>Feature sequence01 304 777 gene locus_tag LOCUS_00010 304 777 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_00010 779 1996 gene locus_tag LOCUS_00020 gene iscS 779 1996 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY6 protein_id gnl|my_center|LOCUS_00020 2082 2468 gene locus_tag LOCUS_00030 gene nifU 2082 2468 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY5 protein_id gnl|my_center|LOCUS_00030 2506 2826 gene locus_tag LOCUS_00040 2506 2826 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_00040 2936 3451 gene locus_tag LOCUS_00050 gene hscB 2936 3451 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY3 protein_id gnl|my_center|LOCUS_00050 3490 5352 gene locus_tag LOCUS_00060 gene hscA 3490 5352 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY2 protein_id gnl|my_center|LOCUS_00060 5367 5705 gene locus_tag LOCUS_00070 gene fdx 5367 5705 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_00070 7183 5792 gene locus_tag LOCUS_00080 gene cyaA 7183 5792 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206624.1 protein_id gnl|my_center|LOCUS_00080 7752 7318 gene locus_tag LOCUS_00090 7752 7318 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_00090 11443 7988 gene locus_tag LOCUS_00100 gene mfd 11443 7988 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX8 protein_id gnl|my_center|LOCUS_00100 11940 11587 gene locus_tag LOCUS_00110 11940 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206622.1 protein_id gnl|my_center|LOCUS_00110 12092 13177 gene locus_tag LOCUS_00120 gene trmA 12092 13177 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_00120 13429 13653 gene locus_tag LOCUS_00130 13429 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011679.1 protein_id gnl|my_center|LOCUS_00130 13926 14420 gene locus_tag LOCUS_00140 13926 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206573.1 protein_id gnl|my_center|LOCUS_00140 15325 14417 gene locus_tag LOCUS_00150 15325 14417 CDS product bestrophin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113810.1 protein_id gnl|my_center|LOCUS_00150 17144 15423 gene locus_tag LOCUS_00160 gene glnS2 17144 15423 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH76 protein_id gnl|my_center|LOCUS_00160 17312 17821 gene locus_tag LOCUS_00170 gene ppiB 17312 17821 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_00170 17905 18624 gene locus_tag LOCUS_00180 gene lpxH 17905 18624 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH78 protein_id gnl|my_center|LOCUS_00180 18735 19388 gene locus_tag LOCUS_00190 gene nfnB 18735 19388 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 protein_id gnl|my_center|LOCUS_00190 19491 19715 gene locus_tag LOCUS_00200 19491 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20547 19684 gene locus_tag LOCUS_00210 20547 19684 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_00210 21671 20634 gene locus_tag LOCUS_00220 gene fba 21671 20634 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_00220 22066 21794 gene locus_tag LOCUS_00230 22066 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23403 22216 gene locus_tag LOCUS_00240 gene pgk 23403 22216 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA8 protein_id gnl|my_center|LOCUS_00240 23543 23926 gene locus_tag LOCUS_00250 23543 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_00250 23926 24519 gene locus_tag LOCUS_00260 gene maf 23926 24519 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA6 protein_id gnl|my_center|LOCUS_00260 24536 25705 gene locus_tag LOCUS_00270 gene xseA 24536 25705 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206583.1 protein_id gnl|my_center|LOCUS_00270 27670 25790 gene locus_tag LOCUS_00280 27670 25790 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084153.1 protein_id gnl|my_center|LOCUS_00280 28347 27667 gene locus_tag LOCUS_00290 28347 27667 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084154.1 protein_id gnl|my_center|LOCUS_00290 29396 28617 gene locus_tag LOCUS_00300 29396 28617 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_00300 29933 29424 gene locus_tag LOCUS_00310 gene menG 29933 29424 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_00310 30611 29937 gene locus_tag LOCUS_00320 gene yraR 30611 29937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206619.1 protein_id gnl|my_center|LOCUS_00320 30827 31093 gene locus_tag LOCUS_00330 gene rpsT 30827 31093 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_00330 32008 31271 gene locus_tag LOCUS_00340 gene gpmA 32008 31271 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_00340 32915 32061 gene locus_tag LOCUS_00350 gene cysQ 32915 32061 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206618.1 protein_id gnl|my_center|LOCUS_00350 33313 33561 gene locus_tag LOCUS_00360 33313 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33617 34069 gene locus_tag LOCUS_00370 33617 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34286 34086 gene locus_tag LOCUS_00380 34286 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34620 34231 gene locus_tag LOCUS_00390 34620 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35129 34620 gene locus_tag LOCUS_00400 35129 34620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 35400 35119 gene locus_tag LOCUS_00410 35400 35119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 35530 36669 gene locus_tag LOCUS_00420 35530 36669 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205674.1 protein_id gnl|my_center|LOCUS_00420 39239 36711 gene locus_tag LOCUS_00430 39239 36711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40937 39249 gene locus_tag LOCUS_00440 40937 39249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41245 40937 gene locus_tag LOCUS_00450 41245 40937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 41711 41310 gene locus_tag LOCUS_00460 41711 41310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44247 41713 gene locus_tag LOCUS_00470 44247 41713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039763.1 protein_id gnl|my_center|LOCUS_00470 47233 44369 gene locus_tag LOCUS_00480 47233 44369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49284 47233 gene locus_tag LOCUS_00490 49284 47233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49709 49284 gene locus_tag LOCUS_00500 49709 49284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50194 49709 gene locus_tag LOCUS_00510 50194 49709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 50646 50191 gene locus_tag LOCUS_00520 50646 50191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52718 50649 gene locus_tag LOCUS_00530 52718 50649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 53239 52718 gene locus_tag LOCUS_00540 53239 52718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53645 53340 gene locus_tag LOCUS_00550 53645 53340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54639 53728 gene locus_tag LOCUS_00560 54639 53728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 55328 54657 gene locus_tag LOCUS_00570 55328 54657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55881 55321 gene locus_tag LOCUS_00580 55881 55321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57512 55878 gene locus_tag LOCUS_00590 57512 55878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063619.1 protein_id gnl|my_center|LOCUS_00590 57706 57512 gene locus_tag LOCUS_00600 57706 57512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 58044 57709 gene locus_tag LOCUS_00610 58044 57709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 58558 58136 gene locus_tag LOCUS_00620 58558 58136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 59080 58559 gene locus_tag LOCUS_00630 59080 58559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 59268 59077 gene locus_tag LOCUS_00640 59268 59077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60308 59265 gene locus_tag LOCUS_00650 60308 59265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 60595 60305 gene locus_tag LOCUS_00660 60595 60305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 60930 60607 gene locus_tag LOCUS_00670 60930 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 61142 60939 gene locus_tag LOCUS_00680 61142 60939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 61259 61975 gene locus_tag LOCUS_00690 61259 61975 CDS product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095953.1 protein_id gnl|my_center|LOCUS_00690 61978 62463 gene locus_tag LOCUS_00700 61978 62463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 62656 62874 gene locus_tag LOCUS_00710 62656 62874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 62876 63139 gene locus_tag LOCUS_00720 62876 63139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 63136 64014 gene locus_tag LOCUS_00730 63136 64014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 64063 65508 gene locus_tag LOCUS_00740 64063 65508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 65560 65892 gene locus_tag LOCUS_00750 65560 65892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 65889 66230 gene locus_tag LOCUS_00760 65889 66230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 66223 66525 gene locus_tag LOCUS_00770 66223 66525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 66525 66746 gene locus_tag LOCUS_00780 66525 66746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 67957 66656 gene locus_tag LOCUS_00790 67957 66656 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218286.1 protein_id gnl|my_center|LOCUS_00790 68176 68850 gene locus_tag LOCUS_00800 gene yrfG 68176 68850 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206980.1 protein_id gnl|my_center|LOCUS_00800 68843 69259 gene locus_tag LOCUS_00810 gene hslR 68843 69259 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW4 protein_id gnl|my_center|LOCUS_00810 69426 70472 gene locus_tag LOCUS_00820 gene recA 69426 70472 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW5 protein_id gnl|my_center|LOCUS_00820 70561 71160 gene locus_tag LOCUS_00830 gene recX 70561 71160 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW6 protein_id gnl|my_center|LOCUS_00830 71595 72443 gene locus_tag LOCUS_00840 71595 72443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206981.1 protein_id gnl|my_center|LOCUS_00840 73288 72500 gene locus_tag LOCUS_00850 gene lpxA2 73288 72500 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 protein_id gnl|my_center|LOCUS_00850 73770 73285 gene locus_tag LOCUS_00860 gene fabZ 73770 73285 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC6 protein_id gnl|my_center|LOCUS_00860 74851 73778 gene locus_tag LOCUS_00870 gene lpxD 74851 73778 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC7 protein_id gnl|my_center|LOCUS_00870 75352 74855 gene locus_tag LOCUS_00880 gene ompH 75352 74855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206985.1 protein_id gnl|my_center|LOCUS_00880 77859 75394 gene locus_tag LOCUS_00890 gene yaeT 77859 75394 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC9 protein_id gnl|my_center|LOCUS_00890 79256 77901 gene locus_tag LOCUS_00900 79256 77901 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_00900 80456 79260 gene locus_tag LOCUS_00910 gene dxr 80456 79260 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD2 protein_id gnl|my_center|LOCUS_00910 81281 80457 gene locus_tag LOCUS_00920 gene cdsA 81281 80457 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD3 protein_id gnl|my_center|LOCUS_00920 82037 81285 gene locus_tag LOCUS_00930 gene ispU 82037 81285 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD4 protein_id gnl|my_center|LOCUS_00930 82598 82044 gene locus_tag LOCUS_00940 gene frr 82598 82044 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD5 protein_id gnl|my_center|LOCUS_00940 83405 82677 gene locus_tag LOCUS_00950 gene pyrH 83405 82677 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD6 protein_id gnl|my_center|LOCUS_00950 84795 83452 gene locus_tag LOCUS_00960 gene yliG 84795 83452 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD7 protein_id gnl|my_center|LOCUS_00960 85157 86266 gene locus_tag LOCUS_00970 gene glnL 85157 86266 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115631.1 protein_id gnl|my_center|LOCUS_00970 86253 87734 gene locus_tag LOCUS_00980 gene glnG 86253 87734 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206993.1 protein_id gnl|my_center|LOCUS_00980 88118 87798 gene locus_tag LOCUS_00990 88118 87798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121003.1 protein_id gnl|my_center|LOCUS_00990 90227 88347 gene locus_tag LOCUS_01000 gene mnmG 90227 88347 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW1 protein_id gnl|my_center|LOCUS_01000 90623 90973 gene locus_tag LOCUS_01010 90623 90973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 91220 92125 gene locus_tag LOCUS_01020 gene prmA 91220 92125 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW3 protein_id gnl|my_center|LOCUS_01020 92141 93016 gene locus_tag LOCUS_01030 92141 93016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207144.1 protein_id gnl|my_center|LOCUS_01030 93406 93675 gene locus_tag LOCUS_01040 gene fis 93406 93675 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000816.1 protein_id gnl|my_center|LOCUS_01040 93771 95345 gene locus_tag LOCUS_01050 gene purH 93771 95345 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_01050 95475 96758 gene locus_tag LOCUS_01060 gene purD 95475 96758 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW7 protein_id gnl|my_center|LOCUS_01060 97411 98280 gene locus_tag LOCUS_01070 gene yhcJ 97411 98280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207147.1 protein_id gnl|my_center|LOCUS_01070 98355 99380 gene locus_tag LOCUS_01080 gene metN2 98355 99380 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW9 protein_id gnl|my_center|LOCUS_01080 99377 100072 gene locus_tag LOCUS_01090 gene metN 99377 100072 CDS product methionine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207148.1 protein_id gnl|my_center|LOCUS_01090 100314 103877 gene locus_tag LOCUS_01100 gene dnaE 100314 103877 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLL6 protein_id gnl|my_center|LOCUS_01100 103912 104769 gene locus_tag LOCUS_01110 gene trmJ 103912 104769 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLL5 protein_id gnl|my_center|LOCUS_01110 104762 105571 gene locus_tag LOCUS_01120 gene cysE 104762 105571 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_01120 105676 106602 gene locus_tag LOCUS_01130 105676 106602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206520.1 protein_id gnl|my_center|LOCUS_01130 106728 108746 gene locus_tag LOCUS_01140 106728 108746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206519.1 protein_id gnl|my_center|LOCUS_01140 109188 111836 gene locus_tag LOCUS_01150 gene mutS 109188 111836 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIZ0 protein_id gnl|my_center|LOCUS_01150 112031 112354 gene locus_tag LOCUS_01160 gene fdxA 112031 112354 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_01160 112523 113215 gene locus_tag LOCUS_01170 112523 113215 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115771.1 protein_id gnl|my_center|LOCUS_01170 113379 114101 gene locus_tag LOCUS_01180 113379 114101 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206262.1 protein_id gnl|my_center|LOCUS_01180 115081 114239 gene locus_tag LOCUS_01190 115081 114239 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115820.1 protein_id gnl|my_center|LOCUS_01190 115842 115225 gene locus_tag LOCUS_01200 115842 115225 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206261.1 protein_id gnl|my_center|LOCUS_01200 116434 115835 gene locus_tag LOCUS_01210 116434 115835 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206260.1 protein_id gnl|my_center|LOCUS_01210 117730 116540 gene locus_tag LOCUS_01220 gene cyaD 117730 116540 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 protein_id gnl|my_center|LOCUS_01220 119865 117727 gene locus_tag LOCUS_01230 gene paxB 119865 117727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 protein_id gnl|my_center|LOCUS_01230 121274 119862 gene locus_tag LOCUS_01240 121274 119862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 122296 121550 gene locus_tag LOCUS_01250 122296 121550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_01250 122862 122296 gene locus_tag LOCUS_01260 gene lptA 122862 122296 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX6 protein_id gnl|my_center|LOCUS_01260 123394 122846 gene locus_tag LOCUS_01270 123394 122846 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070181.1 protein_id gnl|my_center|LOCUS_01270 123975 123436 gene locus_tag LOCUS_01280 gene kdsC 123975 123436 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_01280 124956 123979 gene locus_tag LOCUS_01290 gene kdsD 124956 123979 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX3 protein_id gnl|my_center|LOCUS_01290 125171 126592 gene locus_tag LOCUS_01300 gene cysS 125171 126592 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX2 protein_id gnl|my_center|LOCUS_01300 126655 126730 gene locus_tag LOCUS_t00010 126655 126730 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 128848 127109 gene locus_tag LOCUS_01310 gene bccA 128848 127109 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206324.1 protein_id gnl|my_center|LOCUS_01310 130427 128838 gene locus_tag LOCUS_01320 gene ybgK 130427 128838 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206323.1 protein_id gnl|my_center|LOCUS_01320 131255 130446 gene locus_tag LOCUS_01330 131255 130446 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJK7 protein_id gnl|my_center|LOCUS_01330 132029 131271 gene locus_tag LOCUS_01340 132029 131271 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJK6 protein_id gnl|my_center|LOCUS_01340 133281 132049 gene locus_tag LOCUS_01350 gene ycsG 133281 132049 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206320.1 protein_id gnl|my_center|LOCUS_01350 133988 134968 gene locus_tag LOCUS_01360 133988 134968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 protein_id gnl|my_center|LOCUS_01360 134993 136024 gene locus_tag LOCUS_01370 gene metE 134993 136024 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_01370 136182 136676 gene locus_tag LOCUS_01380 gene rutF 136182 136676 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_01380 137818 137150 gene locus_tag LOCUS_01390 137818 137150 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119498.1 protein_id gnl|my_center|LOCUS_01390 139251 138340 gene locus_tag LOCUS_01400 gene rbcR 139251 138340 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206319.1 protein_id gnl|my_center|LOCUS_01400 139651 141285 gene locus_tag LOCUS_01410 gene mqo 139651 141285 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG75 protein_id gnl|my_center|LOCUS_01410 141558 142031 gene locus_tag LOCUS_01420 141558 142031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206016.1 protein_id gnl|my_center|LOCUS_01420 143253 142168 gene locus_tag LOCUS_01430 143253 142168 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526219.1 protein_id gnl|my_center|LOCUS_01430 149813 143346 gene locus_tag LOCUS_01440 149813 143346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 150231 149779 gene locus_tag LOCUS_01450 150231 149779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208472.1 protein_id gnl|my_center|LOCUS_01450 151578 150928 gene locus_tag LOCUS_01460 gene modC 151578 150928 CDS product molybdate-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Y1 protein_id gnl|my_center|LOCUS_01460 152263 151580 gene locus_tag LOCUS_01470 gene modB 152263 151580 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206719.1 protein_id gnl|my_center|LOCUS_01470 153052 152291 gene locus_tag LOCUS_01480 gene modA 153052 152291 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 protein_id gnl|my_center|LOCUS_01480 154266 153067 gene locus_tag LOCUS_01490 gene moeA 154266 153067 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207006.1 protein_id gnl|my_center|LOCUS_01490 155228 154305 gene locus_tag LOCUS_01500 gene moaCB 155228 154305 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_01500 155832 155314 gene locus_tag LOCUS_01510 gene moaE 155832 155314 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207008.1 protein_id gnl|my_center|LOCUS_01510 156085 155834 gene locus_tag LOCUS_01520 156085 155834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187654.1 protein_id gnl|my_center|LOCUS_01520 157124 156087 gene locus_tag LOCUS_01530 gene moaA 157124 156087 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGG5 protein_id gnl|my_center|LOCUS_01530 157885 157259 gene locus_tag LOCUS_01540 gene mobA 157885 157259 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207011.1 protein_id gnl|my_center|LOCUS_01540 160662 157882 gene locus_tag LOCUS_01550 gene nasA 160662 157882 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 protein_id gnl|my_center|LOCUS_01550 162576 160957 gene locus_tag LOCUS_01560 gene nasD 162576 160957 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207013.1 protein_id gnl|my_center|LOCUS_01560 165155 162606 gene locus_tag LOCUS_01570 gene nasB 165155 162606 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_01570 166388 165186 gene locus_tag LOCUS_01580 gene crnA 166388 165186 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_01580 166971 167558 gene locus_tag LOCUS_01590 gene nasT 166971 167558 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115726.1 protein_id gnl|my_center|LOCUS_01590 167562 168566 gene locus_tag LOCUS_01600 gene nasF 167562 168566 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207015.1 protein_id gnl|my_center|LOCUS_01600 168750 169964 gene locus_tag LOCUS_01610 gene dhaT 168750 169964 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_01610 170129 171097 gene locus_tag LOCUS_01620 170129 171097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_01620 172307 171126 gene locus_tag LOCUS_01630 172307 171126 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_01630 172511 174022 gene locus_tag LOCUS_01640 gene aldA 172511 174022 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207086.1 protein_id gnl|my_center|LOCUS_01640 174236 174952 gene locus_tag LOCUS_01650 gene yfeJ 174236 174952 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 protein_id gnl|my_center|LOCUS_01650 175594 175013 gene locus_tag LOCUS_01660 gene yceI 175594 175013 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 protein_id gnl|my_center|LOCUS_01660 176184 175969 gene locus_tag LOCUS_01670 176184 175969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 178499 176511 gene locus_tag LOCUS_01680 gene tktA 178499 176511 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM84 protein_id gnl|my_center|LOCUS_01680 179302 180468 gene locus_tag LOCUS_01690 gene metK 179302 180468 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_01690 180766 180521 gene locus_tag LOCUS_01700 180766 180521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 181088 181276 gene locus_tag LOCUS_01710 181088 181276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 181990 181418 gene locus_tag LOCUS_01720 gene fxsA 181990 181418 CDS product FxsA cytoplasmic membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206565.1 protein_id gnl|my_center|LOCUS_01720 182113 182658 gene locus_tag LOCUS_01730 gene ruvC 182113 182658 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM75 protein_id gnl|my_center|LOCUS_01730 184181 182709 gene locus_tag LOCUS_01740 gene yjeF 184181 182709 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM73 protein_id gnl|my_center|LOCUS_01740 184205 185317 gene locus_tag LOCUS_01750 gene queG 184205 185317 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM72 protein_id gnl|my_center|LOCUS_01750 185603 186592 gene locus_tag LOCUS_01760 gene bioB 185603 186592 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM71 protein_id gnl|my_center|LOCUS_01760 186881 186654 gene locus_tag LOCUS_01770 186881 186654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206557.1 protein_id gnl|my_center|LOCUS_01770 187202 187744 gene locus_tag LOCUS_01780 gene pilin 187202 187744 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 protein_id gnl|my_center|LOCUS_01780 187820 188551 gene locus_tag LOCUS_01790 gene mrkB 187820 188551 CDS product fimbrial chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206740.1 protein_id gnl|my_center|LOCUS_01790 188607 191156 gene locus_tag LOCUS_01800 gene mrkC 188607 191156 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_01800 191153 192163 gene locus_tag LOCUS_01810 gene mrkD 191153 192163 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206738.1 protein_id gnl|my_center|LOCUS_01810 192280 192576 gene locus_tag LOCUS_01820 192280 192576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 192963 193769 gene locus_tag LOCUS_01830 192963 193769 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268502.1 protein_id gnl|my_center|LOCUS_01830 193795 194793 gene locus_tag LOCUS_01840 193795 194793 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_01840 195034 194958 gene locus_tag LOCUS_t00020 195034 194958 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 196265 196828 gene locus_tag LOCUS_01850 196265 196828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 196942 197691 gene locus_tag LOCUS_01860 196942 197691 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLP9 protein_id gnl|my_center|LOCUS_01860 198280 197810 gene locus_tag LOCUS_01870 gene lrp 198280 197810 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050132.1 protein_id gnl|my_center|LOCUS_01870 199102 198338 gene locus_tag LOCUS_01880 199102 198338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 199571 200773 gene locus_tag LOCUS_01890 gene soxC 199571 200773 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206539.1 protein_id gnl|my_center|LOCUS_01890 200784 202007 gene locus_tag LOCUS_01900 gene soxC 200784 202007 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206538.1 protein_id gnl|my_center|LOCUS_01900 202007 203431 gene locus_tag LOCUS_01910 gene soxA 202007 203431 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206537.1 protein_id gnl|my_center|LOCUS_01910 203447 204289 gene locus_tag LOCUS_01920 203447 204289 CDS product methionine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206536.1 protein_id gnl|my_center|LOCUS_01920 204301 205371 gene locus_tag LOCUS_01930 gene metN1 204301 205371 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN6 protein_id gnl|my_center|LOCUS_01930 205352 206011 gene locus_tag LOCUS_01940 gene metI 205352 206011 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069679.1 protein_id gnl|my_center|LOCUS_01940 206125 207216 gene locus_tag LOCUS_01950 gene ychF 206125 207216 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_01950 207408 207665 gene locus_tag LOCUS_01960 207408 207665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206531.1 protein_id gnl|my_center|LOCUS_01960 208400 207918 gene locus_tag LOCUS_01970 208400 207918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483316.1 protein_id gnl|my_center|LOCUS_01970 208502 209257 gene locus_tag LOCUS_01980 208502 209257 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206530.1 protein_id gnl|my_center|LOCUS_01980 209247 209597 gene locus_tag LOCUS_01990 209247 209597 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002133404.1 protein_id gnl|my_center|LOCUS_01990 209756 210961 gene locus_tag LOCUS_02000 gene purT 209756 210961 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM6 protein_id gnl|my_center|LOCUS_02000 210992 213658 gene locus_tag LOCUS_02010 gene glnD 210992 213658 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM5 protein_id gnl|my_center|LOCUS_02010 213683 214852 gene locus_tag LOCUS_02020 gene dapL 213683 214852 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 protein_id gnl|my_center|LOCUS_02020 215414 214932 gene locus_tag LOCUS_02030 gene gpo 215414 214932 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_02030 215830 215411 gene locus_tag LOCUS_02040 gene msrB 215830 215411 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM0 protein_id gnl|my_center|LOCUS_02040 215984 217219 gene locus_tag LOCUS_02050 215984 217219 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206525.1 protein_id gnl|my_center|LOCUS_02050 217348 217515 gene locus_tag LOCUS_02060 217348 217515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 217621 218442 gene locus_tag LOCUS_02070 gene rluE 217621 218442 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH0 protein_id gnl|my_center|LOCUS_02070 220845 218614 gene locus_tag LOCUS_02080 gene icd2 220845 218614 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400583.1 protein_id gnl|my_center|LOCUS_02080 223173 221470 gene locus_tag LOCUS_02090 223173 221470 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207339.1 protein_id gnl|my_center|LOCUS_02090 223355 224665 gene locus_tag LOCUS_02100 gene dacD 223355 224665 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207340.1 protein_id gnl|my_center|LOCUS_02100 225066 225584 gene locus_tag LOCUS_02110 gene slyD 225066 225584 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_02110 226112 225708 gene locus_tag LOCUS_02120 gene rnk 226112 225708 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_02120 227570 226317 gene locus_tag LOCUS_02130 gene glyA 227570 226317 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_02130 227970 228668 gene locus_tag LOCUS_02140 gene exoX 227970 228668 CDS product DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_02140 228757 229338 gene locus_tag LOCUS_02150 228757 229338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207238.1 protein_id gnl|my_center|LOCUS_02150 229865 229790 gene locus_tag LOCUS_t00030 229865 229790 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 230054 230989 gene locus_tag LOCUS_02160 gene yadG 230054 230989 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 protein_id gnl|my_center|LOCUS_02160 230986 231759 gene locus_tag LOCUS_02170 gene yadH 230986 231759 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_02170 231759 232574 gene locus_tag LOCUS_02180 gene queF 231759 232574 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ66 protein_id gnl|my_center|LOCUS_02180 232599 233249 gene locus_tag LOCUS_02190 232599 233249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_02190 233784 234785 gene locus_tag LOCUS_02200 gene mltB 233784 234785 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207240.1 protein_id gnl|my_center|LOCUS_02200 235072 235680 gene locus_tag LOCUS_02210 235072 235680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 protein_id gnl|my_center|LOCUS_02210 236534 236220 gene locus_tag LOCUS_02220 236534 236220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 237246 236536 gene locus_tag LOCUS_02230 237246 236536 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 protein_id gnl|my_center|LOCUS_02230 238186 237350 gene locus_tag LOCUS_02240 gene chpD 238186 237350 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 protein_id gnl|my_center|LOCUS_02240 238792 238262 gene locus_tag LOCUS_02250 238792 238262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207244.1 protein_id gnl|my_center|LOCUS_02250 239878 239003 gene locus_tag LOCUS_02260 gene tsf 239878 239003 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ75 protein_id gnl|my_center|LOCUS_02260 240786 240019 gene locus_tag LOCUS_02270 gene rpsB 240786 240019 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ76 protein_id gnl|my_center|LOCUS_02270 240994 241821 gene locus_tag LOCUS_02280 gene map 240994 241821 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ77 protein_id gnl|my_center|LOCUS_02280 242066 243292 gene locus_tag LOCUS_02290 gene aspC 242066 243292 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_02290 243712 244146 gene locus_tag LOCUS_02300 243712 244146 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_02300 244647 244192 gene locus_tag LOCUS_02310 244647 244192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207361.1 protein_id gnl|my_center|LOCUS_02310 244888 244963 gene locus_tag LOCUS_t00040 244888 244963 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 246368 245184 gene locus_tag LOCUS_02320 gene algW 246368 245184 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 protein_id gnl|my_center|LOCUS_02320 246539 247297 gene locus_tag LOCUS_02330 246539 247297 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ93 protein_id gnl|my_center|LOCUS_02330 247454 248080 gene locus_tag LOCUS_02340 gene sodB 247454 248080 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_02340 248225 248300 gene locus_tag LOCUS_t00050 248225 248300 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 248306 248381 gene locus_tag LOCUS_t00060 248306 248381 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 248665 248740 gene locus_tag LOCUS_t00070 248665 248740 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 248837 249241 gene locus_tag LOCUS_02350 248837 249241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068176.1 protein_id gnl|my_center|LOCUS_02350 250186 249308 gene locus_tag LOCUS_02360 gene ubiA 250186 249308 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ7 protein_id gnl|my_center|LOCUS_02360 250689 250225 gene locus_tag LOCUS_02370 gene ubiC 250689 250225 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ8 protein_id gnl|my_center|LOCUS_02370 251022 250747 gene locus_tag LOCUS_02380 251022 250747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 252527 251112 gene locus_tag LOCUS_02390 gene glnA 252527 251112 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ9 protein_id gnl|my_center|LOCUS_02390 253443 254027 gene locus_tag LOCUS_02400 gene trpG 253443 254027 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207264.1 protein_id gnl|my_center|LOCUS_02400 254036 255082 gene locus_tag LOCUS_02410 gene trpD 254036 255082 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR5 protein_id gnl|my_center|LOCUS_02410 255104 255910 gene locus_tag LOCUS_02420 gene trpC 255104 255910 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR6 protein_id gnl|my_center|LOCUS_02420 255870 256607 gene locus_tag LOCUS_02430 255870 256607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_02430 256695 257249 gene locus_tag LOCUS_02440 gene folE 256695 257249 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS1 protein_id gnl|my_center|LOCUS_02440 257661 257413 gene locus_tag LOCUS_02450 257661 257413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 259508 257622 gene locus_tag LOCUS_02460 259508 257622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_02460 260054 259581 gene locus_tag LOCUS_02470 260054 259581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_02470 261004 260201 gene locus_tag LOCUS_02480 261004 260201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207274.1 protein_id gnl|my_center|LOCUS_02480 262111 261041 gene locus_tag LOCUS_02490 gene hemE 262111 261041 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS6 protein_id gnl|my_center|LOCUS_02490 262313 263551 gene locus_tag LOCUS_02500 262313 263551 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 protein_id gnl|my_center|LOCUS_02500 263774 264466 gene locus_tag LOCUS_02510 263774 264466 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207293.1 protein_id gnl|my_center|LOCUS_02510 264633 265508 gene locus_tag LOCUS_02520 gene hmt-1 264633 265508 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206015.1 protein_id gnl|my_center|LOCUS_02520 265521 266825 gene locus_tag LOCUS_02530 gene arcD 265521 266825 CDS product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117544.1 protein_id gnl|my_center|LOCUS_02530 267312 267223 gene locus_tag LOCUS_t00080 267312 267223 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 269393 267696 gene locus_tag LOCUS_02540 gene dld 269393 267696 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 protein_id gnl|my_center|LOCUS_02540 270844 269690 gene locus_tag LOCUS_02550 gene lldD 270844 269690 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS9 protein_id gnl|my_center|LOCUS_02550 271590 270841 gene locus_tag LOCUS_02560 gene lldR 271590 270841 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208064.1 protein_id gnl|my_center|LOCUS_02560 273287 271623 gene locus_tag LOCUS_02570 gene lldP 273287 271623 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208063.1 protein_id gnl|my_center|LOCUS_02570 274647 273730 gene locus_tag LOCUS_02580 gene yoaV 274647 273730 CDS product putative transporter YoaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34416 protein_id gnl|my_center|LOCUS_02580 274818 275675 gene locus_tag LOCUS_02590 gene czcR 274818 275675 CDS product HTH-type transcriptional regulator CzcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71025 protein_id gnl|my_center|LOCUS_02590 275931 277274 gene locus_tag LOCUS_02600 gene argG 275931 277274 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI5 protein_id gnl|my_center|LOCUS_02600 277529 278569 gene locus_tag LOCUS_02610 gene pyrC 277529 278569 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI3 protein_id gnl|my_center|LOCUS_02610 278566 279213 gene locus_tag LOCUS_02620 gene rnt 278566 279213 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI2 protein_id gnl|my_center|LOCUS_02620 279234 279309 gene locus_tag LOCUS_t00090 279234 279309 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 279695 279770 gene locus_tag LOCUS_t00100 279695 279770 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 279877 281295 gene locus_tag LOCUS_02630 gene mmuP 279877 281295 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207841.1 protein_id gnl|my_center|LOCUS_02630 281379 282266 gene locus_tag LOCUS_02640 281379 282266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207842.1 protein_id gnl|my_center|LOCUS_02640 282400 282475 gene locus_tag LOCUS_t00110 282400 282475 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 282518 282593 gene locus_tag LOCUS_t00120 282518 282593 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 283345 282905 gene locus_tag LOCUS_02650 283345 282905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 283547 283996 gene locus_tag LOCUS_02660 283547 283996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 285251 284007 gene locus_tag LOCUS_02670 gene noxB 285251 284007 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206115.1 protein_id gnl|my_center|LOCUS_02670 286931 285342 gene locus_tag LOCUS_02680 gene yejF 286931 285342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_02680 287919 286906 gene locus_tag LOCUS_02690 gene yejE 287919 286906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_02690 288953 287919 gene locus_tag LOCUS_02700 gene yejB 288953 287919 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206112.1 protein_id gnl|my_center|LOCUS_02700 290857 289019 gene locus_tag LOCUS_02710 290857 289019 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 protein_id gnl|my_center|LOCUS_02710 294087 290887 gene locus_tag LOCUS_02720 gene mltD 294087 290887 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 protein_id gnl|my_center|LOCUS_02720 294360 295766 gene locus_tag LOCUS_02730 gene dnaQ 294360 295766 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHH4 protein_id gnl|my_center|LOCUS_02730 295893 297536 gene locus_tag LOCUS_02740 295893 297536 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206108.1 protein_id gnl|my_center|LOCUS_02740 297536 298309 gene locus_tag LOCUS_02750 gene nudC 297536 298309 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 protein_id gnl|my_center|LOCUS_02750 299198 298311 gene locus_tag LOCUS_02760 gene afmiD 299198 298311 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206106.1 protein_id gnl|my_center|LOCUS_02760 299871 299188 gene locus_tag LOCUS_02770 299871 299188 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_02770 300362 299931 gene locus_tag LOCUS_02780 300362 299931 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH09 protein_id gnl|my_center|LOCUS_02780 301162 300359 gene locus_tag LOCUS_02790 301162 300359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 301310 302155 gene locus_tag LOCUS_02800 gene rsmI 301310 302155 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH08 protein_id gnl|my_center|LOCUS_02800 302503 302255 gene locus_tag LOCUS_02810 302503 302255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117665.1 protein_id gnl|my_center|LOCUS_02810 303912 302680 gene locus_tag LOCUS_02820 gene ubiF 303912 302680 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_02820 305120 303909 gene locus_tag LOCUS_02830 gene ubiH 305120 303909 CDS product ubiquinone biosynthesis protein UbiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_02830 306488 305157 gene locus_tag LOCUS_02840 gene pepP 306488 305157 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_02840 307195 306566 gene locus_tag LOCUS_02850 307195 306566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_02850 307260 307811 gene locus_tag LOCUS_02860 307260 307811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206098.1 protein_id gnl|my_center|LOCUS_02860 307814 308098 gene locus_tag LOCUS_02870 307814 308098 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ6 protein_id gnl|my_center|LOCUS_02870 308575 308441 gene locus_tag LOCUS_02880 308575 308441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 308764 310842 gene locus_tag LOCUS_02890 gene ppk 308764 310842 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_02890 311095 313194 gene locus_tag LOCUS_02900 gene fhuA 311095 313194 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206116.1 protein_id gnl|my_center|LOCUS_02900 314793 313303 gene locus_tag LOCUS_02910 gene mocR 314793 313303 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206378.1 protein_id gnl|my_center|LOCUS_02910 314899 315354 gene locus_tag LOCUS_02920 gene hpa2 314899 315354 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206377.1 protein_id gnl|my_center|LOCUS_02920 316785 315511 gene locus_tag LOCUS_02930 gene gdhA 316785 315511 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_02930 317735 316809 gene locus_tag LOCUS_02940 gene hutG 317735 316809 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI04 protein_id gnl|my_center|LOCUS_02940 318978 317779 gene locus_tag LOCUS_02950 gene hutI 318978 317779 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI05 protein_id gnl|my_center|LOCUS_02950 320440 319028 gene locus_tag LOCUS_02960 gene proY 320440 319028 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804358.1 protein_id gnl|my_center|LOCUS_02960 322049 320520 gene locus_tag LOCUS_02970 gene hutH 322049 320520 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI07 protein_id gnl|my_center|LOCUS_02970 323809 322139 gene locus_tag LOCUS_02980 gene hutU 323809 322139 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI08 protein_id gnl|my_center|LOCUS_02980 324634 324053 gene locus_tag LOCUS_02990 324634 324053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207980.1 protein_id gnl|my_center|LOCUS_02990 325383 324631 gene locus_tag LOCUS_03000 gene hutC 325383 324631 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207981.1 protein_id gnl|my_center|LOCUS_03000 325784 325488 gene locus_tag LOCUS_03010 325784 325488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 327916 326441 gene locus_tag LOCUS_03020 327916 326441 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207544.1 protein_id gnl|my_center|LOCUS_03020 329525 329388 gene locus_tag LOCUS_03030 329525 329388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 329524 330624 gene locus_tag LOCUS_03040 gene dctA 329524 330624 CDS product transporter dicarboxylate/amino acid:cation Na+/H+ symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 protein_id gnl|my_center|LOCUS_03040 331701 330811 gene locus_tag LOCUS_03050 gene yjiE 331701 330811 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206693.1 protein_id gnl|my_center|LOCUS_03050 331836 333251 gene locus_tag LOCUS_03060 gene aspA 331836 333251 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206691.1 protein_id gnl|my_center|LOCUS_03060 335568 333433 gene locus_tag LOCUS_03070 gene foxA 335568 333433 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207927.1 protein_id gnl|my_center|LOCUS_03070 337565 335865 gene locus_tag LOCUS_03080 gene sfcA 337565 335865 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF5 protein_id gnl|my_center|LOCUS_03080 340791 337966 gene locus_tag LOCUS_03090 340791 337966 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_03090 340876 341256 gene locus_tag LOCUS_03100 340876 341256 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708751.1 protein_id gnl|my_center|LOCUS_03100 341304 341891 gene locus_tag LOCUS_03110 341304 341891 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ2 protein_id gnl|my_center|LOCUS_03110 342039 344465 gene locus_tag LOCUS_03120 gene lon 342039 344465 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ1 protein_id gnl|my_center|LOCUS_03120 344889 345371 gene locus_tag LOCUS_03130 gene rlmH 344889 345371 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ0 protein_id gnl|my_center|LOCUS_03130 345554 346330 gene locus_tag LOCUS_03140 345554 346330 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_03140 346470 347237 gene locus_tag LOCUS_03150 346470 347237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 348652 347306 gene locus_tag LOCUS_03160 gene gdhA 348652 347306 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY7 protein_id gnl|my_center|LOCUS_03160 349043 349906 gene locus_tag LOCUS_03170 gene rnfB 349043 349906 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 protein_id gnl|my_center|LOCUS_03170 349909 350598 gene locus_tag LOCUS_03180 gene nth 349909 350598 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY5 protein_id gnl|my_center|LOCUS_03180 350788 350606 gene locus_tag LOCUS_03190 350788 350606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 351545 350886 gene locus_tag LOCUS_03200 gene adk 351545 350886 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_03200 352947 351631 gene locus_tag LOCUS_03210 352947 351631 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_03210 353401 355407 gene locus_tag LOCUS_03220 gene pbpA 353401 355407 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_03220 355411 355968 gene locus_tag LOCUS_03230 gene rsmD 355411 355968 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX9 protein_id gnl|my_center|LOCUS_03230 356304 356633 gene locus_tag LOCUS_03240 356304 356633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117704.1 protein_id gnl|my_center|LOCUS_03240 357410 356817 gene locus_tag LOCUS_03250 357410 356817 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_03250 359352 357718 gene locus_tag LOCUS_03260 gene groL 359352 357718 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT7 protein_id gnl|my_center|LOCUS_03260 359699 359409 gene locus_tag LOCUS_03270 gene groS 359699 359409 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_03270 360657 359896 gene locus_tag LOCUS_03280 360657 359896 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207450.1 protein_id gnl|my_center|LOCUS_03280 361573 360638 gene locus_tag LOCUS_03290 361573 360638 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115559.1 protein_id gnl|my_center|LOCUS_03290 361981 363813 gene locus_tag LOCUS_03300 gene pckG 361981 363813 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU3 protein_id gnl|my_center|LOCUS_03300 363915 364280 gene locus_tag LOCUS_03310 363915 364280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207890.1 protein_id gnl|my_center|LOCUS_03310 365994 364474 gene locus_tag LOCUS_03320 gene glpD 365994 364474 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207451.1 protein_id gnl|my_center|LOCUS_03320 366431 366859 gene locus_tag LOCUS_03330 366431 366859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115580.1 protein_id gnl|my_center|LOCUS_03330 367553 366885 gene locus_tag LOCUS_03340 367553 366885 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_03340 368634 367786 gene locus_tag LOCUS_03350 gene folD 368634 367786 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_03350 368788 368861 gene locus_tag LOCUS_t00130 368788 368861 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 368875 368960 gene locus_tag LOCUS_t00140 368875 368960 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 370099 369104 gene locus_tag LOCUS_03360 370099 369104 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 protein_id gnl|my_center|LOCUS_03360 371945 370329 gene locus_tag LOCUS_03370 gene cysNC 371945 370329 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW1 protein_id gnl|my_center|LOCUS_03370 372899 371985 gene locus_tag LOCUS_03380 gene cysD 372899 371985 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_03380 374210 373320 gene locus_tag LOCUS_03390 gene sucD 374210 373320 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX7 protein_id gnl|my_center|LOCUS_03390 375388 374222 gene locus_tag LOCUS_03400 gene sucC 375388 374222 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX8 protein_id gnl|my_center|LOCUS_03400 376995 375562 gene locus_tag LOCUS_03410 gene lpdG 376995 375562 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX9 protein_id gnl|my_center|LOCUS_03410 378281 377064 gene locus_tag LOCUS_03420 gene sucB 378281 377064 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY0 protein_id gnl|my_center|LOCUS_03420 381121 378281 gene locus_tag LOCUS_03430 gene sucA 381121 378281 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_03430 382608 381898 gene locus_tag LOCUS_03440 gene sdhB 382608 381898 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 protein_id gnl|my_center|LOCUS_03440 384521 382623 gene locus_tag LOCUS_03450 gene sdhA 384521 382623 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME4 protein_id gnl|my_center|LOCUS_03450 384899 384534 gene locus_tag LOCUS_03460 gene sdhD 384899 384534 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME5 protein_id gnl|my_center|LOCUS_03460 385288 384899 gene locus_tag LOCUS_03470 gene sdhC 385288 384899 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207477.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence02 996 130 gene locus_tag LOCUS_03480 996 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1175 2179 gene locus_tag LOCUS_03490 gene yerI 1175 2179 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 protein_id gnl|my_center|LOCUS_03490 2271 3305 gene locus_tag LOCUS_03500 gene yesN 2271 3305 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_03500 4882 3533 gene locus_tag LOCUS_03510 4882 3533 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 protein_id gnl|my_center|LOCUS_03510 6595 5384 gene locus_tag LOCUS_03520 6595 5384 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268090.1 protein_id gnl|my_center|LOCUS_03520 7388 6786 gene locus_tag LOCUS_03530 7388 6786 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_03530 8116 7574 gene locus_tag LOCUS_03540 gene yrdA 8116 7574 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 protein_id gnl|my_center|LOCUS_03540 9359 8211 gene locus_tag LOCUS_03550 gene dacC 9359 8211 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_03550 9863 9474 gene locus_tag LOCUS_03560 9863 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118406.1 protein_id gnl|my_center|LOCUS_03560 10454 10077 gene locus_tag LOCUS_03570 10454 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 10890 11705 gene locus_tag LOCUS_03580 gene nlpD 10890 11705 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_03580 11797 12726 gene locus_tag LOCUS_03590 gene aaeR 11797 12726 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 protein_id gnl|my_center|LOCUS_03590 13996 12785 gene locus_tag LOCUS_03600 gene argD 13996 12785 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_03600 14161 14502 gene locus_tag LOCUS_03610 gene grxD 14161 14502 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_03610 17209 14564 gene locus_tag LOCUS_03620 gene ycbZ 17209 14564 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067989.1 protein_id gnl|my_center|LOCUS_03620 17325 19541 gene locus_tag LOCUS_03630 gene ampG4 17325 19541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207307.1 protein_id gnl|my_center|LOCUS_03630 19552 19953 gene locus_tag LOCUS_03640 gene gloA 19552 19953 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118996.1 protein_id gnl|my_center|LOCUS_03640 20097 21077 gene locus_tag LOCUS_03650 20097 21077 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207306.1 protein_id gnl|my_center|LOCUS_03650 21286 21516 gene locus_tag LOCUS_03660 gene rpmE 21286 21516 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJW3 protein_id gnl|my_center|LOCUS_03660 23717 21615 gene locus_tag LOCUS_03670 23717 21615 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207305.1 protein_id gnl|my_center|LOCUS_03670 25459 23714 gene locus_tag LOCUS_03680 25459 23714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207304.1 protein_id gnl|my_center|LOCUS_03680 26490 25474 gene locus_tag LOCUS_03690 26490 25474 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_03690 26561 27130 gene locus_tag LOCUS_03700 gene efp 26561 27130 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJV8 protein_id gnl|my_center|LOCUS_03700 27306 29399 gene locus_tag LOCUS_03710 gene cstA 27306 29399 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207301.1 protein_id gnl|my_center|LOCUS_03710 29396 29698 gene locus_tag LOCUS_03720 29396 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980869.1 protein_id gnl|my_center|LOCUS_03720 29989 29913 gene locus_tag LOCUS_t00150 29989 29913 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30489 30896 gene locus_tag LOCUS_03730 30489 30896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 30944 32341 gene locus_tag LOCUS_03740 30944 32341 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207846.1 protein_id gnl|my_center|LOCUS_03740 32341 33561 gene locus_tag LOCUS_03750 gene czcB 32341 33561 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207845.1 protein_id gnl|my_center|LOCUS_03750 33551 36700 gene locus_tag LOCUS_03760 gene czcA 33551 36700 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207844.1 protein_id gnl|my_center|LOCUS_03760 37451 36831 gene locus_tag LOCUS_03770 37451 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 37573 38175 gene locus_tag LOCUS_03780 37573 38175 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_03780 38360 39925 gene locus_tag LOCUS_03790 gene ahpF 38360 39925 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 protein_id gnl|my_center|LOCUS_03790 40504 40076 gene locus_tag LOCUS_03800 gene arsC 40504 40076 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLK5 protein_id gnl|my_center|LOCUS_03800 40437 40595 gene locus_tag LOCUS_03810 40437 40595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 40658 40909 gene locus_tag LOCUS_03820 gene arsR 40658 40909 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206514.1 protein_id gnl|my_center|LOCUS_03820 40915 41388 gene locus_tag LOCUS_03830 gene arsC 40915 41388 CDS product low molecular weight phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 protein_id gnl|my_center|LOCUS_03830 41392 42432 gene locus_tag LOCUS_03840 gene arsB 41392 42432 CDS product arsenite transporter ACR3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206515.1 protein_id gnl|my_center|LOCUS_03840 42433 43137 gene locus_tag LOCUS_03850 gene arsH 42433 43137 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 protein_id gnl|my_center|LOCUS_03850 43597 43139 gene locus_tag LOCUS_03860 43597 43139 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206102.1 protein_id gnl|my_center|LOCUS_03860 43632 44249 gene locus_tag LOCUS_03870 43632 44249 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_03870 45202 44363 gene locus_tag LOCUS_03880 45202 44363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066203.1 protein_id gnl|my_center|LOCUS_03880 46264 46830 gene locus_tag LOCUS_03890 46264 46830 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121343.1 protein_id gnl|my_center|LOCUS_03890 48221 47442 gene locus_tag LOCUS_03900 gene fpr 48221 47442 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118187.1 protein_id gnl|my_center|LOCUS_03900 48324 49055 gene locus_tag LOCUS_03910 48324 49055 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_03910 50274 49030 gene locus_tag LOCUS_03920 50274 49030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073461.1 protein_id gnl|my_center|LOCUS_03920 50459 52216 gene locus_tag LOCUS_03930 gene xcpR 50459 52216 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_03930 52279 52680 gene locus_tag LOCUS_03940 52279 52680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207222.1 protein_id gnl|my_center|LOCUS_03940 52831 53490 gene locus_tag LOCUS_03950 gene qseB 52831 53490 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 protein_id gnl|my_center|LOCUS_03950 53492 54835 gene locus_tag LOCUS_03960 gene qseC 53492 54835 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207220.1 protein_id gnl|my_center|LOCUS_03960 55074 54904 gene locus_tag LOCUS_03970 55074 54904 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118129.1 protein_id gnl|my_center|LOCUS_03970 55215 56114 gene locus_tag LOCUS_03980 55215 56114 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207219.1 protein_id gnl|my_center|LOCUS_03980 56738 56172 gene locus_tag LOCUS_03990 56738 56172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207218.1 protein_id gnl|my_center|LOCUS_03990 59153 56754 gene locus_tag LOCUS_04000 gene mrcB 59153 56754 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ35 protein_id gnl|my_center|LOCUS_04000 59512 60426 gene locus_tag LOCUS_04010 gene nadK 59512 60426 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ34 protein_id gnl|my_center|LOCUS_04010 60427 60696 gene locus_tag LOCUS_04020 60427 60696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_04020 61910 60897 gene locus_tag LOCUS_04030 61910 60897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_04030 62298 63635 gene locus_tag LOCUS_04040 gene dctA 62298 63635 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207216.1 protein_id gnl|my_center|LOCUS_04040 63835 64944 gene locus_tag LOCUS_04050 gene pheA 63835 64944 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 protein_id gnl|my_center|LOCUS_04050 65110 67356 gene locus_tag LOCUS_04060 gene aroA 65110 67356 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_04060 67396 67845 gene locus_tag LOCUS_04070 67396 67845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207212.1 protein_id gnl|my_center|LOCUS_04070 68632 68003 gene locus_tag LOCUS_04080 gene rp471 68632 68003 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207209.1 protein_id gnl|my_center|LOCUS_04080 68757 69527 gene locus_tag LOCUS_04090 68757 69527 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ21 protein_id gnl|my_center|LOCUS_04090 70057 71379 gene locus_tag LOCUS_04100 70057 71379 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_04100 71447 72448 gene locus_tag LOCUS_04110 gene add 71447 72448 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_04110 72523 72891 gene locus_tag LOCUS_04120 72523 72891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 73510 72956 gene locus_tag LOCUS_04130 gene yceJ 73510 72956 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206183.1 protein_id gnl|my_center|LOCUS_04130 73735 74112 gene locus_tag LOCUS_04140 73735 74112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 74178 74756 gene locus_tag LOCUS_04150 gene rnhB 74178 74756 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI71 protein_id gnl|my_center|LOCUS_04150 75066 74812 gene locus_tag LOCUS_04160 gene csrA 75066 74812 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI72 protein_id gnl|my_center|LOCUS_04160 76561 75317 gene locus_tag LOCUS_04170 gene lysC 76561 75317 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI73 protein_id gnl|my_center|LOCUS_04170 79355 76662 gene locus_tag LOCUS_04180 gene alaS 79355 76662 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI74 protein_id gnl|my_center|LOCUS_04180 79833 80858 gene locus_tag LOCUS_04190 gene epD 79833 80858 CDS product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_04190 81045 81356 gene locus_tag LOCUS_04200 81045 81356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 81685 81386 gene locus_tag LOCUS_04210 81685 81386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522986.1 protein_id gnl|my_center|LOCUS_04210 82428 81682 gene locus_tag LOCUS_04220 82428 81682 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530159.1 protein_id gnl|my_center|LOCUS_04220 82588 83043 gene locus_tag LOCUS_04230 82588 83043 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 protein_id gnl|my_center|LOCUS_04230 83494 83084 gene locus_tag LOCUS_04240 gene lrpB 83494 83084 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207916.1 protein_id gnl|my_center|LOCUS_04240 83679 84161 gene locus_tag LOCUS_04250 gene ywoC 83679 84161 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207917.1 protein_id gnl|my_center|LOCUS_04250 84365 85531 gene locus_tag LOCUS_04260 gene hisZ 84365 85531 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI76 protein_id gnl|my_center|LOCUS_04260 85601 86920 gene locus_tag LOCUS_04270 gene purA 85601 86920 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI77 protein_id gnl|my_center|LOCUS_04270 87088 87396 gene locus_tag LOCUS_04280 87088 87396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121533.1 protein_id gnl|my_center|LOCUS_04280 87509 88285 gene locus_tag LOCUS_04290 gene oma1 87509 88285 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121572.1 protein_id gnl|my_center|LOCUS_04290 89454 88405 gene locus_tag LOCUS_04300 gene tas 89454 88405 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206188.1 protein_id gnl|my_center|LOCUS_04300 90441 89740 gene locus_tag LOCUS_04310 gene crp 90441 89740 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 protein_id gnl|my_center|LOCUS_04310 90590 91012 gene locus_tag LOCUS_04320 90590 91012 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_04320 91338 93920 gene locus_tag LOCUS_04330 gene clpB 91338 93920 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI86 protein_id gnl|my_center|LOCUS_04330 96265 94058 gene locus_tag LOCUS_04340 gene ycbY 96265 94058 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI89 protein_id gnl|my_center|LOCUS_04340 96720 97736 gene locus_tag LOCUS_04350 gene pyrB 96720 97736 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI91 protein_id gnl|my_center|LOCUS_04350 97746 98981 gene locus_tag LOCUS_04360 gene pyrX 97746 98981 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_04360 99149 100645 gene locus_tag LOCUS_04370 99149 100645 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206198.1 protein_id gnl|my_center|LOCUS_04370 100736 101524 gene locus_tag LOCUS_04380 100736 101524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_04380 101551 102225 gene locus_tag LOCUS_04390 gene cmoA 101551 102225 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 protein_id gnl|my_center|LOCUS_04390 103002 102286 gene locus_tag LOCUS_04400 gene trmB 103002 102286 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI97 protein_id gnl|my_center|LOCUS_04400 104616 103156 gene locus_tag LOCUS_04410 gene ybaR 104616 103156 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 protein_id gnl|my_center|LOCUS_04410 104822 105433 gene locus_tag LOCUS_04420 gene gstB 104822 105433 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121577.1 protein_id gnl|my_center|LOCUS_04420 105629 106210 gene locus_tag LOCUS_04430 gene mdaB 105629 106210 CDS product NADPH quinone reductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207799.1 protein_id gnl|my_center|LOCUS_04430 106234 106554 gene locus_tag LOCUS_04440 106234 106554 CDS product quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958587.1 protein_id gnl|my_center|LOCUS_04440 107411 106626 gene locus_tag LOCUS_04450 gene thiG 107411 106626 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL0 protein_id gnl|my_center|LOCUS_04450 107621 107424 gene locus_tag LOCUS_04460 gene thiS 107621 107424 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115323.1 protein_id gnl|my_center|LOCUS_04460 108012 107647 gene locus_tag LOCUS_04470 108012 107647 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_04470 109026 108157 gene locus_tag LOCUS_04480 gene rpoH 109026 108157 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_04480 109398 109165 gene locus_tag LOCUS_04490 109398 109165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 109781 109993 gene locus_tag LOCUS_04500 gene cspG 109781 109993 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 protein_id gnl|my_center|LOCUS_04500 110093 111244 gene locus_tag LOCUS_04510 gene rhlB 110093 111244 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK3 protein_id gnl|my_center|LOCUS_04510 111762 111382 gene locus_tag LOCUS_04520 111762 111382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_04520 111976 112551 gene locus_tag LOCUS_04530 111976 112551 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_04530 112585 113658 gene locus_tag LOCUS_04540 gene gpsA 112585 113658 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_04540 113805 114260 gene locus_tag LOCUS_04550 113805 114260 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_04550 114289 115428 gene locus_tag LOCUS_04560 114289 115428 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ8 protein_id gnl|my_center|LOCUS_04560 115428 115907 gene locus_tag LOCUS_04570 115428 115907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207201.1 protein_id gnl|my_center|LOCUS_04570 115998 117008 gene locus_tag LOCUS_04580 gene pyrD 115998 117008 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ6 protein_id gnl|my_center|LOCUS_04580 117005 117589 gene locus_tag LOCUS_04590 117005 117589 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 protein_id gnl|my_center|LOCUS_04590 117614 119152 gene locus_tag LOCUS_04600 gene purF 117614 119152 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ4 protein_id gnl|my_center|LOCUS_04600 119242 121131 gene locus_tag LOCUS_04610 119242 121131 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207198.1 protein_id gnl|my_center|LOCUS_04610 121244 121867 gene locus_tag LOCUS_04620 121244 121867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207197.1 protein_id gnl|my_center|LOCUS_04620 121886 122854 gene locus_tag LOCUS_04630 gene tkrA 121886 122854 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115253.1 protein_id gnl|my_center|LOCUS_04630 122982 124376 gene locus_tag LOCUS_04640 122982 124376 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ0 protein_id gnl|my_center|LOCUS_04640 124994 124548 gene locus_tag LOCUS_04650 124994 124548 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_04650 125242 125027 gene locus_tag LOCUS_04660 gene rpsU 125242 125027 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII8 protein_id gnl|my_center|LOCUS_04660 125388 126395 gene locus_tag LOCUS_04670 gene tsaD 125388 126395 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII7 protein_id gnl|my_center|LOCUS_04670 127108 126464 gene locus_tag LOCUS_04680 127108 126464 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 protein_id gnl|my_center|LOCUS_04680 127237 127716 gene locus_tag LOCUS_04690 127237 127716 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_04690 128670 127798 gene locus_tag LOCUS_04700 128670 127798 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 protein_id gnl|my_center|LOCUS_04700 128855 130366 gene locus_tag LOCUS_04710 128855 130366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_04710 130356 131174 gene locus_tag LOCUS_04720 130356 131174 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207194.1 protein_id gnl|my_center|LOCUS_04720 131282 131366 gene locus_tag LOCUS_t00160 131282 131366 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 131402 131475 gene locus_tag LOCUS_t00170 131402 131475 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 131515 131599 gene locus_tag LOCUS_t00180 131515 131599 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 132059 131856 gene locus_tag LOCUS_04730 132059 131856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119766.1 protein_id gnl|my_center|LOCUS_04730 132555 133073 gene locus_tag LOCUS_04740 132555 133073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 133956 133225 gene locus_tag LOCUS_04750 gene gloB 133956 133225 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHX1 protein_id gnl|my_center|LOCUS_04750 134172 135560 gene locus_tag LOCUS_04760 gene ydjN 134172 135560 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207331.1 protein_id gnl|my_center|LOCUS_04760 135704 136534 gene locus_tag LOCUS_04770 135704 136534 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207330.1 protein_id gnl|my_center|LOCUS_04770 136717 139449 gene locus_tag LOCUS_04780 136717 139449 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_04780 139992 139597 gene locus_tag LOCUS_04790 139992 139597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 protein_id gnl|my_center|LOCUS_04790 140091 140735 gene locus_tag LOCUS_04800 140091 140735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_04800 142233 140770 gene locus_tag LOCUS_04810 gene ygiF 142233 140770 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 protein_id gnl|my_center|LOCUS_04810 143850 142390 gene locus_tag LOCUS_04820 gene ygiF 143850 142390 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 protein_id gnl|my_center|LOCUS_04820 144435 145055 gene locus_tag LOCUS_04830 gene thiE 144435 145055 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF6 protein_id gnl|my_center|LOCUS_04830 145097 146395 gene locus_tag LOCUS_04840 gene hemL 145097 146395 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF5 protein_id gnl|my_center|LOCUS_04840 146737 147333 gene locus_tag LOCUS_04850 gene rluA 146737 147333 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_04850 147477 150314 gene locus_tag LOCUS_04860 gene hepA 147477 150314 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF2 protein_id gnl|my_center|LOCUS_04860 151475 150555 gene locus_tag LOCUS_04870 gene argF 151475 150555 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_04870 152237 151587 gene locus_tag LOCUS_04880 gene mtrR 152237 151587 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 protein_id gnl|my_center|LOCUS_04880 152489 153364 gene locus_tag LOCUS_04890 gene prpB 152489 153364 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0X5 protein_id gnl|my_center|LOCUS_04890 153391 154530 gene locus_tag LOCUS_04900 gene prpC 153391 154530 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_04900 >Feature sequence03 131 697 gene locus_tag LOCUS_04910 131 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1108 893 gene locus_tag LOCUS_04920 1108 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207879.1 protein_id gnl|my_center|LOCUS_04920 1391 1876 gene locus_tag LOCUS_04930 gene nudJ 1391 1876 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119006.1 protein_id gnl|my_center|LOCUS_04930 1869 3014 gene locus_tag LOCUS_04940 gene trmU 1869 3014 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX6 protein_id gnl|my_center|LOCUS_04940 3030 3761 gene locus_tag LOCUS_04950 gene hflD 3030 3761 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX7 protein_id gnl|my_center|LOCUS_04950 3816 5204 gene locus_tag LOCUS_04960 gene purB 3816 5204 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX8 protein_id gnl|my_center|LOCUS_04960 5276 5917 gene locus_tag LOCUS_04970 gene yjdF 5276 5917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 protein_id gnl|my_center|LOCUS_04970 6960 5998 gene locus_tag LOCUS_04980 gene sohB 6960 5998 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207313.1 protein_id gnl|my_center|LOCUS_04980 8193 7279 gene locus_tag LOCUS_04990 gene pstB 8193 7279 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_04990 9598 8207 gene locus_tag LOCUS_05000 gene pstA 9598 8207 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY3 protein_id gnl|my_center|LOCUS_05000 10974 9595 gene locus_tag LOCUS_05010 gene pstC 10974 9595 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKD9 protein_id gnl|my_center|LOCUS_05010 12102 11077 gene locus_tag LOCUS_05020 gene sphX 12102 11077 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118975.1 protein_id gnl|my_center|LOCUS_05020 13958 12579 gene locus_tag LOCUS_05030 gene aroP 13958 12579 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207315.1 protein_id gnl|my_center|LOCUS_05030 15822 14101 gene locus_tag LOCUS_05040 gene pdc1 15822 14101 CDS product pyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207316.1 protein_id gnl|my_center|LOCUS_05040 15957 16442 gene locus_tag LOCUS_05050 gene lrp 15957 16442 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700117.1 protein_id gnl|my_center|LOCUS_05050 17944 16514 gene locus_tag LOCUS_05060 17944 16514 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_05060 19763 18231 gene locus_tag LOCUS_05070 gene ddc 19763 18231 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 protein_id gnl|my_center|LOCUS_05070 21140 19767 gene locus_tag LOCUS_05080 gene dat 21140 19767 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 protein_id gnl|my_center|LOCUS_05080 21577 22281 gene locus_tag LOCUS_05090 21577 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_05090 22939 25518 gene locus_tag LOCUS_05100 22939 25518 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479527.1 protein_id gnl|my_center|LOCUS_05100 25570 27402 gene locus_tag LOCUS_05110 25570 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479497.1 protein_id gnl|my_center|LOCUS_05110 28470 27466 gene locus_tag LOCUS_05120 28470 27466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 30196 32112 gene locus_tag LOCUS_05130 30196 32112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 34284 32149 gene locus_tag LOCUS_05140 34284 32149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 34570 34277 gene locus_tag LOCUS_05150 34570 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 35279 34680 gene locus_tag LOCUS_05160 35279 34680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 36425 35307 gene locus_tag LOCUS_05170 36425 35307 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 protein_id gnl|my_center|LOCUS_05170 37748 36615 gene locus_tag LOCUS_05180 gene proB 37748 36615 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ0 protein_id gnl|my_center|LOCUS_05180 38995 37778 gene locus_tag LOCUS_05190 gene yhbZ 38995 37778 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ1 protein_id gnl|my_center|LOCUS_05190 39886 39524 gene locus_tag LOCUS_05200 gene ytfH 39886 39524 CDS product putative HTH-type transcriptional regulator YtfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACN2 protein_id gnl|my_center|LOCUS_05200 40002 40859 gene locus_tag LOCUS_05210 gene qorB 40002 40859 CDS product quinone oxidoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39315 protein_id gnl|my_center|LOCUS_05210 42425 40968 gene locus_tag LOCUS_05220 gene gap 42425 40968 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ4 protein_id gnl|my_center|LOCUS_05220 43592 42663 gene locus_tag LOCUS_05230 gene rarD 43592 42663 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207355.1 protein_id gnl|my_center|LOCUS_05230 44273 43731 gene locus_tag LOCUS_05240 gene blc 44273 43731 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207356.1 protein_id gnl|my_center|LOCUS_05240 46517 44439 gene locus_tag LOCUS_05250 gene uvrB 46517 44439 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ7 protein_id gnl|my_center|LOCUS_05250 46723 47511 gene locus_tag LOCUS_05260 46723 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207357.1 protein_id gnl|my_center|LOCUS_05260 47754 47575 gene locus_tag LOCUS_05270 47754 47575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118942.1 protein_id gnl|my_center|LOCUS_05270 48178 48035 gene locus_tag LOCUS_05280 48178 48035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 49671 48256 gene locus_tag LOCUS_05290 gene sthA 49671 48256 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_05290 49880 50893 gene locus_tag LOCUS_05300 gene lipA 49880 50893 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_05300 51647 51033 gene locus_tag LOCUS_05310 gene miaE 51647 51033 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_05310 52424 51699 gene locus_tag LOCUS_05320 gene pdxJ 52424 51699 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_05320 53148 52438 gene locus_tag LOCUS_05330 gene recO 53148 52438 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK9 protein_id gnl|my_center|LOCUS_05330 53349 53161 gene locus_tag LOCUS_05340 53349 53161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 54416 53388 gene locus_tag LOCUS_05350 gene era 54416 53388 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL1 protein_id gnl|my_center|LOCUS_05350 55114 54422 gene locus_tag LOCUS_05360 gene rnc 55114 54422 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL2 protein_id gnl|my_center|LOCUS_05360 55460 55086 gene locus_tag LOCUS_05370 55460 55086 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_05370 56308 55481 gene locus_tag LOCUS_05380 gene lepB 56308 55481 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_05380 58147 56330 gene locus_tag LOCUS_05390 gene lepA 58147 56330 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL5 protein_id gnl|my_center|LOCUS_05390 58880 58422 gene locus_tag LOCUS_05400 58880 58422 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_05400 59046 60683 gene locus_tag LOCUS_05410 gene nadB 59046 60683 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL23 protein_id gnl|my_center|LOCUS_05410 61384 60782 gene locus_tag LOCUS_05420 gene tmk 61384 60782 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL25 protein_id gnl|my_center|LOCUS_05420 62437 61388 gene locus_tag LOCUS_05430 62437 61388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 protein_id gnl|my_center|LOCUS_05430 63251 62439 gene locus_tag LOCUS_05440 gene pabC 63251 62439 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 protein_id gnl|my_center|LOCUS_05440 63418 64425 gene locus_tag LOCUS_05450 gene cysP 63418 64425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207376.1 protein_id gnl|my_center|LOCUS_05450 64466 65065 gene locus_tag LOCUS_05460 64466 65065 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118423.1 protein_id gnl|my_center|LOCUS_05460 65159 65992 gene locus_tag LOCUS_05470 gene cysT 65159 65992 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207377.1 protein_id gnl|my_center|LOCUS_05470 65989 66882 gene locus_tag LOCUS_05480 gene cysW 65989 66882 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 protein_id gnl|my_center|LOCUS_05480 66894 67955 gene locus_tag LOCUS_05490 gene cysA 66894 67955 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL32 protein_id gnl|my_center|LOCUS_05490 68007 68930 gene locus_tag LOCUS_05500 gene gltC 68007 68930 CDS product cys regulon transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_05500 69852 69139 gene locus_tag LOCUS_05510 69852 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_05510 70149 70970 gene locus_tag LOCUS_05520 gene dapD 70149 70970 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL35 protein_id gnl|my_center|LOCUS_05520 71087 71797 gene locus_tag LOCUS_05530 gene queE 71087 71797 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL36 protein_id gnl|my_center|LOCUS_05530 71840 72511 gene locus_tag LOCUS_05540 gene queC 71840 72511 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL37 protein_id gnl|my_center|LOCUS_05540 72525 72935 gene locus_tag LOCUS_05550 72525 72935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073124.1 protein_id gnl|my_center|LOCUS_05550 73002 73694 gene locus_tag LOCUS_05560 73002 73694 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207380.1 protein_id gnl|my_center|LOCUS_05560 73708 74169 gene locus_tag LOCUS_05570 gene bcp 73708 74169 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207381.1 protein_id gnl|my_center|LOCUS_05570 74842 74204 gene locus_tag LOCUS_05580 74842 74204 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_05580 74935 75831 gene locus_tag LOCUS_05590 gene iciA 74935 75831 CDS product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206103.1 protein_id gnl|my_center|LOCUS_05590 76438 75869 gene locus_tag LOCUS_05600 76438 75869 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887576.1 protein_id gnl|my_center|LOCUS_05600 77065 76496 gene locus_tag LOCUS_05610 77065 76496 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119001.1 protein_id gnl|my_center|LOCUS_05610 77169 77969 gene locus_tag LOCUS_05620 gene paaG 77169 77969 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_05620 78410 78099 gene locus_tag LOCUS_05630 78410 78099 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 protein_id gnl|my_center|LOCUS_05630 78742 81201 gene locus_tag LOCUS_05640 gene fadE 78742 81201 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_05640 81540 81325 gene locus_tag LOCUS_05650 81540 81325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 85929 82099 gene locus_tag LOCUS_05660 gene purL 85929 82099 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL47 protein_id gnl|my_center|LOCUS_05660 86368 87708 gene locus_tag LOCUS_05670 gene dgt 86368 87708 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_05670 87846 88448 gene locus_tag LOCUS_05680 gene ruvA 87846 88448 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL49 protein_id gnl|my_center|LOCUS_05680 88703 89704 gene locus_tag LOCUS_05690 gene ruvB 88703 89704 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL50 protein_id gnl|my_center|LOCUS_05690 89940 91295 gene locus_tag LOCUS_05700 gene ill4 89940 91295 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207389.1 protein_id gnl|my_center|LOCUS_05700 91645 92052 gene locus_tag LOCUS_05710 91645 92052 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699892.1 protein_id gnl|my_center|LOCUS_05710 92077 92775 gene locus_tag LOCUS_05720 gene tolQ 92077 92775 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207390.1 protein_id gnl|my_center|LOCUS_05720 92775 93215 gene locus_tag LOCUS_05730 gene tolR 92775 93215 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence04 972 262 gene locus_tag LOCUS_05740 972 262 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207779.1 protein_id gnl|my_center|LOCUS_05740 1367 2938 gene locus_tag LOCUS_05750 1367 2938 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_05750 3228 3605 gene locus_tag LOCUS_05760 3228 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3801 5087 gene locus_tag LOCUS_05770 gene mrp 3801 5087 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV5 protein_id gnl|my_center|LOCUS_05770 5761 5279 gene locus_tag LOCUS_05780 5761 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205919.1 protein_id gnl|my_center|LOCUS_05780 6104 6697 gene locus_tag LOCUS_05790 6104 6697 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071033.1 protein_id gnl|my_center|LOCUS_05790 6813 7382 gene locus_tag LOCUS_05800 gene dcd 6813 7382 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 protein_id gnl|my_center|LOCUS_05800 9183 7468 gene locus_tag LOCUS_05810 gene proS 9183 7468 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_05810 10113 9475 gene locus_tag LOCUS_05820 10113 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207559.1 protein_id gnl|my_center|LOCUS_05820 10385 10768 gene locus_tag LOCUS_05830 gene pilG 10385 10768 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_05830 10792 11160 gene locus_tag LOCUS_05840 gene pilH 10792 11160 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_05840 11166 11705 gene locus_tag LOCUS_05850 gene pilI 11166 11705 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_05850 11747 13822 gene locus_tag LOCUS_05860 gene pilJ 11747 13822 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072794.1 protein_id gnl|my_center|LOCUS_05860 13993 18354 gene locus_tag LOCUS_05870 gene chpA 13993 18354 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207558.1 protein_id gnl|my_center|LOCUS_05870 18356 18814 gene locus_tag LOCUS_05880 18356 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207557.1 protein_id gnl|my_center|LOCUS_05880 20089 18953 gene locus_tag LOCUS_05890 gene dapE 20089 18953 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_05890 20347 20207 gene locus_tag LOCUS_05900 20347 20207 CDS product entericidin, EcnA/B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_05900 21337 20465 gene locus_tag LOCUS_05910 21337 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 protein_id gnl|my_center|LOCUS_05910 21461 21817 gene locus_tag LOCUS_05920 21461 21817 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN58 protein_id gnl|my_center|LOCUS_05920 21826 22317 gene locus_tag LOCUS_05930 21826 22317 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_05930 22654 22729 gene locus_tag LOCUS_t00190 22654 22729 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22754 22830 gene locus_tag LOCUS_t00200 22754 22830 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22920 22995 gene locus_tag LOCUS_t00210 22920 22995 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26011 23453 gene locus_tag LOCUS_05940 gene cysJ 26011 23453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207550.1 protein_id gnl|my_center|LOCUS_05940 26754 26194 gene locus_tag LOCUS_05950 26754 26194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 protein_id gnl|my_center|LOCUS_05950 29014 26840 gene locus_tag LOCUS_05960 29014 26840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207548.1 protein_id gnl|my_center|LOCUS_05960 29151 30365 gene locus_tag LOCUS_05970 gene bcr 29151 30365 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 protein_id gnl|my_center|LOCUS_05970 31130 30423 gene locus_tag LOCUS_05980 31130 30423 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 protein_id gnl|my_center|LOCUS_05980 31548 32861 gene locus_tag LOCUS_05990 31548 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207512.1 protein_id gnl|my_center|LOCUS_05990 33433 34662 gene locus_tag LOCUS_06000 gene gltS 33433 34662 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 protein_id gnl|my_center|LOCUS_06000 34829 35806 gene locus_tag LOCUS_06010 gene ylbK 34829 35806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207543.1 protein_id gnl|my_center|LOCUS_06010 36187 36705 gene locus_tag LOCUS_06020 gene vdlD 36187 36705 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_06020 37260 37042 gene locus_tag LOCUS_06030 37260 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 37722 38723 gene locus_tag LOCUS_06040 gene cobW 37722 38723 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 protein_id gnl|my_center|LOCUS_06040 38832 39362 gene locus_tag LOCUS_06050 gene yaeQ 38832 39362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075397.1 protein_id gnl|my_center|LOCUS_06050 39571 39912 gene locus_tag LOCUS_06060 gene fbp 39571 39912 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG87 protein_id gnl|my_center|LOCUS_06060 40532 40062 gene locus_tag LOCUS_06070 40532 40062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 40786 42789 gene locus_tag LOCUS_06080 gene pgaB 40786 42789 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206024.1 protein_id gnl|my_center|LOCUS_06080 42801 44093 gene locus_tag LOCUS_06090 gene pgaC 42801 44093 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 protein_id gnl|my_center|LOCUS_06090 44083 44496 gene locus_tag LOCUS_06100 44083 44496 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206026.1 protein_id gnl|my_center|LOCUS_06100 44720 45208 gene locus_tag LOCUS_06110 44720 45208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 45977 45195 gene locus_tag LOCUS_06120 45977 45195 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 protein_id gnl|my_center|LOCUS_06120 46203 46787 gene locus_tag LOCUS_06130 gene pnuC 46203 46787 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_06130 46818 47090 gene locus_tag LOCUS_06140 46818 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206029.1 protein_id gnl|my_center|LOCUS_06140 47561 48046 gene locus_tag LOCUS_06150 gene def2 47561 48046 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB1 protein_id gnl|my_center|LOCUS_06150 48043 48483 gene locus_tag LOCUS_06160 48043 48483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206047.1 protein_id gnl|my_center|LOCUS_06160 52343 48597 gene locus_tag LOCUS_06170 gene metH 52343 48597 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_06170 52778 54397 gene locus_tag LOCUS_06180 gene pitA 52778 54397 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT0 protein_id gnl|my_center|LOCUS_06180 56000 54450 gene locus_tag LOCUS_06190 56000 54450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_06190 56350 56183 gene locus_tag LOCUS_06200 56350 56183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854552.1 protein_id gnl|my_center|LOCUS_06200 57145 56528 gene locus_tag LOCUS_06210 57145 56528 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_06210 57305 57943 gene locus_tag LOCUS_06220 gene nfuA 57305 57943 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_06220 59084 58077 gene locus_tag LOCUS_06230 59084 58077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 protein_id gnl|my_center|LOCUS_06230 59291 59905 gene locus_tag LOCUS_06240 gene cynT 59291 59905 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_06240 60505 59939 gene locus_tag LOCUS_06250 gene tesA 60505 59939 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 protein_id gnl|my_center|LOCUS_06250 60580 61314 gene locus_tag LOCUS_06260 gene ybbA 60580 61314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070633.1 protein_id gnl|my_center|LOCUS_06260 61311 63791 gene locus_tag LOCUS_06270 61311 63791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206064.1 protein_id gnl|my_center|LOCUS_06270 64633 63821 gene locus_tag LOCUS_06280 gene aarA 64633 63821 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206065.1 protein_id gnl|my_center|LOCUS_06280 64713 65387 gene locus_tag LOCUS_06290 gene mtgA 64713 65387 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU7 protein_id gnl|my_center|LOCUS_06290 65464 67578 gene locus_tag LOCUS_06300 gene ppk 65464 67578 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_06300 68633 67728 gene locus_tag LOCUS_06310 gene estR 68633 67728 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_06310 69584 68640 gene locus_tag LOCUS_06320 69584 68640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_06320 70816 69638 gene locus_tag LOCUS_06330 gene rubB 70816 69638 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_06330 71050 70886 gene locus_tag LOCUS_06340 gene rubA 71050 70886 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_06340 71817 71311 gene locus_tag LOCUS_06350 71817 71311 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206073.1 protein_id gnl|my_center|LOCUS_06350 72267 73793 gene locus_tag LOCUS_06360 gene lysS 72267 73793 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV7 protein_id gnl|my_center|LOCUS_06360 73967 75412 gene locus_tag LOCUS_06370 73967 75412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206075.1 protein_id gnl|my_center|LOCUS_06370 76817 75804 gene locus_tag LOCUS_06380 gene trpS 76817 75804 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 protein_id gnl|my_center|LOCUS_06380 77003 77929 gene locus_tag LOCUS_06390 77003 77929 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_06390 77973 78878 gene locus_tag LOCUS_06400 77973 78878 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_06400 79475 78918 gene locus_tag LOCUS_06410 79475 78918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 79712 81211 gene locus_tag LOCUS_06420 gene nhx7 79712 81211 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207471.1 protein_id gnl|my_center|LOCUS_06420 81379 81714 gene locus_tag LOCUS_06430 gene atl1 81379 81714 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_06430 82216 81776 gene locus_tag LOCUS_06440 gene uspA1 82216 81776 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW6 protein_id gnl|my_center|LOCUS_06440 83176 82547 gene locus_tag LOCUS_06450 gene catB2 83176 82547 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207463.1 protein_id gnl|my_center|LOCUS_06450 83794 83318 gene locus_tag LOCUS_06460 gene greA 83794 83318 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW2 protein_id gnl|my_center|LOCUS_06460 87115 83885 gene locus_tag LOCUS_06470 gene carB 87115 83885 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW1 protein_id gnl|my_center|LOCUS_06470 88269 87130 gene locus_tag LOCUS_06480 gene carA 88269 87130 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW0 protein_id gnl|my_center|LOCUS_06480 >Feature sequence05 825 2111 gene locus_tag LOCUS_06490 gene tolB 825 2111 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL57 protein_id gnl|my_center|LOCUS_06490 2150 2719 gene locus_tag LOCUS_06500 gene pal 2150 2719 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_06500 2966 2781 gene locus_tag LOCUS_06510 2966 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067763.1 protein_id gnl|my_center|LOCUS_06510 3157 4131 gene locus_tag LOCUS_06520 gene fbp 3157 4131 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL60 protein_id gnl|my_center|LOCUS_06520 4181 4957 gene locus_tag LOCUS_06530 4181 4957 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_06530 5128 5742 gene locus_tag LOCUS_06540 5128 5742 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118814.1 protein_id gnl|my_center|LOCUS_06540 5739 6059 gene locus_tag LOCUS_06550 5739 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118556.1 protein_id gnl|my_center|LOCUS_06550 6049 6468 gene locus_tag LOCUS_06560 6049 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118619.1 protein_id gnl|my_center|LOCUS_06560 7239 6523 gene locus_tag LOCUS_06570 gene dnaA 7239 6523 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_06570 8475 7255 gene locus_tag LOCUS_06580 gene rp630 8475 7255 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_06580 8610 9677 gene locus_tag LOCUS_06590 gene purM 8610 9677 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_06590 9688 10317 gene locus_tag LOCUS_06600 gene purN 9688 10317 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL71 protein_id gnl|my_center|LOCUS_06600 11184 10381 gene locus_tag LOCUS_06610 11184 10381 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_06610 12206 11181 gene locus_tag LOCUS_06620 gene nhaA 12206 11181 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_06620 12338 13294 gene locus_tag LOCUS_06630 gene htrB 12338 13294 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_06630 15576 13291 gene locus_tag LOCUS_06640 gene comEC 15576 13291 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207402.1 protein_id gnl|my_center|LOCUS_06640 16485 15802 gene locus_tag LOCUS_06650 gene lolD 16485 15802 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL76 protein_id gnl|my_center|LOCUS_06650 17623 16478 gene locus_tag LOCUS_06660 gene lolC 17623 16478 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_06660 19035 18118 gene locus_tag LOCUS_06670 gene pagO 19035 18118 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_06670 19518 19048 gene locus_tag LOCUS_06680 19518 19048 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL79 protein_id gnl|my_center|LOCUS_06680 19789 20721 gene locus_tag LOCUS_06690 19789 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 protein_id gnl|my_center|LOCUS_06690 21049 21189 gene locus_tag LOCUS_06700 21049 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 22332 21253 gene locus_tag LOCUS_06710 gene serC 22332 21253 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL81 protein_id gnl|my_center|LOCUS_06710 23063 24382 gene locus_tag LOCUS_06720 gene gltP 23063 24382 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 protein_id gnl|my_center|LOCUS_06720 27949 24956 gene locus_tag LOCUS_06730 gene gyrA 27949 24956 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL86 protein_id gnl|my_center|LOCUS_06730 29280 28348 gene locus_tag LOCUS_06740 29280 28348 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 protein_id gnl|my_center|LOCUS_06740 30047 29298 gene locus_tag LOCUS_06750 gene etfB 30047 29298 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_06750 31076 30705 gene locus_tag LOCUS_06760 31076 30705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 32226 31300 gene locus_tag LOCUS_06770 gene xerC 32226 31300 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL90 protein_id gnl|my_center|LOCUS_06770 33213 32368 gene locus_tag LOCUS_06780 gene dapF 33213 32368 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL93 protein_id gnl|my_center|LOCUS_06780 34470 33226 gene locus_tag LOCUS_06790 gene lysA 34470 33226 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL94 protein_id gnl|my_center|LOCUS_06790 34722 34495 gene locus_tag LOCUS_06800 34722 34495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118887.1 protein_id gnl|my_center|LOCUS_06800 36259 34856 gene locus_tag LOCUS_06810 gene cycA 36259 34856 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207418.1 protein_id gnl|my_center|LOCUS_06810 36541 37929 gene locus_tag LOCUS_06820 gene radA 36541 37929 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL98 protein_id gnl|my_center|LOCUS_06820 38042 39013 gene locus_tag LOCUS_06830 38042 39013 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118912.1 protein_id gnl|my_center|LOCUS_06830 39190 39699 gene locus_tag LOCUS_06840 39190 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 40331 39798 gene locus_tag LOCUS_06850 40331 39798 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207252.1 protein_id gnl|my_center|LOCUS_06850 40593 41975 gene locus_tag LOCUS_06860 gene sahH 40593 41975 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ86 protein_id gnl|my_center|LOCUS_06860 42132 42968 gene locus_tag LOCUS_06870 gene metF 42132 42968 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ87 protein_id gnl|my_center|LOCUS_06870 42996 43712 gene locus_tag LOCUS_06880 42996 43712 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_06880 43879 46743 gene locus_tag LOCUS_06890 43879 46743 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207255.1 protein_id gnl|my_center|LOCUS_06890 46892 49162 gene locus_tag LOCUS_06900 gene maeB 46892 49162 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_06900 49253 50488 gene locus_tag LOCUS_06910 gene cca 49253 50488 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ91 protein_id gnl|my_center|LOCUS_06910 51611 50619 gene locus_tag LOCUS_06920 gene poxA 51611 50619 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_06920 52693 51608 gene locus_tag LOCUS_06930 gene pdxB 52693 51608 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA1 protein_id gnl|my_center|LOCUS_06930 54008 52779 gene locus_tag LOCUS_06940 gene caiB 54008 52779 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208447.1 protein_id gnl|my_center|LOCUS_06940 55277 54051 gene locus_tag LOCUS_06950 gene gcdH 55277 54051 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 protein_id gnl|my_center|LOCUS_06950 55528 56451 gene locus_tag LOCUS_06960 gene gcvA 55528 56451 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 protein_id gnl|my_center|LOCUS_06960 57415 56618 gene locus_tag LOCUS_06970 57415 56618 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_06970 57874 57503 gene locus_tag LOCUS_06980 gene zntR 57874 57503 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078608.1 protein_id gnl|my_center|LOCUS_06980 58214 58786 gene locus_tag LOCUS_06990 58214 58786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_06990 60180 58789 gene locus_tag LOCUS_07000 gene met13 60180 58789 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206819.1 protein_id gnl|my_center|LOCUS_07000 61010 60633 gene locus_tag LOCUS_07010 61010 60633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 61234 61022 gene locus_tag LOCUS_07020 61234 61022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 62102 62013 gene locus_tag LOCUS_t00220 62102 62013 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62686 62201 gene locus_tag LOCUS_07030 gene greB 62686 62201 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLS6 protein_id gnl|my_center|LOCUS_07030 63052 64164 gene locus_tag LOCUS_07040 gene yfhD 63052 64164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 protein_id gnl|my_center|LOCUS_07040 64607 64224 gene locus_tag LOCUS_07050 64607 64224 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_07050 65743 64823 gene locus_tag LOCUS_07060 gene ttcA 65743 64823 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLS9 protein_id gnl|my_center|LOCUS_07060 66245 67099 gene locus_tag LOCUS_07070 gene vII 66245 67099 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_07070 67306 68211 gene locus_tag LOCUS_07080 gene htpX 67306 68211 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT1 protein_id gnl|my_center|LOCUS_07080 68784 68410 gene locus_tag LOCUS_07090 gene dgkA 68784 68410 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_07090 69144 72164 gene locus_tag LOCUS_07100 gene mexB 69144 72164 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207444.1 protein_id gnl|my_center|LOCUS_07100 73861 72260 gene locus_tag LOCUS_07110 gene aceA 73861 72260 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_07110 74599 75588 gene locus_tag LOCUS_07120 gene nahR 74599 75588 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_07120 75714 77045 gene locus_tag LOCUS_07130 gene ytfL 75714 77045 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 protein_id gnl|my_center|LOCUS_07130 77571 78911 gene locus_tag LOCUS_07140 gene citN 77571 78911 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117607.1 protein_id gnl|my_center|LOCUS_07140 79483 78974 gene locus_tag LOCUS_07150 79483 78974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206079.1 protein_id gnl|my_center|LOCUS_07150 79790 80443 gene locus_tag LOCUS_07160 79790 80443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 80628 80713 gene locus_tag LOCUS_t00230 80628 80713 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81168 80854 gene locus_tag LOCUS_07170 81168 80854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115563.1 protein_id gnl|my_center|LOCUS_07170 82141 81290 gene locus_tag LOCUS_07180 82141 81290 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV3 protein_id gnl|my_center|LOCUS_07180 84068 82278 gene locus_tag LOCUS_07190 gene ftsH 84068 82278 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV4 protein_id gnl|my_center|LOCUS_07190 84949 84299 gene locus_tag LOCUS_07200 gene rlmE 84949 84299 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_07200 85145 85468 gene locus_tag LOCUS_07210 85145 85468 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_07210 85474 86013 gene locus_tag LOCUS_07220 85474 86013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 protein_id gnl|my_center|LOCUS_07220 86579 86112 gene locus_tag LOCUS_07230 86579 86112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence06 29 1075 gene locus_tag LOCUS_07240 gene mreB 29 1075 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_07240 1188 1949 gene locus_tag LOCUS_07250 gene mreC 1188 1949 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN35 protein_id gnl|my_center|LOCUS_07250 1936 2427 gene locus_tag LOCUS_07260 1936 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2415 2981 gene locus_tag LOCUS_07270 2415 2981 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN32 protein_id gnl|my_center|LOCUS_07270 3020 4474 gene locus_tag LOCUS_07280 gene cafA 3020 4474 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116044.1 protein_id gnl|my_center|LOCUS_07280 4607 4780 gene locus_tag LOCUS_07290 4607 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116397.1 protein_id gnl|my_center|LOCUS_07290 6207 4828 gene locus_tag LOCUS_07300 6207 4828 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_07300 7111 6377 gene locus_tag LOCUS_07310 gene cysH 7111 6377 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_07310 7310 7927 gene locus_tag LOCUS_07320 gene thrH 7310 7927 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_07320 9321 7999 gene locus_tag LOCUS_07330 gene fadL 9321 7999 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206872.1 protein_id gnl|my_center|LOCUS_07330 10701 9889 gene locus_tag LOCUS_07340 gene uppP3 10701 9889 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KML1 protein_id gnl|my_center|LOCUS_07340 11012 12736 gene locus_tag LOCUS_07350 gene kdpA 11012 12736 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR9 protein_id gnl|my_center|LOCUS_07350 12748 14790 gene locus_tag LOCUS_07360 gene kdpB 12748 14790 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR8 protein_id gnl|my_center|LOCUS_07360 14814 15416 gene locus_tag LOCUS_07370 gene kdpC 14814 15416 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR7 protein_id gnl|my_center|LOCUS_07370 15549 18197 gene locus_tag LOCUS_07380 gene kdpD 15549 18197 CDS product sensory kinase in two-component regulatory system wtih KdpE, regulates potassium transport system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207115.1 protein_id gnl|my_center|LOCUS_07380 18225 18938 gene locus_tag LOCUS_07390 gene kdpE 18225 18938 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207114.1 protein_id gnl|my_center|LOCUS_07390 19331 20743 gene locus_tag LOCUS_07400 gene puuA 19331 20743 CDS product gamma-glutamylputrescine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207113.1 protein_id gnl|my_center|LOCUS_07400 20754 20897 gene locus_tag LOCUS_07410 20754 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 21807 21028 gene locus_tag LOCUS_07420 21807 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_07420 22314 22239 gene locus_tag LOCUS_t00240 22314 22239 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23696 22404 gene locus_tag LOCUS_07430 gene aroP 23696 22404 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 protein_id gnl|my_center|LOCUS_07430 24086 25279 gene locus_tag LOCUS_07440 24086 25279 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_07440 25496 26404 gene locus_tag LOCUS_07450 gene ispA 25496 26404 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_07450 27966 26476 gene locus_tag LOCUS_07460 gene putP 27966 26476 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_07460 29002 28148 gene locus_tag LOCUS_07470 gene qmcA 29002 28148 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_07470 29497 29024 gene locus_tag LOCUS_07480 29497 29024 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_07480 30511 29594 gene locus_tag LOCUS_07490 gene ylbK 30511 29594 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_07490 30884 32062 gene locus_tag LOCUS_07500 gene ampG4 30884 32062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_07500 32202 33860 gene locus_tag LOCUS_07510 gene yjdB 32202 33860 CDS product lipid A phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207511.1 protein_id gnl|my_center|LOCUS_07510 33896 34564 gene locus_tag LOCUS_07520 gene qseB 33896 34564 CDS product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 protein_id gnl|my_center|LOCUS_07520 34545 35894 gene locus_tag LOCUS_07530 gene qseC 34545 35894 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 protein_id gnl|my_center|LOCUS_07530 36533 35883 gene locus_tag LOCUS_07540 36533 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207508.1 protein_id gnl|my_center|LOCUS_07540 37956 36769 gene locus_tag LOCUS_07550 37956 36769 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_07550 38558 39295 gene locus_tag LOCUS_07560 38558 39295 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_07560 40102 39359 gene locus_tag LOCUS_07570 gene gltL 40102 39359 CDS product glutamate/aspartate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194225.1 protein_id gnl|my_center|LOCUS_07570 40782 40099 gene locus_tag LOCUS_07580 40782 40099 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_07580 41525 40782 gene locus_tag LOCUS_07590 41525 40782 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396522.1 protein_id gnl|my_center|LOCUS_07590 42536 41595 gene locus_tag LOCUS_07600 42536 41595 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268726.1 protein_id gnl|my_center|LOCUS_07600 44251 42953 gene locus_tag LOCUS_07610 44251 42953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206829.1 protein_id gnl|my_center|LOCUS_07610 45120 44464 gene locus_tag LOCUS_07620 45120 44464 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207949.1 protein_id gnl|my_center|LOCUS_07620 45557 46618 gene locus_tag LOCUS_07630 45557 46618 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207503.1 protein_id gnl|my_center|LOCUS_07630 47348 46656 gene locus_tag LOCUS_07640 47348 46656 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454174.1 protein_id gnl|my_center|LOCUS_07640 48597 47341 gene locus_tag LOCUS_07650 48597 47341 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106357.1 protein_id gnl|my_center|LOCUS_07650 51556 48662 gene locus_tag LOCUS_07660 gene valS 51556 48662 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMI4 protein_id gnl|my_center|LOCUS_07660 51738 52403 gene locus_tag LOCUS_07670 51738 52403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 52452 53258 gene locus_tag LOCUS_07680 52452 53258 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_07680 53261 53962 gene locus_tag LOCUS_07690 53261 53962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_07690 54456 54016 gene locus_tag LOCUS_07700 54456 54016 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_07700 54816 54460 gene locus_tag LOCUS_07710 54816 54460 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_07710 56382 54922 gene locus_tag LOCUS_07720 gene oprM 56382 54922 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_07720 59564 56382 gene locus_tag LOCUS_07730 gene acrB2 59564 56382 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_07730 60827 59577 gene locus_tag LOCUS_07740 gene acrA 60827 59577 CDS product AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_07740 61411 60860 gene locus_tag LOCUS_07750 gene pgpB 61411 60860 CDS product phosphatidylglycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064516.1 protein_id gnl|my_center|LOCUS_07750 63793 61778 gene locus_tag LOCUS_07760 63793 61778 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_07760 64838 63861 gene locus_tag LOCUS_07770 gene ispB 64838 63861 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_07770 65272 65583 gene locus_tag LOCUS_07780 gene rplU 65272 65583 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH1 protein_id gnl|my_center|LOCUS_07780 65603 65860 gene locus_tag LOCUS_07790 gene rpmA 65603 65860 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F2 protein_id gnl|my_center|LOCUS_07790 66079 66777 gene locus_tag LOCUS_07800 gene lolA 66079 66777 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_07800 67011 67802 gene locus_tag LOCUS_07810 67011 67802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207489.1 protein_id gnl|my_center|LOCUS_07810 67922 69193 gene locus_tag LOCUS_07820 gene serS 67922 69193 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG7 protein_id gnl|my_center|LOCUS_07820 69283 70659 gene locus_tag LOCUS_07830 gene cysG 69283 70659 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG6 protein_id gnl|my_center|LOCUS_07830 70697 71176 gene locus_tag LOCUS_07840 gene trmL 70697 71176 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG5 protein_id gnl|my_center|LOCUS_07840 72798 71401 gene locus_tag LOCUS_07850 gene yeeF 72798 71401 CDS product putrescine/spermidine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207482.1 protein_id gnl|my_center|LOCUS_07850 74249 73065 gene locus_tag LOCUS_07860 gene dhaT 74249 73065 CDS product alcohol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_07860 74790 74251 gene locus_tag LOCUS_07870 74790 74251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_07870 75519 74860 gene locus_tag LOCUS_07880 gene lipB 75519 74860 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF5 protein_id gnl|my_center|LOCUS_07880 75968 75675 gene locus_tag LOCUS_07890 75968 75675 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116017.1 protein_id gnl|my_center|LOCUS_07890 77970 76084 gene locus_tag LOCUS_07900 gene rpoD 77970 76084 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF3 protein_id gnl|my_center|LOCUS_07900 78339 78545 gene locus_tag LOCUS_07910 78339 78545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116495.1 protein_id gnl|my_center|LOCUS_07910 78615 79139 gene locus_tag LOCUS_07920 78615 79139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_07920 79903 79322 gene locus_tag LOCUS_07930 79903 79322 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_07930 81074 80142 gene locus_tag LOCUS_07940 81074 80142 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF0 protein_id gnl|my_center|LOCUS_07940 81276 81761 gene locus_tag LOCUS_07950 81276 81761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064555.1 protein_id gnl|my_center|LOCUS_07950 81807 82421 gene locus_tag LOCUS_07960 gene leuE 81807 82421 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115157.1 protein_id gnl|my_center|LOCUS_07960 83159 82500 gene locus_tag LOCUS_07970 gene ribB 83159 82500 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ9 protein_id gnl|my_center|LOCUS_07970 83948 83568 gene locus_tag LOCUS_07980 gene panD 83948 83568 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_07980 84673 84089 gene locus_tag LOCUS_07990 gene pth 84673 84089 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF04 protein_id gnl|my_center|LOCUS_07990 84989 84693 gene locus_tag LOCUS_08000 gene rplY 84989 84693 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG5 protein_id gnl|my_center|LOCUS_08000 86040 85087 gene locus_tag LOCUS_08010 gene prs 86040 85087 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_08010 86151 86077 gene locus_tag LOCUS_t00250 86151 86077 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 818 210 gene locus_tag LOCUS_08020 gene slt 818 210 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208138.1 protein_id gnl|my_center|LOCUS_08020 1912 1346 gene locus_tag LOCUS_08030 gene wrbA 1912 1346 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208139.1 protein_id gnl|my_center|LOCUS_08030 2414 1929 gene locus_tag LOCUS_08040 2414 1929 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208140.1 protein_id gnl|my_center|LOCUS_08040 2495 2899 gene locus_tag LOCUS_08050 gene cueR 2495 2899 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208141.1 protein_id gnl|my_center|LOCUS_08050 3042 4301 gene locus_tag LOCUS_08060 3042 4301 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 protein_id gnl|my_center|LOCUS_08060 4517 6931 gene locus_tag LOCUS_08070 4517 6931 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK01 protein_id gnl|my_center|LOCUS_08070 7271 7816 gene locus_tag LOCUS_08080 7271 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208143.1 protein_id gnl|my_center|LOCUS_08080 8226 7867 gene locus_tag LOCUS_08090 8226 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 protein_id gnl|my_center|LOCUS_08090 9526 8825 gene locus_tag LOCUS_08100 gene yegX 9526 8825 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_08100 11081 9687 gene locus_tag LOCUS_08110 gene farB 11081 9687 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208151.1 protein_id gnl|my_center|LOCUS_08110 11905 11282 gene locus_tag LOCUS_08120 11905 11282 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK12 protein_id gnl|my_center|LOCUS_08120 12235 13812 gene locus_tag LOCUS_08130 gene yoaE 12235 13812 CDS product S-adenosylmethionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208153.1 protein_id gnl|my_center|LOCUS_08130 13905 14372 gene locus_tag LOCUS_08140 13905 14372 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_08140 14432 15076 gene locus_tag LOCUS_08150 14432 15076 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_08150 15209 16528 gene locus_tag LOCUS_08160 15209 16528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121171.1 protein_id gnl|my_center|LOCUS_08160 16693 18912 gene locus_tag LOCUS_08170 gene parC 16693 18912 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK17 protein_id gnl|my_center|LOCUS_08170 19061 20737 gene locus_tag LOCUS_08180 gene fadD 19061 20737 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_08180 21172 20792 gene locus_tag LOCUS_08190 21172 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 protein_id gnl|my_center|LOCUS_08190 21278 21676 gene locus_tag LOCUS_08200 21278 21676 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_08200 21803 22327 gene locus_tag LOCUS_08210 gene ppa 21803 22327 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK21 protein_id gnl|my_center|LOCUS_08210 23698 22427 gene locus_tag LOCUS_08220 gene oprD 23698 22427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 protein_id gnl|my_center|LOCUS_08220 24200 24976 gene locus_tag LOCUS_08230 24200 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 25321 26082 gene locus_tag LOCUS_08240 25321 26082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_08240 27713 26226 gene locus_tag LOCUS_08250 gene yifB 27713 26226 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_08250 28008 27781 gene locus_tag LOCUS_08260 28008 27781 CDS product membrane fusogenic activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121136.1 protein_id gnl|my_center|LOCUS_08260 28289 28627 gene locus_tag LOCUS_08270 gene glnK 28289 28627 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_08270 28686 30086 gene locus_tag LOCUS_08280 gene amtB 28686 30086 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK32 protein_id gnl|my_center|LOCUS_08280 30226 30684 gene locus_tag LOCUS_08290 gene nrdR 30226 30684 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK33 protein_id gnl|my_center|LOCUS_08290 30697 31800 gene locus_tag LOCUS_08300 gene ribD 30697 31800 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK34 protein_id gnl|my_center|LOCUS_08300 31797 33089 gene locus_tag LOCUS_08310 31797 33089 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_08310 33117 33776 gene locus_tag LOCUS_08320 gene ribC 33117 33776 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_08320 33887 34432 gene locus_tag LOCUS_08330 gene dedA 33887 34432 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_08330 34754 34536 gene locus_tag LOCUS_08340 34754 34536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121224.1 protein_id gnl|my_center|LOCUS_08340 35527 34895 gene locus_tag LOCUS_08350 35527 34895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121184.1 protein_id gnl|my_center|LOCUS_08350 35963 35556 gene locus_tag LOCUS_08360 gene holC 35963 35556 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121193.1 protein_id gnl|my_center|LOCUS_08360 37404 35956 gene locus_tag LOCUS_08370 gene pepA 37404 35956 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK40 protein_id gnl|my_center|LOCUS_08370 37564 38664 gene locus_tag LOCUS_08380 37564 38664 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_08380 38667 39737 gene locus_tag LOCUS_08390 38667 39737 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_08390 39853 41400 gene locus_tag LOCUS_08400 gene gpmI 39853 41400 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK43 protein_id gnl|my_center|LOCUS_08400 41428 42606 gene locus_tag LOCUS_08410 gene ctpA 41428 42606 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208171.1 protein_id gnl|my_center|LOCUS_08410 43762 42611 gene locus_tag LOCUS_08420 gene pilR 43762 42611 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208172.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08420 44013 43777 gene locus_tag LOCUS_08430 44013 43777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 45603 44035 gene locus_tag LOCUS_08440 gene pilS 45603 44035 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208173.1 protein_id gnl|my_center|LOCUS_08440 46265 45630 gene locus_tag LOCUS_08450 gene gacA 46265 45630 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_08450 46512 47540 gene locus_tag LOCUS_08460 gene pbpG 46512 47540 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121158.1 protein_id gnl|my_center|LOCUS_08460 48758 47616 gene locus_tag LOCUS_08470 gene thrC 48758 47616 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_08470 50120 48816 gene locus_tag LOCUS_08480 gene hom 50120 48816 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK50 protein_id gnl|my_center|LOCUS_08480 51059 50244 gene locus_tag LOCUS_08490 gene dsbC 51059 50244 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_08490 52084 51167 gene locus_tag LOCUS_08500 gene xerD 52084 51167 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK52 protein_id gnl|my_center|LOCUS_08500 52257 52520 gene locus_tag LOCUS_08510 gene feoA 52257 52520 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121198.1 protein_id gnl|my_center|LOCUS_08510 52517 54373 gene locus_tag LOCUS_08520 gene feoB 52517 54373 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 protein_id gnl|my_center|LOCUS_08520 54420 54671 gene locus_tag LOCUS_08530 54420 54671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208178.1 protein_id gnl|my_center|LOCUS_08530 54835 56181 gene locus_tag LOCUS_08540 gene murD 54835 56181 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_08540 56203 57399 gene locus_tag LOCUS_08550 gene ftsW 56203 57399 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK57 protein_id gnl|my_center|LOCUS_08550 58467 57511 gene locus_tag LOCUS_08560 gene gluQ 58467 57511 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK58 protein_id gnl|my_center|LOCUS_08560 58997 58470 gene locus_tag LOCUS_08570 gene dksA 58997 58470 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL8 protein_id gnl|my_center|LOCUS_08570 60016 59207 gene locus_tag LOCUS_08580 gene icc 60016 59207 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL9 protein_id gnl|my_center|LOCUS_08580 60647 60027 gene locus_tag LOCUS_08590 gene aspP 60647 60027 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208182.1 protein_id gnl|my_center|LOCUS_08590 62619 60724 gene locus_tag LOCUS_08600 gene thiC 62619 60724 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM1 protein_id gnl|my_center|LOCUS_08600 64030 62960 gene locus_tag LOCUS_08610 64030 62960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208183.1 protein_id gnl|my_center|LOCUS_08610 64358 65077 gene locus_tag LOCUS_08620 gene phoU 64358 65077 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM7 protein_id gnl|my_center|LOCUS_08620 66042 65269 gene locus_tag LOCUS_08630 gene pcaU 66042 65269 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114686.1 protein_id gnl|my_center|LOCUS_08630 66491 68575 gene locus_tag LOCUS_08640 66491 68575 CDS product fusaric acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208221.1 protein_id gnl|my_center|LOCUS_08640 68578 68784 gene locus_tag LOCUS_08650 68578 68784 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115096.1 protein_id gnl|my_center|LOCUS_08650 68833 69831 gene locus_tag LOCUS_08660 gene ydhJ 68833 69831 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 protein_id gnl|my_center|LOCUS_08660 70361 69918 gene locus_tag LOCUS_08670 70361 69918 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT8 protein_id gnl|my_center|LOCUS_08670 70917 70354 gene locus_tag LOCUS_08680 70917 70354 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT9 protein_id gnl|my_center|LOCUS_08680 71395 72735 gene locus_tag LOCUS_08690 71395 72735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023256.1 protein_id gnl|my_center|LOCUS_08690 72755 73159 gene locus_tag LOCUS_08700 72755 73159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 73170 73769 gene locus_tag LOCUS_08710 73170 73769 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071314.1 protein_id gnl|my_center|LOCUS_08710 73860 74807 gene locus_tag LOCUS_08720 73860 74807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 76534 74873 gene locus_tag LOCUS_08730 gene recN 76534 74873 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU0 protein_id gnl|my_center|LOCUS_08730 77041 77364 gene locus_tag LOCUS_08740 77041 77364 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_08740 77497 78246 gene locus_tag LOCUS_08750 gene rlmB 77497 78246 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA3 protein_id gnl|my_center|LOCUS_08750 78281 79201 gene locus_tag LOCUS_08760 78281 79201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_08760 79805 79215 gene locus_tag LOCUS_08770 gene coaE 79805 79215 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_08770 80681 79821 gene locus_tag LOCUS_08780 gene pilD 80681 79821 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA6 protein_id gnl|my_center|LOCUS_08780 81907 80681 gene locus_tag LOCUS_08790 gene pilC 81907 80681 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_08790 83646 81937 gene locus_tag LOCUS_08800 gene pilB 83646 81937 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_08800 83929 84720 gene locus_tag LOCUS_08810 gene tpiA 83929 84720 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB0 protein_id gnl|my_center|LOCUS_08810 84734 85063 gene locus_tag LOCUS_08820 gene secG 84734 85063 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_08820 85117 85201 gene locus_tag LOCUS_t00260 85117 85201 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 85248 85324 gene locus_tag LOCUS_t00270 85248 85324 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence08 206 526 gene locus_tag LOCUS_08830 gene ripk4 206 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208019.1 protein_id gnl|my_center|LOCUS_08830 926 2404 gene locus_tag LOCUS_08840 926 2404 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL7 protein_id gnl|my_center|LOCUS_08840 2415 2558 gene locus_tag LOCUS_08850 2415 2558 CDS product putative methionine/alanine importer small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119126.1 protein_id gnl|my_center|LOCUS_08850 3222 3695 gene locus_tag LOCUS_08860 3222 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3819 6434 gene locus_tag LOCUS_08870 3819 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968588.1 protein_id gnl|my_center|LOCUS_08870 6508 12531 gene locus_tag LOCUS_08880 6508 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 12535 13254 gene locus_tag LOCUS_08890 12535 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 13251 16196 gene locus_tag LOCUS_08900 13251 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 17551 16244 gene locus_tag LOCUS_08910 gene sun 17551 16244 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL5 protein_id gnl|my_center|LOCUS_08910 18555 17551 gene locus_tag LOCUS_08920 gene fmt 18555 17551 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL4 protein_id gnl|my_center|LOCUS_08920 18984 20771 gene locus_tag LOCUS_08930 gene ilvD1 18984 20771 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL3 protein_id gnl|my_center|LOCUS_08930 21143 22828 gene locus_tag LOCUS_08940 gene ilvD 21143 22828 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 protein_id gnl|my_center|LOCUS_08940 22898 24208 gene locus_tag LOCUS_08950 22898 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208012.1 protein_id gnl|my_center|LOCUS_08950 24189 24476 gene locus_tag LOCUS_08960 24189 24476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 24629 25366 gene locus_tag LOCUS_08970 24629 25366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 protein_id gnl|my_center|LOCUS_08970 26311 25409 gene locus_tag LOCUS_08980 gene gltC 26311 25409 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208010.1 protein_id gnl|my_center|LOCUS_08980 27717 26416 gene locus_tag LOCUS_08990 gene ycdG 27717 26416 CDS product pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 protein_id gnl|my_center|LOCUS_08990 30699 28015 gene locus_tag LOCUS_09000 gene ppc 30699 28015 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 protein_id gnl|my_center|LOCUS_09000 31402 30881 gene locus_tag LOCUS_09010 31402 30881 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119184.1 protein_id gnl|my_center|LOCUS_09010 31654 32760 gene locus_tag LOCUS_09020 gene mdtA 31654 32760 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 protein_id gnl|my_center|LOCUS_09020 32757 35918 gene locus_tag LOCUS_09030 gene nolG 32757 35918 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_09030 36050 36427 gene locus_tag LOCUS_09040 36050 36427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119294.1 protein_id gnl|my_center|LOCUS_09040 36534 37649 gene locus_tag LOCUS_09050 gene dnaJ 36534 37649 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI50 protein_id gnl|my_center|LOCUS_09050 38009 37749 gene locus_tag LOCUS_09060 38009 37749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 38249 39070 gene locus_tag LOCUS_09070 gene dapB 38249 39070 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_09070 40401 39226 gene locus_tag LOCUS_09080 gene ydhP 40401 39226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066574.1 protein_id gnl|my_center|LOCUS_09080 40553 41443 gene locus_tag LOCUS_09090 gene yafC 40553 41443 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208002.1 protein_id gnl|my_center|LOCUS_09090 41738 41403 gene locus_tag LOCUS_09100 41738 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 41897 43339 gene locus_tag LOCUS_09110 gene ydcR 41897 43339 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 protein_id gnl|my_center|LOCUS_09110 44344 43322 gene locus_tag LOCUS_09120 gene yjgB 44344 43322 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_09120 44936 44364 gene locus_tag LOCUS_09130 gene tag 44936 44364 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066585.1 protein_id gnl|my_center|LOCUS_09130 45202 44957 gene locus_tag LOCUS_09140 45202 44957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066589.1 protein_id gnl|my_center|LOCUS_09140 45762 45220 gene locus_tag LOCUS_09150 gene lytH 45762 45220 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207998.1 protein_id gnl|my_center|LOCUS_09150 46858 45824 gene locus_tag LOCUS_09160 gene mutY 46858 45824 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 protein_id gnl|my_center|LOCUS_09160 47343 46984 gene locus_tag LOCUS_09170 gene mg132 47343 46984 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207996.1 protein_id gnl|my_center|LOCUS_09170 48161 47418 gene locus_tag LOCUS_09180 48161 47418 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_09180 49125 48424 gene locus_tag LOCUS_09190 gene fklB 49125 48424 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_09190 49880 49176 gene locus_tag LOCUS_09200 gene fkpA 49880 49176 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ3 protein_id gnl|my_center|LOCUS_09200 52340 50154 gene locus_tag LOCUS_09210 gene ptk 52340 50154 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 protein_id gnl|my_center|LOCUS_09210 52787 52359 gene locus_tag LOCUS_09220 gene ptp 52787 52359 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_09220 53871 52789 gene locus_tag LOCUS_09230 gene wza 53871 52789 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 protein_id gnl|my_center|LOCUS_09230 54645 55922 gene locus_tag LOCUS_09240 gene wbpO 54645 55922 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039034.1 protein_id gnl|my_center|LOCUS_09240 55948 56970 gene locus_tag LOCUS_09250 gene wbpP 55948 56970 CDS product UDP-GlkcNAc C4 epimerase WbpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_09250 56981 58153 gene locus_tag LOCUS_09260 56981 58153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 58264 58743 gene locus_tag LOCUS_09270 58264 58743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975948.1 protein_id gnl|my_center|LOCUS_09270 58826 59389 gene locus_tag LOCUS_09280 58826 59389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 59414 60532 gene locus_tag LOCUS_09290 59414 60532 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_09290 60529 61623 gene locus_tag LOCUS_09300 60529 61623 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061499.1 protein_id gnl|my_center|LOCUS_09300 61810 62841 gene locus_tag LOCUS_09310 61810 62841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 62841 63980 gene locus_tag LOCUS_09320 62841 63980 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_09320 63984 64604 gene locus_tag LOCUS_09330 63984 64604 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_09330 64597 65253 gene locus_tag LOCUS_09340 gene perB 64597 65253 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DBF7 protein_id gnl|my_center|LOCUS_09340 65281 66450 gene locus_tag LOCUS_09350 gene pglC 65281 66450 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_09350 66590 68464 gene locus_tag LOCUS_09360 gene wbfY 66590 68464 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_09360 68477 69355 gene locus_tag LOCUS_09370 gene galU 68477 69355 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS0 protein_id gnl|my_center|LOCUS_09370 69367 70623 gene locus_tag LOCUS_09380 gene udg 69367 70623 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_09380 70623 72302 gene locus_tag LOCUS_09390 gene pgi 70623 72302 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS2 protein_id gnl|my_center|LOCUS_09390 72295 73314 gene locus_tag LOCUS_09400 gene galE 72295 73314 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208059.1 protein_id gnl|my_center|LOCUS_09400 74734 73364 gene locus_tag LOCUS_09410 gene manB 74734 73364 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_09410 76736 75144 gene locus_tag LOCUS_09420 76736 75144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 78384 76852 gene locus_tag LOCUS_09430 78384 76852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence09 2774 30 gene locus_tag LOCUS_09440 gene glnE 2774 30 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY1 protein_id gnl|my_center|LOCUS_09440 4125 2857 gene locus_tag LOCUS_09450 gene bvgS 4125 2857 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207643.1 protein_id gnl|my_center|LOCUS_09450 4470 4384 gene locus_tag LOCUS_t00280 4470 4384 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4666 5703 gene locus_tag LOCUS_09460 gene queA 4666 5703 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY3 protein_id gnl|my_center|LOCUS_09460 5726 6001 gene locus_tag LOCUS_09470 5726 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6130 7260 gene locus_tag LOCUS_09480 gene tgt 6130 7260 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY4 protein_id gnl|my_center|LOCUS_09480 7364 7693 gene locus_tag LOCUS_09490 gene yajC 7364 7693 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_09490 7746 9647 gene locus_tag LOCUS_09500 gene secD 7746 9647 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY6 protein_id gnl|my_center|LOCUS_09500 9659 10630 gene locus_tag LOCUS_09510 gene secF 9659 10630 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY7 protein_id gnl|my_center|LOCUS_09510 11155 10721 gene locus_tag LOCUS_09520 11155 10721 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_09520 12396 11176 gene locus_tag LOCUS_09530 gene fabF 12396 11176 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208361.1 protein_id gnl|my_center|LOCUS_09530 13121 12396 gene locus_tag LOCUS_09540 gene fabG 13121 12396 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208360.1 protein_id gnl|my_center|LOCUS_09540 13555 13118 gene locus_tag LOCUS_09550 13555 13118 CDS product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208359.1 protein_id gnl|my_center|LOCUS_09550 14748 13552 gene locus_tag LOCUS_09560 gene oxsM 14748 13552 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208358.1 protein_id gnl|my_center|LOCUS_09560 15296 14760 gene locus_tag LOCUS_09570 15296 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208357.1 protein_id gnl|my_center|LOCUS_09570 16596 15298 gene locus_tag LOCUS_09580 16596 15298 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208356.1 protein_id gnl|my_center|LOCUS_09580 18940 16616 gene locus_tag LOCUS_09590 18940 16616 CDS product bifunctional glycerol-3-phosphate dehydrogenase/glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208355.1 protein_id gnl|my_center|LOCUS_09590 19559 18915 gene locus_tag LOCUS_09600 19559 18915 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMR3 protein_id gnl|my_center|LOCUS_09600 19983 19564 gene locus_tag LOCUS_09610 19983 19564 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208353.1 protein_id gnl|my_center|LOCUS_09610 21535 19994 gene locus_tag LOCUS_09620 gene hutH 21535 19994 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208352.1 protein_id gnl|my_center|LOCUS_09620 22464 21535 gene locus_tag LOCUS_09630 22464 21535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 23203 22469 gene locus_tag LOCUS_09640 23203 22469 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208350.1 protein_id gnl|my_center|LOCUS_09640 24890 23214 gene locus_tag LOCUS_09650 gene vraA 24890 23214 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208349.1 protein_id gnl|my_center|LOCUS_09650 25449 24895 gene locus_tag LOCUS_09660 25449 24895 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208348.1 protein_id gnl|my_center|LOCUS_09660 25694 25446 gene locus_tag LOCUS_09670 gene acpP 25694 25446 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ6 protein_id gnl|my_center|LOCUS_09670 25964 25704 gene locus_tag LOCUS_09680 25964 25704 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067033.1 protein_id gnl|my_center|LOCUS_09680 26760 25948 gene locus_tag LOCUS_09690 gene acl-2 26760 25948 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208347.1 protein_id gnl|my_center|LOCUS_09690 27392 26754 gene locus_tag LOCUS_09700 27392 26754 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208346.1 protein_id gnl|my_center|LOCUS_09700 29931 27625 gene locus_tag LOCUS_09710 gene relA 29931 27625 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_09710 31352 29949 gene locus_tag LOCUS_09720 gene rlmD 31352 29949 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC1 protein_id gnl|my_center|LOCUS_09720 32180 31359 gene locus_tag LOCUS_09730 32180 31359 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 protein_id gnl|my_center|LOCUS_09730 33133 32204 gene locus_tag LOCUS_09740 gene cysM 33133 32204 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_09740 33266 36070 gene locus_tag LOCUS_09750 gene barA 33266 36070 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 protein_id gnl|my_center|LOCUS_09750 36186 36974 gene locus_tag LOCUS_09760 gene ech1 36186 36974 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_09760 37025 37891 gene locus_tag LOCUS_09770 gene glxR 37025 37891 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208388.1 protein_id gnl|my_center|LOCUS_09770 37927 38721 gene locus_tag LOCUS_09780 gene hyi 37927 38721 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_09780 38799 39203 gene locus_tag LOCUS_09790 gene rsfS 38799 39203 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB4 protein_id gnl|my_center|LOCUS_09790 40771 39317 gene locus_tag LOCUS_09800 gene pntB 40771 39317 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB1 protein_id gnl|my_center|LOCUS_09800 41098 40772 gene locus_tag LOCUS_09810 41098 40772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 42237 41110 gene locus_tag LOCUS_09820 gene pntA1 42237 41110 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_09820 42808 42635 gene locus_tag LOCUS_09830 42808 42635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 43087 44013 gene locus_tag LOCUS_09840 43087 44013 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208382.1 protein_id gnl|my_center|LOCUS_09840 44526 44005 gene locus_tag LOCUS_09850 44526 44005 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_09850 44610 45038 gene locus_tag LOCUS_09860 44610 45038 CDS product flavin-containing amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 protein_id gnl|my_center|LOCUS_09860 45048 46247 gene locus_tag LOCUS_09870 gene ygaY 45048 46247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208380.1 protein_id gnl|my_center|LOCUS_09870 46715 48013 gene locus_tag LOCUS_09880 46715 48013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931161.1 protein_id gnl|my_center|LOCUS_09880 48036 48842 gene locus_tag LOCUS_09890 gene fabG 48036 48842 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065170.1 protein_id gnl|my_center|LOCUS_09890 49962 48883 gene locus_tag LOCUS_09900 gene gldA 49962 48883 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815496.1 protein_id gnl|my_center|LOCUS_09900 50630 50082 gene locus_tag LOCUS_09910 50630 50082 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_09910 50803 51714 gene locus_tag LOCUS_09920 50803 51714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529025.1 protein_id gnl|my_center|LOCUS_09920 52638 52390 gene locus_tag LOCUS_09930 52638 52390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 53876 53370 gene locus_tag LOCUS_09940 53876 53370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 54871 53876 gene locus_tag LOCUS_09950 54871 53876 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204745.1 protein_id gnl|my_center|LOCUS_09950 56658 54871 gene locus_tag LOCUS_09960 gene P 56658 54871 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038092.1 protein_id gnl|my_center|LOCUS_09960 56818 57648 gene locus_tag LOCUS_09970 gene O 56818 57648 CDS product phage capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038093.1 protein_id gnl|my_center|LOCUS_09970 57652 58662 gene locus_tag LOCUS_09980 57652 58662 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532901.1 protein_id gnl|my_center|LOCUS_09980 58674 59420 gene locus_tag LOCUS_09990 58674 59420 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632318.1 protein_id gnl|my_center|LOCUS_09990 59522 59986 gene locus_tag LOCUS_10000 59522 59986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 59987 60196 gene locus_tag LOCUS_10010 59987 60196 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868184.1 protein_id gnl|my_center|LOCUS_10010 60207 60599 gene locus_tag LOCUS_10020 60207 60599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 60886 61743 gene locus_tag LOCUS_10030 60886 61743 CDS product bacteriophage-acquired protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941345.1 protein_id gnl|my_center|LOCUS_10030 61740 62267 gene locus_tag LOCUS_10040 61740 62267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 62264 62713 gene locus_tag LOCUS_10050 gene S 62264 62713 CDS product virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038100.1 protein_id gnl|my_center|LOCUS_10050 62786 63424 gene locus_tag LOCUS_10060 gene V 62786 63424 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038105.1 protein_id gnl|my_center|LOCUS_10060 63421 63768 gene locus_tag LOCUS_10070 63421 63768 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213447.1 protein_id gnl|my_center|LOCUS_10070 63780 64694 gene locus_tag LOCUS_10080 gene J 63780 64694 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038101.1 protein_id gnl|my_center|LOCUS_10080 64691 65290 gene locus_tag LOCUS_10090 64691 65290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 65290 67908 gene locus_tag LOCUS_10100 65290 67908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 67921 69306 gene locus_tag LOCUS_10110 67921 69306 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104804.1 protein_id gnl|my_center|LOCUS_10110 69317 69601 gene locus_tag LOCUS_10120 69317 69601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 69708 70877 gene locus_tag LOCUS_10130 69708 70877 CDS product tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046101.1 protein_id gnl|my_center|LOCUS_10130 70889 71404 gene locus_tag LOCUS_10140 gene FII 70889 71404 CDS product major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038108.1 protein_id gnl|my_center|LOCUS_10140 71475 71846 gene locus_tag LOCUS_10150 71475 71846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10150 72002 74458 gene locus_tag LOCUS_10160 72002 74458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 74465 74905 gene locus_tag LOCUS_10170 74465 74905 CDS product bacteriophage tail-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935906.1 protein_id gnl|my_center|LOCUS_10170 74905 76224 gene locus_tag LOCUS_10180 74905 76224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 76370 76615 gene locus_tag LOCUS_10190 76370 76615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549899.1 protein_id gnl|my_center|LOCUS_10190 77057 77386 gene locus_tag LOCUS_10200 77057 77386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence10 760 155 gene locus_tag LOCUS_10210 gene clpP 760 155 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM2 protein_id gnl|my_center|LOCUS_10210 2289 955 gene locus_tag LOCUS_10220 gene tig 2289 955 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM1 protein_id gnl|my_center|LOCUS_10220 2744 4981 gene locus_tag LOCUS_10230 gene bfrD 2744 4981 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207070.1 protein_id gnl|my_center|LOCUS_10230 5048 5764 gene locus_tag LOCUS_10240 gene piuC 5048 5764 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH49 protein_id gnl|my_center|LOCUS_10240 6161 7858 gene locus_tag LOCUS_10250 gene leuA 6161 7858 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM59 protein_id gnl|my_center|LOCUS_10250 7909 9108 gene locus_tag LOCUS_10260 gene metX 7909 9108 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_10260 9108 9701 gene locus_tag LOCUS_10270 gene metW 9108 9701 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_10270 9698 10285 gene locus_tag LOCUS_10280 9698 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_10280 10398 11024 gene locus_tag LOCUS_10290 10398 11024 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM55 protein_id gnl|my_center|LOCUS_10290 12006 11131 gene locus_tag LOCUS_10300 12006 11131 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_10300 12160 12378 gene locus_tag LOCUS_10310 gene tatA 12160 12378 CDS product sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM53 protein_id gnl|my_center|LOCUS_10310 12391 12831 gene locus_tag LOCUS_10320 gene tatB 12391 12831 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM52 protein_id gnl|my_center|LOCUS_10320 12828 13598 gene locus_tag LOCUS_10330 gene tatC 12828 13598 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_10330 13806 15815 gene locus_tag LOCUS_10340 13806 15815 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208316.1 protein_id gnl|my_center|LOCUS_10340 16667 15858 gene locus_tag LOCUS_10350 16667 15858 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 protein_id gnl|my_center|LOCUS_10350 16735 17547 gene locus_tag LOCUS_10360 gene lgt 16735 17547 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM47 protein_id gnl|my_center|LOCUS_10360 17631 18017 gene locus_tag LOCUS_10370 17631 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115133.1 protein_id gnl|my_center|LOCUS_10370 18469 18110 gene locus_tag LOCUS_10380 gene rplT 18469 18110 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE1 protein_id gnl|my_center|LOCUS_10380 18675 18481 gene locus_tag LOCUS_10390 gene rpmI 18675 18481 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_10390 18911 20170 gene locus_tag LOCUS_10400 gene entS 18911 20170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_10400 20271 21005 gene locus_tag LOCUS_10410 20271 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 21511 21086 gene locus_tag LOCUS_10420 21511 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_10420 21810 21526 gene locus_tag LOCUS_10430 21810 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 22542 21919 gene locus_tag LOCUS_10440 gene yfcG 22542 21919 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_10440 23282 22785 gene locus_tag LOCUS_10450 gene infC 23282 22785 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A0 protein_id gnl|my_center|LOCUS_10450 25264 23342 gene locus_tag LOCUS_10460 gene thrS 25264 23342 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND4 protein_id gnl|my_center|LOCUS_10460 25646 27277 gene locus_tag LOCUS_10470 gene alkK 25646 27277 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208402.1 protein_id gnl|my_center|LOCUS_10470 27921 27385 gene locus_tag LOCUS_10480 27921 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208401.1 protein_id gnl|my_center|LOCUS_10480 28193 27924 gene locus_tag LOCUS_10490 gene ptsO 28193 27924 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984428.1 protein_id gnl|my_center|LOCUS_10490 29041 28190 gene locus_tag LOCUS_10500 29041 28190 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND0 protein_id gnl|my_center|LOCUS_10500 29913 29068 gene locus_tag LOCUS_10510 gene panC 29913 29068 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC9 protein_id gnl|my_center|LOCUS_10510 30726 29917 gene locus_tag LOCUS_10520 gene panB 30726 29917 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC8 protein_id gnl|my_center|LOCUS_10520 31253 30765 gene locus_tag LOCUS_10530 gene folK 31253 30765 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 protein_id gnl|my_center|LOCUS_10530 32707 31250 gene locus_tag LOCUS_10540 gene pcnB 32707 31250 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC6 protein_id gnl|my_center|LOCUS_10540 33243 32833 gene locus_tag LOCUS_10550 33243 32833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 34014 33259 gene locus_tag LOCUS_10560 gene mazG 34014 33259 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_10560 34686 34036 gene locus_tag LOCUS_10570 gene ffp 34686 34036 CDS product ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208363.1 protein_id gnl|my_center|LOCUS_10570 36190 34781 gene locus_tag LOCUS_10580 gene engA 36190 34781 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_10580 37510 36359 gene locus_tag LOCUS_10590 gene ire-1 37510 36359 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ1 protein_id gnl|my_center|LOCUS_10590 38208 37510 gene locus_tag LOCUS_10600 38208 37510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208343.1 protein_id gnl|my_center|LOCUS_10600 39533 38238 gene locus_tag LOCUS_10610 gene hisS 39533 38238 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP9 protein_id gnl|my_center|LOCUS_10610 40645 39530 gene locus_tag LOCUS_10620 gene ispG 40645 39530 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP7 protein_id gnl|my_center|LOCUS_10620 41458 40670 gene locus_tag LOCUS_10630 41458 40670 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208339.1 protein_id gnl|my_center|LOCUS_10630 42219 41449 gene locus_tag LOCUS_10640 gene pilF 42219 41449 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_10640 43507 42272 gene locus_tag LOCUS_10650 gene rlmN 43507 42272 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_10650 44062 43631 gene locus_tag LOCUS_10660 gene ndk 44062 43631 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_10660 44381 44181 gene locus_tag LOCUS_10670 44381 44181 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_10670 45020 44469 gene locus_tag LOCUS_10680 gene pgpB 45020 44469 CDS product phosphatidylglycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_10680 46337 45054 gene locus_tag LOCUS_10690 46337 45054 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208336.1 protein_id gnl|my_center|LOCUS_10690 47657 46641 gene locus_tag LOCUS_10700 gene ilvC 47657 46641 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT8 protein_id gnl|my_center|LOCUS_10700 48249 47758 gene locus_tag LOCUS_10710 gene ilvH 48249 47758 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_10710 49973 48246 gene locus_tag LOCUS_10720 gene ilvI 49973 48246 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT6 protein_id gnl|my_center|LOCUS_10720 50717 50977 gene locus_tag LOCUS_10730 50717 50977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 51125 53749 gene locus_tag LOCUS_10740 gene leuS 51125 53749 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT5 protein_id gnl|my_center|LOCUS_10740 53929 54471 gene locus_tag LOCUS_10750 gene rlpB 53929 54471 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT4 protein_id gnl|my_center|LOCUS_10750 54489 55478 gene locus_tag LOCUS_10760 gene holA 54489 55478 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208369.1 protein_id gnl|my_center|LOCUS_10760 55707 57002 gene locus_tag LOCUS_10770 gene macA 55707 57002 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 protein_id gnl|my_center|LOCUS_10770 57002 58984 gene locus_tag LOCUS_10780 gene macB 57002 58984 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT1 protein_id gnl|my_center|LOCUS_10780 58996 60399 gene locus_tag LOCUS_10790 gene cmeC 58996 60399 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208366.1 protein_id gnl|my_center|LOCUS_10790 61107 60577 gene locus_tag LOCUS_10800 61107 60577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208378.1 protein_id gnl|my_center|LOCUS_10800 61491 62408 gene locus_tag LOCUS_10810 gene thyA 61491 62408 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM44 protein_id gnl|my_center|LOCUS_10810 62691 63203 gene locus_tag LOCUS_10820 gene folA 62691 63203 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM43 protein_id gnl|my_center|LOCUS_10820 63232 64293 gene locus_tag LOCUS_10830 63232 64293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_10830 64393 64851 gene locus_tag LOCUS_10840 64393 64851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 64967 65491 gene locus_tag LOCUS_10850 gene msrA 64967 65491 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_10850 65959 65555 gene locus_tag LOCUS_10860 gene exbD 65959 65555 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_10860 66582 65959 gene locus_tag LOCUS_10870 gene exbB 66582 65959 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_10870 67388 66603 gene locus_tag LOCUS_10880 gene tonB 67388 66603 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208308.1 protein_id gnl|my_center|LOCUS_10880 68447 67581 gene locus_tag LOCUS_10890 gene purU1 68447 67581 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM37 protein_id gnl|my_center|LOCUS_10890 69233 68517 gene locus_tag LOCUS_10900 69233 68517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 69354 70802 gene locus_tag LOCUS_10910 gene calB 69354 70802 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM35 protein_id gnl|my_center|LOCUS_10910 >Feature sequence11 425 1795 gene locus_tag LOCUS_10920 gene yicE 425 1795 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207585.1 protein_id gnl|my_center|LOCUS_10920 1861 2886 gene locus_tag LOCUS_10930 gene rsmC 1861 2886 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA0 protein_id gnl|my_center|LOCUS_10930 2896 4365 gene locus_tag LOCUS_10940 gene lysP 2896 4365 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207587.1 protein_id gnl|my_center|LOCUS_10940 5678 4641 gene locus_tag LOCUS_10950 gene ompA 5678 4641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207589.1 protein_id gnl|my_center|LOCUS_10950 6050 6574 gene locus_tag LOCUS_10960 gene fimT 6050 6574 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_10960 7244 7516 gene locus_tag LOCUS_10970 7244 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8285 7989 gene locus_tag LOCUS_10980 gene ihfA 8285 7989 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE5 protein_id gnl|my_center|LOCUS_10980 10663 8282 gene locus_tag LOCUS_10990 gene pheT 10663 8282 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE4 protein_id gnl|my_center|LOCUS_10990 11768 10788 gene locus_tag LOCUS_11000 gene pheS 11768 10788 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE3 protein_id gnl|my_center|LOCUS_11000 11926 12957 gene locus_tag LOCUS_11010 11926 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208406.1 protein_id gnl|my_center|LOCUS_11010 13840 13052 gene locus_tag LOCUS_11020 13840 13052 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_11020 14533 13982 gene locus_tag LOCUS_11030 gene orn 14533 13982 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_11030 14659 15726 gene locus_tag LOCUS_11040 gene engC 14659 15726 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS6 protein_id gnl|my_center|LOCUS_11040 15820 16227 gene locus_tag LOCUS_11050 gene yibN 15820 16227 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_11050 16246 16500 gene locus_tag LOCUS_11060 gene grx 16246 16500 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_11060 16537 16992 gene locus_tag LOCUS_11070 gene secB 16537 16992 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_11070 17878 17075 gene locus_tag LOCUS_11080 gene fabI 17878 17075 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS9 protein_id gnl|my_center|LOCUS_11080 19166 18156 gene locus_tag LOCUS_11090 19166 18156 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_11090 19359 20912 gene locus_tag LOCUS_11100 gene plD 19359 20912 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117884.1 protein_id gnl|my_center|LOCUS_11100 21756 20947 gene locus_tag LOCUS_11110 gene plsC 21756 20947 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_11110 22416 21937 gene locus_tag LOCUS_11120 gene ogt 22416 21937 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP06 protein_id gnl|my_center|LOCUS_11120 22766 22452 gene locus_tag LOCUS_11130 gene sugE 22766 22452 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_11130 23904 22990 gene locus_tag LOCUS_11140 23904 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 25747 23891 gene locus_tag LOCUS_11150 gene pcoA 25747 23891 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 protein_id gnl|my_center|LOCUS_11150 26243 25788 gene locus_tag LOCUS_11160 26243 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208438.1 protein_id gnl|my_center|LOCUS_11160 27396 26710 gene locus_tag LOCUS_11170 gene rpe 27396 26710 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_11170 27583 27858 gene locus_tag LOCUS_11180 27583 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843456.1 protein_id gnl|my_center|LOCUS_11180 28746 27910 gene locus_tag LOCUS_11190 gene esd 28746 27910 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ7 protein_id gnl|my_center|LOCUS_11190 30172 28760 gene locus_tag LOCUS_11200 30172 28760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_11200 31112 30294 gene locus_tag LOCUS_11210 gene rsmJ 31112 30294 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ5 protein_id gnl|my_center|LOCUS_11210 31930 31106 gene locus_tag LOCUS_11220 gene uppP2 31930 31106 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_11220 32608 31943 gene locus_tag LOCUS_11230 gene yeaZ 32608 31943 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_11230 33376 32762 gene locus_tag LOCUS_11240 gene nudL 33376 32762 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_11240 33514 34047 gene locus_tag LOCUS_11250 33514 34047 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_11250 34240 35577 gene locus_tag LOCUS_11260 gene pabB 34240 35577 CDS product p-aminobenzoate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 protein_id gnl|my_center|LOCUS_11260 36690 35599 gene locus_tag LOCUS_11270 gene hisC 36690 35599 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH3 protein_id gnl|my_center|LOCUS_11270 38194 36902 gene locus_tag LOCUS_11280 gene hisD 38194 36902 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH2 protein_id gnl|my_center|LOCUS_11280 38690 38614 gene locus_tag LOCUS_t00290 38690 38614 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38770 38695 gene locus_tag LOCUS_t00300 38770 38695 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 38885 38809 gene locus_tag LOCUS_t00310 38885 38809 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39008 38932 gene locus_tag LOCUS_t00320 39008 38932 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40227 39160 gene locus_tag LOCUS_11290 gene nadA 40227 39160 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_11290 41596 40376 gene locus_tag LOCUS_11300 gene argJ 41596 40376 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_11300 42115 41777 gene locus_tag LOCUS_11310 42115 41777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116535.1 protein_id gnl|my_center|LOCUS_11310 45008 42279 gene locus_tag LOCUS_11320 gene secA 45008 42279 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNT4 protein_id gnl|my_center|LOCUS_11320 45350 46009 gene locus_tag LOCUS_11330 45350 46009 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_11330 46292 47071 gene locus_tag LOCUS_11340 46292 47071 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207607.1 protein_id gnl|my_center|LOCUS_11340 47068 47649 gene locus_tag LOCUS_11350 47068 47649 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 protein_id gnl|my_center|LOCUS_11350 48808 47669 gene locus_tag LOCUS_11360 gene iga 48808 47669 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 protein_id gnl|my_center|LOCUS_11360 50082 48799 gene locus_tag LOCUS_11370 gene folC 50082 48799 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 protein_id gnl|my_center|LOCUS_11370 50975 50079 gene locus_tag LOCUS_11380 gene accD 50975 50079 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU0 protein_id gnl|my_center|LOCUS_11380 51775 50972 gene locus_tag LOCUS_11390 gene trpA 51775 50972 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU1 protein_id gnl|my_center|LOCUS_11390 53523 52294 gene locus_tag LOCUS_11400 gene trpB 53523 52294 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_11400 54148 53507 gene locus_tag LOCUS_11410 gene trpF 54148 53507 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU7 protein_id gnl|my_center|LOCUS_11410 54549 56396 gene locus_tag LOCUS_11420 gene btuB 54549 56396 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 protein_id gnl|my_center|LOCUS_11420 56487 57065 gene locus_tag LOCUS_11430 56487 57065 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 protein_id gnl|my_center|LOCUS_11430 57321 58058 gene locus_tag LOCUS_11440 gene ugpQ 57321 58058 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_11440 58231 59397 gene locus_tag LOCUS_11450 gene olE1 58231 59397 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_11450 59477 59623 gene locus_tag LOCUS_11460 59477 59623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11460 59645 59833 gene locus_tag LOCUS_11470 59645 59833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11470 59964 61343 gene locus_tag LOCUS_11480 59964 61343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 protein_id gnl|my_center|LOCUS_11480 61424 61801 gene locus_tag LOCUS_11490 61424 61801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360950.1 protein_id gnl|my_center|LOCUS_11490 63340 61997 gene locus_tag LOCUS_11500 gene aroP 63340 61997 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 protein_id gnl|my_center|LOCUS_11500 64270 63584 gene locus_tag LOCUS_11510 gene baeR 64270 63584 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116101.1 protein_id gnl|my_center|LOCUS_11510 65931 64291 gene locus_tag LOCUS_11520 gene baeS 65931 64291 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207622.1 protein_id gnl|my_center|LOCUS_11520 66070 66693 gene locus_tag LOCUS_11530 66070 66693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 67778 66771 gene locus_tag LOCUS_11540 67778 66771 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence12 1096 440 gene locus_tag LOCUS_11550 1096 440 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_11550 1507 1818 gene locus_tag LOCUS_11560 1507 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121546.1 protein_id gnl|my_center|LOCUS_11560 2221 3267 gene locus_tag LOCUS_11570 2221 3267 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207349.1 protein_id gnl|my_center|LOCUS_11570 4379 3333 gene locus_tag LOCUS_11580 gene dusB 4379 3333 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKI7 protein_id gnl|my_center|LOCUS_11580 4590 4727 gene locus_tag LOCUS_11590 4590 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 5033 4881 gene locus_tag LOCUS_11600 5033 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 5636 6844 gene locus_tag LOCUS_11610 5636 6844 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207351.1 protein_id gnl|my_center|LOCUS_11610 6811 7461 gene locus_tag LOCUS_11620 gene cicA 6811 7461 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067866.1 protein_id gnl|my_center|LOCUS_11620 8642 7548 gene locus_tag LOCUS_11630 gene des6 8642 7548 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_11630 9724 8657 gene locus_tag LOCUS_11640 gene hmp 9724 8657 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207321.1 protein_id gnl|my_center|LOCUS_11640 9880 10572 gene locus_tag LOCUS_11650 9880 10572 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118668.1 protein_id gnl|my_center|LOCUS_11650 11087 10731 gene locus_tag LOCUS_11660 11087 10731 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR0 protein_id gnl|my_center|LOCUS_11660 13472 11196 gene locus_tag LOCUS_11670 gene clpA 13472 11196 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073979.1 protein_id gnl|my_center|LOCUS_11670 13892 13482 gene locus_tag LOCUS_11680 gene clpS 13892 13482 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR2 protein_id gnl|my_center|LOCUS_11680 14660 13911 gene locus_tag LOCUS_11690 14660 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206946.1 protein_id gnl|my_center|LOCUS_11690 15788 14739 gene locus_tag LOCUS_11700 gene argC 15788 14739 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR4 protein_id gnl|my_center|LOCUS_11700 16616 15945 gene locus_tag LOCUS_11710 16616 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206949.1 protein_id gnl|my_center|LOCUS_11710 17389 16718 gene locus_tag LOCUS_11720 gene rpiA 17389 16718 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR7 protein_id gnl|my_center|LOCUS_11720 17498 19036 gene locus_tag LOCUS_11730 gene ilvA 17498 19036 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR8 protein_id gnl|my_center|LOCUS_11730 19623 19090 gene locus_tag LOCUS_11740 19623 19090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 21009 19861 gene locus_tag LOCUS_11750 gene pldA 21009 19861 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_11750 23973 21034 gene locus_tag LOCUS_11760 gene preP2 23973 21034 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_11760 24672 24223 gene locus_tag LOCUS_11770 24672 24223 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181709.1 protein_id gnl|my_center|LOCUS_11770 24810 25823 gene locus_tag LOCUS_11780 24810 25823 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_11780 25823 26149 gene locus_tag LOCUS_11790 25823 26149 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121079.1 protein_id gnl|my_center|LOCUS_11790 26168 26794 gene locus_tag LOCUS_11800 26168 26794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121106.1 protein_id gnl|my_center|LOCUS_11800 27445 26840 gene locus_tag LOCUS_11810 27445 26840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 protein_id gnl|my_center|LOCUS_11810 28030 27560 gene locus_tag LOCUS_11820 28030 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206651.1 protein_id gnl|my_center|LOCUS_11820 28063 28935 gene locus_tag LOCUS_11830 28063 28935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 protein_id gnl|my_center|LOCUS_11830 30885 29017 gene locus_tag LOCUS_11840 gene ppiD 30885 29017 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ1 protein_id gnl|my_center|LOCUS_11840 31290 31018 gene locus_tag LOCUS_11850 gene hup 31290 31018 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_11850 31925 31449 gene locus_tag LOCUS_11860 31925 31449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069443.1 protein_id gnl|my_center|LOCUS_11860 32111 32767 gene locus_tag LOCUS_11870 32111 32767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206628.1 protein_id gnl|my_center|LOCUS_11870 32873 33346 gene locus_tag LOCUS_11880 32873 33346 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_11880 33348 34565 gene locus_tag LOCUS_11890 gene iscS 33348 34565 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY6 protein_id gnl|my_center|LOCUS_11890 34653 35039 gene locus_tag LOCUS_11900 gene nifU 34653 35039 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY5 protein_id gnl|my_center|LOCUS_11900 35077 35397 gene locus_tag LOCUS_11910 35077 35397 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_11910 35503 36018 gene locus_tag LOCUS_11920 gene hscB 35503 36018 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY3 protein_id gnl|my_center|LOCUS_11920 36057 37919 gene locus_tag LOCUS_11930 gene hscA 36057 37919 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY2 protein_id gnl|my_center|LOCUS_11930 37933 38271 gene locus_tag LOCUS_11940 gene fdx 37933 38271 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_11940 39741 38359 gene locus_tag LOCUS_11950 gene cyaA 39741 38359 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206624.1 protein_id gnl|my_center|LOCUS_11950 40305 39871 gene locus_tag LOCUS_11960 40305 39871 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_11960 43998 40540 gene locus_tag LOCUS_11970 gene mfd 43998 40540 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX8 protein_id gnl|my_center|LOCUS_11970 44487 44134 gene locus_tag LOCUS_11980 44487 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206622.1 protein_id gnl|my_center|LOCUS_11980 44910 46418 gene locus_tag LOCUS_11990 gene putP 44910 46418 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_11990 46951 46460 gene locus_tag LOCUS_12000 gene lrp 46951 46460 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 protein_id gnl|my_center|LOCUS_12000 47068 50838 gene locus_tag LOCUS_12010 gene putA 47068 50838 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM92 protein_id gnl|my_center|LOCUS_12010 51135 52217 gene locus_tag LOCUS_12020 gene trmA 51135 52217 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_12020 52469 52696 gene locus_tag LOCUS_12030 52469 52696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011679.1 protein_id gnl|my_center|LOCUS_12030 52883 53419 gene locus_tag LOCUS_12040 52883 53419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206573.1 protein_id gnl|my_center|LOCUS_12040 54357 53446 gene locus_tag LOCUS_12050 54357 53446 CDS product bestrophin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113810.1 protein_id gnl|my_center|LOCUS_12050 56176 54455 gene locus_tag LOCUS_12060 gene glnS2 56176 54455 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH76 protein_id gnl|my_center|LOCUS_12060 56343 56852 gene locus_tag LOCUS_12070 gene ppiB 56343 56852 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_12070 56877 57596 gene locus_tag LOCUS_12080 gene lpxH 56877 57596 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH78 protein_id gnl|my_center|LOCUS_12080 57771 58424 gene locus_tag LOCUS_12090 gene nfnB 57771 58424 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 protein_id gnl|my_center|LOCUS_12090 59590 58727 gene locus_tag LOCUS_12100 59590 58727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_12100 60709 59672 gene locus_tag LOCUS_12110 gene fba 60709 59672 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_12110 61095 60832 gene locus_tag LOCUS_12120 61095 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 62434 61244 gene locus_tag LOCUS_12130 gene pgk 62434 61244 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA8 protein_id gnl|my_center|LOCUS_12130 62577 62960 gene locus_tag LOCUS_12140 62577 62960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_12140 62960 63553 gene locus_tag LOCUS_12150 gene maf 62960 63553 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA6 protein_id gnl|my_center|LOCUS_12150 63569 64738 gene locus_tag LOCUS_12160 gene xseA 63569 64738 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206583.1 protein_id gnl|my_center|LOCUS_12160 65579 64914 gene locus_tag LOCUS_12170 gene yraR 65579 64914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206619.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence13 348 1547 gene locus_tag LOCUS_12180 348 1547 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_12180 1752 2579 gene locus_tag LOCUS_12190 gene bla 1752 2579 CDS product OXA-213 family carbapenem-hydrolyzing class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206564.1 protein_id gnl|my_center|LOCUS_12190 2832 2608 gene locus_tag LOCUS_12200 2832 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3503 3063 gene locus_tag LOCUS_12210 3503 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_12210 3862 4473 gene locus_tag LOCUS_12220 3862 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5047 4676 gene locus_tag LOCUS_12230 5047 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120775.1 protein_id gnl|my_center|LOCUS_12230 5677 5270 gene locus_tag LOCUS_12240 5677 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120752.1 protein_id gnl|my_center|LOCUS_12240 6866 6120 gene locus_tag LOCUS_12250 gene yciK 6866 6120 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_12250 7599 6901 gene locus_tag LOCUS_12260 gene gph2 7599 6901 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_12260 8312 7596 gene locus_tag LOCUS_12270 gene ubiG 8312 7596 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_12270 8492 9109 gene locus_tag LOCUS_12280 gene dsbA 8492 9109 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_12280 9837 9178 gene locus_tag LOCUS_12290 9837 9178 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 protein_id gnl|my_center|LOCUS_12290 10072 10788 gene locus_tag LOCUS_12300 gene rph 10072 10788 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_12300 11001 11171 gene locus_tag LOCUS_12310 11001 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 12013 11168 gene locus_tag LOCUS_12320 gene nadC 12013 11168 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208036.1 protein_id gnl|my_center|LOCUS_12320 12189 12764 gene locus_tag LOCUS_12330 gene ampD 12189 12764 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_12330 12848 14389 gene locus_tag LOCUS_12340 gene mviN 12848 14389 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ1 protein_id gnl|my_center|LOCUS_12340 14679 14521 gene locus_tag LOCUS_12350 14679 14521 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI32 protein_id gnl|my_center|LOCUS_12350 14871 15323 gene locus_tag LOCUS_12360 14871 15323 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_12360 15787 15320 gene locus_tag LOCUS_12370 gene ybbK 15787 15320 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207987.1 protein_id gnl|my_center|LOCUS_12370 15998 17272 gene locus_tag LOCUS_12380 gene rarA 15998 17272 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_12380 17904 17371 gene locus_tag LOCUS_12390 17904 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040495.1 protein_id gnl|my_center|LOCUS_12390 18081 18575 gene locus_tag LOCUS_12400 18081 18575 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423792.1 protein_id gnl|my_center|LOCUS_12400 19325 18606 gene locus_tag LOCUS_12410 gene purC 19325 18606 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_12410 19967 19362 gene locus_tag LOCUS_12420 19967 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207991.1 protein_id gnl|my_center|LOCUS_12420 20881 19982 gene locus_tag LOCUS_12430 gene dapA 20881 19982 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_12430 21452 22075 gene locus_tag LOCUS_12440 gene pncA 21452 22075 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207990.1 protein_id gnl|my_center|LOCUS_12440 23470 22199 gene locus_tag LOCUS_12450 23470 22199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207968.1 protein_id gnl|my_center|LOCUS_12450 23530 24750 gene locus_tag LOCUS_12460 gene serB 23530 24750 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207967.1 protein_id gnl|my_center|LOCUS_12460 25163 25498 gene locus_tag LOCUS_12470 25163 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119105.1 protein_id gnl|my_center|LOCUS_12470 25616 26095 gene locus_tag LOCUS_12480 25616 26095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119134.1 protein_id gnl|my_center|LOCUS_12480 26600 26157 gene locus_tag LOCUS_12490 gene dtd 26600 26157 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY7 protein_id gnl|my_center|LOCUS_12490 26816 28021 gene locus_tag LOCUS_12500 gene pncB 26816 28021 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYM9 protein_id gnl|my_center|LOCUS_12500 28137 28985 gene locus_tag LOCUS_12510 gene rhdA 28137 28985 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY5 protein_id gnl|my_center|LOCUS_12510 28982 29833 gene locus_tag LOCUS_12520 gene psd 28982 29833 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_12520 30552 29944 gene locus_tag LOCUS_12530 30552 29944 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208120.1 protein_id gnl|my_center|LOCUS_12530 32385 30580 gene locus_tag LOCUS_12540 gene argS 32385 30580 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF4 protein_id gnl|my_center|LOCUS_12540 32582 32869 gene locus_tag LOCUS_12550 32582 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 protein_id gnl|my_center|LOCUS_12550 34244 32934 gene locus_tag LOCUS_12560 34244 32934 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066720.1 protein_id gnl|my_center|LOCUS_12560 34840 34289 gene locus_tag LOCUS_12570 34840 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122008.1 protein_id gnl|my_center|LOCUS_12570 35436 34897 gene locus_tag LOCUS_12580 35436 34897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_12580 35649 37226 gene locus_tag LOCUS_12590 gene gshA 35649 37226 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG2 protein_id gnl|my_center|LOCUS_12590 37245 37769 gene locus_tag LOCUS_12600 gene dsbB 37245 37769 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_12600 39193 37892 gene locus_tag LOCUS_12610 39193 37892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121854.1 protein_id gnl|my_center|LOCUS_12610 39525 40007 gene locus_tag LOCUS_12620 gene yqiA 39525 40007 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207947.1 protein_id gnl|my_center|LOCUS_12620 40022 41902 gene locus_tag LOCUS_12630 gene parE 40022 41902 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF2 protein_id gnl|my_center|LOCUS_12630 42422 41985 gene locus_tag LOCUS_12640 42422 41985 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 protein_id gnl|my_center|LOCUS_12640 43041 42520 gene locus_tag LOCUS_12650 gene pitA 43041 42520 CDS product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUU7 protein_id gnl|my_center|LOCUS_12650 43872 43147 gene locus_tag LOCUS_12660 gene tsx 43872 43147 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_12660 44355 44732 gene locus_tag LOCUS_12670 44355 44732 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985299.1 protein_id gnl|my_center|LOCUS_12670 44866 45411 gene locus_tag LOCUS_12680 44866 45411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066773.1 protein_id gnl|my_center|LOCUS_12680 45424 46191 gene locus_tag LOCUS_12690 45424 46191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207941.1 protein_id gnl|my_center|LOCUS_12690 46293 48050 gene locus_tag LOCUS_12700 gene dsbD 46293 48050 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 protein_id gnl|my_center|LOCUS_12700 48193 48765 gene locus_tag LOCUS_12710 gene azoR2 48193 48765 CDS product FMN-dependent NADH-azoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E2 protein_id gnl|my_center|LOCUS_12710 48961 49398 gene locus_tag LOCUS_12720 48961 49398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_12720 49784 49473 gene locus_tag LOCUS_12730 gene yffB 49784 49473 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_12730 51086 50268 gene locus_tag LOCUS_12740 gene crc 51086 50268 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 protein_id gnl|my_center|LOCUS_12740 51128 51778 gene locus_tag LOCUS_12750 gene pyrE 51128 51778 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_12750 53311 51893 gene locus_tag LOCUS_12760 gene cycA 53311 51893 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206138.1 protein_id gnl|my_center|LOCUS_12760 54361 53411 gene locus_tag LOCUS_12770 54361 53411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_12770 55395 54367 gene locus_tag LOCUS_12780 gene arcB 55395 54367 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680822.1 protein_id gnl|my_center|LOCUS_12780 55519 55941 gene locus_tag LOCUS_12790 55519 55941 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_12790 56027 56977 gene locus_tag LOCUS_12800 gene gshB 56027 56977 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_12800 57286 58383 gene locus_tag LOCUS_12810 gene murG 57286 58383 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC8 protein_id gnl|my_center|LOCUS_12810 58397 59845 gene locus_tag LOCUS_12820 gene murC 58397 59845 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_12820 59902 60831 gene locus_tag LOCUS_12830 gene ddlB 59902 60831 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_12830 60835 61689 gene locus_tag LOCUS_12840 gene ftsQ 60835 61689 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC5 protein_id gnl|my_center|LOCUS_12840 >Feature sequence14 455 198 gene locus_tag LOCUS_12850 gene sirA 455 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053527.1 protein_id gnl|my_center|LOCUS_12850 782 1621 gene locus_tag LOCUS_12860 gene corC 782 1621 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_12860 1618 3177 gene locus_tag LOCUS_12870 gene lnt 1618 3177 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF2 protein_id gnl|my_center|LOCUS_12870 3597 3244 gene locus_tag LOCUS_12880 3597 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804170.1 protein_id gnl|my_center|LOCUS_12880 4406 3861 gene locus_tag LOCUS_12890 gene xcpT 4406 3861 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208252.1 protein_id gnl|my_center|LOCUS_12890 5635 4430 gene locus_tag LOCUS_12900 gene xcpS 5635 4430 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_12900 5762 7984 gene locus_tag LOCUS_12910 gene priA 5762 7984 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE7 protein_id gnl|my_center|LOCUS_12910 8041 9882 gene locus_tag LOCUS_12920 gene kefB 8041 9882 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_12920 9933 10808 gene locus_tag LOCUS_12930 gene hslO 9933 10808 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE5 protein_id gnl|my_center|LOCUS_12930 11098 12060 gene locus_tag LOCUS_12940 gene cbpA 11098 12060 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_12940 12072 12410 gene locus_tag LOCUS_12950 12072 12410 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 protein_id gnl|my_center|LOCUS_12950 12497 12763 gene locus_tag LOCUS_12960 12497 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 protein_id gnl|my_center|LOCUS_12960 14084 12846 gene locus_tag LOCUS_12970 gene corA 14084 12846 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_12970 16335 14242 gene locus_tag LOCUS_12980 gene pnp 16335 14242 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE0 protein_id gnl|my_center|LOCUS_12980 16853 16584 gene locus_tag LOCUS_12990 gene rpsO 16853 16584 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_12990 19578 17815 gene locus_tag LOCUS_13000 gene recD 19578 17815 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD7 protein_id gnl|my_center|LOCUS_13000 23345 19644 gene locus_tag LOCUS_13010 gene recB 23345 19644 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD6 protein_id gnl|my_center|LOCUS_13010 27048 23350 gene locus_tag LOCUS_13020 gene recC 27048 23350 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD4 protein_id gnl|my_center|LOCUS_13020 27225 27734 gene locus_tag LOCUS_13030 27225 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 protein_id gnl|my_center|LOCUS_13030 29201 27783 gene locus_tag LOCUS_13040 29201 27783 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_13040 29864 29304 gene locus_tag LOCUS_13050 29864 29304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 protein_id gnl|my_center|LOCUS_13050 30451 29975 gene locus_tag LOCUS_13060 30451 29975 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116954.1 protein_id gnl|my_center|LOCUS_13060 30574 31218 gene locus_tag LOCUS_13070 gene parA 30574 31218 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 protein_id gnl|my_center|LOCUS_13070 31555 32496 gene locus_tag LOCUS_13080 31555 32496 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_13080 33880 32651 gene locus_tag LOCUS_13090 gene cmr 33880 32651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 protein_id gnl|my_center|LOCUS_13090 34645 34268 gene locus_tag LOCUS_13100 34645 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207801.1 protein_id gnl|my_center|LOCUS_13100 36152 34743 gene locus_tag LOCUS_13110 36152 34743 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_13110 36508 37740 gene locus_tag LOCUS_13120 gene serA 36508 37740 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_13120 38013 38849 gene locus_tag LOCUS_13130 38013 38849 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207805.1 protein_id gnl|my_center|LOCUS_13130 39023 39727 gene locus_tag LOCUS_13140 39023 39727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208240.1 protein_id gnl|my_center|LOCUS_13140 39883 40827 gene locus_tag LOCUS_13150 gene ubiE 39883 40827 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD0 protein_id gnl|my_center|LOCUS_13150 40839 41525 gene locus_tag LOCUS_13160 40839 41525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208239.1 protein_id gnl|my_center|LOCUS_13160 41538 43157 gene locus_tag LOCUS_13170 gene ubiB 41538 43157 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208238.1 protein_id gnl|my_center|LOCUS_13170 43452 44234 gene locus_tag LOCUS_13180 gene hisI 43452 44234 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC5 protein_id gnl|my_center|LOCUS_13180 44239 45750 gene locus_tag LOCUS_13190 gene fbh1 44239 45750 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC4 protein_id gnl|my_center|LOCUS_13190 46079 48922 gene locus_tag LOCUS_13200 gene phaAB 46079 48922 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208232.1 protein_id gnl|my_center|LOCUS_13200 48924 49289 gene locus_tag LOCUS_13210 gene phaC 48924 49289 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115033.1 protein_id gnl|my_center|LOCUS_13210 49289 51097 gene locus_tag LOCUS_13220 gene phaD 49289 51097 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208231.1 protein_id gnl|my_center|LOCUS_13220 51100 51618 gene locus_tag LOCUS_13230 gene phaE 51100 51618 CDS product pesticidal protein Cry1Ba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208230.1 protein_id gnl|my_center|LOCUS_13230 51618 51893 gene locus_tag LOCUS_13240 51618 51893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 51906 52307 gene locus_tag LOCUS_13250 gene phaG 51906 52307 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 protein_id gnl|my_center|LOCUS_13250 52854 52447 gene locus_tag LOCUS_13260 gene rbfA 52854 52447 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB5 protein_id gnl|my_center|LOCUS_13260 55562 52854 gene locus_tag LOCUS_13270 gene infB 55562 52854 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB4 protein_id gnl|my_center|LOCUS_13270 57057 55573 gene locus_tag LOCUS_13280 gene nusA 57057 55573 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB3 protein_id gnl|my_center|LOCUS_13280 57621 57097 gene locus_tag LOCUS_13290 gene rimP 57621 57097 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB2 protein_id gnl|my_center|LOCUS_13290 57907 57831 gene locus_tag LOCUS_t00330 57907 57831 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 <1 580 gene locus_tag LOCUS_13300 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206899.1:3-oxoadipyl-CoA thiolase 600 1961 gene locus_tag LOCUS_13310 gene pcaB 600 1961 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206931.1 protein_id gnl|my_center|LOCUS_13310 1958 2749 gene locus_tag LOCUS_13320 gene pcaD 1958 2749 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 protein_id gnl|my_center|LOCUS_13320 2789 4144 gene locus_tag LOCUS_13330 gene pcaK 2789 4144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206929.1 protein_id gnl|my_center|LOCUS_13330 4157 4564 gene locus_tag LOCUS_13340 gene pcaC 4157 4564 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701356.1 protein_id gnl|my_center|LOCUS_13340 4586 5311 gene locus_tag LOCUS_13350 gene pcaH 4586 5311 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077913.1 protein_id gnl|my_center|LOCUS_13350 5330 5959 gene locus_tag LOCUS_13360 gene pcaG 5330 5959 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206928.1 protein_id gnl|my_center|LOCUS_13360 6029 6886 gene locus_tag LOCUS_13370 gene quiB 6029 6886 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF80 protein_id gnl|my_center|LOCUS_13370 6908 8362 gene locus_tag LOCUS_13380 gene quiC 6908 8362 CDS product 3-dehydroshikimate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206926.1 protein_id gnl|my_center|LOCUS_13380 8431 9666 gene locus_tag LOCUS_13390 gene quiX 8431 9666 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF78 protein_id gnl|my_center|LOCUS_13390 10050 12476 gene locus_tag LOCUS_13400 gene quiA 10050 12476 CDS product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206924.1 protein_id gnl|my_center|LOCUS_13400 12661 13593 gene locus_tag LOCUS_13410 12661 13593 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807997.1 protein_id gnl|my_center|LOCUS_13410 13714 14487 gene locus_tag LOCUS_13420 gene moeB 13714 14487 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_13420 14546 15844 gene locus_tag LOCUS_13430 14546 15844 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_13430 15929 16309 gene locus_tag LOCUS_13440 gene folB 15929 16309 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHS1 protein_id gnl|my_center|LOCUS_13440 16266 16709 gene locus_tag LOCUS_13450 16266 16709 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207119.1 protein_id gnl|my_center|LOCUS_13450 16831 17460 gene locus_tag LOCUS_13460 16831 17460 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206638.1 protein_id gnl|my_center|LOCUS_13460 17457 17978 gene locus_tag LOCUS_13470 gene cobU 17457 17978 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_13470 17975 19027 gene locus_tag LOCUS_13480 gene cobT 17975 19027 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN03 protein_id gnl|my_center|LOCUS_13480 19047 19658 gene locus_tag LOCUS_13490 gene cobC 19047 19658 CDS product fructose 2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206641.1 protein_id gnl|my_center|LOCUS_13490 19655 20398 gene locus_tag LOCUS_13500 gene cobS 19655 20398 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN06 protein_id gnl|my_center|LOCUS_13500 20767 20456 gene locus_tag LOCUS_13510 gene tusE 20767 20456 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF7 protein_id gnl|my_center|LOCUS_13510 21065 20781 gene locus_tag LOCUS_13520 21065 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21433 21083 gene locus_tag LOCUS_13530 21433 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115699.1 protein_id gnl|my_center|LOCUS_13530 21845 21477 gene locus_tag LOCUS_13540 gene tusD 21845 21477 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 protein_id gnl|my_center|LOCUS_13540 21918 22925 gene locus_tag LOCUS_13550 gene galE 21918 22925 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207002.1 protein_id gnl|my_center|LOCUS_13550 23045 24439 gene locus_tag LOCUS_13560 gene fumC 23045 24439 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF2 protein_id gnl|my_center|LOCUS_13560 24539 25030 gene locus_tag LOCUS_13570 24539 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115670.1 protein_id gnl|my_center|LOCUS_13570 25267 25869 gene locus_tag LOCUS_13580 25267 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207729.1 protein_id gnl|my_center|LOCUS_13580 26207 26638 gene locus_tag LOCUS_13590 26207 26638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_13590 26703 26912 gene locus_tag LOCUS_13600 26703 26912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 26909 28357 gene locus_tag LOCUS_13610 gene cioA 26909 28357 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206501.1 protein_id gnl|my_center|LOCUS_13610 28354 29358 gene locus_tag LOCUS_13620 gene cioB 28354 29358 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206500.1 protein_id gnl|my_center|LOCUS_13620 29611 30423 gene locus_tag LOCUS_13630 29611 30423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076457.1 protein_id gnl|my_center|LOCUS_13630 30416 30595 gene locus_tag LOCUS_13640 30416 30595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 30696 32156 gene locus_tag LOCUS_13650 30696 32156 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090459.1 protein_id gnl|my_center|LOCUS_13650 32717 32163 gene locus_tag LOCUS_13660 32717 32163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 32989 33582 gene locus_tag LOCUS_13670 32989 33582 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 protein_id gnl|my_center|LOCUS_13670 34073 33606 gene locus_tag LOCUS_13680 34073 33606 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207035.1 protein_id gnl|my_center|LOCUS_13680 34139 34363 gene locus_tag LOCUS_13690 34139 34363 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087716.1 protein_id gnl|my_center|LOCUS_13690 34803 36080 gene locus_tag LOCUS_13700 gene gabT-3 34803 36080 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767839.1 protein_id gnl|my_center|LOCUS_13700 36080 37471 gene locus_tag LOCUS_13710 36080 37471 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103752.1 protein_id gnl|my_center|LOCUS_13710 37523 39094 gene locus_tag LOCUS_13720 37523 39094 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406390.1 protein_id gnl|my_center|LOCUS_13720 39251 40534 gene locus_tag LOCUS_13730 39251 40534 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112529.1 protein_id gnl|my_center|LOCUS_13730 40633 43575 gene locus_tag LOCUS_13740 40633 43575 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104207.1 protein_id gnl|my_center|LOCUS_13740 44557 43622 gene locus_tag LOCUS_13750 44557 43622 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 protein_id gnl|my_center|LOCUS_13750 45035 46435 gene locus_tag LOCUS_13760 gene gabP 45035 46435 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206843.1 protein_id gnl|my_center|LOCUS_13760 47053 46748 gene locus_tag LOCUS_13770 47053 46748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 47174 47320 gene locus_tag LOCUS_13780 47174 47320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 48039 47572 gene locus_tag LOCUS_13790 48039 47572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 protein_id gnl|my_center|LOCUS_13790 49314 48064 gene locus_tag LOCUS_13800 gene mtaD 49314 48064 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206286.1 protein_id gnl|my_center|LOCUS_13800 49587 50231 gene locus_tag LOCUS_13810 49587 50231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 50237 50494 gene locus_tag LOCUS_13820 50237 50494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13820 52185 51118 gene locus_tag LOCUS_13830 52185 51118 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387917.1 protein_id gnl|my_center|LOCUS_13830 53500 52202 gene locus_tag LOCUS_13840 53500 52202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706306.1 protein_id gnl|my_center|LOCUS_13840 53842 54735 gene locus_tag LOCUS_13850 gene ttdR 53842 54735 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 protein_id gnl|my_center|LOCUS_13850 55743 54847 gene locus_tag LOCUS_13860 55743 54847 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113086.1 protein_id gnl|my_center|LOCUS_13860 55884 56921 gene locus_tag LOCUS_13870 55884 56921 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268189.1 protein_id gnl|my_center|LOCUS_13870 56914 57738 gene locus_tag LOCUS_13880 56914 57738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence16 1606 233 gene locus_tag LOCUS_13890 gene cabC1 1606 233 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_13890 2120 1815 gene locus_tag LOCUS_13900 2120 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206634.1 protein_id gnl|my_center|LOCUS_13900 2319 2702 gene locus_tag LOCUS_13910 2319 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2794 3804 gene locus_tag LOCUS_13920 gene prmB 2794 3804 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ1 protein_id gnl|my_center|LOCUS_13920 3817 4911 gene locus_tag LOCUS_13930 gene aroC 3817 4911 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ2 protein_id gnl|my_center|LOCUS_13930 5646 6890 gene locus_tag LOCUS_13940 gene dadA3 5646 6890 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115716.1 protein_id gnl|my_center|LOCUS_13940 7000 7641 gene locus_tag LOCUS_13950 7000 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 8268 7693 gene locus_tag LOCUS_13960 8268 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206996.1 protein_id gnl|my_center|LOCUS_13960 8442 8933 gene locus_tag LOCUS_13970 gene ispF 8442 8933 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE4 protein_id gnl|my_center|LOCUS_13970 9445 8921 gene locus_tag LOCUS_13980 9445 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_13980 10601 9510 gene locus_tag LOCUS_13990 gene aroF 10601 9510 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_13990 11618 10728 gene locus_tag LOCUS_14000 11618 10728 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN08 protein_id gnl|my_center|LOCUS_14000 13549 12068 gene locus_tag LOCUS_14010 13549 12068 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206646.1 protein_id gnl|my_center|LOCUS_14010 16194 13996 gene locus_tag LOCUS_14020 gene fpvA1 16194 13996 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_14020 16413 17591 gene locus_tag LOCUS_14030 gene lpxB 16413 17591 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN14 protein_id gnl|my_center|LOCUS_14030 17818 18285 gene locus_tag LOCUS_14040 gene ybaK 17818 18285 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ8 protein_id gnl|my_center|LOCUS_14040 19067 18432 gene locus_tag LOCUS_14050 gene coq7 19067 18432 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_14050 20394 19072 gene locus_tag LOCUS_14060 gene lplT 20394 19072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 protein_id gnl|my_center|LOCUS_14060 20572 23307 gene locus_tag LOCUS_14070 gene ytfM 20572 23307 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207110.1 protein_id gnl|my_center|LOCUS_14070 23330 27844 gene locus_tag LOCUS_14080 23330 27844 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207109.1 protein_id gnl|my_center|LOCUS_14080 28401 29057 gene locus_tag LOCUS_14090 28401 29057 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816993.1 protein_id gnl|my_center|LOCUS_14090 29083 29943 gene locus_tag LOCUS_14100 29083 29943 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096535.1 protein_id gnl|my_center|LOCUS_14100 30667 30092 gene locus_tag LOCUS_14110 30667 30092 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_14110 31341 30691 gene locus_tag LOCUS_14120 gene hmgA 31341 30691 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_14120 32641 31358 gene locus_tag LOCUS_14130 gene hmgB 32641 31358 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_14130 33032 33811 gene locus_tag LOCUS_14140 gene araD 33032 33811 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 protein_id gnl|my_center|LOCUS_14140 33969 34850 gene locus_tag LOCUS_14150 gene gltC 33969 34850 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206698.1 protein_id gnl|my_center|LOCUS_14150 34975 35688 gene locus_tag LOCUS_14160 gene atoD 34975 35688 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_14160 35692 36339 gene locus_tag LOCUS_14170 gene atoA 35692 36339 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_14170 36442 37614 gene locus_tag LOCUS_14180 gene thlA 36442 37614 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_14180 37912 38112 gene locus_tag LOCUS_14190 37912 38112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 38608 38399 gene locus_tag LOCUS_14200 gene cspA 38608 38399 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 protein_id gnl|my_center|LOCUS_14200 39186 39262 gene locus_tag LOCUS_t00340 39186 39262 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 39415 39774 gene locus_tag LOCUS_14210 39415 39774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073636.1 protein_id gnl|my_center|LOCUS_14210 41039 39975 gene locus_tag LOCUS_14220 gene porB 41039 39975 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_14220 41799 41386 gene locus_tag LOCUS_14230 41799 41386 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_14230 42101 41832 gene locus_tag LOCUS_14240 42101 41832 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206654.1 protein_id gnl|my_center|LOCUS_14240 43055 42183 gene locus_tag LOCUS_14250 43055 42183 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_14250 43364 44551 gene locus_tag LOCUS_14260 gene metZ 43364 44551 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN23 protein_id gnl|my_center|LOCUS_14260 44581 44910 gene locus_tag LOCUS_14270 44581 44910 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_14270 44923 45519 gene locus_tag LOCUS_14280 gene recR 44923 45519 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN26 protein_id gnl|my_center|LOCUS_14280 45744 46886 gene locus_tag LOCUS_14290 gene rnd 45744 46886 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_14290 46955 47323 gene locus_tag LOCUS_14300 46955 47323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 47345 47728 gene locus_tag LOCUS_14310 47345 47728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113949.1 protein_id gnl|my_center|LOCUS_14310 47751 48602 gene locus_tag LOCUS_14320 47751 48602 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_14320 48616 49803 gene locus_tag LOCUS_14330 48616 49803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_14330 50335 49904 gene locus_tag LOCUS_14340 50335 49904 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_14340 50759 50460 gene locus_tag LOCUS_14350 50759 50460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121078.1 protein_id gnl|my_center|LOCUS_14350 51203 50970 gene locus_tag LOCUS_14360 51203 50970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121063.1 protein_id gnl|my_center|LOCUS_14360 51427 51786 gene locus_tag LOCUS_14370 51427 51786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120892.1 protein_id gnl|my_center|LOCUS_14370 51892 52209 gene locus_tag LOCUS_14380 51892 52209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 52404 53501 gene locus_tag LOCUS_14390 gene ftsY 52404 53501 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT1 protein_id gnl|my_center|LOCUS_14390 53780 54373 gene locus_tag LOCUS_14400 53780 54373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121011.1 protein_id gnl|my_center|LOCUS_14400 54784 54542 gene locus_tag LOCUS_14410 54784 54542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 56585 55143 gene locus_tag LOCUS_14420 gene dnaB 56585 55143 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV3 protein_id gnl|my_center|LOCUS_14420 57281 56835 gene locus_tag LOCUS_14430 gene rplI 57281 56835 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_14430 >Feature sequence17 341 1243 gene locus_tag LOCUS_14440 gene vacJ 341 1243 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208418.1 protein_id gnl|my_center|LOCUS_14440 1346 2314 gene locus_tag LOCUS_14450 gene rsbP 1346 2314 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117221.1 protein_id gnl|my_center|LOCUS_14450 2428 2946 gene locus_tag LOCUS_14460 2428 2946 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 protein_id gnl|my_center|LOCUS_14460 2971 3795 gene locus_tag LOCUS_14470 2971 3795 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 protein_id gnl|my_center|LOCUS_14470 3907 4332 gene locus_tag LOCUS_14480 gene ohr 3907 4332 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208414.1 protein_id gnl|my_center|LOCUS_14480 5931 4444 gene locus_tag LOCUS_14490 gene xcpR 5931 4444 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_14490 6025 6852 gene locus_tag LOCUS_14500 6025 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804297.1 protein_id gnl|my_center|LOCUS_14500 6861 7787 gene locus_tag LOCUS_14510 6861 7787 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066312.1 protein_id gnl|my_center|LOCUS_14510 10583 7896 gene locus_tag LOCUS_14520 10583 7896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 protein_id gnl|my_center|LOCUS_14520 10746 13511 gene locus_tag LOCUS_14530 gene polA 10746 13511 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_14530 15900 13705 gene locus_tag LOCUS_14540 15900 13705 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104883.1 protein_id gnl|my_center|LOCUS_14540 16121 16936 gene locus_tag LOCUS_14550 16121 16936 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207330.1 protein_id gnl|my_center|LOCUS_14550 17738 17169 gene locus_tag LOCUS_14560 17738 17169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_14560 18596 17766 gene locus_tag LOCUS_14570 gene proC 18596 17766 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_14570 19854 18625 gene locus_tag LOCUS_14580 gene mesJ 19854 18625 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF2 protein_id gnl|my_center|LOCUS_14580 20735 19911 gene locus_tag LOCUS_14590 gene accA 20735 19911 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF1 protein_id gnl|my_center|LOCUS_14590 22306 20786 gene locus_tag LOCUS_14600 gene ppx 22306 20786 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_14600 22567 22893 gene locus_tag LOCUS_14610 gene trxA 22567 22893 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE9 protein_id gnl|my_center|LOCUS_14610 23229 24497 gene locus_tag LOCUS_14620 gene rho 23229 24497 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE8 protein_id gnl|my_center|LOCUS_14620 25183 24698 gene locus_tag LOCUS_14630 25183 24698 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207592.1 protein_id gnl|my_center|LOCUS_14630 26819 25176 gene locus_tag LOCUS_14640 gene cysI 26819 25176 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207593.1 protein_id gnl|my_center|LOCUS_14640 29510 27108 gene locus_tag LOCUS_14650 gene gcd 29510 27108 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207594.1 protein_id gnl|my_center|LOCUS_14650 30931 29690 gene locus_tag LOCUS_14660 gene oprB 30931 29690 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNS1 protein_id gnl|my_center|LOCUS_14660 31559 32599 gene locus_tag LOCUS_14670 gene oruR 31559 32599 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_14670 32795 33058 gene locus_tag LOCUS_14680 32795 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280981.1 protein_id gnl|my_center|LOCUS_14680 33594 33163 gene locus_tag LOCUS_14690 33594 33163 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207602.1 protein_id gnl|my_center|LOCUS_14690 34876 33653 gene locus_tag LOCUS_14700 gene gstcD 34876 33653 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_14700 34978 35619 gene locus_tag LOCUS_14710 gene yqfA 34978 35619 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207604.1 protein_id gnl|my_center|LOCUS_14710 35837 37075 gene locus_tag LOCUS_14720 gene yhjE 35837 37075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207605.1 protein_id gnl|my_center|LOCUS_14720 38042 37221 gene locus_tag LOCUS_14730 38042 37221 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_14730 38955 38050 gene locus_tag LOCUS_14740 38955 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208372.1 protein_id gnl|my_center|LOCUS_14740 39888 39070 gene locus_tag LOCUS_14750 39888 39070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117238.1 protein_id gnl|my_center|LOCUS_14750 41575 39983 gene locus_tag LOCUS_14760 gene prfC 41575 39983 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU2 protein_id gnl|my_center|LOCUS_14760 42023 41700 gene locus_tag LOCUS_14770 42023 41700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 44613 42415 gene locus_tag LOCUS_14780 gene prc 44613 42415 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 protein_id gnl|my_center|LOCUS_14780 44814 45836 gene locus_tag LOCUS_14790 gene nagZ 44814 45836 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_14790 46022 47287 gene locus_tag LOCUS_14800 gene proA 46022 47287 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_14800 47822 48985 gene locus_tag LOCUS_14810 gene ackA 47822 48985 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM8 protein_id gnl|my_center|LOCUS_14810 49041 51182 gene locus_tag LOCUS_14820 gene pta 49041 51182 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM7 protein_id gnl|my_center|LOCUS_14820 51867 51235 gene locus_tag LOCUS_14830 gene yahN 51867 51235 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208296.1 protein_id gnl|my_center|LOCUS_14830 52610 51981 gene locus_tag LOCUS_14840 52610 51981 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_14840 52875 54401 gene locus_tag LOCUS_14850 gene fumA 52875 54401 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM6 protein_id gnl|my_center|LOCUS_14850 <55863 54543 gene locus_tag LOCUS_14860 <55863 54543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMM3:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence18 1019 135 gene locus_tag LOCUS_14870 gene metR 1019 135 CDS product cell density-dependent motility repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207780.1 protein_id gnl|my_center|LOCUS_14870 2681 1203 gene locus_tag LOCUS_14880 gene cycA 2681 1203 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206138.1 protein_id gnl|my_center|LOCUS_14880 4057 3080 gene locus_tag LOCUS_14890 gene astE 4057 3080 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE5 protein_id gnl|my_center|LOCUS_14890 5422 4082 gene locus_tag LOCUS_14900 gene astB 5422 4082 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE6 protein_id gnl|my_center|LOCUS_14900 6913 5444 gene locus_tag LOCUS_14910 gene astD 6913 5444 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE7 protein_id gnl|my_center|LOCUS_14910 7944 6913 gene locus_tag LOCUS_14920 gene astA 7944 6913 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE8 protein_id gnl|my_center|LOCUS_14920 9172 7955 gene locus_tag LOCUS_14930 gene astC 9172 7955 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE9 protein_id gnl|my_center|LOCUS_14930 10521 9250 gene locus_tag LOCUS_14940 gene gdhA 10521 9250 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_14940 10717 11139 gene locus_tag LOCUS_14950 10717 11139 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_14950 11869 11234 gene locus_tag LOCUS_14960 gene rhtC 11869 11234 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114256.1 protein_id gnl|my_center|LOCUS_14960 12023 11871 gene locus_tag LOCUS_14970 12023 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 12115 13047 gene locus_tag LOCUS_14980 gene ltrA 12115 13047 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206473.1 protein_id gnl|my_center|LOCUS_14980 13755 13147 gene locus_tag LOCUS_14990 gene ttdB 13755 13147 CDS product L+-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077020.1 protein_id gnl|my_center|LOCUS_14990 14651 13752 gene locus_tag LOCUS_15000 gene ttdA 14651 13752 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206174.1 protein_id gnl|my_center|LOCUS_15000 16002 14704 gene locus_tag LOCUS_15010 gene ttuB 16002 14704 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 protein_id gnl|my_center|LOCUS_15010 16237 17136 gene locus_tag LOCUS_15020 gene ttdR 16237 17136 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 protein_id gnl|my_center|LOCUS_15020 17283 18200 gene locus_tag LOCUS_15030 gene mdcR 17283 18200 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206497.1 protein_id gnl|my_center|LOCUS_15030 19018 18257 gene locus_tag LOCUS_15040 gene madM 19018 18257 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765415.1 protein_id gnl|my_center|LOCUS_15040 19427 19011 gene locus_tag LOCUS_15050 19427 19011 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402948.1 protein_id gnl|my_center|LOCUS_15050 20414 19482 gene locus_tag LOCUS_15060 gene mdcH 20414 19482 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLI2 protein_id gnl|my_center|LOCUS_15060 21036 20416 gene locus_tag LOCUS_15070 gene mdcG 21036 20416 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206495.1 protein_id gnl|my_center|LOCUS_15070 21860 21036 gene locus_tag LOCUS_15080 gene mdcE 21860 21036 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206494.1 protein_id gnl|my_center|LOCUS_15080 22708 21863 gene locus_tag LOCUS_15090 gene mdcD 22708 21863 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206493.1 protein_id gnl|my_center|LOCUS_15090 23000 22701 gene locus_tag LOCUS_15100 gene mdcC 23000 22701 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLH8 protein_id gnl|my_center|LOCUS_15100 23890 23012 gene locus_tag LOCUS_15110 gene mdcB 23890 23012 CDS product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL22 protein_id gnl|my_center|LOCUS_15110 25569 23890 gene locus_tag LOCUS_15120 25569 23890 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206490.1 protein_id gnl|my_center|LOCUS_15120 28247 26049 gene locus_tag LOCUS_15130 gene iutA 28247 26049 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_15130 29055 28456 gene locus_tag LOCUS_15140 gene rhbD 29055 28456 CDS product rhizobactin siderophore biosynthesis protein RhbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q9 protein_id gnl|my_center|LOCUS_15140 29699 29082 gene locus_tag LOCUS_15150 29699 29082 CDS product S-adenosylmethionine--2-demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267804.1 protein_id gnl|my_center|LOCUS_15150 30505 29684 gene locus_tag LOCUS_15160 30505 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 32448 30523 gene locus_tag LOCUS_15170 32448 30523 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267799.1 protein_id gnl|my_center|LOCUS_15170 34298 32460 gene locus_tag LOCUS_15180 34298 32460 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267797.1 protein_id gnl|my_center|LOCUS_15180 35756 34323 gene locus_tag LOCUS_15190 35756 34323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267796.1 protein_id gnl|my_center|LOCUS_15190 37177 35771 gene locus_tag LOCUS_15200 gene rhbE 37177 35771 CDS product rhizobactin siderophore biosynthesis protein RhbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q8 protein_id gnl|my_center|LOCUS_15200 38960 37170 gene locus_tag LOCUS_15210 38960 37170 CDS product petrobactin biosynthesis protein AsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163354.1 protein_id gnl|my_center|LOCUS_15210 39265 39654 gene locus_tag LOCUS_15220 39265 39654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 40125 39739 gene locus_tag LOCUS_15230 40125 39739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269382.1 protein_id gnl|my_center|LOCUS_15230 41037 40174 gene locus_tag LOCUS_15240 41037 40174 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416628.1 protein_id gnl|my_center|LOCUS_15240 42034 41078 gene locus_tag LOCUS_15250 42034 41078 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228200.1 protein_id gnl|my_center|LOCUS_15250 43239 42307 gene locus_tag LOCUS_15260 gene dsdC 43239 42307 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605223.1 protein_id gnl|my_center|LOCUS_15260 43459 44796 gene locus_tag LOCUS_15270 43459 44796 CDS product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369057.1 protein_id gnl|my_center|LOCUS_15270 44816 46147 gene locus_tag LOCUS_15280 gene dsdA 44816 46147 CDS product D-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XCK5 protein_id gnl|my_center|LOCUS_15280 47448 46390 gene locus_tag LOCUS_15290 gene bdh1 47448 46390 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_15290 48990 47590 gene locus_tag LOCUS_15300 gene acoD 48990 47590 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK1 protein_id gnl|my_center|LOCUS_15300 50550 49000 gene locus_tag LOCUS_15310 gene acoC 50550 49000 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK0 protein_id gnl|my_center|LOCUS_15310 51571 50552 gene locus_tag LOCUS_15320 gene acoB 51571 50552 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 protein_id gnl|my_center|LOCUS_15320 52549 51587 gene locus_tag LOCUS_15330 gene acoA 52549 51587 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_15330 52909 53889 gene locus_tag LOCUS_15340 gene lipA 52909 53889 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ7 protein_id gnl|my_center|LOCUS_15340 54148 55239 gene locus_tag LOCUS_15350 54148 55239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069347.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence19 277 1761 gene locus_tag LOCUS_15360 gene glpK 277 1761 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT38 protein_id gnl|my_center|LOCUS_15360 3345 1816 gene locus_tag LOCUS_15370 gene emrB 3345 1816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_15370 4503 3352 gene locus_tag LOCUS_15380 gene emrA 4503 3352 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_15380 5350 4850 gene locus_tag LOCUS_15390 5350 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205992.1 protein_id gnl|my_center|LOCUS_15390 5455 6468 gene locus_tag LOCUS_15400 gene hemB 5455 6468 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN7 protein_id gnl|my_center|LOCUS_15400 6487 7608 gene locus_tag LOCUS_15410 6487 7608 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205991.1 protein_id gnl|my_center|LOCUS_15410 8303 7929 gene locus_tag LOCUS_15420 8303 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 9360 8770 gene locus_tag LOCUS_15430 gene rhtC 9360 8770 CDS product threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_15430 9517 9335 gene locus_tag LOCUS_15440 9517 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 9834 9640 gene locus_tag LOCUS_15450 9834 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10113 10985 gene locus_tag LOCUS_15460 gene dcyD 10113 10985 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_15460 11052 12251 gene locus_tag LOCUS_15470 11052 12251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205908.1 protein_id gnl|my_center|LOCUS_15470 12764 12552 gene locus_tag LOCUS_15480 12764 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 14451 12796 gene locus_tag LOCUS_15490 14451 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_15490 14956 14678 gene locus_tag LOCUS_15500 14956 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 15246 15668 gene locus_tag LOCUS_15510 15246 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205905.1 protein_id gnl|my_center|LOCUS_15510 16475 15714 gene locus_tag LOCUS_15520 gene fpr 16475 15714 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_15520 16561 17445 gene locus_tag LOCUS_15530 gene yeiE 16561 17445 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_15530 17881 17588 gene locus_tag LOCUS_15540 17881 17588 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205904.1 protein_id gnl|my_center|LOCUS_15540 18605 17970 gene locus_tag LOCUS_15550 gene upp 18605 17970 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET7 protein_id gnl|my_center|LOCUS_15550 20198 18705 gene locus_tag LOCUS_15560 gene nuoN 20198 18705 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET6 protein_id gnl|my_center|LOCUS_15560 21812 20202 gene locus_tag LOCUS_15570 gene nuoM 21812 20202 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 protein_id gnl|my_center|LOCUS_15570 23709 21814 gene locus_tag LOCUS_15580 gene nuoL 23709 21814 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120008.1 protein_id gnl|my_center|LOCUS_15580 24014 23706 gene locus_tag LOCUS_15590 gene nuoK 24014 23706 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET3 protein_id gnl|my_center|LOCUS_15590 24535 24014 gene locus_tag LOCUS_15600 gene nuoJ 24535 24014 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205902.1 protein_id gnl|my_center|LOCUS_15600 25074 24532 gene locus_tag LOCUS_15610 gene nuoI 25074 24532 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XFD5 protein_id gnl|my_center|LOCUS_15610 26109 25093 gene locus_tag LOCUS_15620 gene nuoH 26109 25093 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET0 protein_id gnl|my_center|LOCUS_15620 28797 26113 gene locus_tag LOCUS_15630 gene nuoG 28797 26113 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES9 protein_id gnl|my_center|LOCUS_15630 30140 28809 gene locus_tag LOCUS_15640 gene nuoF 30140 28809 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_15640 30646 30137 gene locus_tag LOCUS_15650 gene nuoE 30646 30137 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_15650 32446 30659 gene locus_tag LOCUS_15660 gene nuoC 32446 30659 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES6 protein_id gnl|my_center|LOCUS_15660 33211 32534 gene locus_tag LOCUS_15670 gene nuoB 33211 32534 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES5 protein_id gnl|my_center|LOCUS_15670 33766 33218 gene locus_tag LOCUS_15680 gene nuoA 33766 33218 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPM2 protein_id gnl|my_center|LOCUS_15680 34108 33977 gene locus_tag LOCUS_15690 34108 33977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 34338 34685 gene locus_tag LOCUS_15700 34338 34685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205897.1 protein_id gnl|my_center|LOCUS_15700 36397 34760 gene locus_tag LOCUS_15710 gene rstB 36397 34760 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_15710 37144 36428 gene locus_tag LOCUS_15720 gene rstA 37144 36428 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_15720 37732 40566 gene locus_tag LOCUS_15730 gene nrdA 37732 40566 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071099.1 protein_id gnl|my_center|LOCUS_15730 40639 40773 gene locus_tag LOCUS_15740 40639 40773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 40914 42197 gene locus_tag LOCUS_15750 gene nrdB 40914 42197 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPL5 protein_id gnl|my_center|LOCUS_15750 42683 43594 gene locus_tag LOCUS_15760 gene pqqB 42683 43594 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP45 protein_id gnl|my_center|LOCUS_15760 43605 44360 gene locus_tag LOCUS_15770 gene pqqC 43605 44360 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP46 protein_id gnl|my_center|LOCUS_15770 44357 44641 gene locus_tag LOCUS_15780 gene pqqD 44357 44641 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP47 protein_id gnl|my_center|LOCUS_15780 44638 45789 gene locus_tag LOCUS_15790 gene pqqE 44638 45789 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP48 protein_id gnl|my_center|LOCUS_15790 45792 46847 gene locus_tag LOCUS_15800 45792 46847 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206725.1 protein_id gnl|my_center|LOCUS_15800 47956 47078 gene locus_tag LOCUS_15810 gene yhaE 47956 47078 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206830.1 protein_id gnl|my_center|LOCUS_15810 49332 47956 gene locus_tag LOCUS_15820 gene hpaX 49332 47956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206831.1 protein_id gnl|my_center|LOCUS_15820 50339 49347 gene locus_tag LOCUS_15830 50339 49347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206832.1 protein_id gnl|my_center|LOCUS_15830 51479 50535 gene locus_tag LOCUS_15840 51479 50535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 51591 52766 gene locus_tag LOCUS_15850 51591 52766 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206835.1 protein_id gnl|my_center|LOCUS_15850 52891 54678 gene locus_tag LOCUS_15860 52891 54678 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086692.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence20 2 1264 gene locus_tag LOCUS_15870 gene ftsA 2 1264 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC4 protein_id gnl|my_center|LOCUS_15870 1424 2617 gene locus_tag LOCUS_15880 gene ftsZ 1424 2617 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC3 protein_id gnl|my_center|LOCUS_15880 2740 3642 gene locus_tag LOCUS_15890 gene lpxC 2740 3642 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC2 protein_id gnl|my_center|LOCUS_15890 4179 3739 gene locus_tag LOCUS_15900 4179 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121887.1 protein_id gnl|my_center|LOCUS_15900 4287 4976 gene locus_tag LOCUS_15910 gene yebA 4287 4976 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121983.1 protein_id gnl|my_center|LOCUS_15910 5256 7970 gene locus_tag LOCUS_15920 gene aceE 5256 7970 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB9 protein_id gnl|my_center|LOCUS_15920 7973 9940 gene locus_tag LOCUS_15930 gene aceF 7973 9940 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB8 protein_id gnl|my_center|LOCUS_15930 10368 10943 gene locus_tag LOCUS_15940 10368 10943 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_15940 11382 12848 gene locus_tag LOCUS_15950 gene guaB 11382 12848 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB3 protein_id gnl|my_center|LOCUS_15950 12975 14306 gene locus_tag LOCUS_15960 gene glmM 12975 14306 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB2 protein_id gnl|my_center|LOCUS_15960 14316 14972 gene locus_tag LOCUS_15970 gene pdxH 14316 14972 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB1 protein_id gnl|my_center|LOCUS_15970 14973 16676 gene locus_tag LOCUS_15980 gene recJ 14973 16676 CDS product ssDNA exonuclease, 5'--> 3' specific, Mg dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_004997053.1 protein_id gnl|my_center|LOCUS_15980 17514 16726 gene locus_tag LOCUS_15990 17514 16726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 protein_id gnl|my_center|LOCUS_15990 18068 19117 gene locus_tag LOCUS_16000 gene prfB 18068 19117 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA8 protein_id gnl|my_center|LOCUS_16000 19348 19650 gene locus_tag LOCUS_16010 19348 19650 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121891.1 protein_id gnl|my_center|LOCUS_16010 19689 20765 gene locus_tag LOCUS_16020 gene nemA 19689 20765 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207922.1 protein_id gnl|my_center|LOCUS_16020 20959 22155 gene locus_tag LOCUS_16030 gene kdtA 20959 22155 CDS product 3-deoxy-D-manno-2-octulosonate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207921.1 protein_id gnl|my_center|LOCUS_16030 22378 23091 gene locus_tag LOCUS_16040 22378 23091 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA4 protein_id gnl|my_center|LOCUS_16040 24048 23074 gene locus_tag LOCUS_16050 24048 23074 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_16050 24738 24157 gene locus_tag LOCUS_16060 24738 24157 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066837.1 protein_id gnl|my_center|LOCUS_16060 25027 26970 gene locus_tag LOCUS_16070 gene acsA2 25027 26970 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207919.1 protein_id gnl|my_center|LOCUS_16070 27654 27037 gene locus_tag LOCUS_16080 gene rhtB 27654 27037 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206232.1 protein_id gnl|my_center|LOCUS_16080 29117 27972 gene locus_tag LOCUS_16090 29117 27972 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208088.1 protein_id gnl|my_center|LOCUS_16090 30372 29263 gene locus_tag LOCUS_16100 gene ssuD 30372 29263 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207915.1 protein_id gnl|my_center|LOCUS_16100 31136 30402 gene locus_tag LOCUS_16110 gene msuE 31136 30402 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207914.1 protein_id gnl|my_center|LOCUS_16110 31504 32163 gene locus_tag LOCUS_16120 gene agmR 31504 32163 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_16120 35791 32294 gene locus_tag LOCUS_16130 gene luxQ 35791 32294 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207912.1 protein_id gnl|my_center|LOCUS_16130 35976 36308 gene locus_tag LOCUS_16140 35976 36308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 protein_id gnl|my_center|LOCUS_16140 36310 38025 gene locus_tag LOCUS_16150 36310 38025 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 protein_id gnl|my_center|LOCUS_16150 38200 38883 gene locus_tag LOCUS_16160 38200 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_16160 39165 41135 gene locus_tag LOCUS_16170 gene betT 39165 41135 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207909.1 protein_id gnl|my_center|LOCUS_16170 42101 41217 gene locus_tag LOCUS_16180 42101 41217 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207908.1 protein_id gnl|my_center|LOCUS_16180 42961 43275 gene locus_tag LOCUS_16190 42961 43275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 46647 43816 gene locus_tag LOCUS_16200 gene uvrA 46647 43816 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGS6 protein_id gnl|my_center|LOCUS_16200 46902 47258 gene locus_tag LOCUS_16210 46902 47258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_16210 47316 47657 gene locus_tag LOCUS_16220 gene glpM 47316 47657 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789991.1 protein_id gnl|my_center|LOCUS_16220 48607 47939 gene locus_tag LOCUS_16230 gene thiED 48607 47939 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGR9 protein_id gnl|my_center|LOCUS_16230 48842 49918 gene locus_tag LOCUS_16240 48842 49918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_16240 50075 51439 gene locus_tag LOCUS_16250 gene yajR 50075 51439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_16250 51491 52087 gene locus_tag LOCUS_16260 51491 52087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence21 152 994 gene locus_tag LOCUS_16270 gene czcD 152 994 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207843.1 protein_id gnl|my_center|LOCUS_16270 1368 1027 gene locus_tag LOCUS_16280 1368 1027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078496.1 protein_id gnl|my_center|LOCUS_16280 1581 1506 gene locus_tag LOCUS_t00350 1581 1506 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1688 1613 gene locus_tag LOCUS_t00360 1688 1613 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3254 1746 gene locus_tag LOCUS_16290 gene gltX 3254 1746 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 protein_id gnl|my_center|LOCUS_16290 3633 3394 gene locus_tag LOCUS_16300 3633 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116889.1 protein_id gnl|my_center|LOCUS_16300 4057 5079 gene locus_tag LOCUS_16310 gene sbp 4057 5079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207839.1 protein_id gnl|my_center|LOCUS_16310 5324 6247 gene locus_tag LOCUS_16320 gene mraW 5324 6247 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG25 protein_id gnl|my_center|LOCUS_16320 6247 6579 gene locus_tag LOCUS_16330 gene ftsL 6247 6579 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG24 protein_id gnl|my_center|LOCUS_16330 6593 8416 gene locus_tag LOCUS_16340 gene ftsI 6593 8416 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_16340 8427 9923 gene locus_tag LOCUS_16350 gene murE 8427 9923 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG22 protein_id gnl|my_center|LOCUS_16350 9933 11339 gene locus_tag LOCUS_16360 gene murF 9933 11339 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG21 protein_id gnl|my_center|LOCUS_16360 11339 12457 gene locus_tag LOCUS_16370 gene mraY 11339 12457 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG20 protein_id gnl|my_center|LOCUS_16370 12540 13343 gene locus_tag LOCUS_16380 gene rrmA 12540 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_16380 15837 13393 gene locus_tag LOCUS_16390 gene ponA 15837 13393 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 protein_id gnl|my_center|LOCUS_16390 16092 17153 gene locus_tag LOCUS_16400 gene pilM 16092 17153 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804529.1 protein_id gnl|my_center|LOCUS_16400 17153 17797 gene locus_tag LOCUS_16410 gene pilN 17153 17797 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_16410 17794 18546 gene locus_tag LOCUS_16420 gene pilO 17794 18546 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_16420 18549 19076 gene locus_tag LOCUS_16430 gene pilP 18549 19076 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_16430 19094 19888 gene locus_tag LOCUS_16440 19094 19888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16440 19849 21231 gene locus_tag LOCUS_16450 19849 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 21268 21816 gene locus_tag LOCUS_16460 gene aroK 21268 21816 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG11 protein_id gnl|my_center|LOCUS_16460 21834 22919 gene locus_tag LOCUS_16470 gene aroB 21834 22919 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG10 protein_id gnl|my_center|LOCUS_16470 22923 23786 gene locus_tag LOCUS_16480 22923 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207827.1 protein_id gnl|my_center|LOCUS_16480 24232 28713 gene locus_tag LOCUS_16490 gene gltB 24232 28713 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207826.1 protein_id gnl|my_center|LOCUS_16490 28786 30207 gene locus_tag LOCUS_16500 gene gltD 28786 30207 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_16500 30247 30429 gene locus_tag LOCUS_16510 30247 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 30390 30980 gene locus_tag LOCUS_16520 30390 30980 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117090.1 protein_id gnl|my_center|LOCUS_16520 31010 32086 gene locus_tag LOCUS_16530 31010 32086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207823.1 protein_id gnl|my_center|LOCUS_16530 32080 32640 gene locus_tag LOCUS_16540 32080 32640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207822.1 protein_id gnl|my_center|LOCUS_16540 32850 33329 gene locus_tag LOCUS_16550 gene pilA 32850 33329 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04739 protein_id gnl|my_center|LOCUS_16550 33418 33660 gene locus_tag LOCUS_16560 33418 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 33666 34883 gene locus_tag LOCUS_16570 33666 34883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 35046 35777 gene locus_tag LOCUS_16580 35046 35777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 35846 37483 gene locus_tag LOCUS_16590 35846 37483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207819.1 protein_id gnl|my_center|LOCUS_16590 38001 37537 gene locus_tag LOCUS_16600 gene bfrB 38001 37537 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ9 protein_id gnl|my_center|LOCUS_16600 38451 38257 gene locus_tag LOCUS_16610 gene bfd 38451 38257 CDS product regulatory or redox protein complexing with Bfr in iron storage and mobility inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000629.1 protein_id gnl|my_center|LOCUS_16610 39002 38619 gene locus_tag LOCUS_16620 39002 38619 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_16620 41175 39070 gene locus_tag LOCUS_16630 gene spoT 41175 39070 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_16630 41678 41397 gene locus_tag LOCUS_16640 gene rpoZ 41678 41397 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ3 protein_id gnl|my_center|LOCUS_16640 42378 41755 gene locus_tag LOCUS_16650 gene gmk 42378 41755 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ2 protein_id gnl|my_center|LOCUS_16650 42513 43463 gene locus_tag LOCUS_16660 gene ispH 42513 43463 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_16660 43713 43498 gene locus_tag LOCUS_16670 43713 43498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 43634 44071 gene locus_tag LOCUS_16680 43634 44071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 44091 44585 gene locus_tag LOCUS_16690 gene pilV 44091 44585 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207814.1 protein_id gnl|my_center|LOCUS_16690 44575 45591 gene locus_tag LOCUS_16700 44575 45591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 45588 46274 gene locus_tag LOCUS_16710 gene pilX 45588 46274 CDS product type IV fimbrial biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207812.1 protein_id gnl|my_center|LOCUS_16710 46292 50473 gene locus_tag LOCUS_16720 46292 50473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 50484 51200 gene locus_tag LOCUS_16730 50484 51200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 51326 51646 gene locus_tag LOCUS_16740 51326 51646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 51792 52073 gene locus_tag LOCUS_16750 gene rpsP 51792 52073 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY3 protein_id gnl|my_center|LOCUS_16750 >Feature sequence22 254 409 gene locus_tag LOCUS_16760 gene rpmG 254 409 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_16760 550 2268 gene locus_tag LOCUS_16770 gene ybaL 550 2268 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079171.1 protein_id gnl|my_center|LOCUS_16770 2601 2323 gene locus_tag LOCUS_16780 2601 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114792.1 protein_id gnl|my_center|LOCUS_16780 3210 2707 gene locus_tag LOCUS_16790 3210 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_16790 3911 3621 gene locus_tag LOCUS_16800 gene rbpD 3911 3621 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_16800 5999 4008 gene locus_tag LOCUS_16810 gene pcrA 5999 4008 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM27 protein_id gnl|my_center|LOCUS_16810 7217 6066 gene locus_tag LOCUS_16820 7217 6066 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_16820 8128 7370 gene locus_tag LOCUS_16830 8128 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_16830 10946 8307 gene locus_tag LOCUS_16840 gene topA 10946 8307 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM24 protein_id gnl|my_center|LOCUS_16840 11431 10982 gene locus_tag LOCUS_16850 11431 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004842579.1 protein_id gnl|my_center|LOCUS_16850 12515 11502 gene locus_tag LOCUS_16860 12515 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 12843 12598 gene locus_tag LOCUS_16870 12843 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 12877 14784 gene locus_tag LOCUS_16880 gene uup 12877 14784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_16880 14990 15832 gene locus_tag LOCUS_16890 gene htrB 14990 15832 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_16890 15864 16988 gene locus_tag LOCUS_16900 gene lpsB 15864 16988 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_16900 18389 17262 gene locus_tag LOCUS_16910 18389 17262 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_16910 18581 19699 gene locus_tag LOCUS_16920 gene asd 18581 19699 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM13 protein_id gnl|my_center|LOCUS_16920 19843 21243 gene locus_tag LOCUS_16930 19843 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208290.1 protein_id gnl|my_center|LOCUS_16930 21315 22652 gene locus_tag LOCUS_16940 21315 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208289.1 protein_id gnl|my_center|LOCUS_16940 22684 23664 gene locus_tag LOCUS_16950 gene ansA 22684 23664 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208288.1 protein_id gnl|my_center|LOCUS_16950 23682 24479 gene locus_tag LOCUS_16960 gene truA 23682 24479 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM09 protein_id gnl|my_center|LOCUS_16960 25604 24594 gene locus_tag LOCUS_16970 gene rr07 25604 24594 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_16970 25834 26055 gene locus_tag LOCUS_16980 gene infA 25834 26055 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_16980 27468 26389 gene locus_tag LOCUS_16990 gene leuB 27468 26389 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_16990 28076 27513 gene locus_tag LOCUS_17000 28076 27513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066026.1 protein_id gnl|my_center|LOCUS_17000 28833 28183 gene locus_tag LOCUS_17010 gene leuD 28833 28183 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_17010 30288 28855 gene locus_tag LOCUS_17020 gene leuC 30288 28855 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_17020 30697 30506 gene locus_tag LOCUS_17030 30697 30506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 31053 31922 gene locus_tag LOCUS_17040 gene gltC 31053 31922 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 protein_id gnl|my_center|LOCUS_17040 32224 31979 gene locus_tag LOCUS_17050 32224 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_17050 33049 32399 gene locus_tag LOCUS_17060 33049 32399 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_17060 33232 33708 gene locus_tag LOCUS_17070 gene rppH 33232 33708 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLZ5 protein_id gnl|my_center|LOCUS_17070 33799 36096 gene locus_tag LOCUS_17080 gene ptsP 33799 36096 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208281.1 protein_id gnl|my_center|LOCUS_17080 36296 36099 gene locus_tag LOCUS_17090 36296 36099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 36805 38325 gene locus_tag LOCUS_17100 gene kat 36805 38325 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS5 protein_id gnl|my_center|LOCUS_17100 39360 38392 gene locus_tag LOCUS_17110 39360 38392 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208279.1 protein_id gnl|my_center|LOCUS_17110 40051 40932 gene locus_tag LOCUS_17120 gene hcaR 40051 40932 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066014.1 protein_id gnl|my_center|LOCUS_17120 41123 41800 gene locus_tag LOCUS_17130 41123 41800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_17130 42560 41952 gene locus_tag LOCUS_17140 gene erd13 42560 41952 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 protein_id gnl|my_center|LOCUS_17140 43329 42625 gene locus_tag LOCUS_17150 43329 42625 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114898.1 protein_id gnl|my_center|LOCUS_17150 44058 43390 gene locus_tag LOCUS_17160 gene ppaX 44058 43390 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 protein_id gnl|my_center|LOCUS_17160 45252 44317 gene locus_tag LOCUS_17170 45252 44317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 45625 45443 gene locus_tag LOCUS_17180 45625 45443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 46018 49452 gene locus_tag LOCUS_17190 gene rne 46018 49452 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY4 protein_id gnl|my_center|LOCUS_17190 49627 51468 gene locus_tag LOCUS_17200 49627 51468 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 protein_id gnl|my_center|LOCUS_17200 51661 51736 gene locus_tag LOCUS_t00370 51661 51736 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 1584 901 gene locus_tag LOCUS_17210 gene cmk 1584 901 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD6 protein_id gnl|my_center|LOCUS_17210 2033 1602 gene locus_tag LOCUS_17220 2033 1602 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 protein_id gnl|my_center|LOCUS_17220 2613 2092 gene locus_tag LOCUS_17230 gene yfhC 2613 2092 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_17230 3741 2617 gene locus_tag LOCUS_17240 gene hibch 3741 2617 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206599.1 protein_id gnl|my_center|LOCUS_17240 4451 3738 gene locus_tag LOCUS_17250 gene ung 4451 3738 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_17250 5094 4498 gene locus_tag LOCUS_17260 5094 4498 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_17260 6161 5211 gene locus_tag LOCUS_17270 gene xcpX 6161 5211 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_17270 6849 6220 gene locus_tag LOCUS_17280 gene xcpW 6849 6220 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_17280 7223 6846 gene locus_tag LOCUS_17290 gene xcpV 7223 6846 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121425.1 protein_id gnl|my_center|LOCUS_17290 7725 7213 gene locus_tag LOCUS_17300 7725 7213 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206596.1 protein_id gnl|my_center|LOCUS_17300 8394 7780 gene locus_tag LOCUS_17310 8394 7780 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_17310 9212 8439 gene locus_tag LOCUS_17320 gene ycfH 9212 8439 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_17320 9581 9240 gene locus_tag LOCUS_17330 gene pilZ 9581 9240 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_17330 10582 9599 gene locus_tag LOCUS_17340 gene holB 10582 9599 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 protein_id gnl|my_center|LOCUS_17340 11373 10612 gene locus_tag LOCUS_17350 gene kdsB 11373 10612 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC2 protein_id gnl|my_center|LOCUS_17350 12393 11386 gene locus_tag LOCUS_17360 gene lpxK 12393 11386 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC1 protein_id gnl|my_center|LOCUS_17360 14124 12397 gene locus_tag LOCUS_17370 gene msbA 14124 12397 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC0 protein_id gnl|my_center|LOCUS_17370 14546 14124 gene locus_tag LOCUS_17380 gene exbD 14546 14124 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_17380 15193 14555 gene locus_tag LOCUS_17390 15193 14555 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_17390 16106 15219 gene locus_tag LOCUS_17400 gene spoOJ 16106 15219 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206589.1 protein_id gnl|my_center|LOCUS_17400 16885 16103 gene locus_tag LOCUS_17410 gene soj 16885 16103 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_17410 17542 16910 gene locus_tag LOCUS_17420 gene gidB 17542 16910 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB5 protein_id gnl|my_center|LOCUS_17420 18317 17628 gene locus_tag LOCUS_17430 gene mpg1 18317 17628 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_17430 19330 18317 gene locus_tag LOCUS_17440 19330 18317 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 protein_id gnl|my_center|LOCUS_17440 19451 21904 gene locus_tag LOCUS_17450 gene lptD 19451 21904 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB2 protein_id gnl|my_center|LOCUS_17450 21904 23208 gene locus_tag LOCUS_17460 gene surA 21904 23208 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB1 protein_id gnl|my_center|LOCUS_17460 23933 23400 gene locus_tag LOCUS_17470 23933 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 24970 24026 gene locus_tag LOCUS_17480 gene miaA 24970 24026 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH83 protein_id gnl|my_center|LOCUS_17480 26932 24977 gene locus_tag LOCUS_17490 gene mutL 26932 24977 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH84 protein_id gnl|my_center|LOCUS_17490 27527 26925 gene locus_tag LOCUS_17500 27527 26925 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_17500 27526 28431 gene locus_tag LOCUS_17510 27526 28431 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207101.1 protein_id gnl|my_center|LOCUS_17510 28547 28867 gene locus_tag LOCUS_17520 28547 28867 CDS product RelB/DinJ family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068595.1 protein_id gnl|my_center|LOCUS_17520 28958 29401 gene locus_tag LOCUS_17530 28958 29401 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122286.1 protein_id gnl|my_center|LOCUS_17530 30122 29394 gene locus_tag LOCUS_17540 gene rsuA 30122 29394 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH89 protein_id gnl|my_center|LOCUS_17540 30210 30692 gene locus_tag LOCUS_17550 30210 30692 CDS product UPF0756 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHP9 protein_id gnl|my_center|LOCUS_17550 31719 30799 gene locus_tag LOCUS_17560 gene metR 31719 30799 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 protein_id gnl|my_center|LOCUS_17560 32066 32245 gene locus_tag LOCUS_17570 32066 32245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 33905 32175 gene locus_tag LOCUS_17580 gene pif1 33905 32175 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_17580 35278 34169 gene locus_tag LOCUS_17590 gene fabH 35278 34169 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 protein_id gnl|my_center|LOCUS_17590 39158 35304 gene locus_tag LOCUS_17600 gene hrpA 39158 35304 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206207.1 protein_id gnl|my_center|LOCUS_17600 39776 40339 gene locus_tag LOCUS_17610 gene ahpC 39776 40339 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_17610 40548 40754 gene locus_tag LOCUS_17620 40548 40754 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 protein_id gnl|my_center|LOCUS_17620 41377 40787 gene locus_tag LOCUS_17630 gene mdmC 41377 40787 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_17630 41660 41439 gene locus_tag LOCUS_17640 41660 41439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_17640 42073 43404 gene locus_tag LOCUS_17650 gene alr2 42073 43404 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKC7 protein_id gnl|my_center|LOCUS_17650 43988 43818 gene locus_tag LOCUS_17660 43988 43818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 44394 44179 gene locus_tag LOCUS_17670 44394 44179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 47586 44947 gene locus_tag LOCUS_17680 gene acnB 47586 44947 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHQ6 protein_id gnl|my_center|LOCUS_17680 >Feature sequence24 2027 579 gene locus_tag LOCUS_17690 gene gabD 2027 579 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207896.1 protein_id gnl|my_center|LOCUS_17690 3307 2024 gene locus_tag LOCUS_17700 gene gabT 3307 2024 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207897.1 protein_id gnl|my_center|LOCUS_17700 3586 5082 gene locus_tag LOCUS_17710 gene mocR 3586 5082 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_17710 6499 5141 gene locus_tag LOCUS_17720 6499 5141 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 protein_id gnl|my_center|LOCUS_17720 8810 7596 gene locus_tag LOCUS_17730 gene tyrS 8810 7596 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI8 protein_id gnl|my_center|LOCUS_17730 8915 10018 gene locus_tag LOCUS_17740 gene anmK 8915 10018 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI7 protein_id gnl|my_center|LOCUS_17740 11368 10082 gene locus_tag LOCUS_17750 gene mltB 11368 10082 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_17750 13031 11910 gene locus_tag LOCUS_17760 gene purK 13031 11910 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_17760 13640 13047 gene locus_tag LOCUS_17770 gene purE 13640 13047 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_17770 14091 13753 gene locus_tag LOCUS_17780 14091 13753 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207671.1 protein_id gnl|my_center|LOCUS_17780 14349 15713 gene locus_tag LOCUS_17790 gene mpl 14349 15713 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF6 protein_id gnl|my_center|LOCUS_17790 16127 15843 gene locus_tag LOCUS_17800 16127 15843 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_17800 16299 17489 gene locus_tag LOCUS_17810 gene sotB 16299 17489 CDS product putative sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWR7 protein_id gnl|my_center|LOCUS_17810 17807 18763 gene locus_tag LOCUS_17820 gene terC 17807 18763 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207675.1 protein_id gnl|my_center|LOCUS_17820 19391 18813 gene locus_tag LOCUS_17830 19391 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098896.1 protein_id gnl|my_center|LOCUS_17830 19655 20992 gene locus_tag LOCUS_17840 gene guaD 19655 20992 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_17840 21212 21718 gene locus_tag LOCUS_17850 gene hpt 21212 21718 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115408.1 protein_id gnl|my_center|LOCUS_17850 21897 22148 gene locus_tag LOCUS_17860 21897 22148 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_17860 22949 22248 gene locus_tag LOCUS_17870 gene dsbC 22949 22248 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207679.1 protein_id gnl|my_center|LOCUS_17870 23998 23081 gene locus_tag LOCUS_17880 gene czcD 23998 23081 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207680.1 protein_id gnl|my_center|LOCUS_17880 24054 24320 gene locus_tag LOCUS_17890 24054 24320 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115414.1 protein_id gnl|my_center|LOCUS_17890 24436 25605 gene locus_tag LOCUS_17900 24436 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 27000 25645 gene locus_tag LOCUS_17910 gene mnmE 27000 25645 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPG9 protein_id gnl|my_center|LOCUS_17910 28852 27101 gene locus_tag LOCUS_17920 gene yidC 28852 27101 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH0 protein_id gnl|my_center|LOCUS_17920 29179 28871 gene locus_tag LOCUS_17930 29179 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 29578 29189 gene locus_tag LOCUS_17940 gene rnpA 29578 29189 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH1 protein_id gnl|my_center|LOCUS_17940 29743 29609 gene locus_tag LOCUS_17950 gene rpmH 29743 29609 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH2 protein_id gnl|my_center|LOCUS_17950 30403 31782 gene locus_tag LOCUS_17960 gene dnaA 30403 31782 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH3 protein_id gnl|my_center|LOCUS_17960 31881 33026 gene locus_tag LOCUS_17970 31881 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 33042 34124 gene locus_tag LOCUS_17980 gene recF 33042 34124 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH6 protein_id gnl|my_center|LOCUS_17980 34178 36649 gene locus_tag LOCUS_17990 gene gyrB 34178 36649 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH7 protein_id gnl|my_center|LOCUS_17990 36795 37169 gene locus_tag LOCUS_18000 36795 37169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 39380 37446 gene locus_tag LOCUS_18010 gene yheS 39380 37446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_18010 39880 40215 gene locus_tag LOCUS_18020 gene erpA 39880 40215 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI5 protein_id gnl|my_center|LOCUS_18020 40659 40294 gene locus_tag LOCUS_18030 40659 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207668.1 protein_id gnl|my_center|LOCUS_18030 42934 40991 gene locus_tag LOCUS_18040 gene dnaK 42934 40991 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE6 protein_id gnl|my_center|LOCUS_18040 43615 43055 gene locus_tag LOCUS_18050 gene grpE 43615 43055 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE5 protein_id gnl|my_center|LOCUS_18050 44207 44437 gene locus_tag LOCUS_18060 44207 44437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 45124 44660 gene locus_tag LOCUS_18070 45124 44660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 45326 46396 gene locus_tag LOCUS_18080 gene estA 45326 46396 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207659.1 protein_id gnl|my_center|LOCUS_18080 46705 47274 gene locus_tag LOCUS_18090 gene ppiA 46705 47274 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPD9 protein_id gnl|my_center|LOCUS_18090 >Feature sequence25 119 667 gene locus_tag LOCUS_18100 gene rimM 119 667 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_18100 710 1459 gene locus_tag LOCUS_18110 gene trmD 710 1459 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY1 protein_id gnl|my_center|LOCUS_18110 1726 1517 gene locus_tag LOCUS_18120 1726 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1725 2099 gene locus_tag LOCUS_18130 gene rplS 1725 2099 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_18130 2685 3446 gene locus_tag LOCUS_18140 2685 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3863 4768 gene locus_tag LOCUS_18150 gene truB 3863 4768 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX7 protein_id gnl|my_center|LOCUS_18150 4810 5580 gene locus_tag LOCUS_18160 4810 5580 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX6 protein_id gnl|my_center|LOCUS_18160 5707 6165 gene locus_tag LOCUS_18170 5707 6165 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_18170 6564 6232 gene locus_tag LOCUS_18180 6564 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_18180 6753 7136 gene locus_tag LOCUS_18190 gene crcB 6753 7136 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLF8 protein_id gnl|my_center|LOCUS_18190 7516 7262 gene locus_tag LOCUS_18200 gene rpmE2 7516 7262 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG9 protein_id gnl|my_center|LOCUS_18200 8913 7615 gene locus_tag LOCUS_18210 gene adcK4 8913 7615 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_18210 10626 9262 gene locus_tag LOCUS_18220 gene norM 10626 9262 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_18220 11124 10663 gene locus_tag LOCUS_18230 11124 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_18230 11249 12403 gene locus_tag LOCUS_18240 11249 12403 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_18240 12596 12408 gene locus_tag LOCUS_18250 12596 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 12805 13839 gene locus_tag LOCUS_18260 gene ansZ 12805 13839 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34482 protein_id gnl|my_center|LOCUS_18260 15763 13940 gene locus_tag LOCUS_18270 gene mmgC 15763 13940 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_18270 15942 16193 gene locus_tag LOCUS_18280 15942 16193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 17025 16237 gene locus_tag LOCUS_18290 gene aroE 17025 16237 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC4 protein_id gnl|my_center|LOCUS_18290 17370 17164 gene locus_tag LOCUS_18300 17370 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 18662 17718 gene locus_tag LOCUS_18310 gene hemF 18662 17718 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC3 protein_id gnl|my_center|LOCUS_18310 19393 18791 gene locus_tag LOCUS_18320 gene ribA 19393 18791 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC2 protein_id gnl|my_center|LOCUS_18320 19701 21614 gene locus_tag LOCUS_18330 gene dxs 19701 21614 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC1 protein_id gnl|my_center|LOCUS_18330 21726 22556 gene locus_tag LOCUS_18340 gene suhB 21726 22556 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207766.1 protein_id gnl|my_center|LOCUS_18340 23070 24974 gene locus_tag LOCUS_18350 gene deaD 23070 24974 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 protein_id gnl|my_center|LOCUS_18350 25378 26196 gene locus_tag LOCUS_18360 gene ttg2A 25378 26196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207763.1 protein_id gnl|my_center|LOCUS_18360 26193 26969 gene locus_tag LOCUS_18370 gene ttg2B 26193 26969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117010.1 protein_id gnl|my_center|LOCUS_18370 26969 27637 gene locus_tag LOCUS_18380 gene ttg2C 26969 27637 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207762.1 protein_id gnl|my_center|LOCUS_18380 27655 28287 gene locus_tag LOCUS_18390 gene ttg2D 27655 28287 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_18390 28303 28593 gene locus_tag LOCUS_18400 28303 28593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078357.1 protein_id gnl|my_center|LOCUS_18400 29715 28702 gene locus_tag LOCUS_18410 gene corA 29715 28702 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116978.1 protein_id gnl|my_center|LOCUS_18410 29840 30460 gene locus_tag LOCUS_18420 29840 30460 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFB1 protein_id gnl|my_center|LOCUS_18420 30463 30870 gene locus_tag LOCUS_18430 gene mutT 30463 30870 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207760.1 protein_id gnl|my_center|LOCUS_18430 31598 30960 gene locus_tag LOCUS_18440 gene comF 31598 30960 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207759.1 protein_id gnl|my_center|LOCUS_18440 33630 31585 gene locus_tag LOCUS_18450 gene recG 33630 31585 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA8 protein_id gnl|my_center|LOCUS_18450 33666 34487 gene locus_tag LOCUS_18460 33666 34487 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 protein_id gnl|my_center|LOCUS_18460 37100 34524 gene locus_tag LOCUS_18470 gene plsB 37100 34524 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA5 protein_id gnl|my_center|LOCUS_18470 37389 38261 gene locus_tag LOCUS_18480 gene tesB 37389 38261 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_18480 38406 39647 gene locus_tag LOCUS_18490 gene glt-4 38406 39647 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_18490 40612 39764 gene locus_tag LOCUS_18500 gene engB 40612 39764 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA1 protein_id gnl|my_center|LOCUS_18500 41155 40712 gene locus_tag LOCUS_18510 41155 40712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207752.1 protein_id gnl|my_center|LOCUS_18510 42006 41239 gene locus_tag LOCUS_18520 42006 41239 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207751.1 protein_id gnl|my_center|LOCUS_18520 43737 42154 gene locus_tag LOCUS_18530 gene yjgR 43737 42154 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_18530 44972 43770 gene locus_tag LOCUS_18540 gene metC 44972 43770 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207748.1 protein_id gnl|my_center|LOCUS_18540 45133 45870 gene locus_tag LOCUS_18550 gene yfeJ 45133 45870 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116949.1 protein_id gnl|my_center|LOCUS_18550 46137 46448 gene locus_tag LOCUS_18560 gene rpsJ 46137 46448 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF94 protein_id gnl|my_center|LOCUS_18560 46508 47146 gene locus_tag LOCUS_18570 gene rplC 46508 47146 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF93 protein_id gnl|my_center|LOCUS_18570 >Feature sequence26 3 140 gene locus_tag LOCUS_18580 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 397 846 gene locus_tag LOCUS_18590 gene rimI 397 846 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK1 protein_id gnl|my_center|LOCUS_18590 1674 856 gene locus_tag LOCUS_18600 gene ate 1674 856 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK2 protein_id gnl|my_center|LOCUS_18600 2427 1696 gene locus_tag LOCUS_18610 gene aat 2427 1696 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK3 protein_id gnl|my_center|LOCUS_18610 3487 2534 gene locus_tag LOCUS_18620 gene trxB 3487 2534 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK4 protein_id gnl|my_center|LOCUS_18620 3772 6819 gene locus_tag LOCUS_18630 gene ftsK 3772 6819 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205973.1 protein_id gnl|my_center|LOCUS_18630 6972 7874 gene locus_tag LOCUS_18640 6972 7874 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_18640 8229 7942 gene locus_tag LOCUS_18650 8229 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_18650 8685 8413 gene locus_tag LOCUS_18660 gene minE 8685 8413 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK9 protein_id gnl|my_center|LOCUS_18660 9500 8688 gene locus_tag LOCUS_18670 gene minD 9500 8688 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL0 protein_id gnl|my_center|LOCUS_18670 10289 9564 gene locus_tag LOCUS_18680 gene minC 10289 9564 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL1 protein_id gnl|my_center|LOCUS_18680 11333 10410 gene locus_tag LOCUS_18690 11333 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_18690 12426 11500 gene locus_tag LOCUS_18700 gene yihG 12426 11500 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_18700 12671 13321 gene locus_tag LOCUS_18710 gene yiaD 12671 13321 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 protein_id gnl|my_center|LOCUS_18710 13448 15487 gene locus_tag LOCUS_18720 gene rep 13448 15487 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL5 protein_id gnl|my_center|LOCUS_18720 15524 15976 gene locus_tag LOCUS_18730 gene dut 15524 15976 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL6 protein_id gnl|my_center|LOCUS_18730 16394 17818 gene locus_tag LOCUS_18740 gene algC 16394 17818 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 protein_id gnl|my_center|LOCUS_18740 17829 18728 gene locus_tag LOCUS_18750 gene argB 17829 18728 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_18750 18911 19777 gene locus_tag LOCUS_18760 18911 19777 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_18760 20187 20636 gene locus_tag LOCUS_18770 20187 20636 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 protein_id gnl|my_center|LOCUS_18770 20777 21859 gene locus_tag LOCUS_18780 20777 21859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205981.1 protein_id gnl|my_center|LOCUS_18780 21859 22182 gene locus_tag LOCUS_18790 21859 22182 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM3 protein_id gnl|my_center|LOCUS_18790 22626 22228 gene locus_tag LOCUS_18800 gene bamE 22626 22228 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_18800 22738 23175 gene locus_tag LOCUS_18810 gene fur 22738 23175 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_18810 24355 23234 gene locus_tag LOCUS_18820 gene pilU 24355 23234 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 protein_id gnl|my_center|LOCUS_18820 25418 24381 gene locus_tag LOCUS_18830 gene pilT 25418 24381 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_18830 25542 26234 gene locus_tag LOCUS_18840 gene yggS 25542 26234 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_18840 29878 26282 gene locus_tag LOCUS_18850 gene sbcC 29878 26282 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM9 protein_id gnl|my_center|LOCUS_18850 31138 29888 gene locus_tag LOCUS_18860 gene sbcD 31138 29888 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN0 protein_id gnl|my_center|LOCUS_18860 32150 31329 gene locus_tag LOCUS_18870 32150 31329 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207446.1 protein_id gnl|my_center|LOCUS_18870 34499 32442 gene locus_tag LOCUS_18880 gene metG 34499 32442 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV3 protein_id gnl|my_center|LOCUS_18880 34670 35467 gene locus_tag LOCUS_18890 34670 35467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 35523 35834 gene locus_tag LOCUS_18900 35523 35834 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158343.1 protein_id gnl|my_center|LOCUS_18900 36126 37322 gene locus_tag LOCUS_18910 gene bacA 36126 37322 CDS product microcin B17 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207542.1 protein_id gnl|my_center|LOCUS_18910 37911 37393 gene locus_tag LOCUS_18920 gene chrA1 37911 37393 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501457.1 protein_id gnl|my_center|LOCUS_18920 38471 37908 gene locus_tag LOCUS_18930 38471 37908 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 protein_id gnl|my_center|LOCUS_18930 38568 39458 gene locus_tag LOCUS_18940 gene alsR 38568 39458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206516.1 protein_id gnl|my_center|LOCUS_18940 39714 40169 gene locus_tag LOCUS_18950 39714 40169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207539.1 protein_id gnl|my_center|LOCUS_18950 41370 40591 gene locus_tag LOCUS_18960 41370 40591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001373273.1 protein_id gnl|my_center|LOCUS_18960 42918 41443 gene locus_tag LOCUS_18970 gene gatB 42918 41443 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN40 protein_id gnl|my_center|LOCUS_18970 44396 42918 gene locus_tag LOCUS_18980 gene gatA 44396 42918 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN39 protein_id gnl|my_center|LOCUS_18980 44762 44448 gene locus_tag LOCUS_18990 gene gatC 44762 44448 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN38 protein_id gnl|my_center|LOCUS_18990 >Feature sequence27 98 760 gene locus_tag LOCUS_19000 98 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205942.1 protein_id gnl|my_center|LOCUS_19000 845 1462 gene locus_tag LOCUS_19010 845 1462 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205941.1 protein_id gnl|my_center|LOCUS_19010 2345 1614 gene locus_tag LOCUS_19020 2345 1614 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346944.1 protein_id gnl|my_center|LOCUS_19020 2640 3434 gene locus_tag LOCUS_19030 2640 3434 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_19030 3431 4021 gene locus_tag LOCUS_19040 3431 4021 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY7 protein_id gnl|my_center|LOCUS_19040 4063 5196 gene locus_tag LOCUS_19050 gene rluB 4063 5196 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_19050 5927 5286 gene locus_tag LOCUS_19060 gene bioD 5927 5286 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY5 protein_id gnl|my_center|LOCUS_19060 6706 5924 gene locus_tag LOCUS_19070 gene bioC 6706 5924 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY4 protein_id gnl|my_center|LOCUS_19070 7860 6703 gene locus_tag LOCUS_19080 gene bioF 7860 6703 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205938.1 protein_id gnl|my_center|LOCUS_19080 9152 7857 gene locus_tag LOCUS_19090 gene bioA 9152 7857 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY2 protein_id gnl|my_center|LOCUS_19090 9965 9237 gene locus_tag LOCUS_19100 gene bioH 9965 9237 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205936.1 protein_id gnl|my_center|LOCUS_19100 10360 10037 gene locus_tag LOCUS_19110 10360 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 11041 10577 gene locus_tag LOCUS_19120 gene bfrA 11041 10577 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX7 protein_id gnl|my_center|LOCUS_19120 13481 11445 gene locus_tag LOCUS_19130 gene ligA 13481 11445 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX6 protein_id gnl|my_center|LOCUS_19130 14567 13575 gene locus_tag LOCUS_19140 gene zipA 14567 13575 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX5 protein_id gnl|my_center|LOCUS_19140 18021 14569 gene locus_tag LOCUS_19150 gene smc 18021 14569 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX4 protein_id gnl|my_center|LOCUS_19150 18727 18032 gene locus_tag LOCUS_19160 18727 18032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_19160 19716 18907 gene locus_tag LOCUS_19170 19716 18907 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_19170 19747 20505 gene locus_tag LOCUS_19180 gene birA 19747 20505 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205928.1 protein_id gnl|my_center|LOCUS_19180 20515 21246 gene locus_tag LOCUS_19190 gene coaX 20515 21246 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX0 protein_id gnl|my_center|LOCUS_19190 22750 21341 gene locus_tag LOCUS_19200 gene ffh 22750 21341 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW9 protein_id gnl|my_center|LOCUS_19200 22889 23695 gene locus_tag LOCUS_19210 22889 23695 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_19210 24108 25043 gene locus_tag LOCUS_19220 gene dusC 24108 25043 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_19220 25262 26593 gene locus_tag LOCUS_19230 gene hflX 25262 26593 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ5 protein_id gnl|my_center|LOCUS_19230 26637 27008 gene locus_tag LOCUS_19240 26637 27008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 protein_id gnl|my_center|LOCUS_19240 27019 27693 gene locus_tag LOCUS_19250 gene lrgB 27019 27693 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 protein_id gnl|my_center|LOCUS_19250 27783 28229 gene locus_tag LOCUS_19260 27783 28229 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_19260 29192 28338 gene locus_tag LOCUS_19270 gene apaH 29192 28338 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ9 protein_id gnl|my_center|LOCUS_19270 30005 29193 gene locus_tag LOCUS_19280 gene rsmA 30005 29193 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT8 protein_id gnl|my_center|LOCUS_19280 31013 30042 gene locus_tag LOCUS_19290 gene pdxA 31013 30042 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK2 protein_id gnl|my_center|LOCUS_19290 31391 31819 gene locus_tag LOCUS_19300 gene rplM 31391 31819 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK3 protein_id gnl|my_center|LOCUS_19300 31832 32218 gene locus_tag LOCUS_19310 gene rpsI 31832 32218 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK4 protein_id gnl|my_center|LOCUS_19310 32461 33114 gene locus_tag LOCUS_19320 gene sspA 32461 33114 CDS product starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065247.1 protein_id gnl|my_center|LOCUS_19320 33125 33556 gene locus_tag LOCUS_19330 gene sspB 33125 33556 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_19330 33576 34232 gene locus_tag LOCUS_19340 33576 34232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065252.1 protein_id gnl|my_center|LOCUS_19340 34672 35016 gene locus_tag LOCUS_19350 34672 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_19350 35018 35326 gene locus_tag LOCUS_19360 35018 35326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19360 35387 35632 gene locus_tag LOCUS_19370 35387 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19370 >Feature sequence28 206 1600 gene locus_tag LOCUS_19380 gene atpD 206 1600 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG9 protein_id gnl|my_center|LOCUS_19380 1618 2037 gene locus_tag LOCUS_19390 gene atpC 1618 2037 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_19390 2187 2486 gene locus_tag LOCUS_19400 2187 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3178 2573 gene locus_tag LOCUS_19410 3178 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208127.1 protein_id gnl|my_center|LOCUS_19410 3786 3322 gene locus_tag LOCUS_19420 3786 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4537 3992 gene locus_tag LOCUS_19430 gene btuE 4537 3992 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH2 protein_id gnl|my_center|LOCUS_19430 5634 4747 gene locus_tag LOCUS_19440 5634 4747 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 protein_id gnl|my_center|LOCUS_19440 5724 6275 gene locus_tag LOCUS_19450 5724 6275 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207862.1 protein_id gnl|my_center|LOCUS_19450 7061 6330 gene locus_tag LOCUS_19460 gene hisA 7061 6330 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_19460 7810 7130 gene locus_tag LOCUS_19470 gene wrn 7810 7130 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_19470 8538 7921 gene locus_tag LOCUS_19480 gene hisH 8538 7921 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_19480 9131 8538 gene locus_tag LOCUS_19490 gene hisB 9131 8538 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL4 protein_id gnl|my_center|LOCUS_19490 9227 9604 gene locus_tag LOCUS_19500 9227 9604 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116928.1 protein_id gnl|my_center|LOCUS_19500 9941 10016 gene locus_tag LOCUS_t00380 9941 10016 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10151 10226 gene locus_tag LOCUS_t00390 10151 10226 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11573 10401 gene locus_tag LOCUS_19510 gene fadA 11573 10401 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_19510 13739 11586 gene locus_tag LOCUS_19520 gene fadB 13739 11586 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS1 protein_id gnl|my_center|LOCUS_19520 14228 16027 gene locus_tag LOCUS_19530 gene uvrC 14228 16027 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS7 protein_id gnl|my_center|LOCUS_19530 16335 16922 gene locus_tag LOCUS_19540 gene pgsA 16335 16922 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_19540 17667 17398 gene locus_tag LOCUS_19550 17667 17398 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_19550 19109 17679 gene locus_tag LOCUS_19560 gene argH 19109 17679 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_19560 19100 20257 gene locus_tag LOCUS_19570 gene algZ 19100 20257 CDS product alginate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208187.1 protein_id gnl|my_center|LOCUS_19570 20313 21053 gene locus_tag LOCUS_19580 gene algR 20313 21053 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_19580 21159 22076 gene locus_tag LOCUS_19590 gene hemC 21159 22076 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_19590 22078 22857 gene locus_tag LOCUS_19600 gene hemD 22078 22857 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_19600 22854 23696 gene locus_tag LOCUS_19610 22854 23696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208191.1 protein_id gnl|my_center|LOCUS_19610 23704 24897 gene locus_tag LOCUS_19620 23704 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208192.1 protein_id gnl|my_center|LOCUS_19620 25359 25685 gene locus_tag LOCUS_19630 gene hvrA 25359 25685 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_19630 26051 26602 gene locus_tag LOCUS_19640 26051 26602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 26602 27429 gene locus_tag LOCUS_19650 26602 27429 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079413.1 protein_id gnl|my_center|LOCUS_19650 27473 29611 gene locus_tag LOCUS_19660 gene xcpQ 27473 29611 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_19660 29796 30530 gene locus_tag LOCUS_19670 29796 30530 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208196.1 protein_id gnl|my_center|LOCUS_19670 30622 31293 gene locus_tag LOCUS_19680 gene gph 30622 31293 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_19680 31408 32901 gene locus_tag LOCUS_19690 gene trpE 31408 32901 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence29 6 4959 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctacatggcagtgaac 5678 5091 gene locus_tag LOCUS_19700 5678 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 6696 5686 gene locus_tag LOCUS_19710 6696 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 7692 6712 gene locus_tag LOCUS_19720 7692 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 10655 7707 gene locus_tag LOCUS_19730 10655 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 11614 10652 gene locus_tag LOCUS_19740 11614 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_19740 11987 14845 gene locus_tag LOCUS_19750 11987 14845 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206966.1 protein_id gnl|my_center|LOCUS_19750 14860 15810 gene locus_tag LOCUS_19760 14860 15810 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFU7 protein_id gnl|my_center|LOCUS_19760 15797 17521 gene locus_tag LOCUS_19770 gene fruA 15797 17521 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206968.1 protein_id gnl|my_center|LOCUS_19770 17979 19103 gene locus_tag LOCUS_19780 17979 19103 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262044.1 protein_id gnl|my_center|LOCUS_19780 19105 19482 gene locus_tag LOCUS_19790 19105 19482 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_19790 20400 19540 gene locus_tag LOCUS_19800 20400 19540 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262046.1 protein_id gnl|my_center|LOCUS_19800 20758 21879 gene locus_tag LOCUS_19810 gene ribB 20758 21879 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_19810 21891 22361 gene locus_tag LOCUS_19820 gene ribH 21891 22361 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ3 protein_id gnl|my_center|LOCUS_19820 22366 22821 gene locus_tag LOCUS_19830 gene nusB 22366 22821 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ4 protein_id gnl|my_center|LOCUS_19830 22835 23752 gene locus_tag LOCUS_19840 gene thiL 22835 23752 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_19840 23775 24251 gene locus_tag LOCUS_19850 gene pgpA 23775 24251 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ6 protein_id gnl|my_center|LOCUS_19850 24273 25637 gene locus_tag LOCUS_19860 gene glmU 24273 25637 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_19860 25650 27488 gene locus_tag LOCUS_19870 gene glmS 25650 27488 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ8 protein_id gnl|my_center|LOCUS_19870 27643 28443 gene locus_tag LOCUS_19880 27643 28443 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090707.1 protein_id gnl|my_center|LOCUS_19880 28430 30592 gene locus_tag LOCUS_19890 28430 30592 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351437.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence30 1 2247 gene locus_tag LOCUS_19900 1 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2528 4627 gene locus_tag LOCUS_19910 gene foxA 2528 4627 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_19910 4846 5208 gene locus_tag LOCUS_19920 4846 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115127.1 protein_id gnl|my_center|LOCUS_19920 5529 6941 gene locus_tag LOCUS_19930 5529 6941 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 protein_id gnl|my_center|LOCUS_19930 7233 7817 gene locus_tag LOCUS_19940 gene ompW 7233 7817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208202.1 protein_id gnl|my_center|LOCUS_19940 7971 8318 gene locus_tag LOCUS_19950 7971 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060531.1 protein_id gnl|my_center|LOCUS_19950 8412 10343 gene locus_tag LOCUS_19960 gene htpG 8412 10343 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKR1 protein_id gnl|my_center|LOCUS_19960 11544 10432 gene locus_tag LOCUS_19970 11544 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 protein_id gnl|my_center|LOCUS_19970 13119 11632 gene locus_tag LOCUS_19980 13119 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13309 13130 gene locus_tag LOCUS_19990 13309 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 13877 13653 gene locus_tag LOCUS_20000 13877 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 14120 14320 gene locus_tag LOCUS_20010 14120 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_20010 15169 14471 gene locus_tag LOCUS_20020 gene dsb 15169 14471 CDS product dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 protein_id gnl|my_center|LOCUS_20020 15353 16102 gene locus_tag LOCUS_20030 15353 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208207.1 protein_id gnl|my_center|LOCUS_20030 17719 16202 gene locus_tag LOCUS_20040 gene cat1 17719 16202 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_20040 19391 17928 gene locus_tag LOCUS_20050 gene envZ 19391 17928 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_20050 20424 19660 gene locus_tag LOCUS_20060 gene ompR 20424 19660 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_20060 20760 23132 gene locus_tag LOCUS_20070 gene tex 20760 23132 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116875.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence31 81 1007 gene locus_tag LOCUS_20080 gene ilvE 81 1007 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_20080 1097 1978 gene locus_tag LOCUS_20090 1097 1978 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_20090 1992 3020 gene locus_tag LOCUS_20100 1992 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 3017 3772 gene locus_tag LOCUS_20110 gene icaB 3017 3772 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207638.1 protein_id gnl|my_center|LOCUS_20110 3769 4545 gene locus_tag LOCUS_20120 gene lpsC 3769 4545 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207637.1 protein_id gnl|my_center|LOCUS_20120 4542 5573 gene locus_tag LOCUS_20130 gene lpsE 4542 5573 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207636.1 protein_id gnl|my_center|LOCUS_20130 6491 5577 gene locus_tag LOCUS_20140 6491 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207635.1 protein_id gnl|my_center|LOCUS_20140 6541 7302 gene locus_tag LOCUS_20150 6541 7302 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207634.1 protein_id gnl|my_center|LOCUS_20150 8487 7324 gene locus_tag LOCUS_20160 8487 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 9521 8658 gene locus_tag LOCUS_20170 gene htrB 9521 8658 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_20170 9924 9706 gene locus_tag LOCUS_20180 9924 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207632.1 protein_id gnl|my_center|LOCUS_20180 11832 10045 gene locus_tag LOCUS_20190 gene aspS 11832 10045 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_20190 12762 11998 gene locus_tag LOCUS_20200 12762 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207629.1 protein_id gnl|my_center|LOCUS_20200 12906 14966 gene locus_tag LOCUS_20210 12906 14966 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_20210 15072 16535 gene locus_tag LOCUS_20220 15072 16535 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_20220 17406 16939 gene locus_tag LOCUS_20230 17406 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_20230 18063 17566 gene locus_tag LOCUS_20240 18063 17566 CDS product protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116490.1 protein_id gnl|my_center|LOCUS_20240 18208 18846 gene locus_tag LOCUS_20250 18208 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_20250 20809 19028 gene locus_tag LOCUS_20260 gene acdA 20809 19028 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_20260 22782 20980 gene locus_tag LOCUS_20270 gene acdB 22782 20980 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence32 149 74 gene locus_tag LOCUS_t00400 149 74 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 383 694 gene locus_tag LOCUS_20280 gene bolA 383 694 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_20280 708 1100 gene locus_tag LOCUS_20290 708 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208111.1 protein_id gnl|my_center|LOCUS_20290 1168 1386 gene locus_tag LOCUS_20300 1168 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1395 1784 gene locus_tag LOCUS_20310 1395 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114091.1 protein_id gnl|my_center|LOCUS_20310 2695 2057 gene locus_tag LOCUS_20320 gene dedA 2695 2057 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_20320 2935 3303 gene locus_tag LOCUS_20330 2935 3303 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 protein_id gnl|my_center|LOCUS_20330 3527 5110 gene locus_tag LOCUS_20340 gene guaA 3527 5110 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJE6 protein_id gnl|my_center|LOCUS_20340 5495 6442 gene locus_tag LOCUS_20350 5495 6442 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 protein_id gnl|my_center|LOCUS_20350 7817 6456 gene locus_tag LOCUS_20360 gene phoR 7817 6456 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121907.1 protein_id gnl|my_center|LOCUS_20360 8537 7827 gene locus_tag LOCUS_20370 gene phoB 8537 7827 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_20370 9106 9948 gene locus_tag LOCUS_20380 gene ephD 9106 9948 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_20380 10536 11336 gene locus_tag LOCUS_20390 gene otsB 10536 11336 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY0 protein_id gnl|my_center|LOCUS_20390 11369 12808 gene locus_tag LOCUS_20400 gene otsA 11369 12808 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205934.1 protein_id gnl|my_center|LOCUS_20400 14136 12952 gene locus_tag LOCUS_20410 14136 12952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205933.1 protein_id gnl|my_center|LOCUS_20410 15897 14530 gene locus_tag LOCUS_20420 gene ypnP 15897 14530 CDS product multidrug resistance protein, MATE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804387.1 protein_id gnl|my_center|LOCUS_20420 16951 16031 gene locus_tag LOCUS_20430 gene yfeX 16951 16031 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208122.1 protein_id gnl|my_center|LOCUS_20430 17115 17735 gene locus_tag LOCUS_20440 gene rhtB 17115 17735 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804759.1 protein_id gnl|my_center|LOCUS_20440 18888 18088 gene locus_tag LOCUS_20450 gene znuB 18888 18088 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208123.1 protein_id gnl|my_center|LOCUS_20450 19683 18892 gene locus_tag LOCUS_20460 gene znuC 19683 18892 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF9 protein_id gnl|my_center|LOCUS_20460 20153 19656 gene locus_tag LOCUS_20470 gene zur 20153 19656 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_20470 20295 21134 gene locus_tag LOCUS_20480 gene znuA 20295 21134 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 protein_id gnl|my_center|LOCUS_20480 21322 21702 gene locus_tag LOCUS_20490 gene atpI 21322 21702 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072004.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence33 17 93 gene locus_tag LOCUS_t00410 17 93 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 351 848 gene locus_tag LOCUS_20500 351 848 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804627.1 protein_id gnl|my_center|LOCUS_20500 886 1527 gene locus_tag LOCUS_20510 gene ycgM 886 1527 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_20510 2938 1691 gene locus_tag LOCUS_20520 2938 1691 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_20520 3053 3652 gene locus_tag LOCUS_20530 3053 3652 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_20530 4150 3791 gene locus_tag LOCUS_20540 4150 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120526.1 protein_id gnl|my_center|LOCUS_20540 5300 4401 gene locus_tag LOCUS_20550 gene alsR 5300 4401 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208376.1 protein_id gnl|my_center|LOCUS_20550 5354 5533 gene locus_tag LOCUS_20560 5354 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6487 5774 gene locus_tag LOCUS_20570 6487 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_20570 7330 6704 gene locus_tag LOCUS_20580 7330 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 protein_id gnl|my_center|LOCUS_20580 7576 8454 gene locus_tag LOCUS_20590 gene tonB 7576 8454 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 protein_id gnl|my_center|LOCUS_20590 8854 8543 gene locus_tag LOCUS_20600 8854 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 9484 9002 gene locus_tag LOCUS_20610 gene ybeY 9484 9002 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPY1 protein_id gnl|my_center|LOCUS_20610 10588 9515 gene locus_tag LOCUS_20620 gene phoL 10588 9515 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_20620 12081 10627 gene locus_tag LOCUS_20630 gene miaB 12081 10627 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX9 protein_id gnl|my_center|LOCUS_20630 12443 14416 gene locus_tag LOCUS_20640 gene slt 12443 14416 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_20640 14568 15107 gene locus_tag LOCUS_20650 14568 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_20650 15277 16263 gene locus_tag LOCUS_20660 gene mdh 15277 16263 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX6 protein_id gnl|my_center|LOCUS_20660 16446 16706 gene locus_tag LOCUS_20670 16446 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_20670 16812 17069 gene locus_tag LOCUS_20680 16812 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_20680 17670 17143 gene locus_tag LOCUS_20690 17670 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207718.1 protein_id gnl|my_center|LOCUS_20690 18355 17753 gene locus_tag LOCUS_20700 18355 17753 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207717.1 protein_id gnl|my_center|LOCUS_20700 18472 19329 gene locus_tag LOCUS_20710 gene rlmJ 18472 19329 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX2 protein_id gnl|my_center|LOCUS_20710 19373 20200 gene locus_tag LOCUS_20720 gene pssA 19373 20200 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_20720 20240 21313 gene locus_tag LOCUS_20730 20240 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207715.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence34 1904 192 gene locus_tag LOCUS_20740 gene etfD 1904 192 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 protein_id gnl|my_center|LOCUS_20740 2092 2718 gene locus_tag LOCUS_20750 2092 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_20750 2767 3639 gene locus_tag LOCUS_20760 gene murI 2767 3639 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF8 protein_id gnl|my_center|LOCUS_20760 3767 4786 gene locus_tag LOCUS_20770 3767 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208258.1 protein_id gnl|my_center|LOCUS_20770 4844 5875 gene locus_tag LOCUS_20780 gene hemH 4844 5875 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_20780 5897 6541 gene locus_tag LOCUS_20790 gene ycbL 5897 6541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_20790 6769 6584 gene locus_tag LOCUS_20800 gene yacG 6769 6584 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG2 protein_id gnl|my_center|LOCUS_20800 6860 7528 gene locus_tag LOCUS_20810 gene trmB 6860 7528 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_20810 7536 8744 gene locus_tag LOCUS_20820 7536 8744 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 protein_id gnl|my_center|LOCUS_20820 8810 9220 gene locus_tag LOCUS_20830 8810 9220 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_20830 10035 9244 gene locus_tag LOCUS_20840 10035 9244 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207793.1 protein_id gnl|my_center|LOCUS_20840 10159 11448 gene locus_tag LOCUS_20850 10159 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207792.1 protein_id gnl|my_center|LOCUS_20850 11909 12865 gene locus_tag LOCUS_20860 gene hprA 11909 12865 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_20860 13385 12906 gene locus_tag LOCUS_20870 13385 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207781.1 protein_id gnl|my_center|LOCUS_20870 14198 13572 gene locus_tag LOCUS_20880 14198 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 14963 14574 gene locus_tag LOCUS_20890 14963 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207782.1 protein_id gnl|my_center|LOCUS_20890 16060 15227 gene locus_tag LOCUS_20900 16060 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 18339 16270 gene locus_tag LOCUS_20910 gene glyS 18339 16270 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD5 protein_id gnl|my_center|LOCUS_20910 19328 18339 gene locus_tag LOCUS_20920 gene glyQ 19328 18339 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD4 protein_id gnl|my_center|LOCUS_20920 19531 20628 gene locus_tag LOCUS_20930 19531 20628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 protein_id gnl|my_center|LOCUS_20930 20964 20695 gene locus_tag LOCUS_20940 gene pspC 20964 20695 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207771.1 protein_id gnl|my_center|LOCUS_20940 21329 21254 gene locus_tag LOCUS_t00420 21329 21254 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 209 850 gene locus_tag LOCUS_20950 209 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2533 1361 gene locus_tag LOCUS_20960 2533 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3447 4223 gene locus_tag LOCUS_20970 gene parA 3447 4223 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385472.1 protein_id gnl|my_center|LOCUS_20970 4242 5141 gene locus_tag LOCUS_20980 4242 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5462 5992 gene locus_tag LOCUS_20990 5462 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20990 6011 6451 gene locus_tag LOCUS_21000 6011 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21000 7712 8071 gene locus_tag LOCUS_21010 7712 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 8187 9794 gene locus_tag LOCUS_21020 8187 9794 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206466.1 protein_id gnl|my_center|LOCUS_21020 10201 10683 gene locus_tag LOCUS_21030 gene ureE 10201 10683 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX5 protein_id gnl|my_center|LOCUS_21030 10670 11335 gene locus_tag LOCUS_21040 gene ureF 10670 11335 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX6 protein_id gnl|my_center|LOCUS_21040 11353 11967 gene locus_tag LOCUS_21050 gene ureG 11353 11967 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 protein_id gnl|my_center|LOCUS_21050 11982 12548 gene locus_tag LOCUS_21060 gene ureJ 11982 12548 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 protein_id gnl|my_center|LOCUS_21060 12620 13498 gene locus_tag LOCUS_21070 gene ureD 12620 13498 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX0 protein_id gnl|my_center|LOCUS_21070 13599 13901 gene locus_tag LOCUS_21080 gene ureA 13599 13901 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX1 protein_id gnl|my_center|LOCUS_21080 13921 14229 gene locus_tag LOCUS_21090 gene ureB 13921 14229 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX2 protein_id gnl|my_center|LOCUS_21090 14269 15972 gene locus_tag LOCUS_21100 gene ureC 14269 15972 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX4 protein_id gnl|my_center|LOCUS_21100 16263 17231 gene locus_tag LOCUS_21110 16263 17231 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198247.1 protein_id gnl|my_center|LOCUS_21110 17335 18573 gene locus_tag LOCUS_21120 17335 18573 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_21120 18623 19906 gene locus_tag LOCUS_21130 gene proP 18623 19906 CDS product proline/betaine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067910.1 protein_id gnl|my_center|LOCUS_21130 19953 20867 gene locus_tag LOCUS_21140 19953 20867 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence36 244 822 gene locus_tag LOCUS_21150 244 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 844 1389 gene locus_tag LOCUS_21160 gene ydeN 844 1389 CDS product putative hydrolase YdeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96671 protein_id gnl|my_center|LOCUS_21160 1662 1859 gene locus_tag LOCUS_21170 1662 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1931 2284 gene locus_tag LOCUS_21180 1931 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268109.1 protein_id gnl|my_center|LOCUS_21180 2302 2955 gene locus_tag LOCUS_21190 2302 2955 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 protein_id gnl|my_center|LOCUS_21190 2977 3978 gene locus_tag LOCUS_21200 2977 3978 CDS product hydrolase signal peptide protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268112.1 protein_id gnl|my_center|LOCUS_21200 4033 4953 gene locus_tag LOCUS_21210 4033 4953 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400772.1 protein_id gnl|my_center|LOCUS_21210 5093 5368 gene locus_tag LOCUS_21220 5093 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 protein_id gnl|my_center|LOCUS_21220 5386 6495 gene locus_tag LOCUS_21230 gene adhC 5386 6495 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP63 protein_id gnl|my_center|LOCUS_21230 7683 6763 gene locus_tag LOCUS_21240 gene catA 7683 6763 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_21240 8000 7821 gene locus_tag LOCUS_21250 8000 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 8243 9529 gene locus_tag LOCUS_21260 gene salR 8243 9529 CDS product salicylate 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207155.1 protein_id gnl|my_center|LOCUS_21260 9648 11000 gene locus_tag LOCUS_21270 9648 11000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207154.1 protein_id gnl|my_center|LOCUS_21270 11055 11948 gene locus_tag LOCUS_21280 gene nahR 11055 11948 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207153.1 protein_id gnl|my_center|LOCUS_21280 13857 12124 gene locus_tag LOCUS_21290 gene etfD 13857 12124 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 protein_id gnl|my_center|LOCUS_21290 15161 14007 gene locus_tag LOCUS_21300 gene dcaA 15161 14007 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206430.1 protein_id gnl|my_center|LOCUS_21300 15432 16208 gene locus_tag LOCUS_21310 gene dcaE 15432 16208 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_21310 16212 17729 gene locus_tag LOCUS_21320 gene dcaH 16212 17729 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_21320 17741 18943 gene locus_tag LOCUS_21330 gene dcaF 17741 18943 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_21330 18956 20173 gene locus_tag LOCUS_21340 gene caiB 18956 20173 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_21340 20220 20684 gene locus_tag LOCUS_21350 20220 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence37 1466 468 gene locus_tag LOCUS_21360 1466 468 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_21360 1691 2194 gene locus_tag LOCUS_21370 1691 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2787 3860 gene locus_tag LOCUS_21380 gene vanA 2787 3860 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206162.1 protein_id gnl|my_center|LOCUS_21380 3918 4859 gene locus_tag LOCUS_21390 gene vanB 3918 4859 CDS product vanillate O-demethylase oxidoreductase (vanillate degradation ferredoxin-like protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206161.1 protein_id gnl|my_center|LOCUS_21390 5657 4968 gene locus_tag LOCUS_21400 gene vanR 5657 4968 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206160.1 protein_id gnl|my_center|LOCUS_21400 6268 5822 gene locus_tag LOCUS_21410 6268 5822 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206159.1 protein_id gnl|my_center|LOCUS_21410 7578 6340 gene locus_tag LOCUS_21420 gene hcaK 7578 6340 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411707.1 protein_id gnl|my_center|LOCUS_21420 7841 8674 gene locus_tag LOCUS_21430 gene hcaA 7841 8674 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206158.1 protein_id gnl|my_center|LOCUS_21430 8725 10176 gene locus_tag LOCUS_21440 gene hcaB 8725 10176 CDS product salicylaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206157.1 protein_id gnl|my_center|LOCUS_21440 10253 12139 gene locus_tag LOCUS_21450 gene hcaC 10253 12139 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206156.1 protein_id gnl|my_center|LOCUS_21450 12213 13352 gene locus_tag LOCUS_21460 gene hcaD 12213 13352 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206155.1 protein_id gnl|my_center|LOCUS_21460 13404 14660 gene locus_tag LOCUS_21470 13404 14660 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206154.1 protein_id gnl|my_center|LOCUS_21470 14718 15254 gene locus_tag LOCUS_21480 14718 15254 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 protein_id gnl|my_center|LOCUS_21480 15295 15684 gene locus_tag LOCUS_21490 15295 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 15718 17469 gene locus_tag LOCUS_21500 15718 17469 CDS product chlorogenate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206151.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence38 <1 1121 gene locus_tag LOCUS_21510 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KME8:citrate synthase 1710 1237 gene locus_tag LOCUS_21520 1710 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1966 3591 gene locus_tag LOCUS_21530 gene nadE2 1966 3591 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_21530 3584 4594 gene locus_tag LOCUS_21540 3584 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4745 4669 gene locus_tag LOCUS_t00430 4745 4669 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5205 5129 gene locus_tag LOCUS_t00440 5205 5129 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5950 5684 gene locus_tag LOCUS_21550 5950 5684 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_21550 6443 5952 gene locus_tag LOCUS_21560 gene coaD 6443 5952 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH8 protein_id gnl|my_center|LOCUS_21560 6585 7061 gene locus_tag LOCUS_21570 gene smpB 6585 7061 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_21570 7696 7133 gene locus_tag LOCUS_21580 gene wrbA 7696 7133 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075275.1 protein_id gnl|my_center|LOCUS_21580 8476 7736 gene locus_tag LOCUS_21590 8476 7736 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH5 protein_id gnl|my_center|LOCUS_21590 9568 8516 gene locus_tag LOCUS_21600 gene rluD 9568 8516 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH4 protein_id gnl|my_center|LOCUS_21600 9640 10713 gene locus_tag LOCUS_21610 gene comL 9640 10713 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH3 protein_id gnl|my_center|LOCUS_21610 10914 12833 gene locus_tag LOCUS_21620 gene dnaG 10914 12833 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH2 protein_id gnl|my_center|LOCUS_21620 14135 12852 gene locus_tag LOCUS_21630 gene hemA 14135 12852 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH0 protein_id gnl|my_center|LOCUS_21630 14367 15926 gene locus_tag LOCUS_21640 14367 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 protein_id gnl|my_center|LOCUS_21640 15935 16513 gene locus_tag LOCUS_21650 gene lolB 15935 16513 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG8 protein_id gnl|my_center|LOCUS_21650 16536 17366 gene locus_tag LOCUS_21660 gene ispE 16536 17366 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_21660 17368 17442 gene locus_tag LOCUS_t00450 17368 17442 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 1919 483 gene locus_tag LOCUS_21670 1919 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205968.1 protein_id gnl|my_center|LOCUS_21670 2198 3427 gene locus_tag LOCUS_21680 gene fabB 2198 3427 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205967.1 protein_id gnl|my_center|LOCUS_21680 3446 3898 gene locus_tag LOCUS_21690 3446 3898 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120291.1 protein_id gnl|my_center|LOCUS_21690 5082 3964 gene locus_tag LOCUS_21700 5082 3964 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207982.1 protein_id gnl|my_center|LOCUS_21700 6720 5293 gene locus_tag LOCUS_21710 gene cycA 6720 5293 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208093.1 protein_id gnl|my_center|LOCUS_21710 7252 6893 gene locus_tag LOCUS_21720 7252 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208092.1 protein_id gnl|my_center|LOCUS_21720 8374 7265 gene locus_tag LOCUS_21730 gene dadX 8374 7265 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJB4 protein_id gnl|my_center|LOCUS_21730 9672 8413 gene locus_tag LOCUS_21740 gene dadA 9672 8413 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJB3 protein_id gnl|my_center|LOCUS_21740 9811 10275 gene locus_tag LOCUS_21750 gene lrp 9811 10275 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208089.1 protein_id gnl|my_center|LOCUS_21750 11013 10354 gene locus_tag LOCUS_21760 11013 10354 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 protein_id gnl|my_center|LOCUS_21760 11114 11881 gene locus_tag LOCUS_21770 gene thiED 11114 11881 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_21770 12350 12015 gene locus_tag LOCUS_21780 12350 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_21780 12936 12577 gene locus_tag LOCUS_21790 12936 12577 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207084.1 protein_id gnl|my_center|LOCUS_21790 13416 13075 gene locus_tag LOCUS_21800 gene phnA 13416 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_21800 13996 13616 gene locus_tag LOCUS_21810 13996 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 protein_id gnl|my_center|LOCUS_21810 14898 14239 gene locus_tag LOCUS_21820 gene rluA 14898 14239 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208085.1 protein_id gnl|my_center|LOCUS_21820 16791 15496 gene locus_tag LOCUS_21830 gene pcaT 16791 15496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206689.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence40 278 862 gene locus_tag LOCUS_21840 278 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1068 1283 gene locus_tag LOCUS_21850 1068 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1264 1530 gene locus_tag LOCUS_21860 1264 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2659 2204 gene locus_tag LOCUS_21870 2659 2204 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206159.1 protein_id gnl|my_center|LOCUS_21870 3962 2730 gene locus_tag LOCUS_21880 gene hcaK 3962 2730 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411707.1 protein_id gnl|my_center|LOCUS_21880 4217 5050 gene locus_tag LOCUS_21890 gene hcaA 4217 5050 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206158.1 protein_id gnl|my_center|LOCUS_21890 5088 6539 gene locus_tag LOCUS_21900 gene hcaB 5088 6539 CDS product salicylaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206157.1 protein_id gnl|my_center|LOCUS_21900 6630 8507 gene locus_tag LOCUS_21910 gene hcaC 6630 8507 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206156.1 protein_id gnl|my_center|LOCUS_21910 8583 9722 gene locus_tag LOCUS_21920 gene hcaD 8583 9722 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206155.1 protein_id gnl|my_center|LOCUS_21920 9803 11053 gene locus_tag LOCUS_21930 9803 11053 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206154.1 protein_id gnl|my_center|LOCUS_21930 11158 11553 gene locus_tag LOCUS_21940 11158 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 11732 11863 gene locus_tag LOCUS_21950 11732 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 11999 12307 gene locus_tag LOCUS_21960 11999 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 12304 13593 gene locus_tag LOCUS_21970 12304 13593 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_21970 15936 13876 gene locus_tag LOCUS_21980 gene betT 15936 13876 CDS product high-affinity choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070759.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence41 <1 1038 gene locus_tag LOCUS_21990 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMD7:30S ribosomal protein S1 1199 1504 gene locus_tag LOCUS_22000 gene himD 1199 1504 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_22000 1536 1895 gene locus_tag LOCUS_22010 1536 1895 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121360.1 protein_id gnl|my_center|LOCUS_22010 1932 2612 gene locus_tag LOCUS_22020 gene pyrF 1932 2612 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_22020 3625 2717 gene locus_tag LOCUS_22030 3625 2717 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 protein_id gnl|my_center|LOCUS_22030 4118 4339 gene locus_tag LOCUS_22040 4118 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22040 4448 5572 gene locus_tag LOCUS_22050 gene yhcM 4448 5572 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV3 protein_id gnl|my_center|LOCUS_22050 5923 8088 gene locus_tag LOCUS_22060 gene glcB 5923 8088 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV4 protein_id gnl|my_center|LOCUS_22060 8829 8365 gene locus_tag LOCUS_22070 8829 8365 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 protein_id gnl|my_center|LOCUS_22070 10045 9224 gene locus_tag LOCUS_22080 gene thiM 10045 9224 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH64 protein_id gnl|my_center|LOCUS_22080 11200 10103 gene locus_tag LOCUS_22090 11200 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207082.1 protein_id gnl|my_center|LOCUS_22090 11701 11438 gene locus_tag LOCUS_22100 11701 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119338.1 protein_id gnl|my_center|LOCUS_22100 12090 13466 gene locus_tag LOCUS_22110 gene benK 12090 13466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_22110 13561 14811 gene locus_tag LOCUS_22120 13561 14811 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206708.1 protein_id gnl|my_center|LOCUS_22120 15746 14922 gene locus_tag LOCUS_22130 gene pcaU 15746 14922 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence42 661 2013 gene locus_tag LOCUS_22140 gene argA 661 2013 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN4 protein_id gnl|my_center|LOCUS_22140 2328 3299 gene locus_tag LOCUS_22150 gene ssuA2 2328 3299 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208029.1 protein_id gnl|my_center|LOCUS_22150 3317 4318 gene locus_tag LOCUS_22160 3317 4318 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208028.1 protein_id gnl|my_center|LOCUS_22160 4334 5509 gene locus_tag LOCUS_22170 gene ssuD 4334 5509 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN1 protein_id gnl|my_center|LOCUS_22170 5509 6324 gene locus_tag LOCUS_22180 gene ssuC 5509 6324 CDS product sulfonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_22180 6335 7144 gene locus_tag LOCUS_22190 gene ssuB 6335 7144 CDS product aliphatic sulfonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208026.1 protein_id gnl|my_center|LOCUS_22190 7476 8111 gene locus_tag LOCUS_22200 gene rutR 7476 8111 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071782.1 protein_id gnl|my_center|LOCUS_22200 8728 8168 gene locus_tag LOCUS_22210 gene mtnN 8728 8168 CDS product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 protein_id gnl|my_center|LOCUS_22210 9048 9947 gene locus_tag LOCUS_22220 gene ribF 9048 9947 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM5 protein_id gnl|my_center|LOCUS_22220 10012 12858 gene locus_tag LOCUS_22230 gene ileS 10012 12858 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM4 protein_id gnl|my_center|LOCUS_22230 12851 13393 gene locus_tag LOCUS_22240 gene lspA 12851 13393 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_22240 13386 13868 gene locus_tag LOCUS_22250 gene yaaD 13386 13868 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM2 protein_id gnl|my_center|LOCUS_22250 14010 14552 gene locus_tag LOCUS_22260 14010 14552 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208020.1 protein_id gnl|my_center|LOCUS_22260 16323 15142 gene locus_tag LOCUS_22270 16323 15142 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086530.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence43 1078 2295 gene locus_tag LOCUS_22280 1078 2295 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 protein_id gnl|my_center|LOCUS_22280 2915 2313 gene locus_tag LOCUS_22290 2915 2313 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102950.1 protein_id gnl|my_center|LOCUS_22290 6804 3004 gene locus_tag LOCUS_22300 6804 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7144 6941 gene locus_tag LOCUS_22310 gene yopB 7144 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31936 protein_id gnl|my_center|LOCUS_22310 7486 7755 gene locus_tag LOCUS_22320 7486 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 7806 8228 gene locus_tag LOCUS_22330 7806 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8252 8530 gene locus_tag LOCUS_22340 8252 8530 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095141.1 protein_id gnl|my_center|LOCUS_22340 8527 9399 gene locus_tag LOCUS_22350 8527 9399 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887797.1 protein_id gnl|my_center|LOCUS_22350 9566 9411 gene locus_tag LOCUS_22360 9566 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 9735 10301 gene locus_tag LOCUS_22370 9735 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 11802 10354 gene locus_tag LOCUS_22380 11802 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 13228 11807 gene locus_tag LOCUS_22390 13228 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 13700 13912 gene locus_tag LOCUS_22400 13700 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 15686 14052 gene locus_tag LOCUS_22410 gene groL 15686 14052 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT7 protein_id gnl|my_center|LOCUS_22410 >Feature sequence44 203 601 gene locus_tag LOCUS_22420 203 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 990 745 gene locus_tag LOCUS_22430 990 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207871.1 protein_id gnl|my_center|LOCUS_22430 2118 1060 gene locus_tag LOCUS_22440 2118 1060 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207873.1 protein_id gnl|my_center|LOCUS_22440 2423 2905 gene locus_tag LOCUS_22450 2423 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 4870 2993 gene locus_tag LOCUS_22460 gene trkD 4870 2993 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGN4 protein_id gnl|my_center|LOCUS_22460 4993 5082 gene locus_tag LOCUS_t00460 4993 5082 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5807 6865 gene locus_tag LOCUS_22470 gene aspQ 5807 6865 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206524.1 protein_id gnl|my_center|LOCUS_22470 7151 7378 gene locus_tag LOCUS_22480 7151 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 7615 7690 gene locus_tag LOCUS_t00470 7615 7690 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8588 7776 gene locus_tag LOCUS_22490 gene chiG 8588 7776 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207892.1 protein_id gnl|my_center|LOCUS_22490 9891 8593 gene locus_tag LOCUS_22500 9891 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 protein_id gnl|my_center|LOCUS_22500 11184 10306 gene locus_tag LOCUS_22510 11184 10306 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207894.1 protein_id gnl|my_center|LOCUS_22510 11934 11371 gene locus_tag LOCUS_22520 gene ahpC 11934 11371 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_22520 12350 12868 gene locus_tag LOCUS_22530 gene fimA 12350 12868 CDS product type-1 fimbrial protein subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695545.1 protein_id gnl|my_center|LOCUS_22530 12907 13641 gene locus_tag LOCUS_22540 gene mrkB 12907 13641 CDS product fimbrial chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206740.1 protein_id gnl|my_center|LOCUS_22540 13662 13970 gene locus_tag LOCUS_22550 13662 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence45 574 329 gene locus_tag LOCUS_22560 574 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1639 716 gene locus_tag LOCUS_22570 gene mdcF 1639 716 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_22570 2808 1675 gene locus_tag LOCUS_22580 2808 1675 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116511.1 protein_id gnl|my_center|LOCUS_22580 4944 2821 gene locus_tag LOCUS_22590 gene yncD 4944 2821 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_22590 5228 6082 gene locus_tag LOCUS_22600 gene mutM 5228 6082 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN93 protein_id gnl|my_center|LOCUS_22600 6079 6360 gene locus_tag LOCUS_22610 gene ppiC 6079 6360 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN94 protein_id gnl|my_center|LOCUS_22610 6869 6438 gene locus_tag LOCUS_22620 gene mscL 6869 6438 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_22620 8919 7084 gene locus_tag LOCUS_22630 gene typA 8919 7084 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_22630 9246 9488 gene locus_tag LOCUS_22640 9246 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 9554 10579 gene locus_tag LOCUS_22650 gene rsmC 9554 10579 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA0 protein_id gnl|my_center|LOCUS_22650 10589 12058 gene locus_tag LOCUS_22660 gene lysP 10589 12058 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207587.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence46 <1 598 gene locus_tag LOCUS_22670 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KP63:S-(hydroxymethyl)glutathione dehydrogenase 1880 657 gene locus_tag LOCUS_22680 gene tyrB 1880 657 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT1 protein_id gnl|my_center|LOCUS_22680 3311 1911 gene locus_tag LOCUS_22690 gene aroP 3311 1911 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119258.1 protein_id gnl|my_center|LOCUS_22690 4554 3493 gene locus_tag LOCUS_22700 gene hpd 4554 3493 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119157.1 protein_id gnl|my_center|LOCUS_22700 5497 6558 gene locus_tag LOCUS_22710 gene aroF 5497 6558 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFQ9 protein_id gnl|my_center|LOCUS_22710 7000 6626 gene locus_tag LOCUS_22720 gene gcvH 7000 6626 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM96 protein_id gnl|my_center|LOCUS_22720 9024 7171 gene locus_tag LOCUS_22730 9024 7171 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206581.1 protein_id gnl|my_center|LOCUS_22730 9338 9529 gene locus_tag LOCUS_22740 9338 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 9709 10029 gene locus_tag LOCUS_22750 9709 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 10362 10661 gene locus_tag LOCUS_22760 10362 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 10670 11125 gene locus_tag LOCUS_22770 10670 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 11302 11610 gene locus_tag LOCUS_22780 11302 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 12032 11814 gene locus_tag LOCUS_22790 12032 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 12168 12347 gene locus_tag LOCUS_22800 12168 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence47 86 700 gene locus_tag LOCUS_22810 gene ispZ 86 700 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ2 protein_id gnl|my_center|LOCUS_22810 727 1029 gene locus_tag LOCUS_22820 727 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_22820 1034 1531 gene locus_tag LOCUS_22830 1034 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064163.1 protein_id gnl|my_center|LOCUS_22830 1572 3494 gene locus_tag LOCUS_22840 gene mnmC 1572 3494 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC7 protein_id gnl|my_center|LOCUS_22840 3846 4262 gene locus_tag LOCUS_22850 3846 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4683 4369 gene locus_tag LOCUS_22860 gene glpE 4683 4369 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 protein_id gnl|my_center|LOCUS_22860 4775 5263 gene locus_tag LOCUS_22870 4775 5263 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC9 protein_id gnl|my_center|LOCUS_22870 5286 5795 gene locus_tag LOCUS_22880 5286 5795 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 protein_id gnl|my_center|LOCUS_22880 6449 5883 gene locus_tag LOCUS_22890 6449 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 7046 6621 gene locus_tag LOCUS_22900 7046 6621 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116010.1 protein_id gnl|my_center|LOCUS_22900 7482 7048 gene locus_tag LOCUS_22910 gene thi3 7482 7048 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_22910 8379 7483 gene locus_tag LOCUS_22920 8379 7483 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207654.1 protein_id gnl|my_center|LOCUS_22920 8504 8839 gene locus_tag LOCUS_22930 gene blh 8504 8839 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_22930 8832 9257 gene locus_tag LOCUS_22940 gene blh 8832 9257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_22940 9635 11011 gene locus_tag LOCUS_22950 gene pdhD 9635 11011 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207656.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence48 407 1231 gene locus_tag LOCUS_22960 gene pcaU 407 1231 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_22960 2555 1362 gene locus_tag LOCUS_22970 gene pobA 2555 1362 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114537.1 protein_id gnl|my_center|LOCUS_22970 2710 3519 gene locus_tag LOCUS_22980 gene pobR 2710 3519 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206420.1 protein_id gnl|my_center|LOCUS_22980 3932 5278 gene locus_tag LOCUS_22990 gene vanK 3932 5278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206166.1 protein_id gnl|my_center|LOCUS_22990 5353 6621 gene locus_tag LOCUS_23000 gene vanP 5353 6621 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206167.1 protein_id gnl|my_center|LOCUS_23000 9682 6875 gene locus_tag LOCUS_23010 9682 6875 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_23010 10407 9679 gene locus_tag LOCUS_23020 10407 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence49 1910 123 gene locus_tag LOCUS_23030 gene nuoC 1910 123 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES6 protein_id gnl|my_center|LOCUS_23030 2675 1998 gene locus_tag LOCUS_23040 gene nuoB 2675 1998 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES5 protein_id gnl|my_center|LOCUS_23040 3230 2682 gene locus_tag LOCUS_23050 gene nuoA 3230 2682 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPM2 protein_id gnl|my_center|LOCUS_23050 3813 4169 gene locus_tag LOCUS_23060 3813 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205897.1 protein_id gnl|my_center|LOCUS_23060 5875 4217 gene locus_tag LOCUS_23070 gene rstB 5875 4217 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_23070 6620 5904 gene locus_tag LOCUS_23080 gene rstA 6620 5904 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_23080 7207 10041 gene locus_tag LOCUS_23090 gene nrdA 7207 10041 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071099.1 protein_id gnl|my_center|LOCUS_23090 10141 10269 gene locus_tag LOCUS_23100 10141 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence50 1156 158 gene locus_tag LOCUS_23110 1156 158 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113632.1 protein_id gnl|my_center|LOCUS_23110 2473 1169 gene locus_tag LOCUS_23120 gene ttuB 2473 1169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206893.1 protein_id gnl|my_center|LOCUS_23120 2642 4375 gene locus_tag LOCUS_23130 gene ilvD 2642 4375 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206894.1 protein_id gnl|my_center|LOCUS_23130 4454 5170 gene locus_tag LOCUS_23140 gene pdhR 4454 5170 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009388335.1 protein_id gnl|my_center|LOCUS_23140 5213 6163 gene locus_tag LOCUS_23150 gene hprA 5213 6163 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225762.1 protein_id gnl|my_center|LOCUS_23150 6903 6427 gene locus_tag LOCUS_23160 gene ygaU 6903 6427 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_23160 7330 7094 gene locus_tag LOCUS_23170 gene acpP 7330 7094 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ5 protein_id gnl|my_center|LOCUS_23170 8156 7422 gene locus_tag LOCUS_23180 gene fabG 8156 7422 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120395.1 protein_id gnl|my_center|LOCUS_23180 9139 8153 gene locus_tag LOCUS_23190 gene fabD 9139 8153 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ3 protein_id gnl|my_center|LOCUS_23190 9489 9304 gene locus_tag LOCUS_23200 gene rpmF 9489 9304 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ2 protein_id gnl|my_center|LOCUS_23200 10123 9566 gene locus_tag LOCUS_23210 10123 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence51 <1 580 gene locus_tag LOCUS_23220 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206899.1:3-oxoadipyl-CoA thiolase 690 1466 gene locus_tag LOCUS_23230 gene catD 690 1466 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206900.1 protein_id gnl|my_center|LOCUS_23230 2551 1616 gene locus_tag LOCUS_23240 gene nahR 2551 1616 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113533.1 protein_id gnl|my_center|LOCUS_23240 3734 2736 gene locus_tag LOCUS_23250 gene cysK 3734 2736 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJZ5 protein_id gnl|my_center|LOCUS_23250 4002 6503 gene locus_tag LOCUS_23260 gene plsB 4002 6503 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA5 protein_id gnl|my_center|LOCUS_23260 6983 8176 gene locus_tag LOCUS_23270 gene sstT 6983 8176 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA2 protein_id gnl|my_center|LOCUS_23270 8209 8883 gene locus_tag LOCUS_23280 8209 8883 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 protein_id gnl|my_center|LOCUS_23280 8898 9434 gene locus_tag LOCUS_23290 gene yaiL 8898 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121466.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence52 1104 574 gene locus_tag LOCUS_23300 gene def 1104 574 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY9 protein_id gnl|my_center|LOCUS_23300 1225 2388 gene locus_tag LOCUS_23310 1225 2388 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_23310 2398 3543 gene locus_tag LOCUS_23320 gene smf 2398 3543 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 protein_id gnl|my_center|LOCUS_23320 3586 4155 gene locus_tag LOCUS_23330 gene yrdC 3586 4155 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_23330 5444 4533 gene locus_tag LOCUS_23340 5444 4533 CDS product multidrug DMT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208131.1 protein_id gnl|my_center|LOCUS_23340 5966 5574 gene locus_tag LOCUS_23350 5966 5574 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_23350 6619 5996 gene locus_tag LOCUS_23360 6619 5996 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207865.1 protein_id gnl|my_center|LOCUS_23360 7584 6634 gene locus_tag LOCUS_23370 gene thrB 7584 6634 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_23370 7698 8456 gene locus_tag LOCUS_23380 gene hisF 7698 8456 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_23380 8835 9074 gene locus_tag LOCUS_23390 8835 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence53 2526 1825 gene locus_tag LOCUS_23400 2526 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3158 2637 gene locus_tag LOCUS_23410 3158 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5015 4059 gene locus_tag LOCUS_23420 5015 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6325 5309 gene locus_tag LOCUS_23430 gene ilvC 6325 5309 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT8 protein_id gnl|my_center|LOCUS_23430 6923 6432 gene locus_tag LOCUS_23440 gene ilvH 6923 6432 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_23440 <8605 6920 gene locus_tag LOCUS_23450 <8605 6920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMT6:acetolactate synthase >Feature sequence54 108 32 gene locus_tag LOCUS_t00480 108 32 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 215 124 gene locus_tag LOCUS_t00490 215 124 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 483 2912 gene locus_tag LOCUS_23460 gene rnr 483 2912 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPZ5 protein_id gnl|my_center|LOCUS_23460 3067 5106 gene locus_tag LOCUS_23470 gene prlC 3067 5106 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_23470 5142 5357 gene locus_tag LOCUS_23480 5142 5357 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117042.1 protein_id gnl|my_center|LOCUS_23480 5372 5797 gene locus_tag LOCUS_23490 5372 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207735.1 protein_id gnl|my_center|LOCUS_23490 6273 6010 gene locus_tag LOCUS_23500 6273 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 6646 6389 gene locus_tag LOCUS_23510 6646 6389 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_23510 8313 6841 gene locus_tag LOCUS_23520 gene hapE 8313 6841 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence55 2801 192 gene locus_tag LOCUS_23530 gene acnA 2801 192 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208069.1 protein_id gnl|my_center|LOCUS_23530 3060 3782 gene locus_tag LOCUS_23540 3060 3782 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_23540 4547 3852 gene locus_tag LOCUS_23550 gene hisG 4547 3852 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_23550 5803 4547 gene locus_tag LOCUS_23560 gene murA 5803 4547 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH0 protein_id gnl|my_center|LOCUS_23560 6061 5810 gene locus_tag LOCUS_23570 gene ligA 6061 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_23570 6530 6198 gene locus_tag LOCUS_23580 gene rpoX 6530 6198 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071251.1 protein_id gnl|my_center|LOCUS_23580 8156 6702 gene locus_tag LOCUS_23590 gene rpoN 8156 6702 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNG7 protein_id gnl|my_center|LOCUS_23590 >Feature sequence56 1448 297 gene locus_tag LOCUS_23600 1448 297 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693486.1 protein_id gnl|my_center|LOCUS_23600 1550 2602 gene locus_tag LOCUS_23610 gene dusA 1550 2602 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA5 protein_id gnl|my_center|LOCUS_23610 3103 2726 gene locus_tag LOCUS_23620 3103 2726 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207686.1 protein_id gnl|my_center|LOCUS_23620 4523 3258 gene locus_tag LOCUS_23630 gene dfp 4523 3258 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_23630 4634 5326 gene locus_tag LOCUS_23640 gene radC 4634 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207648.1 protein_id gnl|my_center|LOCUS_23640 5399 6310 gene locus_tag LOCUS_23650 5399 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064169.1 protein_id gnl|my_center|LOCUS_23650 7252 6401 gene locus_tag LOCUS_23660 gene trpH 7252 6401 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence57 2661 3614 gene locus_tag LOCUS_23670 gene trxB 2661 3614 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK4 protein_id gnl|my_center|LOCUS_23670 3717 4448 gene locus_tag LOCUS_23680 gene aat 3717 4448 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK3 protein_id gnl|my_center|LOCUS_23680 4470 5288 gene locus_tag LOCUS_23690 gene ate 4470 5288 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK2 protein_id gnl|my_center|LOCUS_23690 5756 5298 gene locus_tag LOCUS_23700 gene rimI 5756 5298 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK1 protein_id gnl|my_center|LOCUS_23700 6115 5978 gene locus_tag LOCUS_23710 6115 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence58 2756 1608 gene locus_tag LOCUS_23720 gene yhcM 2756 1608 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV3 protein_id gnl|my_center|LOCUS_23720 3119 4027 gene locus_tag LOCUS_23730 3119 4027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 protein_id gnl|my_center|LOCUS_23730 4784 4104 gene locus_tag LOCUS_23740 gene pyrF 4784 4104 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_23740 5330 4965 gene locus_tag LOCUS_23750 5330 4965 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121360.1 protein_id gnl|my_center|LOCUS_23750 5655 5353 gene locus_tag LOCUS_23760 gene himD 5655 5353 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_23760 <6458 5816 gene locus_tag LOCUS_23770 <6458 5816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMD7:30S ribosomal protein S1 >Feature sequence59 1097 2035 gene locus_tag LOCUS_23780 1097 2035 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115559.1 protein_id gnl|my_center|LOCUS_23780 2016 2792 gene locus_tag LOCUS_23790 2016 2792 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207450.1 protein_id gnl|my_center|LOCUS_23790 2961 3251 gene locus_tag LOCUS_23800 gene groS 2961 3251 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_23800 3322 4956 gene locus_tag LOCUS_23810 gene groL 3322 4956 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT7 protein_id gnl|my_center|LOCUS_23810 5517 5023 gene locus_tag LOCUS_23820 gene cutF 5517 5023 CDS product lipoprotein involved with copper homeostasis and adhesion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206080.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence60 1098 2375 gene locus_tag LOCUS_23830 gene gltA 1098 2375 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME8 protein_id gnl|my_center|LOCUS_23830 2943 2470 gene locus_tag LOCUS_23840 2943 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3200 4825 gene locus_tag LOCUS_23850 gene nadE2 3200 4825 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_23850 5586 5510 gene locus_tag LOCUS_t00500 5586 5510 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5940 5864 gene locus_tag LOCUS_t00510 5940 5864 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence61 590 102 gene locus_tag LOCUS_23860 590 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23860 1039 590 gene locus_tag LOCUS_23870 1039 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23870 2944 2561 gene locus_tag LOCUS_23880 2944 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23880 3133 2957 gene locus_tag LOCUS_23890 3133 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3411 3875 gene locus_tag LOCUS_23900 3411 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence62 1839 1258 gene locus_tag LOCUS_23910 gene grpE 1839 1258 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE5 protein_id gnl|my_center|LOCUS_23910 3311 2811 gene locus_tag LOCUS_23920 3311 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3529 4599 gene locus_tag LOCUS_23930 gene estA 3529 4599 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207659.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence63 751 35 gene locus_tag LOCUS_23940 751 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208323.1 protein_id gnl|my_center|LOCUS_23940 2232 922 gene locus_tag LOCUS_23950 gene clpX 2232 922 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_23950 2867 2262 gene locus_tag LOCUS_23960 gene clpP 2867 2262 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM2 protein_id gnl|my_center|LOCUS_23960 <4300 3062 gene locus_tag LOCUS_23970 <4300 3062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMM1:trigger factor >Feature sequence64 1396 197 gene locus_tag LOCUS_23980 1396 197 CDS product restriction endonuclease S subunits-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205996.1 protein_id gnl|my_center|LOCUS_23980 2970 1396 gene locus_tag LOCUS_23990 gene hsdM 2970 1396 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_23990 4228 3224 gene locus_tag LOCUS_24000 4228 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence65 475 1458 gene locus_tag LOCUS_24010 475 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 protein_id gnl|my_center|LOCUS_24010 1510 2553 gene locus_tag LOCUS_24020 gene metE 1510 2553 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_24020 2651 3145 gene locus_tag LOCUS_24030 gene rutF 2651 3145 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_24030 3188 3988 gene locus_tag LOCUS_24040 3188 3988 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_24040 >Feature sequence66 852 1112 gene locus_tag LOCUS_24050 852 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24050 1997 3073 gene locus_tag LOCUS_24060 1997 3073 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106325.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence67 1590 883 gene locus_tag LOCUS_24070 1590 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2771 1554 gene locus_tag LOCUS_24080 2771 1554 CDS product restriction endonuclease S subunits-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205996.1 protein_id gnl|my_center|LOCUS_24080 <3958 2771 gene locus_tag LOCUS_24090 <3958 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205995.1:type I restriction-modification system subunit M >Feature sequence68 2448 280 gene locus_tag LOCUS_24100 2448 280 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223352.1 protein_id gnl|my_center|LOCUS_24100 2733 3812 gene locus_tag LOCUS_24110 gene tig 2733 3812 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence69 1509 421 gene locus_tag LOCUS_24120 gene virS 1509 421 CDS product HTH-type transcriptional regulator VirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMJ3 protein_id gnl|my_center|LOCUS_24120 1713 2606 gene locus_tag LOCUS_24130 1713 2606 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence70 798 2276 gene locus_tag LOCUS_24140 gene plD 798 2276 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206732.1 protein_id gnl|my_center|LOCUS_24140 2628 2413 gene locus_tag LOCUS_24150 2628 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248798.1 protein_id gnl|my_center|LOCUS_24150 2837 2625 gene locus_tag LOCUS_24160 2837 2625 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981029.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence71 3 140 gene locus_tag LOCUS_24170 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 474 202 gene locus_tag LOCUS_24180 474 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24180 1238 480 gene locus_tag LOCUS_24190 1238 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24190 >Feature sequence72 1798 782 gene locus_tag LOCUS_24200 gene galE 1798 782 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208059.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence73 <1 1848 gene locus_tag LOCUS_24210 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207616.1:ligand-gated channel protein >Feature sequence74 <1 857 gene locus_tag LOCUS_24220 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKJ4:glyceraldehyde-3-phosphate dehydrogenase 1043 1417 gene locus_tag LOCUS_24230 1043 1417 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013009321.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence75 272 129 gene locus_tag LOCUS_24240 272 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence76 551 700 gene locus_tag LOCUS_24250 551 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1295 966 gene locus_tag LOCUS_24260 1295 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence77 1365 166 gene locus_tag LOCUS_24270 gene ykgB 1365 166 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207108.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence78 <1519 988 gene locus_tag LOCUS_24280 <1519 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118601.1:cys regulon transcriptional regulator Cbl