUS_55340 sequence62 source 1..1581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 566..979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55350 CDS complement(1011..1196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55360 sequence63 source 1..1511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(917..1342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55380 sequence64 source 1..1508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..1452 product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 sequence65 source 1..1507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(47..1384) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035783.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 sequence66 source 1..1478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55410 sequence67 source 1..1470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence68 source 1..1468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1297 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224817.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 sequence69 source 1..1417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence70 source 1..1407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1060..1251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55430 sequence71 source 1..1405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55440 CDS complement(268..1185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55450 sequence72 source 1..1347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55460 sequence73 source 1..1274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence74 source 1..1262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS complement(928..1083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55480 sequence75 source 1..1249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS 517..927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55500 sequence76 source 1..1230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..877) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_720448.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS complement(889..1167) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036813.1 transl_table 11 codon_start 1 locus_tag LOCUS_55520 sequence77 source 1..1211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(699..956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS 999..1157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55540 sequence78 source 1..1164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1164 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_252955.1:elongation factor Tu locus_tag LOCUS_55550 sequence79 source 1..1151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 213..350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55560 CDS complement(459..893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55570 sequence80 source 1..1119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55580 CDS complement(825..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55590 sequence81 source 1..1091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(401..817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55600 sequence82 source 1..1074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 514..942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55610 sequence83 source 1..1032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence84 source 1..1020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence85 source 1..1016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence86 source 1..1005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@