>Feature sequence01 94 19 gene locus_tag LOCUS_t00010 94 19 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 766 113 gene locus_tag LOCUS_00010 gene rnt 766 113 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI2 protein_id gnl|my_center|LOCUS_00010 1797 763 gene locus_tag LOCUS_00020 gene pyrC 1797 763 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI3 protein_id gnl|my_center|LOCUS_00020 3334 1994 gene locus_tag LOCUS_00030 gene argG 3334 1994 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI5 protein_id gnl|my_center|LOCUS_00030 4395 3535 gene locus_tag LOCUS_00040 4395 3535 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926327.1 protein_id gnl|my_center|LOCUS_00040 4522 5436 gene locus_tag LOCUS_00050 gene yoaV 4522 5436 CDS product putative transporter YoaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34416 protein_id gnl|my_center|LOCUS_00050 5785 7815 gene locus_tag LOCUS_00060 gene fadH 5785 7815 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 protein_id gnl|my_center|LOCUS_00060 7901 7990 gene locus_tag LOCUS_t00020 7901 7990 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8533 9741 gene locus_tag LOCUS_00070 8533 9741 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104173.1 protein_id gnl|my_center|LOCUS_00070 9747 12842 gene locus_tag LOCUS_00080 9747 12842 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_00080 12839 15946 gene locus_tag LOCUS_00090 12839 15946 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267714.1 protein_id gnl|my_center|LOCUS_00090 15959 17428 gene locus_tag LOCUS_00100 15959 17428 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267715.1 protein_id gnl|my_center|LOCUS_00100 17468 17983 gene locus_tag LOCUS_00110 gene femI 17468 17983 CDS product ECF sigma factor FemI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_00110 18009 18983 gene locus_tag LOCUS_00120 gene fecR 18009 18983 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206008.1 protein_id gnl|my_center|LOCUS_00120 19067 21493 gene locus_tag LOCUS_00130 gene bfrC 19067 21493 CDS product ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038667.1 protein_id gnl|my_center|LOCUS_00130 22086 22955 gene locus_tag LOCUS_00140 gene hchA 22086 22955 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207522.1 protein_id gnl|my_center|LOCUS_00140 23231 23971 gene locus_tag LOCUS_00150 23231 23971 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112485.1 protein_id gnl|my_center|LOCUS_00150 24245 24550 gene locus_tag LOCUS_00160 24245 24550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00160 24776 24931 gene locus_tag LOCUS_00170 24776 24931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00170 25094 26476 gene locus_tag LOCUS_00180 gene proY 25094 26476 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804358.1 protein_id gnl|my_center|LOCUS_00180 26892 28151 gene locus_tag LOCUS_00190 26892 28151 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_00190 28154 28933 gene locus_tag LOCUS_00200 28154 28933 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_00200 29522 28938 gene locus_tag LOCUS_00210 29522 28938 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_00210 30274 29573 gene locus_tag LOCUS_00220 30274 29573 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118524.1 protein_id gnl|my_center|LOCUS_00220 30546 31793 gene locus_tag LOCUS_00230 30546 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207348.1 protein_id gnl|my_center|LOCUS_00230 31796 32929 gene locus_tag LOCUS_00240 31796 32929 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_00240 33818 32934 gene locus_tag LOCUS_00250 33818 32934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207347.1 protein_id gnl|my_center|LOCUS_00250 35658 33805 gene locus_tag LOCUS_00260 35658 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207346.1 protein_id gnl|my_center|LOCUS_00260 36908 35655 gene locus_tag LOCUS_00270 gene icaA 36908 35655 CDS product N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067892.1 protein_id gnl|my_center|LOCUS_00270 37800 36895 gene locus_tag LOCUS_00280 37800 36895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207345.1 protein_id gnl|my_center|LOCUS_00280 38492 37800 gene locus_tag LOCUS_00290 38492 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207344.1 protein_id gnl|my_center|LOCUS_00290 40119 38686 gene locus_tag LOCUS_00300 gene phrB 40119 38686 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207343.1 protein_id gnl|my_center|LOCUS_00300 40849 40367 gene locus_tag LOCUS_00310 gene slyD 40849 40367 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_00310 42417 41107 gene locus_tag LOCUS_00320 gene dacD 42417 41107 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207340.1 protein_id gnl|my_center|LOCUS_00320 42587 44290 gene locus_tag LOCUS_00330 42587 44290 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207339.1 protein_id gnl|my_center|LOCUS_00330 44533 46764 gene locus_tag LOCUS_00340 gene icd2 44533 46764 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400583.1 protein_id gnl|my_center|LOCUS_00340 47257 46859 gene locus_tag LOCUS_00350 gene yedX 47257 46859 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIG6 protein_id gnl|my_center|LOCUS_00350 48136 47342 gene locus_tag LOCUS_00360 gene rluE 48136 47342 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH0 protein_id gnl|my_center|LOCUS_00360 48332 49588 gene locus_tag LOCUS_00370 gene icd 48332 49588 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKG9 protein_id gnl|my_center|LOCUS_00370 49821 51209 gene locus_tag LOCUS_00380 gene ydjN 49821 51209 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207331.1 protein_id gnl|my_center|LOCUS_00380 51336 52166 gene locus_tag LOCUS_00390 51336 52166 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207330.1 protein_id gnl|my_center|LOCUS_00390 52318 53547 gene locus_tag LOCUS_00400 52318 53547 CDS product voltage-gated chloride channel membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552062.1 protein_id gnl|my_center|LOCUS_00400 53658 56438 gene locus_tag LOCUS_00410 53658 56438 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930957.1 protein_id gnl|my_center|LOCUS_00410 56860 56477 gene locus_tag LOCUS_00420 56860 56477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 protein_id gnl|my_center|LOCUS_00420 56966 57598 gene locus_tag LOCUS_00430 56966 57598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_00430 59113 57647 gene locus_tag LOCUS_00440 gene ygiF 59113 57647 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 protein_id gnl|my_center|LOCUS_00440 59338 59718 gene locus_tag LOCUS_00450 59338 59718 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207325.1 protein_id gnl|my_center|LOCUS_00450 59862 60626 gene locus_tag LOCUS_00460 59862 60626 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199949.1 protein_id gnl|my_center|LOCUS_00460 60756 61391 gene locus_tag LOCUS_00470 gene thiE 60756 61391 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF6 protein_id gnl|my_center|LOCUS_00470 61421 62719 gene locus_tag LOCUS_00480 gene hemL 61421 62719 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF5 protein_id gnl|my_center|LOCUS_00480 62772 63188 gene locus_tag LOCUS_00490 62772 63188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206963.1 protein_id gnl|my_center|LOCUS_00490 63343 63987 gene locus_tag LOCUS_00500 gene rluA 63343 63987 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_00500 64138 66966 gene locus_tag LOCUS_00510 gene hepA 64138 66966 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF2 protein_id gnl|my_center|LOCUS_00510 67556 67047 gene locus_tag LOCUS_00520 gene dps 67556 67047 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU34 protein_id gnl|my_center|LOCUS_00520 68396 67704 gene locus_tag LOCUS_00530 68396 67704 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118668.1 protein_id gnl|my_center|LOCUS_00530 68537 69598 gene locus_tag LOCUS_00540 gene hmp 68537 69598 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207321.1 protein_id gnl|my_center|LOCUS_00540 69613 70707 gene locus_tag LOCUS_00550 gene des6 69613 70707 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_00550 71491 70787 gene locus_tag LOCUS_00560 71491 70787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_00560 72035 73336 gene locus_tag LOCUS_00570 gene dat 72035 73336 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 protein_id gnl|my_center|LOCUS_00570 73343 74875 gene locus_tag LOCUS_00580 gene ddc 73343 74875 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 protein_id gnl|my_center|LOCUS_00580 75165 76196 gene locus_tag LOCUS_00590 gene sphX 75165 76196 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118975.1 protein_id gnl|my_center|LOCUS_00590 76300 77679 gene locus_tag LOCUS_00600 gene pstC 76300 77679 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKD9 protein_id gnl|my_center|LOCUS_00600 77676 79073 gene locus_tag LOCUS_00610 gene pstA 77676 79073 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY3 protein_id gnl|my_center|LOCUS_00610 79085 79996 gene locus_tag LOCUS_00620 gene pstB 79085 79996 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_00620 80147 81109 gene locus_tag LOCUS_00630 gene sohB 80147 81109 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207313.1 protein_id gnl|my_center|LOCUS_00630 81772 81140 gene locus_tag LOCUS_00640 gene yjdF 81772 81140 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 protein_id gnl|my_center|LOCUS_00640 83243 81855 gene locus_tag LOCUS_00650 gene purB 83243 81855 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX8 protein_id gnl|my_center|LOCUS_00650 84030 83299 gene locus_tag LOCUS_00660 gene hflD 84030 83299 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX7 protein_id gnl|my_center|LOCUS_00660 85177 84044 gene locus_tag LOCUS_00670 gene trmU 85177 84044 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX6 protein_id gnl|my_center|LOCUS_00670 85670 85182 gene locus_tag LOCUS_00680 gene nudJ 85670 85182 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119006.1 protein_id gnl|my_center|LOCUS_00680 86094 85744 gene locus_tag LOCUS_00690 86094 85744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974118.1 protein_id gnl|my_center|LOCUS_00690 86753 86214 gene locus_tag LOCUS_00700 gene yrdA 86753 86214 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 protein_id gnl|my_center|LOCUS_00700 88053 86845 gene locus_tag LOCUS_00710 gene dacC 88053 86845 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_00710 88509 88111 gene locus_tag LOCUS_00720 88509 88111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118406.1 protein_id gnl|my_center|LOCUS_00720 88769 89536 gene locus_tag LOCUS_00730 gene surE 88769 89536 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX0 protein_id gnl|my_center|LOCUS_00730 89667 90500 gene locus_tag LOCUS_00740 gene nlpD 89667 90500 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_00740 90610 91539 gene locus_tag LOCUS_00750 gene aaeR 90610 91539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 protein_id gnl|my_center|LOCUS_00750 92807 91593 gene locus_tag LOCUS_00760 gene argD 92807 91593 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_00760 92972 93313 gene locus_tag LOCUS_00770 gene grxD 92972 93313 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_00770 93719 93375 gene locus_tag LOCUS_00780 93719 93375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121546.1 protein_id gnl|my_center|LOCUS_00780 95456 93897 gene locus_tag LOCUS_00790 gene ahpF 95456 93897 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 protein_id gnl|my_center|LOCUS_00790 96485 95574 gene locus_tag LOCUS_00800 96485 95574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 97654 96512 gene locus_tag LOCUS_00810 gene yaaN 97654 96512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37535 protein_id gnl|my_center|LOCUS_00810 98445 97654 gene locus_tag LOCUS_00820 98445 97654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 99976 98723 gene locus_tag LOCUS_00830 gene glyA 99976 98723 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_00830 101352 100132 gene locus_tag LOCUS_00840 101352 100132 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207237.1 protein_id gnl|my_center|LOCUS_00840 101533 102222 gene locus_tag LOCUS_00850 gene exoX 101533 102222 CDS product DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_00850 102744 102820 gene locus_tag LOCUS_t00030 102744 102820 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 103033 103974 gene locus_tag LOCUS_00860 gene yadG 103033 103974 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 protein_id gnl|my_center|LOCUS_00860 103974 104747 gene locus_tag LOCUS_00870 gene yadH 103974 104747 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_00870 104744 105559 gene locus_tag LOCUS_00880 gene queF 104744 105559 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ66 protein_id gnl|my_center|LOCUS_00880 105582 106235 gene locus_tag LOCUS_00890 105582 106235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_00890 106358 107500 gene locus_tag LOCUS_00900 gene rodA 106358 107500 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_00900 107538 108539 gene locus_tag LOCUS_00910 gene mltB 107538 108539 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207240.1 protein_id gnl|my_center|LOCUS_00910 108823 109437 gene locus_tag LOCUS_00920 108823 109437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 protein_id gnl|my_center|LOCUS_00920 109910 110359 gene locus_tag LOCUS_00930 109910 110359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_00930 110864 110382 gene locus_tag LOCUS_00940 110864 110382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207244.1 protein_id gnl|my_center|LOCUS_00940 111804 110929 gene locus_tag LOCUS_00950 gene tsf 111804 110929 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ75 protein_id gnl|my_center|LOCUS_00950 112689 111940 gene locus_tag LOCUS_00960 gene rpsB 112689 111940 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ76 protein_id gnl|my_center|LOCUS_00960 112898 113722 gene locus_tag LOCUS_00970 gene map 112898 113722 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ77 protein_id gnl|my_center|LOCUS_00970 113921 115048 gene locus_tag LOCUS_00980 gene ompW 113921 115048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_00980 117129 115714 gene locus_tag LOCUS_00990 gene sthA 117129 115714 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_00990 117331 118344 gene locus_tag LOCUS_01000 gene lipA 117331 118344 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_01000 118656 121145 gene locus_tag LOCUS_01010 gene fadE 118656 121145 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_01010 121232 121621 gene locus_tag LOCUS_01020 gene pcaC 121232 121621 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_01020 122674 121622 gene locus_tag LOCUS_01030 122674 121622 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 protein_id gnl|my_center|LOCUS_01030 123209 124690 gene locus_tag LOCUS_01040 123209 124690 CDS product proline/betaine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095119.1 protein_id gnl|my_center|LOCUS_01040 125322 124780 gene locus_tag LOCUS_01050 125322 124780 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207252.1 protein_id gnl|my_center|LOCUS_01050 125554 126936 gene locus_tag LOCUS_01060 gene sahH 125554 126936 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ86 protein_id gnl|my_center|LOCUS_01060 127009 127845 gene locus_tag LOCUS_01070 gene metF 127009 127845 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ87 protein_id gnl|my_center|LOCUS_01070 127868 128599 gene locus_tag LOCUS_01080 127868 128599 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_01080 129718 131988 gene locus_tag LOCUS_01090 gene maeB 129718 131988 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_01090 132076 133317 gene locus_tag LOCUS_01100 gene cca 132076 133317 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ91 protein_id gnl|my_center|LOCUS_01100 133990 134181 gene locus_tag LOCUS_01110 133990 134181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 134181 135767 gene locus_tag LOCUS_01120 gene cydA 134181 135767 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 protein_id gnl|my_center|LOCUS_01120 135764 136909 gene locus_tag LOCUS_01130 gene cydB 135764 136909 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_01130 137036 137332 gene locus_tag LOCUS_01140 137036 137332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_01140 137898 137350 gene locus_tag LOCUS_01150 137898 137350 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_01150 138629 137979 gene locus_tag LOCUS_01160 138629 137979 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_01160 139431 138835 gene locus_tag LOCUS_01170 139431 138835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121011.1 protein_id gnl|my_center|LOCUS_01170 140746 139625 gene locus_tag LOCUS_01180 gene ftsY 140746 139625 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT1 protein_id gnl|my_center|LOCUS_01180 140931 142316 gene locus_tag LOCUS_01190 140931 142316 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_01190 142331 143821 gene locus_tag LOCUS_01200 142331 143821 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_01200 144153 143818 gene locus_tag LOCUS_01210 144153 143818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 144625 144266 gene locus_tag LOCUS_01220 144625 144266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120892.1 protein_id gnl|my_center|LOCUS_01220 144847 145080 gene locus_tag LOCUS_01230 144847 145080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121063.1 protein_id gnl|my_center|LOCUS_01230 145716 146147 gene locus_tag LOCUS_01240 145716 146147 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_01240 147475 146288 gene locus_tag LOCUS_01250 147475 146288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_01250 148339 147488 gene locus_tag LOCUS_01260 148339 147488 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_01260 148747 148361 gene locus_tag LOCUS_01270 148747 148361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113949.1 protein_id gnl|my_center|LOCUS_01270 149045 148740 gene locus_tag LOCUS_01280 149045 148740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113722.1 protein_id gnl|my_center|LOCUS_01280 150276 149134 gene locus_tag LOCUS_01290 gene rnd 150276 149134 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_01290 151115 150519 gene locus_tag LOCUS_01300 gene recR 151115 150519 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN26 protein_id gnl|my_center|LOCUS_01300 151458 151129 gene locus_tag LOCUS_01310 151458 151129 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_01310 152683 151493 gene locus_tag LOCUS_01320 gene metZ 152683 151493 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN23 protein_id gnl|my_center|LOCUS_01320 152818 153921 gene locus_tag LOCUS_01330 gene phaC1 152818 153921 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206656.1 protein_id gnl|my_center|LOCUS_01330 153925 154797 gene locus_tag LOCUS_01340 153925 154797 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_01340 154884 155153 gene locus_tag LOCUS_01350 154884 155153 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206654.1 protein_id gnl|my_center|LOCUS_01350 155179 155592 gene locus_tag LOCUS_01360 155179 155592 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_01360 155840 156943 gene locus_tag LOCUS_01370 gene porB 155840 156943 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_01370 157616 156987 gene locus_tag LOCUS_01380 157616 156987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 protein_id gnl|my_center|LOCUS_01380 158184 157723 gene locus_tag LOCUS_01390 158184 157723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206651.1 protein_id gnl|my_center|LOCUS_01390 158244 159086 gene locus_tag LOCUS_01400 158244 159086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 protein_id gnl|my_center|LOCUS_01400 160260 159121 gene locus_tag LOCUS_01410 gene lpxB 160260 159121 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN14 protein_id gnl|my_center|LOCUS_01410 160509 162677 gene locus_tag LOCUS_01420 gene fpvA1 160509 162677 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_01420 163036 164598 gene locus_tag LOCUS_01430 163036 164598 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206646.1 protein_id gnl|my_center|LOCUS_01430 164972 164787 gene locus_tag LOCUS_01440 164972 164787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 165028 165903 gene locus_tag LOCUS_01450 165028 165903 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN08 protein_id gnl|my_center|LOCUS_01450 166026 167117 gene locus_tag LOCUS_01460 gene aroF 166026 167117 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_01460 168705 167176 gene locus_tag LOCUS_01470 gene yoaE 168705 167176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 protein_id gnl|my_center|LOCUS_01470 169316 169780 gene locus_tag LOCUS_01480 169316 169780 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 protein_id gnl|my_center|LOCUS_01480 170445 169777 gene locus_tag LOCUS_01490 170445 169777 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206617.1 protein_id gnl|my_center|LOCUS_01490 172953 170791 gene locus_tag LOCUS_01500 gene glcB 172953 170791 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV4 protein_id gnl|my_center|LOCUS_01500 174446 173304 gene locus_tag LOCUS_01510 gene yhcM 174446 173304 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV3 protein_id gnl|my_center|LOCUS_01510 175522 174536 gene locus_tag LOCUS_01520 175522 174536 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206604.1 protein_id gnl|my_center|LOCUS_01520 175701 177212 gene locus_tag LOCUS_01530 175701 177212 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206603.1 protein_id gnl|my_center|LOCUS_01530 177292 178167 gene locus_tag LOCUS_01540 177292 178167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 protein_id gnl|my_center|LOCUS_01540 178847 178164 gene locus_tag LOCUS_01550 gene pyrF 178847 178164 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_01550 179508 178960 gene locus_tag LOCUS_01560 gene ydcN 179508 178960 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117406.1 protein_id gnl|my_center|LOCUS_01560 179597 180247 gene locus_tag LOCUS_01570 179597 180247 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099346.1 protein_id gnl|my_center|LOCUS_01570 180249 180575 gene locus_tag LOCUS_01580 180249 180575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117414.1 protein_id gnl|my_center|LOCUS_01580 181014 180649 gene locus_tag LOCUS_01590 181014 180649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121360.1 protein_id gnl|my_center|LOCUS_01590 181348 181043 gene locus_tag LOCUS_01600 gene himD 181348 181043 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_01600 183179 181506 gene locus_tag LOCUS_01610 gene rpsA 183179 181506 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD7 protein_id gnl|my_center|LOCUS_01610 183975 183292 gene locus_tag LOCUS_01620 gene cmk 183975 183292 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD6 protein_id gnl|my_center|LOCUS_01620 184420 183986 gene locus_tag LOCUS_01630 184420 183986 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 protein_id gnl|my_center|LOCUS_01630 185046 184522 gene locus_tag LOCUS_01640 gene yfhC 185046 184522 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_01640 186173 185052 gene locus_tag LOCUS_01650 gene hibch 186173 185052 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206599.1 protein_id gnl|my_center|LOCUS_01650 186883 186170 gene locus_tag LOCUS_01660 gene ung 186883 186170 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_01660 187533 186937 gene locus_tag LOCUS_01670 187533 186937 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_01670 188660 187692 gene locus_tag LOCUS_01680 gene xcpX 188660 187692 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_01680 189301 188675 gene locus_tag LOCUS_01690 gene xcpW 189301 188675 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_01690 189684 189298 gene locus_tag LOCUS_01700 gene xcpV 189684 189298 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121425.1 protein_id gnl|my_center|LOCUS_01700 190222 189674 gene locus_tag LOCUS_01710 190222 189674 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206596.1 protein_id gnl|my_center|LOCUS_01710 190849 190235 gene locus_tag LOCUS_01720 190849 190235 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_01720 191656 190883 gene locus_tag LOCUS_01730 gene ycfH 191656 190883 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_01730 192018 191674 gene locus_tag LOCUS_01740 gene pilZ 192018 191674 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_01740 193013 192021 gene locus_tag LOCUS_01750 gene holB 193013 192021 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 protein_id gnl|my_center|LOCUS_01750 193784 193023 gene locus_tag LOCUS_01760 gene kdsB 193784 193023 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC2 protein_id gnl|my_center|LOCUS_01760 194804 193794 gene locus_tag LOCUS_01770 gene lpxK 194804 193794 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC1 protein_id gnl|my_center|LOCUS_01770 196535 194811 gene locus_tag LOCUS_01780 gene msbA 196535 194811 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC0 protein_id gnl|my_center|LOCUS_01780 197750 196860 gene locus_tag LOCUS_01790 gene spoOJ 197750 196860 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206589.1 protein_id gnl|my_center|LOCUS_01790 198529 197747 gene locus_tag LOCUS_01800 gene soj 198529 197747 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_01800 199181 198543 gene locus_tag LOCUS_01810 gene gidB 199181 198543 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB5 protein_id gnl|my_center|LOCUS_01810 199955 199266 gene locus_tag LOCUS_01820 gene mpg1 199955 199266 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_01820 200968 199952 gene locus_tag LOCUS_01830 200968 199952 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 protein_id gnl|my_center|LOCUS_01830 201089 203539 gene locus_tag LOCUS_01840 gene lptD 201089 203539 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB2 protein_id gnl|my_center|LOCUS_01840 203539 204879 gene locus_tag LOCUS_01850 gene surA 203539 204879 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB1 protein_id gnl|my_center|LOCUS_01850 205560 205057 gene locus_tag LOCUS_01860 205560 205057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 206595 205651 gene locus_tag LOCUS_01870 gene miaA 206595 205651 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH83 protein_id gnl|my_center|LOCUS_01870 208563 206602 gene locus_tag LOCUS_01880 gene mutL 208563 206602 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH84 protein_id gnl|my_center|LOCUS_01880 209032 208565 gene locus_tag LOCUS_01890 209032 208565 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_01890 209197 210081 gene locus_tag LOCUS_01900 209197 210081 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207101.1 protein_id gnl|my_center|LOCUS_01900 210191 210520 gene locus_tag LOCUS_01910 210191 210520 CDS product RelB/DinJ family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068595.1 protein_id gnl|my_center|LOCUS_01910 210614 211057 gene locus_tag LOCUS_01920 210614 211057 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122286.1 protein_id gnl|my_center|LOCUS_01920 211757 211050 gene locus_tag LOCUS_01930 gene rsuA 211757 211050 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH89 protein_id gnl|my_center|LOCUS_01930 211821 212208 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtgcggcagttaag 212448 212903 gene locus_tag LOCUS_01940 212448 212903 CDS product UPF0756 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHP9 protein_id gnl|my_center|LOCUS_01940 214043 213123 gene locus_tag LOCUS_01950 gene metR 214043 213123 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 protein_id gnl|my_center|LOCUS_01950 214692 214453 gene locus_tag LOCUS_01960 214692 214453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 214577 215788 gene locus_tag LOCUS_01970 gene ydhP 214577 215788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207106.1 protein_id gnl|my_center|LOCUS_01970 216804 215857 gene locus_tag LOCUS_01980 216804 215857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_01980 217733 216882 gene locus_tag LOCUS_01990 217733 216882 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072539.1 protein_id gnl|my_center|LOCUS_01990 219108 217858 gene locus_tag LOCUS_02000 219108 217858 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EKY3 protein_id gnl|my_center|LOCUS_02000 220683 219700 gene locus_tag LOCUS_02010 gene kcnb2 220683 219700 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_02010 221166 220819 gene locus_tag LOCUS_02020 221166 220819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 221427 222365 gene locus_tag LOCUS_02030 gene rbsK 221427 222365 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHS4 protein_id gnl|my_center|LOCUS_02030 222837 222505 gene locus_tag LOCUS_02040 222837 222505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 222968 223378 gene locus_tag LOCUS_02050 222968 223378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 226073 223434 gene locus_tag LOCUS_02060 gene acnB 226073 223434 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHQ6 protein_id gnl|my_center|LOCUS_02060 226331 226474 gene locus_tag LOCUS_02070 226331 226474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 226952 226434 gene locus_tag LOCUS_02080 226952 226434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 227460 227101 gene locus_tag LOCUS_02090 227460 227101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073636.1 protein_id gnl|my_center|LOCUS_02090 227961 227566 gene locus_tag LOCUS_02100 227961 227566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 228216 230624 gene locus_tag LOCUS_02110 gene copA 228216 230624 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 protein_id gnl|my_center|LOCUS_02110 230624 230836 gene locus_tag LOCUS_02120 gene copZ 230624 230836 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_02120 235415 230916 gene locus_tag LOCUS_02130 235415 230916 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207109.1 protein_id gnl|my_center|LOCUS_02130 238133 235440 gene locus_tag LOCUS_02140 gene ytfM 238133 235440 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207110.1 protein_id gnl|my_center|LOCUS_02140 238301 239623 gene locus_tag LOCUS_02150 gene lplT 238301 239623 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 protein_id gnl|my_center|LOCUS_02150 239628 240263 gene locus_tag LOCUS_02160 gene coq7 239628 240263 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_02160 240803 240309 gene locus_tag LOCUS_02170 240803 240309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207112.1 protein_id gnl|my_center|LOCUS_02170 241563 241102 gene locus_tag LOCUS_02180 241563 241102 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207119.1 protein_id gnl|my_center|LOCUS_02180 241900 241520 gene locus_tag LOCUS_02190 gene folB 241900 241520 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHS1 protein_id gnl|my_center|LOCUS_02190 243226 241919 gene locus_tag LOCUS_02200 243226 241919 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_02200 244050 243238 gene locus_tag LOCUS_02210 gene moeB 244050 243238 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_02210 244282 245267 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactaccgcacaggtagcttagaaa 245391 247373 gene locus_tag LOCUS_02220 245391 247373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 249183 247483 gene locus_tag LOCUS_02230 249183 247483 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_02230 249359 251929 gene locus_tag LOCUS_02240 249359 251929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_02240 252953 252183 gene locus_tag LOCUS_02250 252953 252183 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207124.1 protein_id gnl|my_center|LOCUS_02250 254243 253419 gene locus_tag LOCUS_02260 gene hemK 254243 253419 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT0 protein_id gnl|my_center|LOCUS_02260 255331 254243 gene locus_tag LOCUS_02270 gene prfA 255331 254243 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT1 protein_id gnl|my_center|LOCUS_02270 255789 256250 gene locus_tag LOCUS_02280 255789 256250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 protein_id gnl|my_center|LOCUS_02280 256400 257410 gene locus_tag LOCUS_02290 gene yhbW 256400 257410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068512.1 protein_id gnl|my_center|LOCUS_02290 258937 257492 gene locus_tag LOCUS_02300 258937 257492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 259978 259142 gene locus_tag LOCUS_02310 259978 259142 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU2 protein_id gnl|my_center|LOCUS_02310 260136 262514 gene locus_tag LOCUS_02320 gene ppsA 260136 262514 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU3 protein_id gnl|my_center|LOCUS_02320 262583 263344 gene locus_tag LOCUS_02330 262583 263344 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119677.1 protein_id gnl|my_center|LOCUS_02330 263645 264706 gene locus_tag LOCUS_02340 gene cyoA 263645 264706 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU5 protein_id gnl|my_center|LOCUS_02340 264710 266698 gene locus_tag LOCUS_02350 gene cyoB 264710 266698 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068497.1 protein_id gnl|my_center|LOCUS_02350 266703 267323 gene locus_tag LOCUS_02360 gene cyoC 266703 267323 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119759.1 protein_id gnl|my_center|LOCUS_02360 267323 267649 gene locus_tag LOCUS_02370 gene cyoD 267323 267649 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094534.1 protein_id gnl|my_center|LOCUS_02370 267660 268538 gene locus_tag LOCUS_02380 gene cyoE 267660 268538 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU9 protein_id gnl|my_center|LOCUS_02380 268716 269102 gene locus_tag LOCUS_02390 gene rpsF 268716 269102 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV0 protein_id gnl|my_center|LOCUS_02390 269114 269341 gene locus_tag LOCUS_02400 gene rpsR 269114 269341 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV1 protein_id gnl|my_center|LOCUS_02400 269350 269796 gene locus_tag LOCUS_02410 gene rplI 269350 269796 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_02410 269971 271416 gene locus_tag LOCUS_02420 gene dnaB 269971 271416 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV3 protein_id gnl|my_center|LOCUS_02420 271447 272523 gene locus_tag LOCUS_02430 gene alr 271447 272523 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV4 protein_id gnl|my_center|LOCUS_02430 273355 272606 gene locus_tag LOCUS_02440 273355 272606 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207137.1 protein_id gnl|my_center|LOCUS_02440 274135 273356 gene locus_tag LOCUS_02450 274135 273356 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_02450 274734 274132 gene locus_tag LOCUS_02460 274734 274132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207139.1 protein_id gnl|my_center|LOCUS_02460 276313 274763 gene locus_tag LOCUS_02470 276313 274763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207140.1 protein_id gnl|my_center|LOCUS_02470 276526 277527 gene locus_tag LOCUS_02480 276526 277527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 279770 277890 gene locus_tag LOCUS_02490 gene mnmG 279770 277890 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW1 protein_id gnl|my_center|LOCUS_02490 280009 280239 gene locus_tag LOCUS_02500 280009 280239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859008.1 protein_id gnl|my_center|LOCUS_02500 280382 281293 gene locus_tag LOCUS_02510 gene prmA 280382 281293 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW3 protein_id gnl|my_center|LOCUS_02510 281311 281859 gene locus_tag LOCUS_02520 281311 281859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 282532 282801 gene locus_tag LOCUS_02530 gene fis 282532 282801 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000816.1 protein_id gnl|my_center|LOCUS_02530 282883 284457 gene locus_tag LOCUS_02540 gene purH 282883 284457 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_02540 284593 285876 gene locus_tag LOCUS_02550 gene purD 284593 285876 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW7 protein_id gnl|my_center|LOCUS_02550 286163 287029 gene locus_tag LOCUS_02560 gene yhcJ 286163 287029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207147.1 protein_id gnl|my_center|LOCUS_02560 287103 288128 gene locus_tag LOCUS_02570 gene metN2 287103 288128 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW9 protein_id gnl|my_center|LOCUS_02570 288125 288820 gene locus_tag LOCUS_02580 gene metN 288125 288820 CDS product methionine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207148.1 protein_id gnl|my_center|LOCUS_02580 288954 289685 gene locus_tag LOCUS_02590 gene gloB 288954 289685 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHX1 protein_id gnl|my_center|LOCUS_02590 290006 290209 gene locus_tag LOCUS_02600 290006 290209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119766.1 protein_id gnl|my_center|LOCUS_02600 291509 290628 gene locus_tag LOCUS_02610 gene ubiA 291509 290628 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ7 protein_id gnl|my_center|LOCUS_02610 292021 291518 gene locus_tag LOCUS_02620 gene ubiC 292021 291518 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ8 protein_id gnl|my_center|LOCUS_02620 293905 292496 gene locus_tag LOCUS_02630 gene glnA 293905 292496 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ9 protein_id gnl|my_center|LOCUS_02630 294534 295043 gene locus_tag LOCUS_02640 294534 295043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 295249 295833 gene locus_tag LOCUS_02650 gene trpG 295249 295833 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207264.1 protein_id gnl|my_center|LOCUS_02650 295834 296883 gene locus_tag LOCUS_02660 gene trpD 295834 296883 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR5 protein_id gnl|my_center|LOCUS_02660 296894 297700 gene locus_tag LOCUS_02670 gene trpC 296894 297700 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR6 protein_id gnl|my_center|LOCUS_02670 298223 297738 gene locus_tag LOCUS_02680 298223 297738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 298285 298989 gene locus_tag LOCUS_02690 298285 298989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_02690 300001 299000 gene locus_tag LOCUS_02700 gene xdhC 300001 299000 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207269.1 protein_id gnl|my_center|LOCUS_02700 302397 300016 gene locus_tag LOCUS_02710 gene xdhB 302397 300016 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207270.1 protein_id gnl|my_center|LOCUS_02710 303895 302399 gene locus_tag LOCUS_02720 gene xdhA 303895 302399 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207271.1 protein_id gnl|my_center|LOCUS_02720 304252 304845 gene locus_tag LOCUS_02730 gene folE 304252 304845 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS1 protein_id gnl|my_center|LOCUS_02730 304949 305500 gene locus_tag LOCUS_02740 gene dedA 304949 305500 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_02740 305686 306897 gene locus_tag LOCUS_02750 305686 306897 CDS product arabinose transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706177.1 protein_id gnl|my_center|LOCUS_02750 307731 306925 gene locus_tag LOCUS_02760 307731 306925 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207274.1 protein_id gnl|my_center|LOCUS_02760 308812 307736 gene locus_tag LOCUS_02770 gene hemE 308812 307736 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS6 protein_id gnl|my_center|LOCUS_02770 309014 310393 gene locus_tag LOCUS_02780 309014 310393 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 protein_id gnl|my_center|LOCUS_02780 310625 311314 gene locus_tag LOCUS_02790 310625 311314 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207293.1 protein_id gnl|my_center|LOCUS_02790 314596 311360 gene locus_tag LOCUS_02800 314596 311360 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_02800 315055 315372 gene locus_tag LOCUS_02810 315055 315372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 315483 316649 gene locus_tag LOCUS_02820 315483 316649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 316646 317530 gene locus_tag LOCUS_02830 316646 317530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 317560 318621 gene locus_tag LOCUS_02840 317560 318621 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_02840 318624 319235 gene locus_tag LOCUS_02850 318624 319235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 319247 320200 gene locus_tag LOCUS_02860 gene cas1 319247 320200 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHN1 protein_id gnl|my_center|LOCUS_02860 320298 320805 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcgtcatcgcatagatgatttagaaa >Feature sequence02 1744 2541 gene locus_tag LOCUS_02870 gene tpiA 1744 2541 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB0 protein_id gnl|my_center|LOCUS_02870 2551 2880 gene locus_tag LOCUS_02880 gene secG 2551 2880 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_02880 2937 3021 gene locus_tag LOCUS_t00040 2937 3021 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3517 3593 gene locus_tag LOCUS_t00050 3517 3593 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3796 4320 gene locus_tag LOCUS_02890 gene rimP 3796 4320 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB2 protein_id gnl|my_center|LOCUS_02890 4356 5840 gene locus_tag LOCUS_02900 gene nusA 4356 5840 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB3 protein_id gnl|my_center|LOCUS_02900 5851 8550 gene locus_tag LOCUS_02910 gene infB 5851 8550 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB4 protein_id gnl|my_center|LOCUS_02910 8550 8951 gene locus_tag LOCUS_02920 gene rbfA 8550 8951 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB5 protein_id gnl|my_center|LOCUS_02920 9413 8997 gene locus_tag LOCUS_02930 gene phaG 9413 8997 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 protein_id gnl|my_center|LOCUS_02930 9698 9423 gene locus_tag LOCUS_02940 9698 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 10222 9695 gene locus_tag LOCUS_02950 gene phaE 10222 9695 CDS product pesticidal protein Cry1Ba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208230.1 protein_id gnl|my_center|LOCUS_02950 12033 10225 gene locus_tag LOCUS_02960 gene phaD 12033 10225 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208231.1 protein_id gnl|my_center|LOCUS_02960 12401 12033 gene locus_tag LOCUS_02970 gene phaC 12401 12033 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115033.1 protein_id gnl|my_center|LOCUS_02970 15247 12398 gene locus_tag LOCUS_02980 gene phaAB 15247 12398 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208232.1 protein_id gnl|my_center|LOCUS_02980 16942 15575 gene locus_tag LOCUS_02990 16942 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 18457 16955 gene locus_tag LOCUS_03000 gene fbh1 18457 16955 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC4 protein_id gnl|my_center|LOCUS_03000 19240 18467 gene locus_tag LOCUS_03010 gene hisI 19240 18467 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC5 protein_id gnl|my_center|LOCUS_03010 20680 19409 gene locus_tag LOCUS_03020 20680 19409 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208237.1 protein_id gnl|my_center|LOCUS_03020 22358 20739 gene locus_tag LOCUS_03030 gene ubiB 22358 20739 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208238.1 protein_id gnl|my_center|LOCUS_03030 23037 22372 gene locus_tag LOCUS_03040 23037 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208239.1 protein_id gnl|my_center|LOCUS_03040 23994 23050 gene locus_tag LOCUS_03050 gene ubiE 23994 23050 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD0 protein_id gnl|my_center|LOCUS_03050 24865 24152 gene locus_tag LOCUS_03060 24865 24152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208240.1 protein_id gnl|my_center|LOCUS_03060 25855 26436 gene locus_tag LOCUS_03070 25855 26436 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 protein_id gnl|my_center|LOCUS_03070 26460 27167 gene locus_tag LOCUS_03080 26460 27167 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 protein_id gnl|my_center|LOCUS_03080 27195 29747 gene locus_tag LOCUS_03090 gene mrkC 27195 29747 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 protein_id gnl|my_center|LOCUS_03090 29748 30797 gene locus_tag LOCUS_03100 29748 30797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 31741 33165 gene locus_tag LOCUS_03110 31741 33165 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_03110 34549 33230 gene locus_tag LOCUS_03120 gene citA 34549 33230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208455.1 protein_id gnl|my_center|LOCUS_03120 35242 34739 gene locus_tag LOCUS_03130 35242 34739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 protein_id gnl|my_center|LOCUS_03130 35407 39072 gene locus_tag LOCUS_03140 gene recC 35407 39072 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD4 protein_id gnl|my_center|LOCUS_03140 39079 42783 gene locus_tag LOCUS_03150 gene recB 39079 42783 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD6 protein_id gnl|my_center|LOCUS_03150 42879 44657 gene locus_tag LOCUS_03160 gene recD 42879 44657 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD7 protein_id gnl|my_center|LOCUS_03160 46497 45199 gene locus_tag LOCUS_03170 gene yfeW 46497 45199 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_03170 46777 47046 gene locus_tag LOCUS_03180 gene rpsO 46777 47046 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_03180 47299 49392 gene locus_tag LOCUS_03190 gene pnp 47299 49392 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE0 protein_id gnl|my_center|LOCUS_03190 49742 50965 gene locus_tag LOCUS_03200 gene corA 49742 50965 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_03200 51153 51533 gene locus_tag LOCUS_03210 gene crcB 51153 51533 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG6 protein_id gnl|my_center|LOCUS_03210 51964 51641 gene locus_tag LOCUS_03220 51964 51641 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 protein_id gnl|my_center|LOCUS_03220 52917 51976 gene locus_tag LOCUS_03230 gene cbpA 52917 51976 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_03230 53995 53120 gene locus_tag LOCUS_03240 gene hslO 53995 53120 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE5 protein_id gnl|my_center|LOCUS_03240 55890 54046 gene locus_tag LOCUS_03250 gene kefB 55890 54046 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_03250 58195 55964 gene locus_tag LOCUS_03260 gene priA 58195 55964 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE7 protein_id gnl|my_center|LOCUS_03260 58335 59540 gene locus_tag LOCUS_03270 gene xcpS 58335 59540 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_03270 59564 60052 gene locus_tag LOCUS_03280 gene xcpT 59564 60052 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208252.1 protein_id gnl|my_center|LOCUS_03280 60316 60654 gene locus_tag LOCUS_03290 60316 60654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 62629 61070 gene locus_tag LOCUS_03300 gene lnt 62629 61070 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF2 protein_id gnl|my_center|LOCUS_03300 63465 62626 gene locus_tag LOCUS_03310 gene corC 63465 62626 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_03310 63652 63909 gene locus_tag LOCUS_03320 gene sirA 63652 63909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053527.1 protein_id gnl|my_center|LOCUS_03320 64790 64002 gene locus_tag LOCUS_03330 gene aroE 64790 64002 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC4 protein_id gnl|my_center|LOCUS_03330 65058 64867 gene locus_tag LOCUS_03340 gene yacG 65058 64867 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG2 protein_id gnl|my_center|LOCUS_03340 65156 65794 gene locus_tag LOCUS_03350 gene trmB 65156 65794 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_03350 65784 66989 gene locus_tag LOCUS_03360 65784 66989 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 protein_id gnl|my_center|LOCUS_03360 67069 67482 gene locus_tag LOCUS_03370 67069 67482 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_03370 67960 67628 gene locus_tag LOCUS_03380 67960 67628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_03380 68475 68227 gene locus_tag LOCUS_03390 gene rpmE2 68475 68227 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG9 protein_id gnl|my_center|LOCUS_03390 69868 68567 gene locus_tag LOCUS_03400 gene adcK4 69868 68567 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_03400 70116 71372 gene locus_tag LOCUS_03410 gene soxC 70116 71372 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208266.1 protein_id gnl|my_center|LOCUS_03410 71412 72662 gene locus_tag LOCUS_03420 gene soxC 71412 72662 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208267.1 protein_id gnl|my_center|LOCUS_03420 74074 72725 gene locus_tag LOCUS_03430 gene norM 74074 72725 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_03430 74564 74103 gene locus_tag LOCUS_03440 74564 74103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_03440 74683 75840 gene locus_tag LOCUS_03450 74683 75840 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_03450 76719 75964 gene locus_tag LOCUS_03460 76719 75964 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208271.1 protein_id gnl|my_center|LOCUS_03460 76847 77743 gene locus_tag LOCUS_03470 gene yhjC 76847 77743 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208272.1 protein_id gnl|my_center|LOCUS_03470 78362 77799 gene locus_tag LOCUS_03480 gene ahpC 78362 77799 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_03480 78648 78573 gene locus_tag LOCUS_t00060 78648 78573 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 80610 78769 gene locus_tag LOCUS_03490 80610 78769 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 protein_id gnl|my_center|LOCUS_03490 84216 80800 gene locus_tag LOCUS_03500 gene rne 84216 80800 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY4 protein_id gnl|my_center|LOCUS_03500 84951 85883 gene locus_tag LOCUS_03510 84951 85883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 85880 86545 gene locus_tag LOCUS_03520 gene ppaX 85880 86545 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 protein_id gnl|my_center|LOCUS_03520 86625 87320 gene locus_tag LOCUS_03530 86625 87320 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114898.1 protein_id gnl|my_center|LOCUS_03530 87372 87977 gene locus_tag LOCUS_03540 gene erd13 87372 87977 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 protein_id gnl|my_center|LOCUS_03540 88698 88024 gene locus_tag LOCUS_03550 88698 88024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_03550 89715 88819 gene locus_tag LOCUS_03560 gene hcaR 89715 88819 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066014.1 protein_id gnl|my_center|LOCUS_03560 90069 91046 gene locus_tag LOCUS_03570 90069 91046 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_03570 91102 92154 gene locus_tag LOCUS_03580 91102 92154 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208279.1 protein_id gnl|my_center|LOCUS_03580 93730 92210 gene locus_tag LOCUS_03590 gene kat 93730 92210 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS5 protein_id gnl|my_center|LOCUS_03590 94324 95970 gene locus_tag LOCUS_03600 94324 95970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195844.1 protein_id gnl|my_center|LOCUS_03600 98318 96024 gene locus_tag LOCUS_03610 gene ptsP 98318 96024 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208281.1 protein_id gnl|my_center|LOCUS_03610 98889 98389 gene locus_tag LOCUS_03620 gene rppH 98889 98389 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLZ5 protein_id gnl|my_center|LOCUS_03620 99074 99724 gene locus_tag LOCUS_03630 99074 99724 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_03630 100656 99727 gene locus_tag LOCUS_03640 100656 99727 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705425.1 protein_id gnl|my_center|LOCUS_03640 100836 101891 gene locus_tag LOCUS_03650 gene vanA 100836 101891 CDS product vanillate O-demethylase oxygenase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207677.1 protein_id gnl|my_center|LOCUS_03650 104196 101998 gene locus_tag LOCUS_03660 104196 101998 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_03660 105237 104356 gene locus_tag LOCUS_03670 gene gltC 105237 104356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 protein_id gnl|my_center|LOCUS_03670 105577 105332 gene locus_tag LOCUS_03680 105577 105332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 105842 107275 gene locus_tag LOCUS_03690 gene leuC 105842 107275 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_03690 107275 107928 gene locus_tag LOCUS_03700 107275 107928 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087925.1 protein_id gnl|my_center|LOCUS_03700 107947 108597 gene locus_tag LOCUS_03710 gene leuD 107947 108597 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_03710 108708 109280 gene locus_tag LOCUS_03720 108708 109280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066026.1 protein_id gnl|my_center|LOCUS_03720 109317 110408 gene locus_tag LOCUS_03730 gene leuB 109317 110408 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_03730 110611 110988 gene locus_tag LOCUS_03740 110611 110988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114916.1 protein_id gnl|my_center|LOCUS_03740 111307 111086 gene locus_tag LOCUS_03750 gene infA 111307 111086 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_03750 111536 112543 gene locus_tag LOCUS_03760 gene rr07 111536 112543 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_03760 113416 112601 gene locus_tag LOCUS_03770 gene truA 113416 112601 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM09 protein_id gnl|my_center|LOCUS_03770 114400 113435 gene locus_tag LOCUS_03780 gene ansA 114400 113435 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208288.1 protein_id gnl|my_center|LOCUS_03780 115602 114448 gene locus_tag LOCUS_03790 115602 114448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 116946 115828 gene locus_tag LOCUS_03800 gene asd 116946 115828 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM13 protein_id gnl|my_center|LOCUS_03800 117127 118248 gene locus_tag LOCUS_03810 117127 118248 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_03810 119084 120388 gene locus_tag LOCUS_03820 gene gltP 119084 120388 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208293.1 protein_id gnl|my_center|LOCUS_03820 121557 120451 gene locus_tag LOCUS_03830 gene lpsB 121557 120451 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_03830 122759 121824 gene locus_tag LOCUS_03840 gene htrB 122759 121824 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_03840 124604 122982 gene locus_tag LOCUS_03850 gene ywrD 124604 122982 CDS product putative gamma-glutamyltransferase YwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05218 protein_id gnl|my_center|LOCUS_03850 125582 124950 gene locus_tag LOCUS_03860 gene yahN 125582 124950 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208296.1 protein_id gnl|my_center|LOCUS_03860 127710 125806 gene locus_tag LOCUS_03870 gene uup 127710 125806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_03870 127745 127990 gene locus_tag LOCUS_03880 127745 127990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 128044 129048 gene locus_tag LOCUS_03890 128044 129048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 129234 129683 gene locus_tag LOCUS_03900 129234 129683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004842579.1 protein_id gnl|my_center|LOCUS_03900 129720 132365 gene locus_tag LOCUS_03910 gene topA 129720 132365 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM24 protein_id gnl|my_center|LOCUS_03910 132586 133158 gene locus_tag LOCUS_03920 132586 133158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208303.1 protein_id gnl|my_center|LOCUS_03920 133276 135228 gene locus_tag LOCUS_03930 gene pcrA 133276 135228 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM27 protein_id gnl|my_center|LOCUS_03930 135287 135547 gene locus_tag LOCUS_03940 gene rbpD 135287 135547 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_03940 135540 135911 gene locus_tag LOCUS_03950 135540 135911 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208305.1 protein_id gnl|my_center|LOCUS_03950 136030 136533 gene locus_tag LOCUS_03960 136030 136533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_03960 136646 136924 gene locus_tag LOCUS_03970 136646 136924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114792.1 protein_id gnl|my_center|LOCUS_03970 138704 136986 gene locus_tag LOCUS_03980 gene ybaL 138704 136986 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079171.1 protein_id gnl|my_center|LOCUS_03980 139000 138845 gene locus_tag LOCUS_03990 gene rpmG 139000 138845 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_03990 139249 139013 gene locus_tag LOCUS_04000 gene rpmB 139249 139013 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM34 protein_id gnl|my_center|LOCUS_04000 140864 139416 gene locus_tag LOCUS_04010 gene calB 140864 139416 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM35 protein_id gnl|my_center|LOCUS_04010 140984 141673 gene locus_tag LOCUS_04020 140984 141673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 141758 142624 gene locus_tag LOCUS_04030 gene purU1 141758 142624 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM37 protein_id gnl|my_center|LOCUS_04030 142934 143716 gene locus_tag LOCUS_04040 gene tonB 142934 143716 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208308.1 protein_id gnl|my_center|LOCUS_04040 143736 144359 gene locus_tag LOCUS_04050 gene exbB 143736 144359 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_04050 144359 144763 gene locus_tag LOCUS_04060 gene exbD 144359 144763 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_04060 145341 144820 gene locus_tag LOCUS_04070 gene msrA 145341 144820 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_04070 145937 145440 gene locus_tag LOCUS_04080 145937 145440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 147149 146091 gene locus_tag LOCUS_04090 147149 146091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_04090 147685 147176 gene locus_tag LOCUS_04100 gene folA 147685 147176 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM43 protein_id gnl|my_center|LOCUS_04100 148540 147698 gene locus_tag LOCUS_04110 gene thyA 148540 147698 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM44 protein_id gnl|my_center|LOCUS_04110 149019 148651 gene locus_tag LOCUS_04120 149019 148651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 149398 149012 gene locus_tag LOCUS_04130 149398 149012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115133.1 protein_id gnl|my_center|LOCUS_04130 150374 149553 gene locus_tag LOCUS_04140 gene lgt 150374 149553 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM47 protein_id gnl|my_center|LOCUS_04140 150467 151243 gene locus_tag LOCUS_04150 150467 151243 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 protein_id gnl|my_center|LOCUS_04150 153277 151292 gene locus_tag LOCUS_04160 153277 151292 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208316.1 protein_id gnl|my_center|LOCUS_04160 154216 153455 gene locus_tag LOCUS_04170 gene tatC 154216 153455 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_04170 154671 154213 gene locus_tag LOCUS_04180 gene tatB 154671 154213 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM52 protein_id gnl|my_center|LOCUS_04180 154905 154684 gene locus_tag LOCUS_04190 gene tatA 154905 154684 CDS product sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM53 protein_id gnl|my_center|LOCUS_04190 155057 155935 gene locus_tag LOCUS_04200 155057 155935 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_04200 156848 156216 gene locus_tag LOCUS_04210 156848 156216 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM55 protein_id gnl|my_center|LOCUS_04210 157509 156922 gene locus_tag LOCUS_04220 157509 156922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_04220 158099 157506 gene locus_tag LOCUS_04230 gene metW 158099 157506 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_04230 159262 158099 gene locus_tag LOCUS_04240 gene metX 159262 158099 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_04240 161045 159348 gene locus_tag LOCUS_04250 gene leuA 161045 159348 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM59 protein_id gnl|my_center|LOCUS_04250 162179 161496 gene locus_tag LOCUS_04260 gene piuC 162179 161496 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM60 protein_id gnl|my_center|LOCUS_04260 164486 162291 gene locus_tag LOCUS_04270 gene bfrD 164486 162291 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208321.1 protein_id gnl|my_center|LOCUS_04270 164847 166181 gene locus_tag LOCUS_04280 gene tig 164847 166181 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM1 protein_id gnl|my_center|LOCUS_04280 166374 166979 gene locus_tag LOCUS_04290 gene clpP 166374 166979 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM2 protein_id gnl|my_center|LOCUS_04290 167008 168318 gene locus_tag LOCUS_04300 gene clpX 167008 168318 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_04300 168465 169178 gene locus_tag LOCUS_04310 168465 169178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208323.1 protein_id gnl|my_center|LOCUS_04310 169802 169239 gene locus_tag LOCUS_04320 169802 169239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794750.1 protein_id gnl|my_center|LOCUS_04320 171476 169950 gene locus_tag LOCUS_04330 gene fumA 171476 169950 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM6 protein_id gnl|my_center|LOCUS_04330 171632 172246 gene locus_tag LOCUS_04340 171632 172246 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_04340 174477 172315 gene locus_tag LOCUS_04350 gene pta 174477 172315 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM7 protein_id gnl|my_center|LOCUS_04350 175726 174521 gene locus_tag LOCUS_04360 gene ackA 175726 174521 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM8 protein_id gnl|my_center|LOCUS_04360 177214 179061 gene locus_tag LOCUS_04370 gene edd 177214 179061 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208327.1 protein_id gnl|my_center|LOCUS_04370 179095 179724 gene locus_tag LOCUS_04380 gene eda 179095 179724 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208328.1 protein_id gnl|my_center|LOCUS_04380 179888 181246 gene locus_tag LOCUS_04390 gene gntT 179888 181246 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115035.1 protein_id gnl|my_center|LOCUS_04390 181263 181775 gene locus_tag LOCUS_04400 gene idnK 181263 181775 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN3 protein_id gnl|my_center|LOCUS_04400 181928 183553 gene locus_tag LOCUS_04410 gene gapN 181928 183553 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208330.1 protein_id gnl|my_center|LOCUS_04410 184944 183679 gene locus_tag LOCUS_04420 gene proA 184944 183679 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_04420 185237 186571 gene locus_tag LOCUS_04430 185237 186571 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208332.1 protein_id gnl|my_center|LOCUS_04430 187446 186601 gene locus_tag LOCUS_04440 187446 186601 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208333.1 protein_id gnl|my_center|LOCUS_04440 188585 187566 gene locus_tag LOCUS_04450 gene nagZ 188585 187566 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_04450 188822 191005 gene locus_tag LOCUS_04460 gene prc 188822 191005 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 protein_id gnl|my_center|LOCUS_04460 191188 192477 gene locus_tag LOCUS_04470 191188 192477 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208336.1 protein_id gnl|my_center|LOCUS_04470 192509 193063 gene locus_tag LOCUS_04480 gene pgpB 192509 193063 CDS product phosphatidylglycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_04480 193135 193335 gene locus_tag LOCUS_04490 193135 193335 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_04490 193446 193877 gene locus_tag LOCUS_04500 gene ndk 193446 193877 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_04500 194000 195244 gene locus_tag LOCUS_04510 gene rlmN 194000 195244 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_04510 195323 196063 gene locus_tag LOCUS_04520 gene pilF 195323 196063 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_04520 196054 196836 gene locus_tag LOCUS_04530 196054 196836 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208339.1 protein_id gnl|my_center|LOCUS_04530 196860 197975 gene locus_tag LOCUS_04540 gene ispG 196860 197975 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP7 protein_id gnl|my_center|LOCUS_04540 197972 199264 gene locus_tag LOCUS_04550 gene hisS 197972 199264 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP9 protein_id gnl|my_center|LOCUS_04550 199296 199997 gene locus_tag LOCUS_04560 199296 199997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208343.1 protein_id gnl|my_center|LOCUS_04560 199997 201151 gene locus_tag LOCUS_04570 gene ire-1 199997 201151 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ1 protein_id gnl|my_center|LOCUS_04570 201313 202749 gene locus_tag LOCUS_04580 gene engA 201313 202749 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_04580 202929 203546 gene locus_tag LOCUS_04590 202929 203546 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208346.1 protein_id gnl|my_center|LOCUS_04590 203534 204331 gene locus_tag LOCUS_04600 gene acl-2 203534 204331 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208347.1 protein_id gnl|my_center|LOCUS_04600 204328 204588 gene locus_tag LOCUS_04610 204328 204588 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067033.1 protein_id gnl|my_center|LOCUS_04610 204598 204843 gene locus_tag LOCUS_04620 gene acpP 204598 204843 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ6 protein_id gnl|my_center|LOCUS_04620 204843 205409 gene locus_tag LOCUS_04630 204843 205409 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208348.1 protein_id gnl|my_center|LOCUS_04630 205387 207069 gene locus_tag LOCUS_04640 gene vraA 205387 207069 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208349.1 protein_id gnl|my_center|LOCUS_04640 207066 207803 gene locus_tag LOCUS_04650 207066 207803 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208350.1 protein_id gnl|my_center|LOCUS_04650 207806 208729 gene locus_tag LOCUS_04660 207806 208729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 208731 210314 gene locus_tag LOCUS_04670 gene hutH 208731 210314 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208352.1 protein_id gnl|my_center|LOCUS_04670 210304 210744 gene locus_tag LOCUS_04680 210304 210744 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208353.1 protein_id gnl|my_center|LOCUS_04680 210738 211397 gene locus_tag LOCUS_04690 210738 211397 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMR3 protein_id gnl|my_center|LOCUS_04690 211366 213696 gene locus_tag LOCUS_04700 211366 213696 CDS product bifunctional glycerol-3-phosphate dehydrogenase/glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208355.1 protein_id gnl|my_center|LOCUS_04700 213718 215028 gene locus_tag LOCUS_04710 213718 215028 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208356.1 protein_id gnl|my_center|LOCUS_04710 215030 215572 gene locus_tag LOCUS_04720 215030 215572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208357.1 protein_id gnl|my_center|LOCUS_04720 215594 216829 gene locus_tag LOCUS_04730 gene oxsM 215594 216829 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208358.1 protein_id gnl|my_center|LOCUS_04730 216826 217269 gene locus_tag LOCUS_04740 216826 217269 CDS product 3-hydroxylacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208359.1 protein_id gnl|my_center|LOCUS_04740 217266 217991 gene locus_tag LOCUS_04750 gene fabG 217266 217991 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208360.1 protein_id gnl|my_center|LOCUS_04750 217991 219214 gene locus_tag LOCUS_04760 gene fabF 217991 219214 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208361.1 protein_id gnl|my_center|LOCUS_04760 219228 219662 gene locus_tag LOCUS_04770 219228 219662 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_04770 219690 220340 gene locus_tag LOCUS_04780 gene ffp 219690 220340 CDS product ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208363.1 protein_id gnl|my_center|LOCUS_04780 220376 220648 gene locus_tag LOCUS_04790 220376 220648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 221677 220712 gene locus_tag LOCUS_04800 gene secF 221677 220712 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY7 protein_id gnl|my_center|LOCUS_04800 223590 221689 gene locus_tag LOCUS_04810 gene secD 223590 221689 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY6 protein_id gnl|my_center|LOCUS_04810 223974 223645 gene locus_tag LOCUS_04820 gene yajC 223974 223645 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_04820 225207 224077 gene locus_tag LOCUS_04830 gene tgt 225207 224077 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY4 protein_id gnl|my_center|LOCUS_04830 226560 225526 gene locus_tag LOCUS_04840 gene queA 226560 225526 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY3 protein_id gnl|my_center|LOCUS_04840 226740 226826 gene locus_tag LOCUS_t00070 226740 226826 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 227248 227637 gene locus_tag LOCUS_04850 227248 227637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 227889 229154 gene locus_tag LOCUS_04860 gene bvgS 227889 229154 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207643.1 protein_id gnl|my_center|LOCUS_04860 229219 231966 gene locus_tag LOCUS_04870 gene glnE 229219 231966 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY1 protein_id gnl|my_center|LOCUS_04870 231993 232919 gene locus_tag LOCUS_04880 gene ilvE 231993 232919 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_04880 232987 233874 gene locus_tag LOCUS_04890 232987 233874 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_04890 233879 234907 gene locus_tag LOCUS_04900 233879 234907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 234904 235659 gene locus_tag LOCUS_04910 gene icaB 234904 235659 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207638.1 protein_id gnl|my_center|LOCUS_04910 235656 236423 gene locus_tag LOCUS_04920 gene lpsC 235656 236423 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207637.1 protein_id gnl|my_center|LOCUS_04920 236435 237469 gene locus_tag LOCUS_04930 gene lpsE 236435 237469 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207636.1 protein_id gnl|my_center|LOCUS_04930 238354 237470 gene locus_tag LOCUS_04940 238354 237470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207635.1 protein_id gnl|my_center|LOCUS_04940 238429 239187 gene locus_tag LOCUS_04950 238429 239187 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207634.1 protein_id gnl|my_center|LOCUS_04950 239277 240116 gene locus_tag LOCUS_04960 239277 240116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 240110 240889 gene locus_tag LOCUS_04970 240110 240889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 241654 240917 gene locus_tag LOCUS_04980 241654 240917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 241931 241713 gene locus_tag LOCUS_04990 241931 241713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207632.1 protein_id gnl|my_center|LOCUS_04990 243858 242080 gene locus_tag LOCUS_05000 gene aspS 243858 242080 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_05000 244784 244008 gene locus_tag LOCUS_05010 244784 244008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207629.1 protein_id gnl|my_center|LOCUS_05010 244936 247017 gene locus_tag LOCUS_05020 244936 247017 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_05020 247251 249308 gene locus_tag LOCUS_05030 247251 249308 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_05030 249451 250914 gene locus_tag LOCUS_05040 249451 250914 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_05040 251594 251148 gene locus_tag LOCUS_05050 251594 251148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_05050 251823 252236 gene locus_tag LOCUS_05060 251823 252236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 252361 252708 gene locus_tag LOCUS_05070 252361 252708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 252940 253377 gene locus_tag LOCUS_05080 252940 253377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 253902 253408 gene locus_tag LOCUS_05090 253902 253408 CDS product protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116490.1 protein_id gnl|my_center|LOCUS_05090 254048 254674 gene locus_tag LOCUS_05100 254048 254674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_05100 256497 254716 gene locus_tag LOCUS_05110 gene acdA 256497 254716 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_05110 258471 256669 gene locus_tag LOCUS_05120 gene acdB 258471 256669 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_05120 259123 258770 gene locus_tag LOCUS_05130 259123 258770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207623.1 protein_id gnl|my_center|LOCUS_05130 259258 260955 gene locus_tag LOCUS_05140 gene baeS 259258 260955 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207622.1 protein_id gnl|my_center|LOCUS_05140 260959 261645 gene locus_tag LOCUS_05150 gene baeR 260959 261645 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116101.1 protein_id gnl|my_center|LOCUS_05150 262146 261745 gene locus_tag LOCUS_05160 262146 261745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207518.1 protein_id gnl|my_center|LOCUS_05160 263773 262301 gene locus_tag LOCUS_05170 263773 262301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 protein_id gnl|my_center|LOCUS_05170 264999 263830 gene locus_tag LOCUS_05180 gene olE1 264999 263830 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_05180 265247 265750 gene locus_tag LOCUS_05190 265247 265750 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207619.1 protein_id gnl|my_center|LOCUS_05190 266495 265779 gene locus_tag LOCUS_05200 gene ugpQ 266495 265779 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_05200 267113 266535 gene locus_tag LOCUS_05210 267113 266535 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 protein_id gnl|my_center|LOCUS_05210 269100 267223 gene locus_tag LOCUS_05220 gene btuB 269100 267223 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 protein_id gnl|my_center|LOCUS_05220 269494 270135 gene locus_tag LOCUS_05230 gene trpF 269494 270135 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU7 protein_id gnl|my_center|LOCUS_05230 270119 271348 gene locus_tag LOCUS_05240 gene trpB 270119 271348 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_05240 271418 271945 gene locus_tag LOCUS_05250 271418 271945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139542.1 protein_id gnl|my_center|LOCUS_05250 272034 273029 gene locus_tag LOCUS_05260 272034 273029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207614.1 protein_id gnl|my_center|LOCUS_05260 273933 273058 gene locus_tag LOCUS_05270 273933 273058 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_05270 274047 275084 gene locus_tag LOCUS_05280 274047 275084 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207612.1 protein_id gnl|my_center|LOCUS_05280 275511 276314 gene locus_tag LOCUS_05290 gene trpA 275511 276314 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU1 protein_id gnl|my_center|LOCUS_05290 276311 277207 gene locus_tag LOCUS_05300 gene accD 276311 277207 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU0 protein_id gnl|my_center|LOCUS_05300 277240 278490 gene locus_tag LOCUS_05310 gene folC 277240 278490 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 protein_id gnl|my_center|LOCUS_05310 278481 279476 gene locus_tag LOCUS_05320 gene iga 278481 279476 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 protein_id gnl|my_center|LOCUS_05320 280453 279665 gene locus_tag LOCUS_05330 280453 279665 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207607.1 protein_id gnl|my_center|LOCUS_05330 281265 280624 gene locus_tag LOCUS_05340 281265 280624 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_05340 281607 284324 gene locus_tag LOCUS_05350 gene secA 281607 284324 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNT4 protein_id gnl|my_center|LOCUS_05350 284479 284835 gene locus_tag LOCUS_05360 284479 284835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116535.1 protein_id gnl|my_center|LOCUS_05360 285002 286201 gene locus_tag LOCUS_05370 gene argJ 285002 286201 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_05370 286339 287403 gene locus_tag LOCUS_05380 gene nadA 286339 287403 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_05380 287534 287610 gene locus_tag LOCUS_t00080 287534 287610 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 287671 287747 gene locus_tag LOCUS_t00090 287671 287747 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 287786 287861 gene locus_tag LOCUS_t00100 287786 287861 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 287866 287942 gene locus_tag LOCUS_t00110 287866 287942 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence03 630 85 gene locus_tag LOCUS_05390 630 85 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 protein_id gnl|my_center|LOCUS_05390 1867 869 gene locus_tag LOCUS_05400 1867 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528805.1 protein_id gnl|my_center|LOCUS_05400 2585 2031 gene locus_tag LOCUS_05410 2585 2031 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 2876 4327 gene locus_tag LOCUS_05420 2876 4327 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_05420 4750 6228 gene locus_tag LOCUS_05430 4750 6228 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL7 protein_id gnl|my_center|LOCUS_05430 6240 6383 gene locus_tag LOCUS_05440 6240 6383 CDS product putative methionine/alanine importer small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119126.1 protein_id gnl|my_center|LOCUS_05440 6472 7278 gene locus_tag LOCUS_05450 gene zupT 6472 7278 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1H6 protein_id gnl|my_center|LOCUS_05450 8615 7311 gene locus_tag LOCUS_05460 gene sun 8615 7311 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL5 protein_id gnl|my_center|LOCUS_05460 9571 8612 gene locus_tag LOCUS_05470 gene fmt 9571 8612 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL4 protein_id gnl|my_center|LOCUS_05470 9879 11564 gene locus_tag LOCUS_05480 gene ilvD 9879 11564 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 protein_id gnl|my_center|LOCUS_05480 11636 12937 gene locus_tag LOCUS_05490 11636 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208012.1 protein_id gnl|my_center|LOCUS_05490 13171 14490 gene locus_tag LOCUS_05500 gene ndh 13171 14490 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_05500 14688 15428 gene locus_tag LOCUS_05510 14688 15428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 protein_id gnl|my_center|LOCUS_05510 16330 15425 gene locus_tag LOCUS_05520 gene gltC 16330 15425 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208010.1 protein_id gnl|my_center|LOCUS_05520 17742 16447 gene locus_tag LOCUS_05530 gene ycdG 17742 16447 CDS product pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 protein_id gnl|my_center|LOCUS_05530 20705 18021 gene locus_tag LOCUS_05540 gene ppc 20705 18021 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 protein_id gnl|my_center|LOCUS_05540 21491 20877 gene locus_tag LOCUS_05550 21491 20877 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119184.1 protein_id gnl|my_center|LOCUS_05550 21645 22754 gene locus_tag LOCUS_05560 gene mdtA 21645 22754 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 protein_id gnl|my_center|LOCUS_05560 22751 25879 gene locus_tag LOCUS_05570 gene nolG 22751 25879 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_05570 26012 26389 gene locus_tag LOCUS_05580 26012 26389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119294.1 protein_id gnl|my_center|LOCUS_05580 26494 27600 gene locus_tag LOCUS_05590 gene dnaJ 26494 27600 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI50 protein_id gnl|my_center|LOCUS_05590 27720 28541 gene locus_tag LOCUS_05600 gene dapB 27720 28541 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_05600 28748 29398 gene locus_tag LOCUS_05610 28748 29398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066572.1 protein_id gnl|my_center|LOCUS_05610 30616 29441 gene locus_tag LOCUS_05620 gene ydhP 30616 29441 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066574.1 protein_id gnl|my_center|LOCUS_05620 31434 30628 gene locus_tag LOCUS_05630 31434 30628 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811193.1 protein_id gnl|my_center|LOCUS_05630 31578 32486 gene locus_tag LOCUS_05640 gene yafC 31578 32486 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208002.1 protein_id gnl|my_center|LOCUS_05640 32819 32481 gene locus_tag LOCUS_05650 32819 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 32910 34322 gene locus_tag LOCUS_05660 gene ydcR 32910 34322 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 protein_id gnl|my_center|LOCUS_05660 35387 34365 gene locus_tag LOCUS_05670 gene yjgB 35387 34365 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_05670 35969 35412 gene locus_tag LOCUS_05680 gene tag 35969 35412 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066585.1 protein_id gnl|my_center|LOCUS_05680 36251 36589 gene locus_tag LOCUS_05690 36251 36589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 36831 36586 gene locus_tag LOCUS_05700 36831 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066589.1 protein_id gnl|my_center|LOCUS_05700 37403 36843 gene locus_tag LOCUS_05710 gene lytH 37403 36843 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207998.1 protein_id gnl|my_center|LOCUS_05710 38449 37415 gene locus_tag LOCUS_05720 gene mutY 38449 37415 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 protein_id gnl|my_center|LOCUS_05720 38942 38580 gene locus_tag LOCUS_05730 gene mg132 38942 38580 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207996.1 protein_id gnl|my_center|LOCUS_05730 39742 39002 gene locus_tag LOCUS_05740 39742 39002 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_05740 40094 39936 gene locus_tag LOCUS_05750 40094 39936 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI32 protein_id gnl|my_center|LOCUS_05750 40282 40734 gene locus_tag LOCUS_05760 40282 40734 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_05760 41369 40731 gene locus_tag LOCUS_05770 41369 40731 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_05770 41324 41842 gene locus_tag LOCUS_05780 41324 41842 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206102.1 protein_id gnl|my_center|LOCUS_05780 41973 43145 gene locus_tag LOCUS_05790 gene yliI 41973 43145 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207995.1 protein_id gnl|my_center|LOCUS_05790 43163 44356 gene locus_tag LOCUS_05800 43163 44356 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZC8 protein_id gnl|my_center|LOCUS_05800 44436 45707 gene locus_tag LOCUS_05810 gene rarA 44436 45707 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_05810 46300 48330 gene locus_tag LOCUS_05820 46300 48330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 49188 48334 gene locus_tag LOCUS_05830 gene yfdC 49188 48334 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 protein_id gnl|my_center|LOCUS_05830 50149 49418 gene locus_tag LOCUS_05840 50149 49418 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432251.1 protein_id gnl|my_center|LOCUS_05840 50792 50127 gene locus_tag LOCUS_05850 50792 50127 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105389.1 protein_id gnl|my_center|LOCUS_05850 51460 50792 gene locus_tag LOCUS_05860 51460 50792 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403260.1 protein_id gnl|my_center|LOCUS_05860 52283 51495 gene locus_tag LOCUS_05870 52283 51495 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971581.1 protein_id gnl|my_center|LOCUS_05870 53524 52805 gene locus_tag LOCUS_05880 gene purC 53524 52805 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_05880 54167 53562 gene locus_tag LOCUS_05890 54167 53562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207991.1 protein_id gnl|my_center|LOCUS_05890 55073 54177 gene locus_tag LOCUS_05900 gene dapA 55073 54177 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_05900 55474 56118 gene locus_tag LOCUS_05910 gene pncA 55474 56118 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207990.1 protein_id gnl|my_center|LOCUS_05910 56140 57141 gene locus_tag LOCUS_05920 56140 57141 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_05920 57599 57114 gene locus_tag LOCUS_05930 gene ybbK 57599 57114 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207987.1 protein_id gnl|my_center|LOCUS_05930 57889 57602 gene locus_tag LOCUS_05940 57889 57602 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_05940 58307 57999 gene locus_tag LOCUS_05950 58307 57999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 58743 58315 gene locus_tag LOCUS_05960 58743 58315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05960 59074 58688 gene locus_tag LOCUS_05970 59074 58688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05970 61156 59318 gene locus_tag LOCUS_05980 gene glmS 61156 59318 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ8 protein_id gnl|my_center|LOCUS_05980 62533 61169 gene locus_tag LOCUS_05990 gene glmU 62533 61169 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_05990 63053 62553 gene locus_tag LOCUS_06000 gene pgpA 63053 62553 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ6 protein_id gnl|my_center|LOCUS_06000 63963 63046 gene locus_tag LOCUS_06010 gene thiL 63963 63046 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_06010 64427 63978 gene locus_tag LOCUS_06020 gene nusB 64427 63978 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ4 protein_id gnl|my_center|LOCUS_06020 64901 64431 gene locus_tag LOCUS_06030 gene ribH 64901 64431 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ3 protein_id gnl|my_center|LOCUS_06030 66034 64913 gene locus_tag LOCUS_06040 gene ribB 66034 64913 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_06040 67625 66330 gene locus_tag LOCUS_06050 67625 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207968.1 protein_id gnl|my_center|LOCUS_06050 67703 68923 gene locus_tag LOCUS_06060 gene serB 67703 68923 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207967.1 protein_id gnl|my_center|LOCUS_06060 69342 69677 gene locus_tag LOCUS_06070 69342 69677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119105.1 protein_id gnl|my_center|LOCUS_06070 69832 70317 gene locus_tag LOCUS_06080 69832 70317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119134.1 protein_id gnl|my_center|LOCUS_06080 70794 70354 gene locus_tag LOCUS_06090 gene dtd 70794 70354 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY7 protein_id gnl|my_center|LOCUS_06090 70957 72171 gene locus_tag LOCUS_06100 gene pncB 70957 72171 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY6 protein_id gnl|my_center|LOCUS_06100 72275 73123 gene locus_tag LOCUS_06110 gene rhdA 72275 73123 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY5 protein_id gnl|my_center|LOCUS_06110 73120 73977 gene locus_tag LOCUS_06120 gene psd 73120 73977 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_06120 74550 74047 gene locus_tag LOCUS_06130 74550 74047 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957536.1 protein_id gnl|my_center|LOCUS_06130 76088 74730 gene locus_tag LOCUS_06140 gene phoR 76088 74730 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121907.1 protein_id gnl|my_center|LOCUS_06140 76808 76098 gene locus_tag LOCUS_06150 gene phoB 76808 76098 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_06150 77709 77011 gene locus_tag LOCUS_06160 77709 77011 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_06160 77894 78730 gene locus_tag LOCUS_06170 gene ephD 77894 78730 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_06170 80154 78787 gene locus_tag LOCUS_06180 gene ypnP 80154 78787 CDS product multidrug resistance protein, MATE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804387.1 protein_id gnl|my_center|LOCUS_06180 81415 80261 gene locus_tag LOCUS_06190 gene ybdL 81415 80261 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207957.1 protein_id gnl|my_center|LOCUS_06190 82754 81447 gene locus_tag LOCUS_06200 82754 81447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066720.1 protein_id gnl|my_center|LOCUS_06200 83353 82772 gene locus_tag LOCUS_06210 83353 82772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122008.1 protein_id gnl|my_center|LOCUS_06210 83935 83396 gene locus_tag LOCUS_06220 83935 83396 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_06220 84143 85720 gene locus_tag LOCUS_06230 gene gshA 84143 85720 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG2 protein_id gnl|my_center|LOCUS_06230 85737 86252 gene locus_tag LOCUS_06240 gene dsbB 85737 86252 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_06240 87699 86356 gene locus_tag LOCUS_06250 87699 86356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121854.1 protein_id gnl|my_center|LOCUS_06250 87916 88503 gene locus_tag LOCUS_06260 gene yqiA 87916 88503 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207947.1 protein_id gnl|my_center|LOCUS_06260 88519 90399 gene locus_tag LOCUS_06270 gene parE 88519 90399 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF2 protein_id gnl|my_center|LOCUS_06270 91194 90421 gene locus_tag LOCUS_06280 91194 90421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207885.1 protein_id gnl|my_center|LOCUS_06280 91809 91300 gene locus_tag LOCUS_06290 gene allA 91809 91300 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF1 protein_id gnl|my_center|LOCUS_06290 92829 91825 gene locus_tag LOCUS_06300 gene alc 92829 91825 CDS product putative allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF0 protein_id gnl|my_center|LOCUS_06300 93038 94195 gene locus_tag LOCUS_06310 gene aba2 93038 94195 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_06310 94970 94245 gene locus_tag LOCUS_06320 gene tsx 94970 94245 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_06320 95482 95159 gene locus_tag LOCUS_06330 95482 95159 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHE6 protein_id gnl|my_center|LOCUS_06330 95982 95479 gene locus_tag LOCUS_06340 gene uao 95982 95479 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207943.1 protein_id gnl|my_center|LOCUS_06340 97099 96122 gene locus_tag LOCUS_06350 gene cda1 97099 96122 CDS product chitin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207942.1 protein_id gnl|my_center|LOCUS_06350 97352 97705 gene locus_tag LOCUS_06360 97352 97705 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985299.1 protein_id gnl|my_center|LOCUS_06360 97900 98442 gene locus_tag LOCUS_06370 97900 98442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066773.1 protein_id gnl|my_center|LOCUS_06370 98443 99225 gene locus_tag LOCUS_06380 98443 99225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207941.1 protein_id gnl|my_center|LOCUS_06380 99306 101066 gene locus_tag LOCUS_06390 gene dsbD 99306 101066 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 protein_id gnl|my_center|LOCUS_06390 101910 101080 gene locus_tag LOCUS_06400 101910 101080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 103278 102382 gene locus_tag LOCUS_06410 gene est 103278 102382 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_06410 103450 103887 gene locus_tag LOCUS_06420 103450 103887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_06420 104256 103942 gene locus_tag LOCUS_06430 gene yffB 104256 103942 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_06430 105585 104764 gene locus_tag LOCUS_06440 gene crc 105585 104764 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 protein_id gnl|my_center|LOCUS_06440 105624 106274 gene locus_tag LOCUS_06450 gene pyrE 105624 106274 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_06450 106503 107528 gene locus_tag LOCUS_06460 106503 107528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 protein_id gnl|my_center|LOCUS_06460 107552 108580 gene locus_tag LOCUS_06470 gene metE 107552 108580 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 protein_id gnl|my_center|LOCUS_06470 108769 109272 gene locus_tag LOCUS_06480 gene rutF 108769 109272 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_06480 109531 109319 gene locus_tag LOCUS_06490 109531 109319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122004.1 protein_id gnl|my_center|LOCUS_06490 111408 109801 gene locus_tag LOCUS_06500 111408 109801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 112136 113080 gene locus_tag LOCUS_06510 gene gshB 112136 113080 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_06510 113321 114418 gene locus_tag LOCUS_06520 gene murG 113321 114418 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC8 protein_id gnl|my_center|LOCUS_06520 114432 115880 gene locus_tag LOCUS_06530 gene murC 114432 115880 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_06530 115931 116860 gene locus_tag LOCUS_06540 gene ddlB 115931 116860 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_06540 116863 117717 gene locus_tag LOCUS_06550 gene ftsQ 116863 117717 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC5 protein_id gnl|my_center|LOCUS_06550 117782 119044 gene locus_tag LOCUS_06560 gene ftsA 117782 119044 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC4 protein_id gnl|my_center|LOCUS_06560 119209 120378 gene locus_tag LOCUS_06570 gene ftsZ 119209 120378 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC3 protein_id gnl|my_center|LOCUS_06570 120489 121391 gene locus_tag LOCUS_06580 gene lpxC 120489 121391 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC2 protein_id gnl|my_center|LOCUS_06580 121928 121488 gene locus_tag LOCUS_06590 121928 121488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121887.1 protein_id gnl|my_center|LOCUS_06590 122039 122734 gene locus_tag LOCUS_06600 gene yebA 122039 122734 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121983.1 protein_id gnl|my_center|LOCUS_06600 123003 125717 gene locus_tag LOCUS_06610 gene aceE 123003 125717 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB9 protein_id gnl|my_center|LOCUS_06610 125721 127706 gene locus_tag LOCUS_06620 gene aceF 125721 127706 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB8 protein_id gnl|my_center|LOCUS_06620 128045 128620 gene locus_tag LOCUS_06630 128045 128620 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_06630 128829 129845 gene locus_tag LOCUS_06640 128829 129845 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067939.1 protein_id gnl|my_center|LOCUS_06640 129973 131439 gene locus_tag LOCUS_06650 gene guaB 129973 131439 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB3 protein_id gnl|my_center|LOCUS_06650 131560 132891 gene locus_tag LOCUS_06660 gene glmM 131560 132891 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB2 protein_id gnl|my_center|LOCUS_06660 132907 133563 gene locus_tag LOCUS_06670 gene pdxH 132907 133563 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB1 protein_id gnl|my_center|LOCUS_06670 133564 135270 gene locus_tag LOCUS_06680 gene recJ 133564 135270 CDS product ssDNA exonuclease, 5'--> 3' specific, Mg dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_004997053.1 protein_id gnl|my_center|LOCUS_06680 136091 135318 gene locus_tag LOCUS_06690 136091 135318 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 protein_id gnl|my_center|LOCUS_06690 136705 137637 gene locus_tag LOCUS_06700 gene prfB 136705 137637 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA8 protein_id gnl|my_center|LOCUS_06700 137789 138088 gene locus_tag LOCUS_06710 137789 138088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121891.1 protein_id gnl|my_center|LOCUS_06710 138110 139180 gene locus_tag LOCUS_06720 gene nemA 138110 139180 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207922.1 protein_id gnl|my_center|LOCUS_06720 139740 140162 gene locus_tag LOCUS_06730 139740 140162 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727821.1 protein_id gnl|my_center|LOCUS_06730 140177 140848 gene locus_tag LOCUS_06740 140177 140848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 protein_id gnl|my_center|LOCUS_06740 140885 141871 gene locus_tag LOCUS_06750 140885 141871 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929941.1 protein_id gnl|my_center|LOCUS_06750 141872 143011 gene locus_tag LOCUS_06760 141872 143011 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500E9 protein_id gnl|my_center|LOCUS_06760 143272 144789 gene locus_tag LOCUS_06770 143272 144789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 protein_id gnl|my_center|LOCUS_06770 144990 145829 gene locus_tag LOCUS_06780 144990 145829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 145856 146725 gene locus_tag LOCUS_06790 145856 146725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 147528 146803 gene locus_tag LOCUS_06800 147528 146803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_06800 147693 148556 gene locus_tag LOCUS_06810 147693 148556 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_06810 148624 149784 gene locus_tag LOCUS_06820 148624 149784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_06820 149966 150763 gene locus_tag LOCUS_06830 149966 150763 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_06830 151292 152566 gene locus_tag LOCUS_06840 151292 152566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_06840 153136 154419 gene locus_tag LOCUS_06850 gene kdtA 153136 154419 CDS product 3-deoxy-D-manno-2-octulosonate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207921.1 protein_id gnl|my_center|LOCUS_06850 154416 155123 gene locus_tag LOCUS_06860 154416 155123 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA4 protein_id gnl|my_center|LOCUS_06860 156095 155112 gene locus_tag LOCUS_06870 156095 155112 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_06870 156772 156188 gene locus_tag LOCUS_06880 156772 156188 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066837.1 protein_id gnl|my_center|LOCUS_06880 157063 159024 gene locus_tag LOCUS_06890 gene acsA2 157063 159024 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207919.1 protein_id gnl|my_center|LOCUS_06890 159160 160344 gene locus_tag LOCUS_06900 159160 160344 CDS product FMNH2-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_06900 160909 160370 gene locus_tag LOCUS_06910 gene ywoC 160909 160370 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207917.1 protein_id gnl|my_center|LOCUS_06910 161016 161414 gene locus_tag LOCUS_06920 gene lrpB 161016 161414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207916.1 protein_id gnl|my_center|LOCUS_06920 162624 161506 gene locus_tag LOCUS_06930 gene ssuD 162624 161506 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207915.1 protein_id gnl|my_center|LOCUS_06930 163377 162643 gene locus_tag LOCUS_06940 gene msuE 163377 162643 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207914.1 protein_id gnl|my_center|LOCUS_06940 163752 164402 gene locus_tag LOCUS_06950 gene agmR 163752 164402 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_06950 165242 164475 gene locus_tag LOCUS_06960 165242 164475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207913.1 protein_id gnl|my_center|LOCUS_06960 169114 165617 gene locus_tag LOCUS_06970 gene luxQ 169114 165617 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207912.1 protein_id gnl|my_center|LOCUS_06970 169297 169629 gene locus_tag LOCUS_06980 169297 169629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 protein_id gnl|my_center|LOCUS_06980 169631 171346 gene locus_tag LOCUS_06990 169631 171346 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 protein_id gnl|my_center|LOCUS_06990 171763 171386 gene locus_tag LOCUS_07000 171763 171386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 171961 172653 gene locus_tag LOCUS_07010 171961 172653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_07010 172805 174787 gene locus_tag LOCUS_07020 gene betT 172805 174787 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207909.1 protein_id gnl|my_center|LOCUS_07020 175710 174847 gene locus_tag LOCUS_07030 175710 174847 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207908.1 protein_id gnl|my_center|LOCUS_07030 176767 178509 gene locus_tag LOCUS_07040 gene pleD 176767 178509 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207907.1 protein_id gnl|my_center|LOCUS_07040 179846 178560 gene locus_tag LOCUS_07050 179846 178560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 182710 179879 gene locus_tag LOCUS_07060 gene uvrA 182710 179879 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGS6 protein_id gnl|my_center|LOCUS_07060 183333 182959 gene locus_tag LOCUS_07070 183333 182959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 183564 183863 gene locus_tag LOCUS_07080 gene glpM 183564 183863 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789991.1 protein_id gnl|my_center|LOCUS_07080 184639 183968 gene locus_tag LOCUS_07090 gene thiED 184639 183968 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGR9 protein_id gnl|my_center|LOCUS_07090 184835 185917 gene locus_tag LOCUS_07100 184835 185917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_07100 186055 187419 gene locus_tag LOCUS_07110 gene yajR 186055 187419 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_07110 187472 188050 gene locus_tag LOCUS_07120 187472 188050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 188586 190025 gene locus_tag LOCUS_07130 188586 190025 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 protein_id gnl|my_center|LOCUS_07130 191594 190095 gene locus_tag LOCUS_07140 gene mocR 191594 190095 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_07140 191747 193033 gene locus_tag LOCUS_07150 gene gabT 191747 193033 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207897.1 protein_id gnl|my_center|LOCUS_07150 193039 194487 gene locus_tag LOCUS_07160 gene gabD 193039 194487 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207896.1 protein_id gnl|my_center|LOCUS_07160 194672 195544 gene locus_tag LOCUS_07170 194672 195544 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207894.1 protein_id gnl|my_center|LOCUS_07170 195940 197283 gene locus_tag LOCUS_07180 195940 197283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 protein_id gnl|my_center|LOCUS_07180 197311 198129 gene locus_tag LOCUS_07190 gene chiG 197311 198129 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207892.1 protein_id gnl|my_center|LOCUS_07190 198231 198156 gene locus_tag LOCUS_t00120 198231 198156 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 198411 200252 gene locus_tag LOCUS_07200 gene kefBC 198411 200252 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207190.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence04 1327 674 gene locus_tag LOCUS_07210 gene pcaJ 1327 674 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_07210 2024 1338 gene locus_tag LOCUS_07220 gene catI 2024 1338 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 protein_id gnl|my_center|LOCUS_07220 2404 2114 gene locus_tag LOCUS_07230 gene catC 2404 2114 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF42 protein_id gnl|my_center|LOCUS_07230 3534 2422 gene locus_tag LOCUS_07240 gene catB 3534 2422 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 protein_id gnl|my_center|LOCUS_07240 3658 4569 gene locus_tag LOCUS_07250 gene catM 3658 4569 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206896.1 protein_id gnl|my_center|LOCUS_07250 6125 4596 gene locus_tag LOCUS_07260 6125 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7456 6122 gene locus_tag LOCUS_07270 7456 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8401 7466 gene locus_tag LOCUS_07280 gene catA 8401 7466 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_07280 10200 9016 gene locus_tag LOCUS_07290 gene benE 10200 9016 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_07290 11027 10242 gene locus_tag LOCUS_07300 gene benD 11027 10242 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206211.1 protein_id gnl|my_center|LOCUS_07300 12062 11046 gene locus_tag LOCUS_07310 gene benC 12062 11046 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206212.1 protein_id gnl|my_center|LOCUS_07310 12644 12135 gene locus_tag LOCUS_07320 gene benB 12644 12135 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206213.1 protein_id gnl|my_center|LOCUS_07320 14026 12641 gene locus_tag LOCUS_07330 gene benA 14026 12641 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119889.1 protein_id gnl|my_center|LOCUS_07330 14320 15234 gene locus_tag LOCUS_07340 gene benM 14320 15234 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206214.1 protein_id gnl|my_center|LOCUS_07340 16687 15287 gene locus_tag LOCUS_07350 16687 15287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207154.1 protein_id gnl|my_center|LOCUS_07350 17972 16725 gene locus_tag LOCUS_07360 17972 16725 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206208.1 protein_id gnl|my_center|LOCUS_07360 18256 20058 gene locus_tag LOCUS_07370 18256 20058 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464568.1 protein_id gnl|my_center|LOCUS_07370 20243 21763 gene locus_tag LOCUS_07380 20243 21763 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 protein_id gnl|my_center|LOCUS_07380 21791 22906 gene locus_tag LOCUS_07390 gene areB 21791 22906 CDS product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_07390 22990 23970 gene locus_tag LOCUS_07400 22990 23970 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_07400 24167 25327 gene locus_tag LOCUS_07410 24167 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 25358 26077 gene locus_tag LOCUS_07420 25358 26077 CDS product salicylate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_07420 26999 26109 gene locus_tag LOCUS_07430 gene nahR 26999 26109 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207153.1 protein_id gnl|my_center|LOCUS_07430 28395 27124 gene locus_tag LOCUS_07440 gene salR 28395 27124 CDS product salicylate 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207155.1 protein_id gnl|my_center|LOCUS_07440 28849 30363 gene locus_tag LOCUS_07450 gene yjdB 28849 30363 CDS product lipid A phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207511.1 protein_id gnl|my_center|LOCUS_07450 30365 31045 gene locus_tag LOCUS_07460 gene qseB 30365 31045 CDS product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 protein_id gnl|my_center|LOCUS_07460 31026 32423 gene locus_tag LOCUS_07470 gene qseC 31026 32423 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 protein_id gnl|my_center|LOCUS_07470 32598 33158 gene locus_tag LOCUS_07480 32598 33158 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617714.1 protein_id gnl|my_center|LOCUS_07480 33148 34497 gene locus_tag LOCUS_07490 gene pyrQ 33148 34497 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT33 protein_id gnl|my_center|LOCUS_07490 34673 35551 gene locus_tag LOCUS_07500 gene hmt-1 34673 35551 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206015.1 protein_id gnl|my_center|LOCUS_07500 35557 36897 gene locus_tag LOCUS_07510 gene arcD 35557 36897 CDS product arginine:ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117544.1 protein_id gnl|my_center|LOCUS_07510 37340 36984 gene locus_tag LOCUS_07520 37340 36984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_07520 37508 37816 gene locus_tag LOCUS_07530 37508 37816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206634.1 protein_id gnl|my_center|LOCUS_07530 38110 39486 gene locus_tag LOCUS_07540 gene cabC1 38110 39486 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_07540 39704 40996 gene locus_tag LOCUS_07550 gene acdA 39704 40996 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206632.1 protein_id gnl|my_center|LOCUS_07550 41028 42233 gene locus_tag LOCUS_07560 gene acadM 41028 42233 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206631.1 protein_id gnl|my_center|LOCUS_07560 43516 42290 gene locus_tag LOCUS_07570 gene alkM 43516 42290 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 protein_id gnl|my_center|LOCUS_07570 43712 44632 gene locus_tag LOCUS_07580 gene araC 43712 44632 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_07580 46547 44679 gene locus_tag LOCUS_07590 gene ppiD 46547 44679 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ1 protein_id gnl|my_center|LOCUS_07590 46952 46680 gene locus_tag LOCUS_07600 gene hup 46952 46680 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_07600 47577 47116 gene locus_tag LOCUS_07610 47577 47116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069443.1 protein_id gnl|my_center|LOCUS_07610 47769 48422 gene locus_tag LOCUS_07620 47769 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206628.1 protein_id gnl|my_center|LOCUS_07620 48532 49005 gene locus_tag LOCUS_07630 48532 49005 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_07630 49007 50224 gene locus_tag LOCUS_07640 gene iscS 49007 50224 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY6 protein_id gnl|my_center|LOCUS_07640 50296 50682 gene locus_tag LOCUS_07650 gene nifU 50296 50682 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY5 protein_id gnl|my_center|LOCUS_07650 50708 51028 gene locus_tag LOCUS_07660 50708 51028 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_07660 51113 51628 gene locus_tag LOCUS_07670 gene hscB 51113 51628 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY3 protein_id gnl|my_center|LOCUS_07670 51662 53524 gene locus_tag LOCUS_07680 gene hscA 51662 53524 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY2 protein_id gnl|my_center|LOCUS_07680 53539 53877 gene locus_tag LOCUS_07690 gene fdx 53539 53877 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_07690 55383 53926 gene locus_tag LOCUS_07700 gene cyaA 55383 53926 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206624.1 protein_id gnl|my_center|LOCUS_07700 55875 55441 gene locus_tag LOCUS_07710 55875 55441 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_07710 59559 56092 gene locus_tag LOCUS_07720 gene mfd 59559 56092 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX8 protein_id gnl|my_center|LOCUS_07720 59979 59623 gene locus_tag LOCUS_07730 59979 59623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206622.1 protein_id gnl|my_center|LOCUS_07730 60959 60018 gene locus_tag LOCUS_07740 gene yfeX 60959 60018 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206621.1 protein_id gnl|my_center|LOCUS_07740 61887 61105 gene locus_tag LOCUS_07750 61887 61105 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_07750 62428 61916 gene locus_tag LOCUS_07760 gene menG 62428 61916 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_07760 63106 62444 gene locus_tag LOCUS_07770 gene yraR 63106 62444 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206619.1 protein_id gnl|my_center|LOCUS_07770 63316 63585 gene locus_tag LOCUS_07780 gene rpsT 63316 63585 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_07780 64377 63643 gene locus_tag LOCUS_07790 gene gpmA 64377 63643 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_07790 65294 64434 gene locus_tag LOCUS_07800 gene cysQ 65294 64434 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206618.1 protein_id gnl|my_center|LOCUS_07800 65907 66350 gene locus_tag LOCUS_07810 gene hslR 65907 66350 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW4 protein_id gnl|my_center|LOCUS_07810 66508 67557 gene locus_tag LOCUS_07820 gene recA 66508 67557 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW5 protein_id gnl|my_center|LOCUS_07820 67615 68094 gene locus_tag LOCUS_07830 gene recX 67615 68094 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW6 protein_id gnl|my_center|LOCUS_07830 68506 69333 gene locus_tag LOCUS_07840 68506 69333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206981.1 protein_id gnl|my_center|LOCUS_07840 70181 69393 gene locus_tag LOCUS_07850 gene lpxA2 70181 69393 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 protein_id gnl|my_center|LOCUS_07850 70663 70178 gene locus_tag LOCUS_07860 gene fabZ 70663 70178 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC6 protein_id gnl|my_center|LOCUS_07860 71740 70670 gene locus_tag LOCUS_07870 gene lpxD 71740 70670 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC7 protein_id gnl|my_center|LOCUS_07870 72244 71744 gene locus_tag LOCUS_07880 gene ompH 72244 71744 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206985.1 protein_id gnl|my_center|LOCUS_07880 74749 72293 gene locus_tag LOCUS_07890 gene yaeT 74749 72293 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC9 protein_id gnl|my_center|LOCUS_07890 76166 74811 gene locus_tag LOCUS_07900 76166 74811 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_07900 77367 76171 gene locus_tag LOCUS_07910 gene dxr 77367 76171 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD2 protein_id gnl|my_center|LOCUS_07910 78192 77368 gene locus_tag LOCUS_07920 gene cdsA 78192 77368 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD3 protein_id gnl|my_center|LOCUS_07920 78944 78195 gene locus_tag LOCUS_07930 gene ispU 78944 78195 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD4 protein_id gnl|my_center|LOCUS_07930 79503 78949 gene locus_tag LOCUS_07940 gene frr 79503 78949 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD5 protein_id gnl|my_center|LOCUS_07940 80311 79583 gene locus_tag LOCUS_07950 gene pyrH 80311 79583 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD6 protein_id gnl|my_center|LOCUS_07950 81707 80364 gene locus_tag LOCUS_07960 gene yliG 81707 80364 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD7 protein_id gnl|my_center|LOCUS_07960 82047 83156 gene locus_tag LOCUS_07970 gene glnL 82047 83156 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115631.1 protein_id gnl|my_center|LOCUS_07970 83143 84618 gene locus_tag LOCUS_07980 gene glnG 83143 84618 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206993.1 protein_id gnl|my_center|LOCUS_07980 84766 85422 gene locus_tag LOCUS_07990 gene mtrR 84766 85422 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 protein_id gnl|my_center|LOCUS_07990 85523 86443 gene locus_tag LOCUS_08000 gene argF 85523 86443 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_08000 86594 87505 gene locus_tag LOCUS_08010 86594 87505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205460.1 protein_id gnl|my_center|LOCUS_08010 87867 87508 gene locus_tag LOCUS_08020 87867 87508 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR0 protein_id gnl|my_center|LOCUS_08020 90147 87871 gene locus_tag LOCUS_08030 gene clpA 90147 87871 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073979.1 protein_id gnl|my_center|LOCUS_08030 90570 90157 gene locus_tag LOCUS_08040 gene clpS 90570 90157 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR2 protein_id gnl|my_center|LOCUS_08040 91341 90589 gene locus_tag LOCUS_08050 91341 90589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206946.1 protein_id gnl|my_center|LOCUS_08050 92468 91419 gene locus_tag LOCUS_08060 gene argC 92468 91419 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR4 protein_id gnl|my_center|LOCUS_08060 93304 92630 gene locus_tag LOCUS_08070 93304 92630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206949.1 protein_id gnl|my_center|LOCUS_08070 93975 93304 gene locus_tag LOCUS_08080 gene rpiA 93975 93304 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR7 protein_id gnl|my_center|LOCUS_08080 94081 95619 gene locus_tag LOCUS_08090 gene ilvA 94081 95619 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR8 protein_id gnl|my_center|LOCUS_08090 95771 96442 gene locus_tag LOCUS_08100 gene trkA 95771 96442 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206952.1 protein_id gnl|my_center|LOCUS_08100 96423 97760 gene locus_tag LOCUS_08110 gene ntpJ 96423 97760 CDS product potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206953.1 protein_id gnl|my_center|LOCUS_08110 98972 97812 gene locus_tag LOCUS_08120 gene pldA 98972 97812 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_08120 101938 98999 gene locus_tag LOCUS_08130 gene preP2 101938 98999 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_08130 102247 103251 gene locus_tag LOCUS_08140 102247 103251 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_08140 103253 103576 gene locus_tag LOCUS_08150 103253 103576 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121079.1 protein_id gnl|my_center|LOCUS_08150 103591 104199 gene locus_tag LOCUS_08160 103591 104199 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121106.1 protein_id gnl|my_center|LOCUS_08160 105511 104333 gene locus_tag LOCUS_08170 gene algW 105511 104333 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 protein_id gnl|my_center|LOCUS_08170 105688 106446 gene locus_tag LOCUS_08180 105688 106446 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ93 protein_id gnl|my_center|LOCUS_08180 106653 107279 gene locus_tag LOCUS_08190 gene sodB 106653 107279 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_08190 107459 107534 gene locus_tag LOCUS_t00130 107459 107534 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 108275 107640 gene locus_tag LOCUS_08200 108275 107640 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261421.1 protein_id gnl|my_center|LOCUS_08200 108750 108259 gene locus_tag LOCUS_08210 gene lrp 108750 108259 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700117.1 protein_id gnl|my_center|LOCUS_08210 110158 108782 gene locus_tag LOCUS_08220 gene aroP 110158 108782 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207315.1 protein_id gnl|my_center|LOCUS_08220 110457 110532 gene locus_tag LOCUS_t00140 110457 110532 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 110573 111037 gene locus_tag LOCUS_08230 110573 111037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068176.1 protein_id gnl|my_center|LOCUS_08230 111251 111051 gene locus_tag LOCUS_08240 111251 111051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207258.1 protein_id gnl|my_center|LOCUS_08240 112714 111416 gene locus_tag LOCUS_08250 gene dctA 112714 111416 CDS product transporter dicarboxylate/amino acid:cation Na+/H+ symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 protein_id gnl|my_center|LOCUS_08250 113352 113268 gene locus_tag LOCUS_t00150 113352 113268 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114249 113455 gene locus_tag LOCUS_08260 114249 113455 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207194.1 protein_id gnl|my_center|LOCUS_08260 115758 114253 gene locus_tag LOCUS_08270 115758 114253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_08270 115926 116816 gene locus_tag LOCUS_08280 115926 116816 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 protein_id gnl|my_center|LOCUS_08280 116923 118095 gene locus_tag LOCUS_08290 116923 118095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 119166 118144 gene locus_tag LOCUS_08300 gene tsaD 119166 118144 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII7 protein_id gnl|my_center|LOCUS_08300 119312 119527 gene locus_tag LOCUS_08310 gene rpsU 119312 119527 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII8 protein_id gnl|my_center|LOCUS_08310 119565 120008 gene locus_tag LOCUS_08320 119565 120008 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_08320 120419 120057 gene locus_tag LOCUS_08330 120419 120057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 121905 120499 gene locus_tag LOCUS_08340 121905 120499 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ0 protein_id gnl|my_center|LOCUS_08340 123041 122076 gene locus_tag LOCUS_08350 gene tkrA 123041 122076 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115253.1 protein_id gnl|my_center|LOCUS_08350 123699 123052 gene locus_tag LOCUS_08360 123699 123052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207197.1 protein_id gnl|my_center|LOCUS_08360 125687 123792 gene locus_tag LOCUS_08370 125687 123792 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207198.1 protein_id gnl|my_center|LOCUS_08370 127301 125763 gene locus_tag LOCUS_08380 gene purF 127301 125763 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ4 protein_id gnl|my_center|LOCUS_08380 127913 127326 gene locus_tag LOCUS_08390 127913 127326 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 protein_id gnl|my_center|LOCUS_08390 128921 127917 gene locus_tag LOCUS_08400 gene pyrD 128921 127917 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ6 protein_id gnl|my_center|LOCUS_08400 129495 129013 gene locus_tag LOCUS_08410 129495 129013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207201.1 protein_id gnl|my_center|LOCUS_08410 130634 129495 gene locus_tag LOCUS_08420 130634 129495 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ8 protein_id gnl|my_center|LOCUS_08420 131118 130663 gene locus_tag LOCUS_08430 131118 130663 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_08430 132248 131175 gene locus_tag LOCUS_08440 gene gpsA 132248 131175 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_08440 132863 132279 gene locus_tag LOCUS_08450 132863 132279 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_08450 133068 133439 gene locus_tag LOCUS_08460 133068 133439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_08460 134656 133505 gene locus_tag LOCUS_08470 gene rhlB 134656 133505 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK3 protein_id gnl|my_center|LOCUS_08470 134970 134758 gene locus_tag LOCUS_08480 gene cspG 134970 134758 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 protein_id gnl|my_center|LOCUS_08480 135342 135590 gene locus_tag LOCUS_08490 135342 135590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 135722 136591 gene locus_tag LOCUS_08500 gene rpoH 135722 136591 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_08500 136714 137079 gene locus_tag LOCUS_08510 136714 137079 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_08510 137092 137289 gene locus_tag LOCUS_08520 gene thiS 137092 137289 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115323.1 protein_id gnl|my_center|LOCUS_08520 137303 138088 gene locus_tag LOCUS_08530 gene thiG 137303 138088 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL0 protein_id gnl|my_center|LOCUS_08530 138168 138857 gene locus_tag LOCUS_08540 138168 138857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 139510 138899 gene locus_tag LOCUS_08550 gene gstB 139510 138899 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121577.1 protein_id gnl|my_center|LOCUS_08550 142135 139712 gene locus_tag LOCUS_08560 142135 139712 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206202.1 protein_id gnl|my_center|LOCUS_08560 142327 143046 gene locus_tag LOCUS_08570 gene trmB 142327 143046 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI97 protein_id gnl|my_center|LOCUS_08570 144164 143205 gene locus_tag LOCUS_08580 gene hprA 144164 143205 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225762.1 protein_id gnl|my_center|LOCUS_08580 145194 144238 gene locus_tag LOCUS_08590 145194 144238 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929941.1 protein_id gnl|my_center|LOCUS_08590 146389 145430 gene locus_tag LOCUS_08600 gene gbuA 146389 145430 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_08600 148326 146797 gene locus_tag LOCUS_08610 148326 146797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 protein_id gnl|my_center|LOCUS_08610 149152 148349 gene locus_tag LOCUS_08620 149152 148349 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887209.1 protein_id gnl|my_center|LOCUS_08620 150239 149163 gene locus_tag LOCUS_08630 150239 149163 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_08630 151178 150240 gene locus_tag LOCUS_08640 151178 150240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 151595 152497 gene locus_tag LOCUS_08650 gene gbuR 151595 152497 CDS product protein GbuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 protein_id gnl|my_center|LOCUS_08650 153253 152501 gene locus_tag LOCUS_08660 153253 152501 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267567.1 protein_id gnl|my_center|LOCUS_08660 153580 154140 gene locus_tag LOCUS_08670 153580 154140 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_08670 154244 155416 gene locus_tag LOCUS_08680 154244 155416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_08680 156699 155722 gene locus_tag LOCUS_08690 gene astE 156699 155722 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE5 protein_id gnl|my_center|LOCUS_08690 158058 156718 gene locus_tag LOCUS_08700 gene astB 158058 156718 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE6 protein_id gnl|my_center|LOCUS_08700 159553 158084 gene locus_tag LOCUS_08710 gene astD 159553 158084 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE7 protein_id gnl|my_center|LOCUS_08710 160584 159556 gene locus_tag LOCUS_08720 gene astA 160584 159556 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE8 protein_id gnl|my_center|LOCUS_08720 161809 160598 gene locus_tag LOCUS_08730 gene astC 161809 160598 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE9 protein_id gnl|my_center|LOCUS_08730 161948 162370 gene locus_tag LOCUS_08740 161948 162370 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_08740 163654 162503 gene locus_tag LOCUS_08750 163654 162503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112610.1 protein_id gnl|my_center|LOCUS_08750 164163 163672 gene locus_tag LOCUS_08760 164163 163672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 166408 164213 gene locus_tag LOCUS_08770 166408 164213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 169160 166416 gene locus_tag LOCUS_08780 gene cphA 169160 166416 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_08780 170105 169218 gene locus_tag LOCUS_08790 170105 169218 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64996 protein_id gnl|my_center|LOCUS_08790 171604 170102 gene locus_tag LOCUS_08800 171604 170102 CDS product putative cationic amino acid transport integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704570.1 protein_id gnl|my_center|LOCUS_08800 172986 172318 gene locus_tag LOCUS_08810 gene cmoA 172986 172318 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 protein_id gnl|my_center|LOCUS_08810 173799 173017 gene locus_tag LOCUS_08820 173799 173017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_08820 174912 173893 gene locus_tag LOCUS_08830 174912 173893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208214.1 protein_id gnl|my_center|LOCUS_08830 176296 175061 gene locus_tag LOCUS_08840 gene pyrX 176296 175061 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_08840 177325 176309 gene locus_tag LOCUS_08850 gene pyrB 177325 176309 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI91 protein_id gnl|my_center|LOCUS_08850 177628 179832 gene locus_tag LOCUS_08860 gene ycbY 177628 179832 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI89 protein_id gnl|my_center|LOCUS_08860 180282 179851 gene locus_tag LOCUS_08870 180282 179851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 182287 180500 gene locus_tag LOCUS_08880 gene ilvD1 182287 180500 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL3 protein_id gnl|my_center|LOCUS_08880 185156 182577 gene locus_tag LOCUS_08890 gene clpB 185156 182577 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI86 protein_id gnl|my_center|LOCUS_08890 185907 185482 gene locus_tag LOCUS_08900 gene phnO 185907 185482 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206190.1 protein_id gnl|my_center|LOCUS_08900 186438 186013 gene locus_tag LOCUS_08910 186438 186013 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_08910 186584 187288 gene locus_tag LOCUS_08920 gene crp 186584 187288 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 protein_id gnl|my_center|LOCUS_08920 187449 188495 gene locus_tag LOCUS_08930 gene tas 187449 188495 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206188.1 protein_id gnl|my_center|LOCUS_08930 189328 188549 gene locus_tag LOCUS_08940 gene oma1 189328 188549 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121572.1 protein_id gnl|my_center|LOCUS_08940 189755 189444 gene locus_tag LOCUS_08950 189755 189444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121533.1 protein_id gnl|my_center|LOCUS_08950 191190 189871 gene locus_tag LOCUS_08960 gene purA 191190 189871 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI77 protein_id gnl|my_center|LOCUS_08960 192422 191256 gene locus_tag LOCUS_08970 gene hisZ 192422 191256 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI76 protein_id gnl|my_center|LOCUS_08970 193640 192618 gene locus_tag LOCUS_08980 gene epD 193640 192618 CDS product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_08980 194086 196737 gene locus_tag LOCUS_08990 gene alaS 194086 196737 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI74 protein_id gnl|my_center|LOCUS_08990 196803 198083 gene locus_tag LOCUS_09000 gene lysC 196803 198083 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI73 protein_id gnl|my_center|LOCUS_09000 198329 198541 gene locus_tag LOCUS_09010 198329 198541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence05 216 830 gene locus_tag LOCUS_09020 216 830 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343108.1 protein_id gnl|my_center|LOCUS_09020 884 1195 gene locus_tag LOCUS_09030 gene ripk4 884 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208019.1 protein_id gnl|my_center|LOCUS_09030 1958 1416 gene locus_tag LOCUS_09040 1958 1416 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208020.1 protein_id gnl|my_center|LOCUS_09040 2539 2057 gene locus_tag LOCUS_09050 gene yaaD 2539 2057 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM2 protein_id gnl|my_center|LOCUS_09050 3071 2532 gene locus_tag LOCUS_09060 gene lspA 3071 2532 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_09060 5901 3064 gene locus_tag LOCUS_09070 gene ileS 5901 3064 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM4 protein_id gnl|my_center|LOCUS_09070 6967 5966 gene locus_tag LOCUS_09080 gene ribF 6967 5966 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM5 protein_id gnl|my_center|LOCUS_09080 7176 8300 gene locus_tag LOCUS_09090 7176 8300 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208024.1 protein_id gnl|my_center|LOCUS_09090 8345 9145 gene locus_tag LOCUS_09100 gene rutD 8345 9145 CDS product putative aminoacrylate hydrolase RutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN76 protein_id gnl|my_center|LOCUS_09100 9835 9218 gene locus_tag LOCUS_09110 gene rutR 9835 9218 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071782.1 protein_id gnl|my_center|LOCUS_09110 10288 11397 gene locus_tag LOCUS_09120 gene rutA 10288 11397 CDS product pyrimidine monooxygenase RutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN78 protein_id gnl|my_center|LOCUS_09120 11394 12131 gene locus_tag LOCUS_09130 gene rutB 11394 12131 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN79 protein_id gnl|my_center|LOCUS_09130 12144 12524 gene locus_tag LOCUS_09140 gene rutC 12144 12524 CDS product putative aminoacrylate peracid reductase RutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN80 protein_id gnl|my_center|LOCUS_09140 12603 13169 gene locus_tag LOCUS_09150 gene rutF 12603 13169 CDS product FMN reductase (NADH) RutF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN81 protein_id gnl|my_center|LOCUS_09150 13199 14563 gene locus_tag LOCUS_09160 gene rutG 13199 14563 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207571.1 protein_id gnl|my_center|LOCUS_09160 14579 15451 gene locus_tag LOCUS_09170 14579 15451 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_09170 16282 15482 gene locus_tag LOCUS_09180 gene ssuB 16282 15482 CDS product aliphatic sulfonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208026.1 protein_id gnl|my_center|LOCUS_09180 17095 16295 gene locus_tag LOCUS_09190 gene ssuC 17095 16295 CDS product sulfonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_09190 18282 17092 gene locus_tag LOCUS_09200 gene ssuD 18282 17092 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN1 protein_id gnl|my_center|LOCUS_09200 19312 18305 gene locus_tag LOCUS_09210 19312 18305 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208028.1 protein_id gnl|my_center|LOCUS_09210 20361 19339 gene locus_tag LOCUS_09220 gene ssuA2 20361 19339 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208029.1 protein_id gnl|my_center|LOCUS_09220 22089 20734 gene locus_tag LOCUS_09230 gene argA 22089 20734 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN4 protein_id gnl|my_center|LOCUS_09230 22503 22201 gene locus_tag LOCUS_09240 22503 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120775.1 protein_id gnl|my_center|LOCUS_09240 23065 22679 gene locus_tag LOCUS_09250 23065 22679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 24102 23356 gene locus_tag LOCUS_09260 gene yciK 24102 23356 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_09260 24840 24133 gene locus_tag LOCUS_09270 gene gph2 24840 24133 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_09270 25553 24837 gene locus_tag LOCUS_09280 gene ubiG 25553 24837 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_09280 25732 26352 gene locus_tag LOCUS_09290 gene dsbA 25732 26352 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_09290 27075 26437 gene locus_tag LOCUS_09300 27075 26437 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120773.1 protein_id gnl|my_center|LOCUS_09300 27840 27205 gene locus_tag LOCUS_09310 27840 27205 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 protein_id gnl|my_center|LOCUS_09310 28032 29054 gene locus_tag LOCUS_09320 gene hmp 28032 29054 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208031.1 protein_id gnl|my_center|LOCUS_09320 29089 30240 gene locus_tag LOCUS_09330 gene des6 29089 30240 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 protein_id gnl|my_center|LOCUS_09330 30347 31063 gene locus_tag LOCUS_09340 gene rph 30347 31063 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_09340 31287 31742 gene locus_tag LOCUS_09350 31287 31742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 31735 32283 gene locus_tag LOCUS_09360 31735 32283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206865.1 protein_id gnl|my_center|LOCUS_09360 32285 32917 gene locus_tag LOCUS_09370 32285 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 32924 33370 gene locus_tag LOCUS_09380 32924 33370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 34079 34468 gene locus_tag LOCUS_09390 34079 34468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 34542 34727 gene locus_tag LOCUS_09400 34542 34727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 34709 34915 gene locus_tag LOCUS_09410 34709 34915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 35379 35561 gene locus_tag LOCUS_09420 35379 35561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 36403 35558 gene locus_tag LOCUS_09430 gene nadC 36403 35558 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208036.1 protein_id gnl|my_center|LOCUS_09430 36590 37180 gene locus_tag LOCUS_09440 gene ampD 36590 37180 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_09440 37233 38780 gene locus_tag LOCUS_09450 gene mviN 37233 38780 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ1 protein_id gnl|my_center|LOCUS_09450 39655 38960 gene locus_tag LOCUS_09460 gene fklB 39655 38960 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_09460 40411 39704 gene locus_tag LOCUS_09470 gene fkpA 40411 39704 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ3 protein_id gnl|my_center|LOCUS_09470 42791 40581 gene locus_tag LOCUS_09480 gene ptk 42791 40581 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 protein_id gnl|my_center|LOCUS_09480 43234 42806 gene locus_tag LOCUS_09490 gene ptp 43234 42806 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_09490 44337 43234 gene locus_tag LOCUS_09500 gene wza 44337 43234 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 protein_id gnl|my_center|LOCUS_09500 44807 45970 gene locus_tag LOCUS_09510 44807 45970 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_09510 45989 46873 gene locus_tag LOCUS_09520 45989 46873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 46863 47792 gene locus_tag LOCUS_09530 gene cps1H 46863 47792 CDS product glycosyltransferase, family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101287.1 protein_id gnl|my_center|LOCUS_09530 47777 49039 gene locus_tag LOCUS_09540 47777 49039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 49069 50139 gene locus_tag LOCUS_09550 gene rffG 49069 50139 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8I5 protein_id gnl|my_center|LOCUS_09550 50158 51066 gene locus_tag LOCUS_09560 gene rfbD 50158 51066 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_09560 51067 51966 gene locus_tag LOCUS_09570 gene rfbA 51067 51966 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E7 protein_id gnl|my_center|LOCUS_09570 52037 52600 gene locus_tag LOCUS_09580 gene rfbC 52037 52600 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37780 protein_id gnl|my_center|LOCUS_09580 52614 53693 gene locus_tag LOCUS_09590 52614 53693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 53683 54630 gene locus_tag LOCUS_09600 53683 54630 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_09600 55635 56654 gene locus_tag LOCUS_09610 55635 56654 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_09610 56667 57464 gene locus_tag LOCUS_09620 56667 57464 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706034.1 protein_id gnl|my_center|LOCUS_09620 58910 57492 gene locus_tag LOCUS_09630 58910 57492 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079285.1 protein_id gnl|my_center|LOCUS_09630 59226 60518 gene locus_tag LOCUS_09640 gene wbpA 59226 60518 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_09640 60542 61579 gene locus_tag LOCUS_09650 60542 61579 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039035.1 protein_id gnl|my_center|LOCUS_09650 61666 62874 gene locus_tag LOCUS_09660 61666 62874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039036.1 protein_id gnl|my_center|LOCUS_09660 62871 63971 gene locus_tag LOCUS_09670 62871 63971 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_09670 63984 65075 gene locus_tag LOCUS_09680 63984 65075 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975597.1 protein_id gnl|my_center|LOCUS_09680 65084 66220 gene locus_tag LOCUS_09690 65084 66220 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_09690 66214 66828 gene locus_tag LOCUS_09700 66214 66828 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_09700 66809 67495 gene locus_tag LOCUS_09710 gene perB 66809 67495 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DBF7 protein_id gnl|my_center|LOCUS_09710 67499 68674 gene locus_tag LOCUS_09720 67499 68674 CDS product pilin glycosylation aminotransferase PglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207257.1 protein_id gnl|my_center|LOCUS_09720 68676 70565 gene locus_tag LOCUS_09730 gene wbfY 68676 70565 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_09730 70979 72343 gene locus_tag LOCUS_09740 70979 72343 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183113.1 protein_id gnl|my_center|LOCUS_09740 72435 73310 gene locus_tag LOCUS_09750 gene galU 72435 73310 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS0 protein_id gnl|my_center|LOCUS_09750 73337 74608 gene locus_tag LOCUS_09760 gene udg 73337 74608 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_09760 74605 76278 gene locus_tag LOCUS_09770 gene pgi 74605 76278 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS2 protein_id gnl|my_center|LOCUS_09770 76271 77290 gene locus_tag LOCUS_09780 gene galE 76271 77290 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208059.1 protein_id gnl|my_center|LOCUS_09780 77384 79033 gene locus_tag LOCUS_09790 77384 79033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207819.1 protein_id gnl|my_center|LOCUS_09790 80465 79092 gene locus_tag LOCUS_09800 gene manB 80465 79092 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_09800 81507 80608 gene locus_tag LOCUS_09810 gene nahR 81507 80608 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113533.1 protein_id gnl|my_center|LOCUS_09810 82061 83716 gene locus_tag LOCUS_09820 gene lldP 82061 83716 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208063.1 protein_id gnl|my_center|LOCUS_09820 83740 84492 gene locus_tag LOCUS_09830 gene lldR 83740 84492 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208064.1 protein_id gnl|my_center|LOCUS_09830 84489 85643 gene locus_tag LOCUS_09840 gene lldD 84489 85643 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS9 protein_id gnl|my_center|LOCUS_09840 85656 87365 gene locus_tag LOCUS_09850 gene dld 85656 87365 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 protein_id gnl|my_center|LOCUS_09850 87493 88950 gene locus_tag LOCUS_09860 87493 88950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206075.1 protein_id gnl|my_center|LOCUS_09860 89277 89014 gene locus_tag LOCUS_09870 89277 89014 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896546.1 protein_id gnl|my_center|LOCUS_09870 90645 89431 gene locus_tag LOCUS_09880 gene tyrB 90645 89431 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT1 protein_id gnl|my_center|LOCUS_09880 91821 91351 gene locus_tag LOCUS_09890 gene lrp 91821 91351 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208089.1 protein_id gnl|my_center|LOCUS_09890 91960 93219 gene locus_tag LOCUS_09900 gene dadA 91960 93219 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJB3 protein_id gnl|my_center|LOCUS_09900 93251 94348 gene locus_tag LOCUS_09910 gene dadX 93251 94348 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJB4 protein_id gnl|my_center|LOCUS_09910 94360 94719 gene locus_tag LOCUS_09920 94360 94719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208092.1 protein_id gnl|my_center|LOCUS_09920 94928 96352 gene locus_tag LOCUS_09930 gene cycA 94928 96352 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208093.1 protein_id gnl|my_center|LOCUS_09930 96879 97400 gene locus_tag LOCUS_09940 96879 97400 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816660.1 protein_id gnl|my_center|LOCUS_09940 97479 98231 gene locus_tag LOCUS_09950 gene cupA2 97479 98231 CDS product chaperone CupA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088863.1 protein_id gnl|my_center|LOCUS_09950 98244 100853 gene locus_tag LOCUS_09960 98244 100853 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043728.1 protein_id gnl|my_center|LOCUS_09960 100854 102278 gene locus_tag LOCUS_09970 100854 102278 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309304.1 protein_id gnl|my_center|LOCUS_09970 102275 103012 gene locus_tag LOCUS_09980 102275 103012 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227954.1 protein_id gnl|my_center|LOCUS_09980 103104 104141 gene locus_tag LOCUS_09990 103104 104141 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_09990 105185 104301 gene locus_tag LOCUS_10000 105185 104301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 protein_id gnl|my_center|LOCUS_10000 106784 105237 gene locus_tag LOCUS_10010 gene garD 106784 105237 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206145.1 protein_id gnl|my_center|LOCUS_10010 108217 106853 gene locus_tag LOCUS_10020 gene gudP 108217 106853 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206146.1 protein_id gnl|my_center|LOCUS_10020 108509 109843 gene locus_tag LOCUS_10030 gene gudD 108509 109843 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206147.1 protein_id gnl|my_center|LOCUS_10030 110181 109990 gene locus_tag LOCUS_10040 110181 109990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 110554 111465 gene locus_tag LOCUS_10050 110554 111465 CDS product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHL9 protein_id gnl|my_center|LOCUS_10050 111498 113078 gene locus_tag LOCUS_10060 gene aldH 111498 113078 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206149.1 protein_id gnl|my_center|LOCUS_10060 113294 114007 gene locus_tag LOCUS_10070 gene uxuR 113294 114007 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206150.1 protein_id gnl|my_center|LOCUS_10070 115030 114074 gene locus_tag LOCUS_10080 gene hprA 115030 114074 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225762.1 protein_id gnl|my_center|LOCUS_10080 115427 116470 gene locus_tag LOCUS_10090 115427 116470 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290717.1 protein_id gnl|my_center|LOCUS_10090 116709 118034 gene locus_tag LOCUS_10100 116709 118034 CDS product nucleobase:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969477.1 protein_id gnl|my_center|LOCUS_10100 118045 119475 gene locus_tag LOCUS_10110 118045 119475 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969478.1 protein_id gnl|my_center|LOCUS_10110 119475 120194 gene locus_tag LOCUS_10120 119475 120194 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969479.1 protein_id gnl|my_center|LOCUS_10120 120382 121548 gene locus_tag LOCUS_10130 120382 121548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 121721 121646 gene locus_tag LOCUS_t00160 121721 121646 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 121946 122254 gene locus_tag LOCUS_10140 gene bolA 121946 122254 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_10140 122266 122658 gene locus_tag LOCUS_10150 122266 122658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208111.1 protein_id gnl|my_center|LOCUS_10150 122740 123579 gene locus_tag LOCUS_10160 122740 123579 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071966.1 protein_id gnl|my_center|LOCUS_10160 123590 123979 gene locus_tag LOCUS_10170 123590 123979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114091.1 protein_id gnl|my_center|LOCUS_10170 124189 124779 gene locus_tag LOCUS_10180 124189 124779 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208112.1 protein_id gnl|my_center|LOCUS_10180 125423 124776 gene locus_tag LOCUS_10190 gene dedA 125423 124776 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_10190 125626 126048 gene locus_tag LOCUS_10200 125626 126048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 protein_id gnl|my_center|LOCUS_10200 126161 126529 gene locus_tag LOCUS_10210 126161 126529 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207058.1 protein_id gnl|my_center|LOCUS_10210 126667 128235 gene locus_tag LOCUS_10220 gene guaA 126667 128235 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJE6 protein_id gnl|my_center|LOCUS_10220 130816 128345 gene locus_tag LOCUS_10230 130816 128345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 protein_id gnl|my_center|LOCUS_10230 130985 131512 gene locus_tag LOCUS_10240 130985 131512 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208116.1 protein_id gnl|my_center|LOCUS_10240 131546 131863 gene locus_tag LOCUS_10250 131546 131863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114086.1 protein_id gnl|my_center|LOCUS_10250 131879 132118 gene locus_tag LOCUS_10260 131879 132118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 132269 133216 gene locus_tag LOCUS_10270 132269 133216 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 protein_id gnl|my_center|LOCUS_10270 133213 133611 gene locus_tag LOCUS_10280 133213 133611 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208118.1 protein_id gnl|my_center|LOCUS_10280 133719 134360 gene locus_tag LOCUS_10290 gene gst3 133719 134360 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208119.1 protein_id gnl|my_center|LOCUS_10290 135229 134363 gene locus_tag LOCUS_10300 gene lumQ 135229 134363 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206678.1 protein_id gnl|my_center|LOCUS_10300 135406 136323 gene locus_tag LOCUS_10310 135406 136323 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170570.1 protein_id gnl|my_center|LOCUS_10310 136423 137655 gene locus_tag LOCUS_10320 136423 137655 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527725.1 protein_id gnl|my_center|LOCUS_10320 138316 137714 gene locus_tag LOCUS_10330 138316 137714 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208120.1 protein_id gnl|my_center|LOCUS_10330 140222 138432 gene locus_tag LOCUS_10340 gene argS 140222 138432 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF4 protein_id gnl|my_center|LOCUS_10340 140917 140375 gene locus_tag LOCUS_10350 140917 140375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 141218 142918 gene locus_tag LOCUS_10360 gene sfcA 141218 142918 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF5 protein_id gnl|my_center|LOCUS_10360 143054 146374 gene locus_tag LOCUS_10370 143054 146374 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207953.1 protein_id gnl|my_center|LOCUS_10370 146371 148554 gene locus_tag LOCUS_10380 146371 148554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 148556 149281 gene locus_tag LOCUS_10390 148556 149281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 149495 149647 gene locus_tag LOCUS_10400 149495 149647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 150703 149783 gene locus_tag LOCUS_10410 gene yfeX 150703 149783 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208122.1 protein_id gnl|my_center|LOCUS_10410 150899 151498 gene locus_tag LOCUS_10420 gene rhtB 150899 151498 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804759.1 protein_id gnl|my_center|LOCUS_10420 152316 151501 gene locus_tag LOCUS_10430 gene znuB 152316 151501 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208123.1 protein_id gnl|my_center|LOCUS_10430 153107 152319 gene locus_tag LOCUS_10440 gene znuC 153107 152319 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF9 protein_id gnl|my_center|LOCUS_10440 153577 153089 gene locus_tag LOCUS_10450 gene zur 153577 153089 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_10450 153769 154542 gene locus_tag LOCUS_10460 gene znuA 153769 154542 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 protein_id gnl|my_center|LOCUS_10460 154716 155114 gene locus_tag LOCUS_10470 gene atpI 154716 155114 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072004.1 protein_id gnl|my_center|LOCUS_10470 155218 156093 gene locus_tag LOCUS_10480 gene atpB 155218 156093 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_10480 156178 156423 gene locus_tag LOCUS_10490 gene atpE 156178 156423 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_10490 156463 156933 gene locus_tag LOCUS_10500 gene atpF 156463 156933 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG5 protein_id gnl|my_center|LOCUS_10500 156945 157481 gene locus_tag LOCUS_10510 gene atpH 156945 157481 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG6 protein_id gnl|my_center|LOCUS_10510 157527 159071 gene locus_tag LOCUS_10520 gene atpA 157527 159071 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG7 protein_id gnl|my_center|LOCUS_10520 159149 160018 gene locus_tag LOCUS_10530 gene atpG 159149 160018 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG8 protein_id gnl|my_center|LOCUS_10530 160049 161443 gene locus_tag LOCUS_10540 gene atpD 160049 161443 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG9 protein_id gnl|my_center|LOCUS_10540 161471 161890 gene locus_tag LOCUS_10550 gene atpC 161471 161890 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_10550 162034 162513 gene locus_tag LOCUS_10560 162034 162513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071262.1 protein_id gnl|my_center|LOCUS_10560 162634 162942 gene locus_tag LOCUS_10570 162634 162942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 162955 163839 gene locus_tag LOCUS_10580 gene yeaD 162955 163839 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261570.1 protein_id gnl|my_center|LOCUS_10580 164385 163858 gene locus_tag LOCUS_10590 164385 163858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208127.1 protein_id gnl|my_center|LOCUS_10590 165182 164637 gene locus_tag LOCUS_10600 gene btuE 165182 164637 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH2 protein_id gnl|my_center|LOCUS_10600 166067 165318 gene locus_tag LOCUS_10610 gene yeaM 166067 165318 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208129.1 protein_id gnl|my_center|LOCUS_10610 167330 166116 gene locus_tag LOCUS_10620 gene nepI 167330 166116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072024.1 protein_id gnl|my_center|LOCUS_10620 167477 168151 gene locus_tag LOCUS_10630 167477 168151 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208130.1 protein_id gnl|my_center|LOCUS_10630 168229 169140 gene locus_tag LOCUS_10640 168229 169140 CDS product multidrug DMT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208131.1 protein_id gnl|my_center|LOCUS_10640 169558 170739 gene locus_tag LOCUS_10650 169558 170739 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614499.1 protein_id gnl|my_center|LOCUS_10650 170773 171423 gene locus_tag LOCUS_10660 170773 171423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 171416 172306 gene locus_tag LOCUS_10670 171416 172306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 172303 172923 gene locus_tag LOCUS_10680 172303 172923 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_10680 173085 174032 gene locus_tag LOCUS_10690 173085 174032 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 protein_id gnl|my_center|LOCUS_10690 174284 175567 gene locus_tag LOCUS_10700 174284 175567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 175703 176197 gene locus_tag LOCUS_10710 175703 176197 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_10710 176239 177798 gene locus_tag LOCUS_10720 176239 177798 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967791.1 protein_id gnl|my_center|LOCUS_10720 177838 178944 gene locus_tag LOCUS_10730 177838 178944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_10730 178957 179874 gene locus_tag LOCUS_10740 178957 179874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529891.1 protein_id gnl|my_center|LOCUS_10740 180982 180410 gene locus_tag LOCUS_10750 gene yrdC 180982 180410 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_10750 182173 181022 gene locus_tag LOCUS_10760 gene smf 182173 181022 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 protein_id gnl|my_center|LOCUS_10760 183348 182191 gene locus_tag LOCUS_10770 183348 182191 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_10770 183469 183993 gene locus_tag LOCUS_10780 gene def 183469 183993 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY9 protein_id gnl|my_center|LOCUS_10780 184114 184509 gene locus_tag LOCUS_10790 184114 184509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_10790 184612 186600 gene locus_tag LOCUS_10800 gene oprC 184612 186600 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208134.1 protein_id gnl|my_center|LOCUS_10800 186573 186971 gene locus_tag LOCUS_10810 186573 186971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 188174 187011 gene locus_tag LOCUS_10820 188174 187011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208135.1 protein_id gnl|my_center|LOCUS_10820 188302 188895 gene locus_tag LOCUS_10830 188302 188895 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208136.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence06 <1 548 gene locus_tag LOCUS_10840 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064414.1:O-acetyltransferase 780 607 gene locus_tag LOCUS_10850 780 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116397.1 protein_id gnl|my_center|LOCUS_10850 2371 917 gene locus_tag LOCUS_10860 gene cafA 2371 917 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116044.1 protein_id gnl|my_center|LOCUS_10860 3010 2411 gene locus_tag LOCUS_10870 3010 2411 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN32 protein_id gnl|my_center|LOCUS_10870 3456 2965 gene locus_tag LOCUS_10880 3456 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4300 3443 gene locus_tag LOCUS_10890 gene mreC 4300 3443 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN35 protein_id gnl|my_center|LOCUS_10890 5359 4319 gene locus_tag LOCUS_10900 gene mreB 5359 4319 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_10900 5490 5801 gene locus_tag LOCUS_10910 gene gatC 5490 5801 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN38 protein_id gnl|my_center|LOCUS_10910 5854 7332 gene locus_tag LOCUS_10920 gene gatA 5854 7332 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN39 protein_id gnl|my_center|LOCUS_10920 7332 8819 gene locus_tag LOCUS_10930 gene gatB 7332 8819 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN40 protein_id gnl|my_center|LOCUS_10930 9053 8874 gene locus_tag LOCUS_10940 9053 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 9716 9132 gene locus_tag LOCUS_10950 9716 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10354 9830 gene locus_tag LOCUS_10960 10354 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207539.1 protein_id gnl|my_center|LOCUS_10960 11531 10473 gene locus_tag LOCUS_10970 11531 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 12514 11738 gene locus_tag LOCUS_10980 12514 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207465.1 protein_id gnl|my_center|LOCUS_10980 13631 12552 gene locus_tag LOCUS_10990 13631 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207540.1 protein_id gnl|my_center|LOCUS_10990 13763 14518 gene locus_tag LOCUS_11000 13763 14518 CDS product DUF4850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207541.1 protein_id gnl|my_center|LOCUS_11000 15431 14508 gene locus_tag LOCUS_11010 gene alsR 15431 14508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206516.1 protein_id gnl|my_center|LOCUS_11010 15532 16101 gene locus_tag LOCUS_11020 15532 16101 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 protein_id gnl|my_center|LOCUS_11020 16098 16622 gene locus_tag LOCUS_11030 gene chrA1 16098 16622 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501457.1 protein_id gnl|my_center|LOCUS_11030 16766 16996 gene locus_tag LOCUS_11040 16766 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 18256 17063 gene locus_tag LOCUS_11050 gene bacA 18256 17063 CDS product microcin B17 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207542.1 protein_id gnl|my_center|LOCUS_11050 18529 19107 gene locus_tag LOCUS_11060 gene pfpI 18529 19107 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207538.1 protein_id gnl|my_center|LOCUS_11060 19250 19444 gene locus_tag LOCUS_11070 19250 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 20432 19482 gene locus_tag LOCUS_11080 gene ylbK 20432 19482 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207543.1 protein_id gnl|my_center|LOCUS_11080 22047 20572 gene locus_tag LOCUS_11090 22047 20572 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207544.1 protein_id gnl|my_center|LOCUS_11090 23421 22186 gene locus_tag LOCUS_11100 gene gltS 23421 22186 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 protein_id gnl|my_center|LOCUS_11100 23797 24501 gene locus_tag LOCUS_11110 23797 24501 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 protein_id gnl|my_center|LOCUS_11110 25773 24562 gene locus_tag LOCUS_11120 gene bcr 25773 24562 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 protein_id gnl|my_center|LOCUS_11120 25989 28097 gene locus_tag LOCUS_11130 25989 28097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207548.1 protein_id gnl|my_center|LOCUS_11130 28190 28750 gene locus_tag LOCUS_11140 28190 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 protein_id gnl|my_center|LOCUS_11140 28976 31552 gene locus_tag LOCUS_11150 gene cysJ 28976 31552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207550.1 protein_id gnl|my_center|LOCUS_11150 31776 31597 gene locus_tag LOCUS_11160 31776 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 31928 32473 gene locus_tag LOCUS_11170 31928 32473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 33016 32552 gene locus_tag LOCUS_11180 33016 32552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 33176 33101 gene locus_tag LOCUS_t00170 33176 33101 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 33936 33433 gene locus_tag LOCUS_11190 33936 33433 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_11190 34342 33929 gene locus_tag LOCUS_11200 34342 33929 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN58 protein_id gnl|my_center|LOCUS_11200 34485 35345 gene locus_tag LOCUS_11210 34485 35345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 protein_id gnl|my_center|LOCUS_11210 35492 35632 gene locus_tag LOCUS_11220 35492 35632 CDS product entericidin, EcnA/B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_11220 35751 36884 gene locus_tag LOCUS_11230 gene dapE 35751 36884 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_11230 41227 36914 gene locus_tag LOCUS_11240 gene chpA 41227 36914 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207558.1 protein_id gnl|my_center|LOCUS_11240 42745 41312 gene locus_tag LOCUS_11250 42745 41312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 43306 42788 gene locus_tag LOCUS_11260 gene pilI 43306 42788 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_11260 43681 43310 gene locus_tag LOCUS_11270 gene pilH 43681 43310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_11270 44088 43705 gene locus_tag LOCUS_11280 gene pilG 44088 43705 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_11280 44341 44985 gene locus_tag LOCUS_11290 44341 44985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207559.1 protein_id gnl|my_center|LOCUS_11290 45042 46151 gene locus_tag LOCUS_11300 gene nolF 45042 46151 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207560.1 protein_id gnl|my_center|LOCUS_11300 46175 49276 gene locus_tag LOCUS_11310 gene nolG 46175 49276 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_11310 49379 51091 gene locus_tag LOCUS_11320 gene proS 49379 51091 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_11320 51886 51158 gene locus_tag LOCUS_11330 51886 51158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 53143 52034 gene locus_tag LOCUS_11340 53143 52034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_11340 55417 53159 gene locus_tag LOCUS_11350 55417 53159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205923.1 protein_id gnl|my_center|LOCUS_11350 56063 55431 gene locus_tag LOCUS_11360 56063 55431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205922.1 protein_id gnl|my_center|LOCUS_11360 57454 56075 gene locus_tag LOCUS_11370 57454 56075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205921.1 protein_id gnl|my_center|LOCUS_11370 58255 57686 gene locus_tag LOCUS_11380 gene dcd 58255 57686 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 protein_id gnl|my_center|LOCUS_11380 58946 58353 gene locus_tag LOCUS_11390 58946 58353 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071033.1 protein_id gnl|my_center|LOCUS_11390 59439 59942 gene locus_tag LOCUS_11400 59439 59942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205919.1 protein_id gnl|my_center|LOCUS_11400 60818 59943 gene locus_tag LOCUS_11410 60818 59943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 62216 60993 gene locus_tag LOCUS_11420 gene mrp 62216 60993 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV5 protein_id gnl|my_center|LOCUS_11420 62975 62367 gene locus_tag LOCUS_11430 62975 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120385.1 protein_id gnl|my_center|LOCUS_11430 63632 64477 gene locus_tag LOCUS_11440 gene tsk 63632 64477 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247005.1 protein_id gnl|my_center|LOCUS_11440 64659 66716 gene locus_tag LOCUS_11450 gene metG 64659 66716 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV3 protein_id gnl|my_center|LOCUS_11450 66785 67696 gene locus_tag LOCUS_11460 66785 67696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 67823 68800 gene locus_tag LOCUS_11470 67823 68800 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207446.1 protein_id gnl|my_center|LOCUS_11470 69656 68865 gene locus_tag LOCUS_11480 69656 68865 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731478.1 protein_id gnl|my_center|LOCUS_11480 70599 69649 gene locus_tag LOCUS_11490 70599 69649 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_11490 70707 72140 gene locus_tag LOCUS_11500 gene ncs2 70707 72140 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066765.1 protein_id gnl|my_center|LOCUS_11500 72334 73686 gene locus_tag LOCUS_11510 gene atzB 72334 73686 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 protein_id gnl|my_center|LOCUS_11510 73965 73774 gene locus_tag LOCUS_11520 73965 73774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 74734 74111 gene locus_tag LOCUS_11530 gene rhtC 74734 74111 CDS product threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_11530 75542 74778 gene locus_tag LOCUS_11540 gene yafE 75542 74778 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206235.1 protein_id gnl|my_center|LOCUS_11540 75737 76306 gene locus_tag LOCUS_11550 75737 76306 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120318.1 protein_id gnl|my_center|LOCUS_11550 76299 77960 gene locus_tag LOCUS_11560 gene emrB 76299 77960 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_11560 77976 79145 gene locus_tag LOCUS_11570 gene hlyD 77976 79145 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205910.1 protein_id gnl|my_center|LOCUS_11570 79227 79829 gene locus_tag LOCUS_11580 gene cicA 79227 79829 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207732.1 protein_id gnl|my_center|LOCUS_11580 79839 80723 gene locus_tag LOCUS_11590 gene dcyD 79839 80723 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_11590 80794 81990 gene locus_tag LOCUS_11600 80794 81990 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205908.1 protein_id gnl|my_center|LOCUS_11600 82169 81987 gene locus_tag LOCUS_11610 82169 81987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 83928 82258 gene locus_tag LOCUS_11620 83928 82258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_11620 84393 84157 gene locus_tag LOCUS_11630 84393 84157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205906.1 protein_id gnl|my_center|LOCUS_11630 84549 84971 gene locus_tag LOCUS_11640 84549 84971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205905.1 protein_id gnl|my_center|LOCUS_11640 85864 85103 gene locus_tag LOCUS_11650 gene fpr 85864 85103 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_11650 85950 86837 gene locus_tag LOCUS_11660 gene yeiE 85950 86837 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_11660 89051 86910 gene locus_tag LOCUS_11670 89051 86910 CDS product TonB dependent/Ligand-Gated channel TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706422.1 protein_id gnl|my_center|LOCUS_11670 89871 89236 gene locus_tag LOCUS_11680 gene upp 89871 89236 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET7 protein_id gnl|my_center|LOCUS_11680 91474 89978 gene locus_tag LOCUS_11690 gene nuoN 91474 89978 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET6 protein_id gnl|my_center|LOCUS_11690 93076 91478 gene locus_tag LOCUS_11700 gene nuoM 93076 91478 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 protein_id gnl|my_center|LOCUS_11700 94973 93078 gene locus_tag LOCUS_11710 gene nuoL 94973 93078 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120008.1 protein_id gnl|my_center|LOCUS_11710 95278 94970 gene locus_tag LOCUS_11720 gene nuoK 95278 94970 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET3 protein_id gnl|my_center|LOCUS_11720 95799 95278 gene locus_tag LOCUS_11730 gene nuoJ 95799 95278 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205902.1 protein_id gnl|my_center|LOCUS_11730 96338 95796 gene locus_tag LOCUS_11740 gene nuoI 96338 95796 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XFD5 protein_id gnl|my_center|LOCUS_11740 97373 96357 gene locus_tag LOCUS_11750 gene nuoH 97373 96357 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET0 protein_id gnl|my_center|LOCUS_11750 100061 97377 gene locus_tag LOCUS_11760 gene nuoG 100061 97377 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES9 protein_id gnl|my_center|LOCUS_11760 101404 100073 gene locus_tag LOCUS_11770 gene nuoF 101404 100073 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_11770 101913 101401 gene locus_tag LOCUS_11780 gene nuoE 101913 101401 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_11780 103710 101923 gene locus_tag LOCUS_11790 gene nuoC 103710 101923 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES6 protein_id gnl|my_center|LOCUS_11790 104469 103792 gene locus_tag LOCUS_11800 gene nuoB 104469 103792 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES5 protein_id gnl|my_center|LOCUS_11800 105027 104476 gene locus_tag LOCUS_11810 gene nuoA 105027 104476 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPM2 protein_id gnl|my_center|LOCUS_11810 105662 106021 gene locus_tag LOCUS_11820 105662 106021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205897.1 protein_id gnl|my_center|LOCUS_11820 107713 106073 gene locus_tag LOCUS_11830 gene rstB 107713 106073 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_11830 108476 107760 gene locus_tag LOCUS_11840 gene rstA 108476 107760 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_11840 109021 111846 gene locus_tag LOCUS_11850 gene nrdA 109021 111846 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071099.1 protein_id gnl|my_center|LOCUS_11850 112175 113458 gene locus_tag LOCUS_11860 gene nrdB 112175 113458 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPL5 protein_id gnl|my_center|LOCUS_11860 113905 113570 gene locus_tag LOCUS_11870 113905 113570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_11870 114448 114044 gene locus_tag LOCUS_11880 114448 114044 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070816.1 protein_id gnl|my_center|LOCUS_11880 114840 114496 gene locus_tag LOCUS_11890 gene phnA 114840 114496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_11890 115448 114906 gene locus_tag LOCUS_11900 115448 114906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 115941 115501 gene locus_tag LOCUS_11910 115941 115501 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 protein_id gnl|my_center|LOCUS_11910 116459 116076 gene locus_tag LOCUS_11920 116459 116076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 protein_id gnl|my_center|LOCUS_11920 117245 116586 gene locus_tag LOCUS_11930 gene rluA 117245 116586 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208085.1 protein_id gnl|my_center|LOCUS_11930 117438 118160 gene locus_tag LOCUS_11940 117438 118160 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_11940 118396 119103 gene locus_tag LOCUS_11950 gene dsbC 118396 119103 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_11950 119359 120195 gene locus_tag LOCUS_11960 gene ybeQ 119359 120195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207576.1 protein_id gnl|my_center|LOCUS_11960 121163 120240 gene locus_tag LOCUS_11970 gene mdcF 121163 120240 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_11970 122341 121229 gene locus_tag LOCUS_11980 122341 121229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116511.1 protein_id gnl|my_center|LOCUS_11980 124517 122361 gene locus_tag LOCUS_11990 gene yncD 124517 122361 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_11990 124760 125578 gene locus_tag LOCUS_12000 gene mutM 124760 125578 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN93 protein_id gnl|my_center|LOCUS_12000 125614 125901 gene locus_tag LOCUS_12010 gene ppiC 125614 125901 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN94 protein_id gnl|my_center|LOCUS_12010 126290 125943 gene locus_tag LOCUS_12020 126290 125943 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207583.1 protein_id gnl|my_center|LOCUS_12020 126886 126446 gene locus_tag LOCUS_12030 gene mscL 126886 126446 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_12030 128995 127163 gene locus_tag LOCUS_12040 gene typA 128995 127163 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_12040 129174 130547 gene locus_tag LOCUS_12050 gene yicE 129174 130547 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207585.1 protein_id gnl|my_center|LOCUS_12050 130611 131627 gene locus_tag LOCUS_12060 gene rsmC 130611 131627 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA0 protein_id gnl|my_center|LOCUS_12060 131646 133109 gene locus_tag LOCUS_12070 gene lysP 131646 133109 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207587.1 protein_id gnl|my_center|LOCUS_12070 133506 133667 gene locus_tag LOCUS_12080 133506 133667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 134846 133779 gene locus_tag LOCUS_12090 gene ompA 134846 133779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207589.1 protein_id gnl|my_center|LOCUS_12090 135231 135749 gene locus_tag LOCUS_12100 gene fimT 135231 135749 CDS product type 4 fimbrial biogenesis protein FimT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207590.1 protein_id gnl|my_center|LOCUS_12100 135865 137040 gene locus_tag LOCUS_12110 gene thlA 135865 137040 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_12110 137172 137618 gene locus_tag LOCUS_12120 137172 137618 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_12120 138167 137676 gene locus_tag LOCUS_12130 gene ogt 138167 137676 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP06 protein_id gnl|my_center|LOCUS_12130 138503 138183 gene locus_tag LOCUS_12140 gene sugE 138503 138183 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_12140 139608 138640 gene locus_tag LOCUS_12150 139608 138640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 140493 139663 gene locus_tag LOCUS_12160 gene pcoB 140493 139663 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208440.1 protein_id gnl|my_center|LOCUS_12160 142240 140480 gene locus_tag LOCUS_12170 gene pcoA 142240 140480 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 protein_id gnl|my_center|LOCUS_12170 142757 142299 gene locus_tag LOCUS_12180 142757 142299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208438.1 protein_id gnl|my_center|LOCUS_12180 143817 143131 gene locus_tag LOCUS_12190 gene rpe 143817 143131 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_12190 144014 143799 gene locus_tag LOCUS_12200 144014 143799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 143999 144274 gene locus_tag LOCUS_12210 143999 144274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843456.1 protein_id gnl|my_center|LOCUS_12210 145186 144347 gene locus_tag LOCUS_12220 gene esd 145186 144347 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ7 protein_id gnl|my_center|LOCUS_12220 146489 145155 gene locus_tag LOCUS_12230 146489 145155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_12230 147529 146717 gene locus_tag LOCUS_12240 gene rsmJ 147529 146717 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ5 protein_id gnl|my_center|LOCUS_12240 148347 147523 gene locus_tag LOCUS_12250 gene uppP2 148347 147523 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_12250 149025 148360 gene locus_tag LOCUS_12260 gene yeaZ 149025 148360 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_12260 149674 149132 gene locus_tag LOCUS_12270 149674 149132 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_12270 150305 149700 gene locus_tag LOCUS_12280 gene nudL 150305 149700 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_12280 150542 150976 gene locus_tag LOCUS_12290 150542 150976 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_12290 152926 151019 gene locus_tag LOCUS_12300 152926 151019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208429.1 protein_id gnl|my_center|LOCUS_12300 154168 152945 gene locus_tag LOCUS_12310 154168 152945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 155832 154168 gene locus_tag LOCUS_12320 155832 154168 CDS product outer membrane protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208426.1 protein_id gnl|my_center|LOCUS_12320 157007 155847 gene locus_tag LOCUS_12330 157007 155847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208425.1 protein_id gnl|my_center|LOCUS_12330 157892 157059 gene locus_tag LOCUS_12340 157892 157059 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208424.1 protein_id gnl|my_center|LOCUS_12340 158972 158106 gene locus_tag LOCUS_12350 158972 158106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208423.1 protein_id gnl|my_center|LOCUS_12350 159274 160584 gene locus_tag LOCUS_12360 gene pabB 159274 160584 CDS product p-aminobenzoate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 protein_id gnl|my_center|LOCUS_12360 161666 160581 gene locus_tag LOCUS_12370 gene hisC 161666 160581 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH3 protein_id gnl|my_center|LOCUS_12370 163035 161746 gene locus_tag LOCUS_12380 gene hisD 163035 161746 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH2 protein_id gnl|my_center|LOCUS_12380 164005 163322 gene locus_tag LOCUS_12390 gene hisG 164005 163322 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_12390 165261 164005 gene locus_tag LOCUS_12400 gene murA 165261 164005 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH0 protein_id gnl|my_center|LOCUS_12400 165519 165268 gene locus_tag LOCUS_12410 gene ligA 165519 165268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_12410 165992 165654 gene locus_tag LOCUS_12420 gene rpoX 165992 165654 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071251.1 protein_id gnl|my_center|LOCUS_12420 167609 166161 gene locus_tag LOCUS_12430 gene rpoN 167609 166161 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNG7 protein_id gnl|my_center|LOCUS_12430 >Feature sequence07 1632 379 gene locus_tag LOCUS_12440 1632 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1867 2838 gene locus_tag LOCUS_12450 gene lip1 1867 2838 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_12450 3053 3898 gene locus_tag LOCUS_12460 3053 3898 CDS product cellobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948182.1 protein_id gnl|my_center|LOCUS_12460 3889 4869 gene locus_tag LOCUS_12470 3889 4869 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948180.1 protein_id gnl|my_center|LOCUS_12470 5264 6916 gene locus_tag LOCUS_12480 5264 6916 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020232.1 protein_id gnl|my_center|LOCUS_12480 7080 7715 gene locus_tag LOCUS_12490 7080 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 7861 10287 gene locus_tag LOCUS_12500 gene lon 7861 10287 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ1 protein_id gnl|my_center|LOCUS_12500 10610 11089 gene locus_tag LOCUS_12510 gene rlmH 10610 11089 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ0 protein_id gnl|my_center|LOCUS_12510 11201 11977 gene locus_tag LOCUS_12520 11201 11977 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_12520 12254 12931 gene locus_tag LOCUS_12530 12254 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 14310 12994 gene locus_tag LOCUS_12540 gene gdhA 14310 12994 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY7 protein_id gnl|my_center|LOCUS_12540 14645 15445 gene locus_tag LOCUS_12550 gene rnfB 14645 15445 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 protein_id gnl|my_center|LOCUS_12550 15446 16126 gene locus_tag LOCUS_12560 gene nth 15446 16126 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY5 protein_id gnl|my_center|LOCUS_12560 16306 16130 gene locus_tag LOCUS_12570 16306 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 17040 16381 gene locus_tag LOCUS_12580 gene adk 17040 16381 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_12580 18437 17121 gene locus_tag LOCUS_12590 18437 17121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_12590 19019 18501 gene locus_tag LOCUS_12600 19019 18501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117557.1 protein_id gnl|my_center|LOCUS_12600 19257 21284 gene locus_tag LOCUS_12610 gene pbpA 19257 21284 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_12610 21284 21829 gene locus_tag LOCUS_12620 gene rsmD 21284 21829 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX9 protein_id gnl|my_center|LOCUS_12620 22089 21853 gene locus_tag LOCUS_12630 22089 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 22682 22224 gene locus_tag LOCUS_12640 22682 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 23317 22745 gene locus_tag LOCUS_12650 gene ureJ 23317 22745 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 protein_id gnl|my_center|LOCUS_12650 23941 23327 gene locus_tag LOCUS_12660 gene ureG 23941 23327 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 protein_id gnl|my_center|LOCUS_12660 24667 24005 gene locus_tag LOCUS_12670 gene ureF 24667 24005 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX6 protein_id gnl|my_center|LOCUS_12670 25136 24657 gene locus_tag LOCUS_12680 gene ureE 25136 24657 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX5 protein_id gnl|my_center|LOCUS_12680 25724 25146 gene locus_tag LOCUS_12690 25724 25146 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769904.1 protein_id gnl|my_center|LOCUS_12690 27439 25739 gene locus_tag LOCUS_12700 gene ureC 27439 25739 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX4 protein_id gnl|my_center|LOCUS_12700 27778 27470 gene locus_tag LOCUS_12710 gene ureB 27778 27470 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX2 protein_id gnl|my_center|LOCUS_12710 28103 27801 gene locus_tag LOCUS_12720 gene ureA 28103 27801 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX1 protein_id gnl|my_center|LOCUS_12720 29087 28212 gene locus_tag LOCUS_12730 gene ureD 29087 28212 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX0 protein_id gnl|my_center|LOCUS_12730 29568 29822 gene locus_tag LOCUS_12740 29568 29822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117704.1 protein_id gnl|my_center|LOCUS_12740 29960 30436 gene locus_tag LOCUS_12750 gene cutF 29960 30436 CDS product lipoprotein involved with copper homeostasis and adhesion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206080.1 protein_id gnl|my_center|LOCUS_12750 32098 30500 gene locus_tag LOCUS_12760 gene aceA 32098 30500 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_12760 32717 33706 gene locus_tag LOCUS_12770 gene nahR 32717 33706 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_12770 33829 35151 gene locus_tag LOCUS_12780 gene ytfL 33829 35151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 protein_id gnl|my_center|LOCUS_12780 35708 35385 gene locus_tag LOCUS_12790 35708 35385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 37372 35714 gene locus_tag LOCUS_12800 37372 35714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 37876 37511 gene locus_tag LOCUS_12810 37876 37511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12810 38218 37892 gene locus_tag LOCUS_12820 38218 37892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12820 39127 38624 gene locus_tag LOCUS_12830 39127 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206079.1 protein_id gnl|my_center|LOCUS_12830 39696 41036 gene locus_tag LOCUS_12840 gene citN 39696 41036 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117607.1 protein_id gnl|my_center|LOCUS_12840 42711 41098 gene locus_tag LOCUS_12850 gene cysNC 42711 41098 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW1 protein_id gnl|my_center|LOCUS_12850 43672 42764 gene locus_tag LOCUS_12860 gene cysD 43672 42764 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_12860 44013 45410 gene locus_tag LOCUS_12870 gene cobQ 44013 45410 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5N6 protein_id gnl|my_center|LOCUS_12870 45589 46275 gene locus_tag LOCUS_12880 gene sodM 45589 46275 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDE4 protein_id gnl|my_center|LOCUS_12880 47860 46331 gene locus_tag LOCUS_12890 gene lysS 47860 46331 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV7 protein_id gnl|my_center|LOCUS_12890 48117 48632 gene locus_tag LOCUS_12900 48117 48632 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206073.1 protein_id gnl|my_center|LOCUS_12900 49013 49177 gene locus_tag LOCUS_12910 gene rubA 49013 49177 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_12910 49262 50443 gene locus_tag LOCUS_12920 gene rubB 49262 50443 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_12920 50499 51437 gene locus_tag LOCUS_12930 50499 51437 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_12930 51451 52356 gene locus_tag LOCUS_12940 gene estR 51451 52356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_12940 54512 52437 gene locus_tag LOCUS_12950 gene ppk 54512 52437 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_12950 55308 54634 gene locus_tag LOCUS_12960 gene mtgA 55308 54634 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU7 protein_id gnl|my_center|LOCUS_12960 55454 56218 gene locus_tag LOCUS_12970 gene aarA 55454 56218 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206065.1 protein_id gnl|my_center|LOCUS_12970 58711 56240 gene locus_tag LOCUS_12980 58711 56240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206064.1 protein_id gnl|my_center|LOCUS_12980 59412 58708 gene locus_tag LOCUS_12990 gene ybbA 59412 58708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070633.1 protein_id gnl|my_center|LOCUS_12990 59455 60090 gene locus_tag LOCUS_13000 gene tesA 59455 60090 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 protein_id gnl|my_center|LOCUS_13000 60743 60129 gene locus_tag LOCUS_13010 gene cynT 60743 60129 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_13010 61019 62017 gene locus_tag LOCUS_13020 61019 62017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 protein_id gnl|my_center|LOCUS_13020 64320 62083 gene locus_tag LOCUS_13030 64320 62083 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223352.1 protein_id gnl|my_center|LOCUS_13030 66752 64575 gene locus_tag LOCUS_13040 gene pfeA 66752 64575 CDS product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206060.1 protein_id gnl|my_center|LOCUS_13040 67548 66910 gene locus_tag LOCUS_13050 gene nfuA 67548 66910 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_13050 67792 68322 gene locus_tag LOCUS_13060 67792 68322 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_13060 68490 68335 gene locus_tag LOCUS_13070 68490 68335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 68530 70080 gene locus_tag LOCUS_13080 68530 70080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_13080 71441 70116 gene locus_tag LOCUS_13090 gene dsdA 71441 70116 CDS product putative D-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT1 protein_id gnl|my_center|LOCUS_13090 73163 71574 gene locus_tag LOCUS_13100 gene pitA 73163 71574 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT0 protein_id gnl|my_center|LOCUS_13100 73642 77328 gene locus_tag LOCUS_13110 gene metH 73642 77328 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_13110 77662 77369 gene locus_tag LOCUS_13120 77662 77369 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205904.1 protein_id gnl|my_center|LOCUS_13120 79284 78052 gene locus_tag LOCUS_13130 gene fsr 79284 78052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206045.1 protein_id gnl|my_center|LOCUS_13130 79377 80150 gene locus_tag LOCUS_13140 gene yeaM 79377 80150 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206044.1 protein_id gnl|my_center|LOCUS_13140 81450 80185 gene locus_tag LOCUS_13150 gene glsA 81450 80185 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB2 protein_id gnl|my_center|LOCUS_13150 82093 81611 gene locus_tag LOCUS_13160 gene def2 82093 81611 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB1 protein_id gnl|my_center|LOCUS_13160 82944 82093 gene locus_tag LOCUS_13170 gene supH 82944 82093 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208437.1 protein_id gnl|my_center|LOCUS_13170 83146 83349 gene locus_tag LOCUS_13180 83146 83349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 83455 84750 gene locus_tag LOCUS_13190 gene proP 83455 84750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206041.1 protein_id gnl|my_center|LOCUS_13190 85387 84791 gene locus_tag LOCUS_13200 85387 84791 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815824.1 protein_id gnl|my_center|LOCUS_13200 85718 85446 gene locus_tag LOCUS_13210 85718 85446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206029.1 protein_id gnl|my_center|LOCUS_13210 86293 85718 gene locus_tag LOCUS_13220 gene pnuC 86293 85718 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_13220 87513 86377 gene locus_tag LOCUS_13230 87513 86377 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205674.1 protein_id gnl|my_center|LOCUS_13230 88108 87695 gene locus_tag LOCUS_13240 88108 87695 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206026.1 protein_id gnl|my_center|LOCUS_13240 89400 88132 gene locus_tag LOCUS_13250 gene pgaC 89400 88132 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 protein_id gnl|my_center|LOCUS_13250 91488 89413 gene locus_tag LOCUS_13260 gene pgaB 91488 89413 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206024.1 protein_id gnl|my_center|LOCUS_13260 92201 91866 gene locus_tag LOCUS_13270 gene fbp 92201 91866 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG87 protein_id gnl|my_center|LOCUS_13270 92781 92251 gene locus_tag LOCUS_13280 gene yaeQ 92781 92251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075397.1 protein_id gnl|my_center|LOCUS_13280 93024 94259 gene locus_tag LOCUS_13290 gene dctA1 93024 94259 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206023.1 protein_id gnl|my_center|LOCUS_13290 95274 94264 gene locus_tag LOCUS_13300 gene cobW 95274 94264 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 protein_id gnl|my_center|LOCUS_13300 95770 96012 gene locus_tag LOCUS_13310 95770 96012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 96673 96152 gene locus_tag LOCUS_13320 gene vdlD 96673 96152 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_13320 97747 96962 gene locus_tag LOCUS_13330 gene budC 97747 96962 CDS product diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 protein_id gnl|my_center|LOCUS_13330 98845 97787 gene locus_tag LOCUS_13340 gene bdh1 98845 97787 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_13340 100320 98920 gene locus_tag LOCUS_13350 gene acoD 100320 98920 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK1 protein_id gnl|my_center|LOCUS_13350 101872 100331 gene locus_tag LOCUS_13360 gene acoC 101872 100331 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK0 protein_id gnl|my_center|LOCUS_13360 102893 101874 gene locus_tag LOCUS_13370 gene acoB 102893 101874 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 protein_id gnl|my_center|LOCUS_13370 103871 102909 gene locus_tag LOCUS_13380 gene acoA 103871 102909 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_13380 104220 105251 gene locus_tag LOCUS_13390 gene lipA 104220 105251 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ7 protein_id gnl|my_center|LOCUS_13390 105466 106581 gene locus_tag LOCUS_13400 105466 106581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069347.1 protein_id gnl|my_center|LOCUS_13400 107243 106620 gene locus_tag LOCUS_13410 107243 106620 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG81 protein_id gnl|my_center|LOCUS_13410 109316 107256 gene locus_tag LOCUS_13420 gene betT 109316 107256 CDS product high-affinity choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070759.1 protein_id gnl|my_center|LOCUS_13420 111062 109482 gene locus_tag LOCUS_13430 gene betT 111062 109482 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206021.1 protein_id gnl|my_center|LOCUS_13430 111310 111936 gene locus_tag LOCUS_13440 gene betI 111310 111936 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG78 protein_id gnl|my_center|LOCUS_13440 111929 113401 gene locus_tag LOCUS_13450 gene betB 111929 113401 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG77 protein_id gnl|my_center|LOCUS_13450 113490 115151 gene locus_tag LOCUS_13460 gene betA 113490 115151 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG76 protein_id gnl|my_center|LOCUS_13460 115651 117282 gene locus_tag LOCUS_13470 gene mqo 115651 117282 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG75 protein_id gnl|my_center|LOCUS_13470 117363 118634 gene locus_tag LOCUS_13480 gene entS 117363 118634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_13480 118698 119183 gene locus_tag LOCUS_13490 118698 119183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 120368 119217 gene locus_tag LOCUS_13500 120368 119217 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208088.1 protein_id gnl|my_center|LOCUS_13500 120439 122577 gene locus_tag LOCUS_13510 gene foxA 120439 122577 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_13510 122756 123247 gene locus_tag LOCUS_13520 122756 123247 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206825.1 protein_id gnl|my_center|LOCUS_13520 124587 123244 gene locus_tag LOCUS_13530 124587 123244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206829.1 protein_id gnl|my_center|LOCUS_13530 125930 124731 gene locus_tag LOCUS_13540 125930 124731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206040.1 protein_id gnl|my_center|LOCUS_13540 127820 126180 gene locus_tag LOCUS_13550 127820 126180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206039.1 protein_id gnl|my_center|LOCUS_13550 129349 127883 gene locus_tag LOCUS_13560 gene betB 129349 127883 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206038.1 protein_id gnl|my_center|LOCUS_13560 130154 129363 gene locus_tag LOCUS_13570 gene nadX 130154 129363 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGA5 protein_id gnl|my_center|LOCUS_13570 130960 130166 gene locus_tag LOCUS_13580 gene pecR 130960 130166 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009973.1 protein_id gnl|my_center|LOCUS_13580 131797 130964 gene locus_tag LOCUS_13590 gene catD 131797 130964 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 protein_id gnl|my_center|LOCUS_13590 132389 131865 gene locus_tag LOCUS_13600 132389 131865 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206035.1 protein_id gnl|my_center|LOCUS_13600 133649 132420 gene locus_tag LOCUS_13610 gene gudP 133649 132420 CDS product D-galactonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206034.1 protein_id gnl|my_center|LOCUS_13610 134927 133716 gene locus_tag LOCUS_13620 gene thcD 134927 133716 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206033.1 protein_id gnl|my_center|LOCUS_13620 135888 134953 gene locus_tag LOCUS_13630 gene mcpII 135888 134953 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206032.1 protein_id gnl|my_center|LOCUS_13630 136663 135899 gene locus_tag LOCUS_13640 136663 135899 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206031.1 protein_id gnl|my_center|LOCUS_13640 137727 136675 gene locus_tag LOCUS_13650 gene vanA 137727 136675 CDS product 3-phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070727.1 protein_id gnl|my_center|LOCUS_13650 138044 137745 gene locus_tag LOCUS_13660 138044 137745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070730.1 protein_id gnl|my_center|LOCUS_13660 138368 138063 gene locus_tag LOCUS_13670 gene ndoA 138368 138063 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 protein_id gnl|my_center|LOCUS_13670 138643 139455 gene locus_tag LOCUS_13680 gene kdgR 138643 139455 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206030.1 protein_id gnl|my_center|LOCUS_13680 139715 140860 gene locus_tag LOCUS_13690 139715 140860 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926295.1 protein_id gnl|my_center|LOCUS_13690 142236 140953 gene locus_tag LOCUS_13700 gene vanP 142236 140953 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206167.1 protein_id gnl|my_center|LOCUS_13700 143614 142268 gene locus_tag LOCUS_13710 gene vanK 143614 142268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206166.1 protein_id gnl|my_center|LOCUS_13710 144423 145499 gene locus_tag LOCUS_13720 gene vanA 144423 145499 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206162.1 protein_id gnl|my_center|LOCUS_13720 145511 146458 gene locus_tag LOCUS_13730 gene vanB 145511 146458 CDS product vanillate O-demethylase oxidoreductase (vanillate degradation ferredoxin-like protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206161.1 protein_id gnl|my_center|LOCUS_13730 147152 146505 gene locus_tag LOCUS_13740 gene vanR 147152 146505 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206160.1 protein_id gnl|my_center|LOCUS_13740 148356 147358 gene locus_tag LOCUS_13750 148356 147358 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728444.1 protein_id gnl|my_center|LOCUS_13750 149383 148928 gene locus_tag LOCUS_13760 149383 148928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 150150 150605 gene locus_tag LOCUS_13770 gene hpa2 150150 150605 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206377.1 protein_id gnl|my_center|LOCUS_13770 152729 150648 gene locus_tag LOCUS_13780 gene foxA 152729 150648 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_13780 152915 153940 gene locus_tag LOCUS_13790 152915 153940 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206828.1 protein_id gnl|my_center|LOCUS_13790 153944 154960 gene locus_tag LOCUS_13800 153944 154960 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206827.1 protein_id gnl|my_center|LOCUS_13800 154964 155728 gene locus_tag LOCUS_13810 154964 155728 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206826.1 protein_id gnl|my_center|LOCUS_13810 156419 155730 gene locus_tag LOCUS_13820 156419 155730 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 protein_id gnl|my_center|LOCUS_13820 157412 156519 gene locus_tag LOCUS_13830 gene iciA 157412 156519 CDS product transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206103.1 protein_id gnl|my_center|LOCUS_13830 157625 158218 gene locus_tag LOCUS_13840 157625 158218 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_13840 160243 158312 gene locus_tag LOCUS_13850 160243 158312 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964060.1 protein_id gnl|my_center|LOCUS_13850 160575 161456 gene locus_tag LOCUS_13860 gene prs 160575 161456 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_13860 161473 162990 gene locus_tag LOCUS_13870 161473 162990 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 protein_id gnl|my_center|LOCUS_13870 163113 163853 gene locus_tag LOCUS_13880 163113 163853 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_13880 163986 164300 gene locus_tag LOCUS_13890 163986 164300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 165789 164401 gene locus_tag LOCUS_13900 165789 164401 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_13900 166378 167142 gene locus_tag LOCUS_13910 166378 167142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence08 <1 1324 gene locus_tag LOCUS_13920 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065953.1:electron transfer flavoprotein-ubiquinone oxidoreductase 3688 1412 gene locus_tag LOCUS_13930 3688 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207769.1 protein_id gnl|my_center|LOCUS_13930 3926 5749 gene locus_tag LOCUS_13940 gene mmgC 3926 5749 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_13940 6348 5791 gene locus_tag LOCUS_13950 6348 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207770.1 protein_id gnl|my_center|LOCUS_13950 6744 7013 gene locus_tag LOCUS_13960 gene pspC 6744 7013 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207771.1 protein_id gnl|my_center|LOCUS_13960 8200 7082 gene locus_tag LOCUS_13970 8200 7082 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 protein_id gnl|my_center|LOCUS_13970 9170 8286 gene locus_tag LOCUS_13980 9170 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_13980 9439 10416 gene locus_tag LOCUS_13990 gene glyQ 9439 10416 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD4 protein_id gnl|my_center|LOCUS_13990 10416 12485 gene locus_tag LOCUS_14000 gene glyS 10416 12485 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD5 protein_id gnl|my_center|LOCUS_14000 12705 13709 gene locus_tag LOCUS_14010 12705 13709 CDS product SecC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269088.1 protein_id gnl|my_center|LOCUS_14010 14070 13891 gene locus_tag LOCUS_14020 14070 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14020 15145 14243 gene locus_tag LOCUS_14030 gene ydfC 15145 14243 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207777.1 protein_id gnl|my_center|LOCUS_14030 15320 16129 gene locus_tag LOCUS_14040 gene ilvY 15320 16129 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207778.1 protein_id gnl|my_center|LOCUS_14040 16208 16597 gene locus_tag LOCUS_14050 16208 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207782.1 protein_id gnl|my_center|LOCUS_14050 16766 17257 gene locus_tag LOCUS_14060 16766 17257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207781.1 protein_id gnl|my_center|LOCUS_14060 18223 17261 gene locus_tag LOCUS_14070 gene hprA 18223 17261 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_14070 18548 19126 gene locus_tag LOCUS_14080 18548 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207785.1 protein_id gnl|my_center|LOCUS_14080 20476 19211 gene locus_tag LOCUS_14090 20476 19211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207792.1 protein_id gnl|my_center|LOCUS_14090 21485 20637 gene locus_tag LOCUS_14100 21485 20637 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_14100 21696 22466 gene locus_tag LOCUS_14110 21696 22466 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207793.1 protein_id gnl|my_center|LOCUS_14110 22491 23045 gene locus_tag LOCUS_14120 22491 23045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067173.1 protein_id gnl|my_center|LOCUS_14120 23648 23088 gene locus_tag LOCUS_14130 23648 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 protein_id gnl|my_center|LOCUS_14130 24239 23769 gene locus_tag LOCUS_14140 24239 23769 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116954.1 protein_id gnl|my_center|LOCUS_14140 24360 25004 gene locus_tag LOCUS_14150 gene parA 24360 25004 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 protein_id gnl|my_center|LOCUS_14150 25131 26243 gene locus_tag LOCUS_14160 25131 26243 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_14160 26539 27150 gene locus_tag LOCUS_14170 26539 27150 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316393.1 protein_id gnl|my_center|LOCUS_14170 27326 29476 gene locus_tag LOCUS_14180 27326 29476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207796.1 protein_id gnl|my_center|LOCUS_14180 30759 29530 gene locus_tag LOCUS_14190 gene cmr 30759 29530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 protein_id gnl|my_center|LOCUS_14190 31246 31866 gene locus_tag LOCUS_14200 gene mdaB 31246 31866 CDS product NADPH quinone reductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207799.1 protein_id gnl|my_center|LOCUS_14200 31863 32180 gene locus_tag LOCUS_14210 31863 32180 CDS product quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 protein_id gnl|my_center|LOCUS_14210 33823 32276 gene locus_tag LOCUS_14220 33823 32276 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901328.1 protein_id gnl|my_center|LOCUS_14220 35010 34204 gene locus_tag LOCUS_14230 gene hetN 35010 34204 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_14230 35625 35254 gene locus_tag LOCUS_14240 35625 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207801.1 protein_id gnl|my_center|LOCUS_14240 37133 35724 gene locus_tag LOCUS_14250 37133 35724 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_14250 37401 38633 gene locus_tag LOCUS_14260 gene serA 37401 38633 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_14260 38726 39613 gene locus_tag LOCUS_14270 38726 39613 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207804.1 protein_id gnl|my_center|LOCUS_14270 39692 40576 gene locus_tag LOCUS_14280 39692 40576 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207805.1 protein_id gnl|my_center|LOCUS_14280 41041 40592 gene locus_tag LOCUS_14290 41041 40592 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_14290 41960 41190 gene locus_tag LOCUS_14300 41960 41190 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX6 protein_id gnl|my_center|LOCUS_14300 42842 41973 gene locus_tag LOCUS_14310 gene truB 42842 41973 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX7 protein_id gnl|my_center|LOCUS_14310 43096 44055 gene locus_tag LOCUS_14320 gene lifO 43096 44055 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX8 protein_id gnl|my_center|LOCUS_14320 44187 45155 gene locus_tag LOCUS_14330 gene lip 44187 45155 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_14330 45596 45225 gene locus_tag LOCUS_14340 gene rplS 45596 45225 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_14340 46487 45738 gene locus_tag LOCUS_14350 gene trmD 46487 45738 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY1 protein_id gnl|my_center|LOCUS_14350 47083 46535 gene locus_tag LOCUS_14360 gene rimM 47083 46535 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_14360 47414 47103 gene locus_tag LOCUS_14370 47414 47103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 47942 47508 gene locus_tag LOCUS_14380 gene pilE 47942 47508 CDS product pilus assembly protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_14380 48451 47942 gene locus_tag LOCUS_14390 gene comE 48451 47942 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207810.1 protein_id gnl|my_center|LOCUS_14390 52865 48513 gene locus_tag LOCUS_14400 gene comC 52865 48513 CDS product pilus assembly protein PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207811.1 protein_id gnl|my_center|LOCUS_14400 53550 52882 gene locus_tag LOCUS_14410 53550 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 54515 53547 gene locus_tag LOCUS_14420 gene comB 54515 53547 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 protein_id gnl|my_center|LOCUS_14420 55052 54516 gene locus_tag LOCUS_14430 gene pilV 55052 54516 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207814.1 protein_id gnl|my_center|LOCUS_14430 55495 55049 gene locus_tag LOCUS_14440 55495 55049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 56572 55622 gene locus_tag LOCUS_14450 gene ispH 56572 55622 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_14450 56707 57330 gene locus_tag LOCUS_14460 gene gmk 56707 57330 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ2 protein_id gnl|my_center|LOCUS_14460 57399 57680 gene locus_tag LOCUS_14470 gene rpoZ 57399 57680 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ3 protein_id gnl|my_center|LOCUS_14470 58019 60133 gene locus_tag LOCUS_14480 gene spoT 58019 60133 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_14480 60210 60593 gene locus_tag LOCUS_14490 60210 60593 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_14490 60747 60941 gene locus_tag LOCUS_14500 gene bfd 60747 60941 CDS product regulatory or redox protein complexing with Bfr in iron storage and mobility inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000629.1 protein_id gnl|my_center|LOCUS_14500 61203 61667 gene locus_tag LOCUS_14510 gene bfrB 61203 61667 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ9 protein_id gnl|my_center|LOCUS_14510 61970 62443 gene locus_tag LOCUS_14520 gene pru 61970 62443 CDS product protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036573.1 protein_id gnl|my_center|LOCUS_14520 63357 62440 gene locus_tag LOCUS_14530 63357 62440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 65777 63423 gene locus_tag LOCUS_14540 gene fasD 65777 63423 CDS product outer membrane usher protein FasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636753.2 protein_id gnl|my_center|LOCUS_14540 66513 65791 gene locus_tag LOCUS_14550 gene ecpD 66513 65791 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036572.1 protein_id gnl|my_center|LOCUS_14550 67011 66559 gene locus_tag LOCUS_14560 67011 66559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 68994 67348 gene locus_tag LOCUS_14570 68994 67348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 69499 69056 gene locus_tag LOCUS_14580 gene pilE 69499 69056 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_14580 70898 69867 gene locus_tag LOCUS_14590 70898 69867 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_14590 71703 72566 gene locus_tag LOCUS_14600 71703 72566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 72626 75415 gene locus_tag LOCUS_14610 72626 75415 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 protein_id gnl|my_center|LOCUS_14610 75553 77016 gene locus_tag LOCUS_14620 75553 77016 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950580.1 protein_id gnl|my_center|LOCUS_14620 77026 78048 gene locus_tag LOCUS_14630 77026 78048 CDS product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974954.1 protein_id gnl|my_center|LOCUS_14630 78658 78098 gene locus_tag LOCUS_14640 78658 78098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207822.1 protein_id gnl|my_center|LOCUS_14640 79728 78652 gene locus_tag LOCUS_14650 79728 78652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207823.1 protein_id gnl|my_center|LOCUS_14650 80334 79744 gene locus_tag LOCUS_14660 80334 79744 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117090.1 protein_id gnl|my_center|LOCUS_14660 81358 80468 gene locus_tag LOCUS_14670 81358 80468 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207824.1 protein_id gnl|my_center|LOCUS_14670 82953 81532 gene locus_tag LOCUS_14680 gene gltD 82953 81532 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_14680 87509 83028 gene locus_tag LOCUS_14690 gene gltB 87509 83028 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207826.1 protein_id gnl|my_center|LOCUS_14690 88813 87962 gene locus_tag LOCUS_14700 88813 87962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207827.1 protein_id gnl|my_center|LOCUS_14700 89911 88823 gene locus_tag LOCUS_14710 gene aroB 89911 88823 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG10 protein_id gnl|my_center|LOCUS_14710 90475 89933 gene locus_tag LOCUS_14720 gene aroK 90475 89933 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG11 protein_id gnl|my_center|LOCUS_14720 92683 90512 gene locus_tag LOCUS_14730 gene pilQ 92683 90512 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_14730 93225 92701 gene locus_tag LOCUS_14740 gene pilP 93225 92701 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_14740 93962 93225 gene locus_tag LOCUS_14750 gene pilO 93962 93225 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_14750 94597 93959 gene locus_tag LOCUS_14760 gene pilN 94597 93959 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_14760 95619 94594 gene locus_tag LOCUS_14770 gene pilM 95619 94594 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804529.1 protein_id gnl|my_center|LOCUS_14770 95911 98379 gene locus_tag LOCUS_14780 gene ponA 95911 98379 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 protein_id gnl|my_center|LOCUS_14780 99213 98392 gene locus_tag LOCUS_14790 gene rrmA 99213 98392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_14790 100397 99279 gene locus_tag LOCUS_14800 gene mraY 100397 99279 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG20 protein_id gnl|my_center|LOCUS_14800 101804 100398 gene locus_tag LOCUS_14810 gene murF 101804 100398 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG21 protein_id gnl|my_center|LOCUS_14810 103309 101813 gene locus_tag LOCUS_14820 gene murE 103309 101813 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG22 protein_id gnl|my_center|LOCUS_14820 105158 103320 gene locus_tag LOCUS_14830 gene ftsI 105158 103320 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_14830 105501 105169 gene locus_tag LOCUS_14840 gene ftsL 105501 105169 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG24 protein_id gnl|my_center|LOCUS_14840 106422 105511 gene locus_tag LOCUS_14850 gene mraW 106422 105511 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG25 protein_id gnl|my_center|LOCUS_14850 107801 106800 gene locus_tag LOCUS_14860 gene sbp 107801 106800 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207839.1 protein_id gnl|my_center|LOCUS_14860 108182 108478 gene locus_tag LOCUS_14870 108182 108478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116889.1 protein_id gnl|my_center|LOCUS_14870 108603 110111 gene locus_tag LOCUS_14880 gene gltX 108603 110111 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 protein_id gnl|my_center|LOCUS_14880 110169 110244 gene locus_tag LOCUS_t00180 110169 110244 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 110270 110345 gene locus_tag LOCUS_t00190 110270 110345 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 110439 110780 gene locus_tag LOCUS_14890 110439 110780 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078496.1 protein_id gnl|my_center|LOCUS_14890 111740 110817 gene locus_tag LOCUS_14900 gene czcD 111740 110817 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207843.1 protein_id gnl|my_center|LOCUS_14900 115016 111852 gene locus_tag LOCUS_14910 gene czcA 115016 111852 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207844.1 protein_id gnl|my_center|LOCUS_14910 116259 115006 gene locus_tag LOCUS_14920 gene czcB 116259 115006 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207845.1 protein_id gnl|my_center|LOCUS_14920 117662 116259 gene locus_tag LOCUS_14930 117662 116259 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207846.1 protein_id gnl|my_center|LOCUS_14930 118053 117709 gene locus_tag LOCUS_14940 118053 117709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207847.1 protein_id gnl|my_center|LOCUS_14940 119888 118227 gene locus_tag LOCUS_14950 gene yjjK 119888 118227 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207852.1 protein_id gnl|my_center|LOCUS_14950 121830 120109 gene locus_tag LOCUS_14960 gene poxB 121830 120109 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 protein_id gnl|my_center|LOCUS_14960 122092 123375 gene locus_tag LOCUS_14970 gene metY 122092 123375 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_14970 123647 124534 gene locus_tag LOCUS_14980 123647 124534 CDS product fatty acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_14980 126780 124597 gene locus_tag LOCUS_14990 gene ychM 126780 124597 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067022.1 protein_id gnl|my_center|LOCUS_14990 129421 127067 gene locus_tag LOCUS_15000 gene tex 129421 127067 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116875.1 protein_id gnl|my_center|LOCUS_15000 130038 130802 gene locus_tag LOCUS_15010 gene ompR 130038 130802 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_15010 130824 132281 gene locus_tag LOCUS_15020 gene envZ 130824 132281 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_15020 132491 134005 gene locus_tag LOCUS_15030 gene cat1 132491 134005 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_15030 134136 134555 gene locus_tag LOCUS_15040 gene ypeA 134136 134555 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_15040 135825 134563 gene locus_tag LOCUS_15050 gene ompP1 135825 134563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 protein_id gnl|my_center|LOCUS_15050 136681 135950 gene locus_tag LOCUS_15060 136681 135950 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_15060 136879 136804 gene locus_tag LOCUS_t00200 136879 136804 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 137368 136985 gene locus_tag LOCUS_15070 137368 136985 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116928.1 protein_id gnl|my_center|LOCUS_15070 137469 138062 gene locus_tag LOCUS_15080 gene hisB 137469 138062 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL4 protein_id gnl|my_center|LOCUS_15080 138065 138682 gene locus_tag LOCUS_15090 gene hisH 138065 138682 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_15090 138834 139403 gene locus_tag LOCUS_15100 138834 139403 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067011.1 protein_id gnl|my_center|LOCUS_15100 139515 140246 gene locus_tag LOCUS_15110 gene hisA 139515 140246 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_15110 144297 140305 gene locus_tag LOCUS_15120 144297 140305 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269157.1 protein_id gnl|my_center|LOCUS_15120 146369 144648 gene locus_tag LOCUS_15130 gene abcb6 146369 144648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207861.1 protein_id gnl|my_center|LOCUS_15130 146922 146527 gene locus_tag LOCUS_15140 146922 146527 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_15140 147586 146960 gene locus_tag LOCUS_15150 147586 146960 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207865.1 protein_id gnl|my_center|LOCUS_15150 148549 147599 gene locus_tag LOCUS_15160 gene thrB 148549 147599 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_15160 148663 149421 gene locus_tag LOCUS_15170 gene hisF 148663 149421 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_15170 150173 149532 gene locus_tag LOCUS_15180 150173 149532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_15180 150278 151279 gene locus_tag LOCUS_15190 150278 151279 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_15190 151539 151294 gene locus_tag LOCUS_15200 151539 151294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207871.1 protein_id gnl|my_center|LOCUS_15200 152644 151622 gene locus_tag LOCUS_15210 152644 151622 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207873.1 protein_id gnl|my_center|LOCUS_15210 152956 153351 gene locus_tag LOCUS_15220 152956 153351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 155307 153427 gene locus_tag LOCUS_15230 gene trkD 155307 153427 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGN4 protein_id gnl|my_center|LOCUS_15230 155430 155519 gene locus_tag LOCUS_t00210 155430 155519 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 155715 155960 gene locus_tag LOCUS_15240 155715 155960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 156427 156149 gene locus_tag LOCUS_15250 156427 156149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 156402 156587 gene locus_tag LOCUS_15260 156402 156587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 156793 157089 gene locus_tag LOCUS_15270 156793 157089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 157208 157717 gene locus_tag LOCUS_15280 157208 157717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence09 65 3154 gene locus_tag LOCUS_15290 65 3154 CDS product receptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206009.1 protein_id gnl|my_center|LOCUS_15290 3347 4138 gene locus_tag LOCUS_15300 3347 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041986.1 protein_id gnl|my_center|LOCUS_15300 4218 5708 gene locus_tag LOCUS_15310 4218 5708 CDS product peptide signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206010.1 protein_id gnl|my_center|LOCUS_15310 6053 5871 gene locus_tag LOCUS_15320 6053 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6094 6639 gene locus_tag LOCUS_15330 6094 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 6675 7271 gene locus_tag LOCUS_15340 6675 7271 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002062720.1 protein_id gnl|my_center|LOCUS_15340 7300 7743 gene locus_tag LOCUS_15350 7300 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206012.1 protein_id gnl|my_center|LOCUS_15350 8005 8994 gene locus_tag LOCUS_15360 8005 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9275 9200 gene locus_tag LOCUS_t00220 9275 9200 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10761 9340 gene locus_tag LOCUS_15370 gene cysS 10761 9340 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX2 protein_id gnl|my_center|LOCUS_15370 10975 11952 gene locus_tag LOCUS_15380 gene kdsD 10975 11952 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX3 protein_id gnl|my_center|LOCUS_15380 11956 12495 gene locus_tag LOCUS_15390 gene kdsC 11956 12495 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_15390 12534 13082 gene locus_tag LOCUS_15400 12534 13082 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070181.1 protein_id gnl|my_center|LOCUS_15400 13066 13614 gene locus_tag LOCUS_15410 gene lptA 13066 13614 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX6 protein_id gnl|my_center|LOCUS_15410 13614 14363 gene locus_tag LOCUS_15420 13614 14363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_15420 14614 16107 gene locus_tag LOCUS_15430 14614 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 16104 18248 gene locus_tag LOCUS_15440 gene paxB 16104 18248 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 protein_id gnl|my_center|LOCUS_15440 18245 19435 gene locus_tag LOCUS_15450 gene cyaD 18245 19435 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 protein_id gnl|my_center|LOCUS_15450 19535 20134 gene locus_tag LOCUS_15460 19535 20134 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206260.1 protein_id gnl|my_center|LOCUS_15460 20127 20738 gene locus_tag LOCUS_15470 20127 20738 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206261.1 protein_id gnl|my_center|LOCUS_15470 21798 20791 gene locus_tag LOCUS_15480 21798 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 22137 22979 gene locus_tag LOCUS_15490 22137 22979 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115820.1 protein_id gnl|my_center|LOCUS_15490 23758 23090 gene locus_tag LOCUS_15500 23758 23090 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206262.1 protein_id gnl|my_center|LOCUS_15500 24583 23912 gene locus_tag LOCUS_15510 24583 23912 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115771.1 protein_id gnl|my_center|LOCUS_15510 25084 24761 gene locus_tag LOCUS_15520 gene fdxA 25084 24761 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_15520 25858 25409 gene locus_tag LOCUS_15530 25858 25409 CDS product blue light sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206997.1 protein_id gnl|my_center|LOCUS_15530 28760 26115 gene locus_tag LOCUS_15540 gene mutS 28760 26115 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIZ0 protein_id gnl|my_center|LOCUS_15540 28988 29194 gene locus_tag LOCUS_15550 28988 29194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 29555 30613 gene locus_tag LOCUS_15560 29555 30613 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060708.1 protein_id gnl|my_center|LOCUS_15560 30627 31340 gene locus_tag LOCUS_15570 30627 31340 CDS product ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209266.1 protein_id gnl|my_center|LOCUS_15570 31373 32566 gene locus_tag LOCUS_15580 gene ssuD 31373 32566 CDS product FMNH(2)-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206742.1 protein_id gnl|my_center|LOCUS_15580 32577 34151 gene locus_tag LOCUS_15590 gene gsiB 32577 34151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206743.1 protein_id gnl|my_center|LOCUS_15590 34157 35308 gene locus_tag LOCUS_15600 gene y4tP 34157 35308 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206744.1 protein_id gnl|my_center|LOCUS_15600 35305 36153 gene locus_tag LOCUS_15610 35305 36153 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206745.1 protein_id gnl|my_center|LOCUS_15610 36156 37973 gene locus_tag LOCUS_15620 36156 37973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206746.1 protein_id gnl|my_center|LOCUS_15620 38001 39269 gene locus_tag LOCUS_15630 gene soxC 38001 39269 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206747.1 protein_id gnl|my_center|LOCUS_15630 40659 39607 gene locus_tag LOCUS_15640 gene soxB 40659 39607 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209743.1 protein_id gnl|my_center|LOCUS_15640 40898 42754 gene locus_tag LOCUS_15650 40898 42754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206748.1 protein_id gnl|my_center|LOCUS_15650 42751 44583 gene locus_tag LOCUS_15660 42751 44583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206749.1 protein_id gnl|my_center|LOCUS_15660 44750 47242 gene locus_tag LOCUS_15670 44750 47242 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206751.1 protein_id gnl|my_center|LOCUS_15670 47284 48546 gene locus_tag LOCUS_15680 47284 48546 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206752.1 protein_id gnl|my_center|LOCUS_15680 49726 48638 gene locus_tag LOCUS_15690 gene ssuD 49726 48638 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005131911.1 protein_id gnl|my_center|LOCUS_15690 50042 51118 gene locus_tag LOCUS_15700 gene flbD 50042 51118 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846949.1 protein_id gnl|my_center|LOCUS_15700 51894 51148 gene locus_tag LOCUS_15710 gene tatC 51894 51148 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP86 protein_id gnl|my_center|LOCUS_15710 52307 51891 gene locus_tag LOCUS_15720 gene tatB 52307 51891 CDS product twin arginine-targeting protein translocase TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206754.1 protein_id gnl|my_center|LOCUS_15720 52536 52321 gene locus_tag LOCUS_15730 gene tatA 52536 52321 CDS product sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP88 protein_id gnl|my_center|LOCUS_15730 53388 52633 gene locus_tag LOCUS_15740 gene ssuB 53388 52633 CDS product sulfonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_15740 54211 53423 gene locus_tag LOCUS_15750 gene ssuC 54211 53423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206756.1 protein_id gnl|my_center|LOCUS_15750 55050 54211 gene locus_tag LOCUS_15760 gene ssuC 55050 54211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206757.1 protein_id gnl|my_center|LOCUS_15760 56127 55054 gene locus_tag LOCUS_15770 gene ssuA 56127 55054 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206758.1 protein_id gnl|my_center|LOCUS_15770 56443 57570 gene locus_tag LOCUS_15780 gene ssuD 56443 57570 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206759.1 protein_id gnl|my_center|LOCUS_15780 57767 58594 gene locus_tag LOCUS_15790 57767 58594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 58619 59353 gene locus_tag LOCUS_15800 gene exbB 58619 59353 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280218.1 protein_id gnl|my_center|LOCUS_15800 59353 59757 gene locus_tag LOCUS_15810 gene exbD 59353 59757 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018517.1 protein_id gnl|my_center|LOCUS_15810 61405 59822 gene locus_tag LOCUS_15820 gene gsiB 61405 59822 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206761.1 protein_id gnl|my_center|LOCUS_15820 61691 64303 gene locus_tag LOCUS_15830 gene foxA 61691 64303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206762.1 protein_id gnl|my_center|LOCUS_15830 64551 66881 gene locus_tag LOCUS_15840 gene fyuA 64551 66881 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_15840 66900 68093 gene locus_tag LOCUS_15850 gene ssuD 66900 68093 CDS product FMNH2-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013197887.1 protein_id gnl|my_center|LOCUS_15850 69344 68217 gene locus_tag LOCUS_15860 gene citB 69344 68217 CDS product tricarballylate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208451.1 protein_id gnl|my_center|LOCUS_15860 70740 69334 gene locus_tag LOCUS_15870 gene ifcA 70740 69334 CDS product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208452.1 protein_id gnl|my_center|LOCUS_15870 71773 70844 gene locus_tag LOCUS_15880 gene nac 71773 70844 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208453.1 protein_id gnl|my_center|LOCUS_15880 72699 71905 gene locus_tag LOCUS_15890 72699 71905 CDS product substrate-binding protein ABC superfamily, PerI-bind inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208454.1 protein_id gnl|my_center|LOCUS_15890 74099 72789 gene locus_tag LOCUS_15900 gene citA 74099 72789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208455.1 protein_id gnl|my_center|LOCUS_15900 75297 74368 gene locus_tag LOCUS_15910 gene nac 75297 74368 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208456.1 protein_id gnl|my_center|LOCUS_15910 76073 75618 gene locus_tag LOCUS_15920 76073 75618 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068860.1 protein_id gnl|my_center|LOCUS_15920 76237 77103 gene locus_tag LOCUS_15930 76237 77103 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206939.1 protein_id gnl|my_center|LOCUS_15930 77230 77910 gene locus_tag LOCUS_15940 77230 77910 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 protein_id gnl|my_center|LOCUS_15940 77907 78674 gene locus_tag LOCUS_15950 gene cbr4 77907 78674 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207074.1 protein_id gnl|my_center|LOCUS_15950 78676 79341 gene locus_tag LOCUS_15960 78676 79341 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207073.1 protein_id gnl|my_center|LOCUS_15960 79683 79862 gene locus_tag LOCUS_15970 79683 79862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 80161 80358 gene locus_tag LOCUS_15980 80161 80358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 80744 81757 gene locus_tag LOCUS_15990 80744 81757 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206241.1 protein_id gnl|my_center|LOCUS_15990 81745 82521 gene locus_tag LOCUS_16000 81745 82521 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206243.1 protein_id gnl|my_center|LOCUS_16000 82514 83113 gene locus_tag LOCUS_16010 gene nodS 82514 83113 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206244.1 protein_id gnl|my_center|LOCUS_16010 83110 83754 gene locus_tag LOCUS_16020 83110 83754 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206245.1 protein_id gnl|my_center|LOCUS_16020 84458 84249 gene locus_tag LOCUS_16030 84458 84249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 84544 84735 gene locus_tag LOCUS_16040 84544 84735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 84760 85710 gene locus_tag LOCUS_16050 84760 85710 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_16050 85761 86039 gene locus_tag LOCUS_16060 85761 86039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 86320 86448 gene locus_tag LOCUS_16070 86320 86448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 86875 87639 gene locus_tag LOCUS_16080 86875 87639 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189909.1 protein_id gnl|my_center|LOCUS_16080 87636 88829 gene locus_tag LOCUS_16090 87636 88829 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_16090 88833 89897 gene locus_tag LOCUS_16100 88833 89897 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_16100 89894 90688 gene locus_tag LOCUS_16110 89894 90688 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_16110 90685 91848 gene locus_tag LOCUS_16120 90685 91848 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090530.1 protein_id gnl|my_center|LOCUS_16120 91845 92819 gene locus_tag LOCUS_16130 91845 92819 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_16130 92852 93628 gene locus_tag LOCUS_16140 gene fadB 92852 93628 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_16140 93669 95222 gene locus_tag LOCUS_16150 93669 95222 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_16150 95679 96545 gene locus_tag LOCUS_16160 95679 96545 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 protein_id gnl|my_center|LOCUS_16160 96591 97811 gene locus_tag LOCUS_16170 96591 97811 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224422.1 protein_id gnl|my_center|LOCUS_16170 97822 98667 gene locus_tag LOCUS_16180 97822 98667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 98827 100290 gene locus_tag LOCUS_16190 gene feaB 98827 100290 CDS product phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528142.1 protein_id gnl|my_center|LOCUS_16190 100320 101435 gene locus_tag LOCUS_16200 100320 101435 CDS product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_16200 101455 101769 gene locus_tag LOCUS_16210 101455 101769 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 protein_id gnl|my_center|LOCUS_16210 101770 103011 gene locus_tag LOCUS_16220 101770 103011 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887717.1 protein_id gnl|my_center|LOCUS_16220 103687 103070 gene locus_tag LOCUS_16230 103687 103070 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040681.1 protein_id gnl|my_center|LOCUS_16230 105924 103972 gene locus_tag LOCUS_16240 105924 103972 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL03 protein_id gnl|my_center|LOCUS_16240 106831 105899 gene locus_tag LOCUS_16250 106831 105899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_16250 108012 107086 gene locus_tag LOCUS_16260 gene srpH 108012 107086 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206475.1 protein_id gnl|my_center|LOCUS_16260 108557 108063 gene locus_tag LOCUS_16270 108557 108063 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206476.1 protein_id gnl|my_center|LOCUS_16270 108935 110560 gene locus_tag LOCUS_16280 gene atsB 108935 110560 CDS product sulfate ester permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206765.1 protein_id gnl|my_center|LOCUS_16280 110570 111385 gene locus_tag LOCUS_16290 gene atsC 110570 111385 CDS product sulfonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206766.1 protein_id gnl|my_center|LOCUS_16290 111398 112243 gene locus_tag LOCUS_16300 gene tonB2 111398 112243 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206767.1 protein_id gnl|my_center|LOCUS_16300 112280 113014 gene locus_tag LOCUS_16310 gene exbB 112280 113014 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206768.1 protein_id gnl|my_center|LOCUS_16310 113014 113421 gene locus_tag LOCUS_16320 gene exbD 113014 113421 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206769.1 protein_id gnl|my_center|LOCUS_16320 113578 114375 gene locus_tag LOCUS_16330 gene crp 113578 114375 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206770.1 protein_id gnl|my_center|LOCUS_16330 114495 115403 gene locus_tag LOCUS_16340 114495 115403 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206771.1 protein_id gnl|my_center|LOCUS_16340 115454 116521 gene locus_tag LOCUS_16350 gene astR 115454 116521 CDS product aryl sulfate ester ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206772.1 protein_id gnl|my_center|LOCUS_16350 116557 118845 gene locus_tag LOCUS_16360 gene fyuA 116557 118845 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_16360 118909 120237 gene locus_tag LOCUS_16370 gene ntaA 118909 120237 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206774.1 protein_id gnl|my_center|LOCUS_16370 120249 121247 gene locus_tag LOCUS_16380 gene yghZ 120249 121247 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206775.1 protein_id gnl|my_center|LOCUS_16380 123791 121314 gene locus_tag LOCUS_16390 gene fyuA 123791 121314 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_16390 125680 124016 gene locus_tag LOCUS_16400 gene atsA 125680 124016 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206777.1 protein_id gnl|my_center|LOCUS_16400 126619 125798 gene locus_tag LOCUS_16410 126619 125798 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701544.1 protein_id gnl|my_center|LOCUS_16410 126841 127794 gene locus_tag LOCUS_16420 gene atsK 126841 127794 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206778.1 protein_id gnl|my_center|LOCUS_16420 127868 128971 gene locus_tag LOCUS_16430 127868 128971 CDS product sulfate ester-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206779.1 protein_id gnl|my_center|LOCUS_16430 129979 129095 gene locus_tag LOCUS_16440 gene mauR 129979 129095 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208095.1 protein_id gnl|my_center|LOCUS_16440 130149 131657 gene locus_tag LOCUS_16450 gene mmsA 130149 131657 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208096.1 protein_id gnl|my_center|LOCUS_16450 131672 132565 gene locus_tag LOCUS_16460 gene mmsB 131672 132565 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJC0 protein_id gnl|my_center|LOCUS_16460 132644 134287 gene locus_tag LOCUS_16470 132644 134287 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_16470 134369 135496 gene locus_tag LOCUS_16480 gene mmgC 134369 135496 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160774.1 protein_id gnl|my_center|LOCUS_16480 135549 136322 gene locus_tag LOCUS_16490 gene fadB1 135549 136322 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069758.1 protein_id gnl|my_center|LOCUS_16490 136335 137363 gene locus_tag LOCUS_16500 gene hibcH 136335 137363 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208100.1 protein_id gnl|my_center|LOCUS_16500 138478 137435 gene locus_tag LOCUS_16510 gene rrp12 138478 137435 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_16510 138920 140563 gene locus_tag LOCUS_16520 138920 140563 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_16520 140616 141797 gene locus_tag LOCUS_16530 gene phbA-2 140616 141797 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104413.1 protein_id gnl|my_center|LOCUS_16530 141814 142941 gene locus_tag LOCUS_16540 141814 142941 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_16540 144225 143017 gene locus_tag LOCUS_16550 144225 143017 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269411.1 protein_id gnl|my_center|LOCUS_16550 144910 144266 gene locus_tag LOCUS_16560 144910 144266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 145552 144953 gene locus_tag LOCUS_16570 145552 144953 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531052.1 protein_id gnl|my_center|LOCUS_16570 <146844 145637 gene locus_tag LOCUS_16580 <146844 145637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083030.1:amidase >Feature sequence10 <1 731 gene locus_tag LOCUS_16590 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system protein 738 3743 gene locus_tag LOCUS_16600 738 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4746 3763 gene locus_tag LOCUS_16610 4746 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5853 4885 gene locus_tag LOCUS_16620 5853 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 7673 6279 gene locus_tag LOCUS_16630 gene cmeC 7673 6279 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208366.1 protein_id gnl|my_center|LOCUS_16630 9679 7685 gene locus_tag LOCUS_16640 gene macB 9679 7685 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT1 protein_id gnl|my_center|LOCUS_16640 11031 9679 gene locus_tag LOCUS_16650 gene macA 11031 9679 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 protein_id gnl|my_center|LOCUS_16650 12127 11132 gene locus_tag LOCUS_16660 gene holA 12127 11132 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208369.1 protein_id gnl|my_center|LOCUS_16660 12659 12144 gene locus_tag LOCUS_16670 gene rlpB 12659 12144 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT4 protein_id gnl|my_center|LOCUS_16670 15308 12687 gene locus_tag LOCUS_16680 gene leuS 15308 12687 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT5 protein_id gnl|my_center|LOCUS_16680 15838 15458 gene locus_tag LOCUS_16690 15838 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 16376 18100 gene locus_tag LOCUS_16700 gene ilvI 16376 18100 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT6 protein_id gnl|my_center|LOCUS_16700 18100 18591 gene locus_tag LOCUS_16710 gene ilvH 18100 18591 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_16710 18624 19640 gene locus_tag LOCUS_16720 gene ilvC 18624 19640 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT8 protein_id gnl|my_center|LOCUS_16720 19921 21957 gene locus_tag LOCUS_16730 19921 21957 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066201.1 protein_id gnl|my_center|LOCUS_16730 22415 24004 gene locus_tag LOCUS_16740 gene prfC 22415 24004 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU2 protein_id gnl|my_center|LOCUS_16740 24083 24901 gene locus_tag LOCUS_16750 24083 24901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117238.1 protein_id gnl|my_center|LOCUS_16750 24989 25927 gene locus_tag LOCUS_16760 24989 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208372.1 protein_id gnl|my_center|LOCUS_16760 25931 26749 gene locus_tag LOCUS_16770 25931 26749 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_16770 26869 29622 gene locus_tag LOCUS_16780 gene acnA 26869 29622 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU6 protein_id gnl|my_center|LOCUS_16780 29732 30223 gene locus_tag LOCUS_16790 29732 30223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114204.1 protein_id gnl|my_center|LOCUS_16790 30318 31091 gene locus_tag LOCUS_16800 30318 31091 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_16800 31597 31118 gene locus_tag LOCUS_16810 31597 31118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208378.1 protein_id gnl|my_center|LOCUS_16810 32921 31914 gene locus_tag LOCUS_16820 gene dusA 32921 31914 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA5 protein_id gnl|my_center|LOCUS_16820 34209 33013 gene locus_tag LOCUS_16830 gene ygaY 34209 33013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208380.1 protein_id gnl|my_center|LOCUS_16830 34643 34224 gene locus_tag LOCUS_16840 34643 34224 CDS product flavin-containing amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 protein_id gnl|my_center|LOCUS_16840 34709 35203 gene locus_tag LOCUS_16850 gene soxR 34709 35203 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206380.1 protein_id gnl|my_center|LOCUS_16850 35844 35200 gene locus_tag LOCUS_16860 35844 35200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 36361 37488 gene locus_tag LOCUS_16870 gene pntA1 36361 37488 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_16870 37500 37814 gene locus_tag LOCUS_16880 37500 37814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 37827 39281 gene locus_tag LOCUS_16890 gene pntB 37827 39281 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB1 protein_id gnl|my_center|LOCUS_16890 39379 39672 gene locus_tag LOCUS_16900 39379 39672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 40178 39777 gene locus_tag LOCUS_16910 gene rsfS 40178 39777 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB4 protein_id gnl|my_center|LOCUS_16910 41096 40299 gene locus_tag LOCUS_16920 gene hyi 41096 40299 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_16920 41987 41112 gene locus_tag LOCUS_16930 gene glxR 41987 41112 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208388.1 protein_id gnl|my_center|LOCUS_16930 42790 42002 gene locus_tag LOCUS_16940 gene ech1 42790 42002 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_16940 45669 42871 gene locus_tag LOCUS_16950 gene barA 45669 42871 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 protein_id gnl|my_center|LOCUS_16950 45825 46748 gene locus_tag LOCUS_16960 gene cysM 45825 46748 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_16960 46781 47614 gene locus_tag LOCUS_16970 46781 47614 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 protein_id gnl|my_center|LOCUS_16970 47611 49002 gene locus_tag LOCUS_16980 gene rlmD 47611 49002 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC1 protein_id gnl|my_center|LOCUS_16980 49035 51341 gene locus_tag LOCUS_16990 gene relA 49035 51341 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_16990 52170 51388 gene locus_tag LOCUS_17000 52170 51388 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_17000 52284 53051 gene locus_tag LOCUS_17010 gene mazG 52284 53051 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_17010 53055 53441 gene locus_tag LOCUS_17020 53055 53441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 53566 55023 gene locus_tag LOCUS_17030 gene pcnB 53566 55023 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC6 protein_id gnl|my_center|LOCUS_17030 55020 55508 gene locus_tag LOCUS_17040 gene folK 55020 55508 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 protein_id gnl|my_center|LOCUS_17040 55546 56355 gene locus_tag LOCUS_17050 gene panB 55546 56355 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC8 protein_id gnl|my_center|LOCUS_17050 56359 57204 gene locus_tag LOCUS_17060 gene panC 56359 57204 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC9 protein_id gnl|my_center|LOCUS_17060 57226 58077 gene locus_tag LOCUS_17070 57226 58077 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND0 protein_id gnl|my_center|LOCUS_17070 58074 58343 gene locus_tag LOCUS_17080 gene ptsO 58074 58343 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984428.1 protein_id gnl|my_center|LOCUS_17080 58346 58879 gene locus_tag LOCUS_17090 58346 58879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208401.1 protein_id gnl|my_center|LOCUS_17090 60607 58964 gene locus_tag LOCUS_17100 gene alkK 60607 58964 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208402.1 protein_id gnl|my_center|LOCUS_17100 61020 62942 gene locus_tag LOCUS_17110 gene thrS 61020 62942 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND4 protein_id gnl|my_center|LOCUS_17110 63029 63499 gene locus_tag LOCUS_17120 gene infC 63029 63499 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGL7 protein_id gnl|my_center|LOCUS_17120 64075 63608 gene locus_tag LOCUS_17130 gene ibpA 64075 63608 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_17130 64374 64994 gene locus_tag LOCUS_17140 gene yfcG 64374 64994 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_17140 65097 65525 gene locus_tag LOCUS_17150 65097 65525 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_17150 66296 65568 gene locus_tag LOCUS_17160 66296 65568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 67642 66389 gene locus_tag LOCUS_17170 gene entS 67642 66389 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_17170 67879 68073 gene locus_tag LOCUS_17180 gene rpmI 67879 68073 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_17180 68085 68444 gene locus_tag LOCUS_17190 gene rplT 68085 68444 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE1 protein_id gnl|my_center|LOCUS_17190 68913 69110 gene locus_tag LOCUS_17200 68913 69110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 70202 69162 gene locus_tag LOCUS_17210 70202 69162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208406.1 protein_id gnl|my_center|LOCUS_17210 70357 71337 gene locus_tag LOCUS_17220 gene pheS 70357 71337 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE3 protein_id gnl|my_center|LOCUS_17220 71372 73753 gene locus_tag LOCUS_17230 gene pheT 71372 73753 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE4 protein_id gnl|my_center|LOCUS_17230 73750 74043 gene locus_tag LOCUS_17240 gene ihfA 73750 74043 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE5 protein_id gnl|my_center|LOCUS_17240 74466 74200 gene locus_tag LOCUS_17250 74466 74200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 76150 74882 gene locus_tag LOCUS_17260 gene rho 76150 74882 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE8 protein_id gnl|my_center|LOCUS_17260 76814 76488 gene locus_tag LOCUS_17270 gene trxA 76814 76488 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE9 protein_id gnl|my_center|LOCUS_17270 77092 78612 gene locus_tag LOCUS_17280 gene ppx 77092 78612 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_17280 78648 79472 gene locus_tag LOCUS_17290 gene accA 78648 79472 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF1 protein_id gnl|my_center|LOCUS_17290 79529 80788 gene locus_tag LOCUS_17300 gene mesJ 79529 80788 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF2 protein_id gnl|my_center|LOCUS_17300 80785 81621 gene locus_tag LOCUS_17310 gene proC 80785 81621 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_17310 81638 82204 gene locus_tag LOCUS_17320 81638 82204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_17320 85017 82255 gene locus_tag LOCUS_17330 gene polA 85017 82255 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_17330 85172 88075 gene locus_tag LOCUS_17340 85172 88075 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 protein_id gnl|my_center|LOCUS_17340 89183 88263 gene locus_tag LOCUS_17350 89183 88263 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066312.1 protein_id gnl|my_center|LOCUS_17350 90013 89192 gene locus_tag LOCUS_17360 90013 89192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804297.1 protein_id gnl|my_center|LOCUS_17360 90114 91601 gene locus_tag LOCUS_17370 gene xcpR 90114 91601 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_17370 92086 91655 gene locus_tag LOCUS_17380 92086 91655 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_17380 92608 92171 gene locus_tag LOCUS_17390 gene ohrR 92608 92171 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208415.1 protein_id gnl|my_center|LOCUS_17390 93522 92698 gene locus_tag LOCUS_17400 93522 92698 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 protein_id gnl|my_center|LOCUS_17400 94068 93547 gene locus_tag LOCUS_17410 94068 93547 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 protein_id gnl|my_center|LOCUS_17410 95150 94182 gene locus_tag LOCUS_17420 gene rsbP 95150 94182 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117221.1 protein_id gnl|my_center|LOCUS_17420 96209 95283 gene locus_tag LOCUS_17430 gene vacJ 96209 95283 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208418.1 protein_id gnl|my_center|LOCUS_17430 96340 96492 gene locus_tag LOCUS_17440 96340 96492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence11 322 618 gene locus_tag LOCUS_17450 322 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1580 852 gene locus_tag LOCUS_17460 1580 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2008 1676 gene locus_tag LOCUS_17470 2008 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2482 2835 gene locus_tag LOCUS_17480 2482 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2868 3179 gene locus_tag LOCUS_17490 2868 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3160 3435 gene locus_tag LOCUS_17500 3160 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3637 3936 gene locus_tag LOCUS_17510 3637 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4009 4158 gene locus_tag LOCUS_17520 4009 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4168 4620 gene locus_tag LOCUS_17530 4168 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5075 5710 gene locus_tag LOCUS_17540 5075 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6971 6792 gene locus_tag LOCUS_17550 6971 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7781 6972 gene locus_tag LOCUS_17560 7781 6972 CDS product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703343.1 protein_id gnl|my_center|LOCUS_17560 9501 7969 gene locus_tag LOCUS_17570 9501 7969 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_17570 9965 10570 gene locus_tag LOCUS_17580 9965 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 10939 12312 gene locus_tag LOCUS_17590 10939 12312 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_17590 12299 12988 gene locus_tag LOCUS_17600 12299 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 13072 14418 gene locus_tag LOCUS_17610 13072 14418 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_17610 15251 17017 gene locus_tag LOCUS_17620 gene shlB 15251 17017 CDS product hemolysin activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206849.1 protein_id gnl|my_center|LOCUS_17620 17110 23112 gene locus_tag LOCUS_17630 gene fhaB 17110 23112 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206848.1 protein_id gnl|my_center|LOCUS_17630 23125 24498 gene locus_tag LOCUS_17640 23125 24498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 24777 24971 gene locus_tag LOCUS_17650 24777 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 25157 25381 gene locus_tag LOCUS_17660 25157 25381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17660 25391 25642 gene locus_tag LOCUS_17670 25391 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17670 25639 25854 gene locus_tag LOCUS_17680 25639 25854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17680 26619 27545 gene locus_tag LOCUS_17690 26619 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 28302 29465 gene locus_tag LOCUS_17700 gene basJ 28302 29465 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207276.1 protein_id gnl|my_center|LOCUS_17700 29559 30188 gene locus_tag LOCUS_17710 29559 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 30222 31001 gene locus_tag LOCUS_17720 30222 31001 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706306.1 protein_id gnl|my_center|LOCUS_17720 31017 33509 gene locus_tag LOCUS_17730 31017 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 33512 36757 gene locus_tag LOCUS_17740 33512 36757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 36773 39973 gene locus_tag LOCUS_17750 36773 39973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 39986 41605 gene locus_tag LOCUS_17760 39986 41605 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960113.1 protein_id gnl|my_center|LOCUS_17760 41619 42959 gene locus_tag LOCUS_17770 41619 42959 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028584.1 protein_id gnl|my_center|LOCUS_17770 42969 44129 gene locus_tag LOCUS_17780 42969 44129 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_17780 44213 44821 gene locus_tag LOCUS_17790 gene rhbD 44213 44821 CDS product rhizobactin siderophore biosynthesis protein RhbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q9 protein_id gnl|my_center|LOCUS_17790 45851 45024 gene locus_tag LOCUS_17800 gene basI 45851 45024 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207277.1 protein_id gnl|my_center|LOCUS_17800 46616 45876 gene locus_tag LOCUS_17810 gene basH 46616 45876 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207278.1 protein_id gnl|my_center|LOCUS_17810 46867 49014 gene locus_tag LOCUS_17820 46867 49014 CDS product TonB dependent/Ligand-Gated channel TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706422.1 protein_id gnl|my_center|LOCUS_17820 49050 50273 gene locus_tag LOCUS_17830 49050 50273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 protein_id gnl|my_center|LOCUS_17830 50330 51451 gene locus_tag LOCUS_17840 50330 51451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 51491 52831 gene locus_tag LOCUS_17850 51491 52831 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285045.1 protein_id gnl|my_center|LOCUS_17850 53386 54066 gene locus_tag LOCUS_17860 gene ydhC 53386 54066 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208068.1 protein_id gnl|my_center|LOCUS_17860 54090 54974 gene locus_tag LOCUS_17870 gene prpB 54090 54974 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT4 protein_id gnl|my_center|LOCUS_17870 55191 56348 gene locus_tag LOCUS_17880 gene prpC 55191 56348 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT5 protein_id gnl|my_center|LOCUS_17880 56348 58981 gene locus_tag LOCUS_17890 gene acnA 56348 58981 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208069.1 protein_id gnl|my_center|LOCUS_17890 59060 59278 gene locus_tag LOCUS_17900 59060 59278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 59308 60144 gene locus_tag LOCUS_17910 59308 60144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_17910 60540 61019 gene locus_tag LOCUS_17920 60540 61019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 61943 62143 gene locus_tag LOCUS_17930 61943 62143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 62306 62127 gene locus_tag LOCUS_17940 62306 62127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 62658 63527 gene locus_tag LOCUS_17950 62658 63527 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269056.1 protein_id gnl|my_center|LOCUS_17950 63776 64621 gene locus_tag LOCUS_17960 63776 64621 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 protein_id gnl|my_center|LOCUS_17960 65383 64697 gene locus_tag LOCUS_17970 gene ybeQ 65383 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208073.1 protein_id gnl|my_center|LOCUS_17970 66188 65547 gene locus_tag LOCUS_17980 gene rhtC 66188 65547 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114256.1 protein_id gnl|my_center|LOCUS_17980 66278 67234 gene locus_tag LOCUS_17990 gene ltrA 66278 67234 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206473.1 protein_id gnl|my_center|LOCUS_17990 67411 69279 gene locus_tag LOCUS_18000 67411 69279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206735.1 protein_id gnl|my_center|LOCUS_18000 69667 70230 gene locus_tag LOCUS_18010 gene ydhM 69667 70230 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_18010 70227 70907 gene locus_tag LOCUS_18020 70227 70907 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268356.1 protein_id gnl|my_center|LOCUS_18020 70952 71935 gene locus_tag LOCUS_18030 gene mecR 70952 71935 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207904.1 protein_id gnl|my_center|LOCUS_18030 72452 73132 gene locus_tag LOCUS_18040 gene pqiA 72452 73132 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207187.1 protein_id gnl|my_center|LOCUS_18040 73129 73911 gene locus_tag LOCUS_18050 73129 73911 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207186.1 protein_id gnl|my_center|LOCUS_18050 73961 75610 gene locus_tag LOCUS_18060 gene pqiB 73961 75610 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207185.1 protein_id gnl|my_center|LOCUS_18060 75666 76319 gene locus_tag LOCUS_18070 75666 76319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207184.1 protein_id gnl|my_center|LOCUS_18070 76771 77211 gene locus_tag LOCUS_18080 76771 77211 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_18080 77663 77418 gene locus_tag LOCUS_18090 77663 77418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114518.1 protein_id gnl|my_center|LOCUS_18090 77807 78418 gene locus_tag LOCUS_18100 gene umuD 77807 78418 CDS product DNA polymerase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_18100 78421 78573 gene locus_tag LOCUS_18110 78421 78573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 79736 78849 gene locus_tag LOCUS_18120 79736 78849 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 protein_id gnl|my_center|LOCUS_18120 79850 79975 gene locus_tag LOCUS_18130 79850 79975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 80032 81105 gene locus_tag LOCUS_18140 80032 81105 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971004.1 protein_id gnl|my_center|LOCUS_18140 81117 81848 gene locus_tag LOCUS_18150 81117 81848 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705015.1 protein_id gnl|my_center|LOCUS_18150 81873 82478 gene locus_tag LOCUS_18160 81873 82478 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227501.1 protein_id gnl|my_center|LOCUS_18160 82479 82724 gene locus_tag LOCUS_18170 82479 82724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 82788 83906 gene locus_tag LOCUS_18180 gene pqsH 82788 83906 CDS product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q0 protein_id gnl|my_center|LOCUS_18180 84497 84844 gene locus_tag LOCUS_18190 84497 84844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 85037 85225 gene locus_tag LOCUS_18200 85037 85225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 86137 85688 gene locus_tag LOCUS_18210 86137 85688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 87138 86872 gene locus_tag LOCUS_18220 87138 86872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 87458 87147 gene locus_tag LOCUS_18230 87458 87147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence12 376 302 gene locus_tag LOCUS_t00230 376 302 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 465 390 gene locus_tag LOCUS_t00240 465 390 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 586 503 gene locus_tag LOCUS_t00250 586 503 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 720 645 gene locus_tag LOCUS_t00260 720 645 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2312 819 gene locus_tag LOCUS_18240 gene trpE 2312 819 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 protein_id gnl|my_center|LOCUS_18240 3081 2416 gene locus_tag LOCUS_18250 gene gph 3081 2416 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_18250 3810 3154 gene locus_tag LOCUS_18260 3810 3154 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208196.1 protein_id gnl|my_center|LOCUS_18260 6195 3877 gene locus_tag LOCUS_18270 gene xcpQ 6195 3877 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_18270 7081 6236 gene locus_tag LOCUS_18280 7081 6236 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079413.1 protein_id gnl|my_center|LOCUS_18280 7824 7081 gene locus_tag LOCUS_18290 7824 7081 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 protein_id gnl|my_center|LOCUS_18290 8313 7987 gene locus_tag LOCUS_18300 gene hvrA 8313 7987 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_18300 8960 8520 gene locus_tag LOCUS_18310 gene ysmA 8960 8520 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208193.1 protein_id gnl|my_center|LOCUS_18310 10162 8969 gene locus_tag LOCUS_18320 10162 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208192.1 protein_id gnl|my_center|LOCUS_18320 11008 10178 gene locus_tag LOCUS_18330 11008 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208191.1 protein_id gnl|my_center|LOCUS_18330 11787 11017 gene locus_tag LOCUS_18340 gene hemD 11787 11017 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_18340 12714 11794 gene locus_tag LOCUS_18350 gene hemC 12714 11794 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_18350 13563 12823 gene locus_tag LOCUS_18360 gene algR 13563 12823 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_18360 14772 13621 gene locus_tag LOCUS_18370 gene algZ 14772 13621 CDS product alginate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208187.1 protein_id gnl|my_center|LOCUS_18370 14763 16196 gene locus_tag LOCUS_18380 gene argH 14763 16196 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_18380 16206 16478 gene locus_tag LOCUS_18390 16206 16478 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_18390 17870 17145 gene locus_tag LOCUS_18400 gene phoU 17870 17145 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM7 protein_id gnl|my_center|LOCUS_18400 19328 17961 gene locus_tag LOCUS_18410 19328 17961 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208186.1 protein_id gnl|my_center|LOCUS_18410 19681 21576 gene locus_tag LOCUS_18420 gene thiC 19681 21576 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM1 protein_id gnl|my_center|LOCUS_18420 21658 22278 gene locus_tag LOCUS_18430 gene aspP 21658 22278 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208182.1 protein_id gnl|my_center|LOCUS_18430 22281 23090 gene locus_tag LOCUS_18440 gene icc 22281 23090 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL9 protein_id gnl|my_center|LOCUS_18440 23302 23832 gene locus_tag LOCUS_18450 gene dksA 23302 23832 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL8 protein_id gnl|my_center|LOCUS_18450 23837 24715 gene locus_tag LOCUS_18460 gene gluQ 23837 24715 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK58 protein_id gnl|my_center|LOCUS_18460 26006 24810 gene locus_tag LOCUS_18470 gene ftsW 26006 24810 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK57 protein_id gnl|my_center|LOCUS_18470 27377 26031 gene locus_tag LOCUS_18480 gene murD 27377 26031 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_18480 27787 27536 gene locus_tag LOCUS_18490 27787 27536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208178.1 protein_id gnl|my_center|LOCUS_18490 29657 27804 gene locus_tag LOCUS_18500 gene feoB 29657 27804 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 protein_id gnl|my_center|LOCUS_18500 29917 29654 gene locus_tag LOCUS_18510 gene feoA 29917 29654 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121198.1 protein_id gnl|my_center|LOCUS_18510 30070 30987 gene locus_tag LOCUS_18520 gene xerD 30070 30987 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK52 protein_id gnl|my_center|LOCUS_18520 31117 31929 gene locus_tag LOCUS_18530 gene dsbC 31117 31929 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_18530 32105 33406 gene locus_tag LOCUS_18540 gene hom 32105 33406 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK50 protein_id gnl|my_center|LOCUS_18540 33467 34606 gene locus_tag LOCUS_18550 gene thrC 33467 34606 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_18550 35758 34700 gene locus_tag LOCUS_18560 gene pbpG 35758 34700 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121158.1 protein_id gnl|my_center|LOCUS_18560 35972 36607 gene locus_tag LOCUS_18570 gene gacA 35972 36607 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_18570 36629 38206 gene locus_tag LOCUS_18580 gene pilS 36629 38206 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208173.1 protein_id gnl|my_center|LOCUS_18580 38224 39639 gene locus_tag LOCUS_18590 gene pilR 38224 39639 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208172.1 protein_id gnl|my_center|LOCUS_18590 40822 39641 gene locus_tag LOCUS_18600 gene ctpA 40822 39641 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208171.1 protein_id gnl|my_center|LOCUS_18600 42380 40833 gene locus_tag LOCUS_18610 gene gpmI 42380 40833 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK43 protein_id gnl|my_center|LOCUS_18610 43572 42502 gene locus_tag LOCUS_18620 43572 42502 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_18620 44672 43572 gene locus_tag LOCUS_18630 44672 43572 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_18630 44827 46275 gene locus_tag LOCUS_18640 gene pepA 44827 46275 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK40 protein_id gnl|my_center|LOCUS_18640 46268 46675 gene locus_tag LOCUS_18650 gene holC 46268 46675 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121193.1 protein_id gnl|my_center|LOCUS_18650 46711 47343 gene locus_tag LOCUS_18660 46711 47343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121184.1 protein_id gnl|my_center|LOCUS_18660 47466 47684 gene locus_tag LOCUS_18670 47466 47684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121224.1 protein_id gnl|my_center|LOCUS_18670 48391 47732 gene locus_tag LOCUS_18680 gene ribC 48391 47732 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_18680 49731 48436 gene locus_tag LOCUS_18690 49731 48436 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_18690 50819 49728 gene locus_tag LOCUS_18700 gene ribD 50819 49728 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK34 protein_id gnl|my_center|LOCUS_18700 51288 50809 gene locus_tag LOCUS_18710 gene nrdR 51288 50809 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK33 protein_id gnl|my_center|LOCUS_18710 52811 51411 gene locus_tag LOCUS_18720 gene amtB 52811 51411 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK32 protein_id gnl|my_center|LOCUS_18720 53211 52873 gene locus_tag LOCUS_18730 gene glnK 53211 52873 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_18730 53444 53716 gene locus_tag LOCUS_18740 53444 53716 CDS product membrane fusogenic activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121136.1 protein_id gnl|my_center|LOCUS_18740 53786 55273 gene locus_tag LOCUS_18750 gene yifB 53786 55273 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_18750 56166 55342 gene locus_tag LOCUS_18760 56166 55342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_18760 56789 58090 gene locus_tag LOCUS_18770 gene oprD 56789 58090 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 protein_id gnl|my_center|LOCUS_18770 58708 58181 gene locus_tag LOCUS_18780 gene ppa 58708 58181 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK21 protein_id gnl|my_center|LOCUS_18780 59233 58835 gene locus_tag LOCUS_18790 59233 58835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_18790 59344 59724 gene locus_tag LOCUS_18800 59344 59724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 protein_id gnl|my_center|LOCUS_18800 61459 59780 gene locus_tag LOCUS_18810 gene fadD 61459 59780 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_18810 63822 61606 gene locus_tag LOCUS_18820 gene parC 63822 61606 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK17 protein_id gnl|my_center|LOCUS_18820 65299 63980 gene locus_tag LOCUS_18830 65299 63980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121171.1 protein_id gnl|my_center|LOCUS_18830 66175 65531 gene locus_tag LOCUS_18840 66175 65531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_18840 66694 66224 gene locus_tag LOCUS_18850 66694 66224 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_18850 68351 66756 gene locus_tag LOCUS_18860 gene yoaE 68351 66756 CDS product S-adenosylmethionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208153.1 protein_id gnl|my_center|LOCUS_18860 68681 69298 gene locus_tag LOCUS_18870 68681 69298 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK12 protein_id gnl|my_center|LOCUS_18870 69512 70825 gene locus_tag LOCUS_18880 gene farB 69512 70825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208151.1 protein_id gnl|my_center|LOCUS_18880 70900 71661 gene locus_tag LOCUS_18890 gene yegX 70900 71661 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_18890 71658 72713 gene locus_tag LOCUS_18900 gene dinP 71658 72713 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK09 protein_id gnl|my_center|LOCUS_18900 72934 74271 gene locus_tag LOCUS_18910 72934 74271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378596.1 protein_id gnl|my_center|LOCUS_18910 74272 74625 gene locus_tag LOCUS_18920 74272 74625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 protein_id gnl|my_center|LOCUS_18920 75144 74626 gene locus_tag LOCUS_18930 75144 74626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208143.1 protein_id gnl|my_center|LOCUS_18930 77929 75536 gene locus_tag LOCUS_18940 77929 75536 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK01 protein_id gnl|my_center|LOCUS_18940 78788 78144 gene locus_tag LOCUS_18950 78788 78144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence13 75 1 gene locus_tag LOCUS_t00270 75 1 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 218 739 gene locus_tag LOCUS_18960 218 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207361.1 protein_id gnl|my_center|LOCUS_18960 2080 848 gene locus_tag LOCUS_18970 gene aspC 2080 848 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_18970 2294 2476 gene locus_tag LOCUS_18980 2294 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118942.1 protein_id gnl|my_center|LOCUS_18980 4224 2800 gene locus_tag LOCUS_18990 gene yedQ 4224 2800 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207358.1 protein_id gnl|my_center|LOCUS_18990 5092 4373 gene locus_tag LOCUS_19000 5092 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207357.1 protein_id gnl|my_center|LOCUS_19000 5389 6081 gene locus_tag LOCUS_19010 5389 6081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261606.1 protein_id gnl|my_center|LOCUS_19010 6168 8189 gene locus_tag LOCUS_19020 gene uvrB 6168 8189 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ7 protein_id gnl|my_center|LOCUS_19020 8317 8907 gene locus_tag LOCUS_19030 gene blc 8317 8907 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207356.1 protein_id gnl|my_center|LOCUS_19030 9020 9952 gene locus_tag LOCUS_19040 gene rarD 9020 9952 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207355.1 protein_id gnl|my_center|LOCUS_19040 10199 11656 gene locus_tag LOCUS_19050 gene gap 10199 11656 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ4 protein_id gnl|my_center|LOCUS_19050 11814 12551 gene locus_tag LOCUS_19060 11814 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207353.1 protein_id gnl|my_center|LOCUS_19060 12560 13240 gene locus_tag LOCUS_19070 12560 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207352.1 protein_id gnl|my_center|LOCUS_19070 13388 14590 gene locus_tag LOCUS_19080 gene yhbZ 13388 14590 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ1 protein_id gnl|my_center|LOCUS_19080 14609 15742 gene locus_tag LOCUS_19090 gene proB 14609 15742 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ0 protein_id gnl|my_center|LOCUS_19090 16423 15770 gene locus_tag LOCUS_19100 gene cicA 16423 15770 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067866.1 protein_id gnl|my_center|LOCUS_19100 17601 16390 gene locus_tag LOCUS_19110 17601 16390 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207351.1 protein_id gnl|my_center|LOCUS_19110 17684 18709 gene locus_tag LOCUS_19120 gene dusB 17684 18709 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKI7 protein_id gnl|my_center|LOCUS_19120 19751 18711 gene locus_tag LOCUS_19130 19751 18711 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207349.1 protein_id gnl|my_center|LOCUS_19130 20106 20339 gene locus_tag LOCUS_19140 20106 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 20600 21466 gene locus_tag LOCUS_19150 gene purU-2 20600 21466 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B4 protein_id gnl|my_center|LOCUS_19150 21463 22356 gene locus_tag LOCUS_19160 gene folD2 21463 22356 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B5 protein_id gnl|my_center|LOCUS_19160 22398 23636 gene locus_tag LOCUS_19170 gene soxB-2 22398 23636 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_19170 23649 23975 gene locus_tag LOCUS_19180 23649 23975 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267521.1 protein_id gnl|my_center|LOCUS_19180 23972 26893 gene locus_tag LOCUS_19190 23972 26893 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_19190 26896 27567 gene locus_tag LOCUS_19200 gene soxG-2 26896 27567 CDS product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104012.1 protein_id gnl|my_center|LOCUS_19200 27986 27693 gene locus_tag LOCUS_19210 27986 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206410.1 protein_id gnl|my_center|LOCUS_19210 28683 28003 gene locus_tag LOCUS_19220 gene ydhC 28683 28003 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049494.1 protein_id gnl|my_center|LOCUS_19220 28829 29431 gene locus_tag LOCUS_19230 28829 29431 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420415.1 protein_id gnl|my_center|LOCUS_19230 29400 30191 gene locus_tag LOCUS_19240 gene catD 29400 30191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206411.1 protein_id gnl|my_center|LOCUS_19240 30221 31153 gene locus_tag LOCUS_19250 gene ntaB 30221 31153 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206412.1 protein_id gnl|my_center|LOCUS_19250 31156 32238 gene locus_tag LOCUS_19260 gene y4vJ 31156 32238 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212559.1 protein_id gnl|my_center|LOCUS_19260 32213 33679 gene locus_tag LOCUS_19270 32213 33679 CDS product carnitine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206413.1 protein_id gnl|my_center|LOCUS_19270 34046 35449 gene locus_tag LOCUS_19280 gene fcy21 34046 35449 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076659.1 protein_id gnl|my_center|LOCUS_19280 35476 36639 gene locus_tag LOCUS_19290 35476 36639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206415.1 protein_id gnl|my_center|LOCUS_19290 36792 38243 gene locus_tag LOCUS_19300 gene gabD 36792 38243 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206416.1 protein_id gnl|my_center|LOCUS_19300 38243 38629 gene locus_tag LOCUS_19310 gene pcaC 38243 38629 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_19310 39002 40303 gene locus_tag LOCUS_19320 gene soxC 39002 40303 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206502.1 protein_id gnl|my_center|LOCUS_19320 40466 41857 gene locus_tag LOCUS_19330 gene y4fC 40466 41857 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206503.1 protein_id gnl|my_center|LOCUS_19330 42011 43483 gene locus_tag LOCUS_19340 gene yaaU 42011 43483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206504.1 protein_id gnl|my_center|LOCUS_19340 44887 43577 gene locus_tag LOCUS_19350 gene amt-2 44887 43577 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882P0 protein_id gnl|my_center|LOCUS_19350 45938 45072 gene locus_tag LOCUS_19360 45938 45072 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 protein_id gnl|my_center|LOCUS_19360 46037 47188 gene locus_tag LOCUS_19370 46037 47188 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704940.1 protein_id gnl|my_center|LOCUS_19370 47882 47286 gene locus_tag LOCUS_19380 47882 47286 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 protein_id gnl|my_center|LOCUS_19380 48168 49562 gene locus_tag LOCUS_19390 48168 49562 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_19390 49610 50533 gene locus_tag LOCUS_19400 49610 50533 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267556.1 protein_id gnl|my_center|LOCUS_19400 50564 51292 gene locus_tag LOCUS_19410 50564 51292 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_19410 51320 52654 gene locus_tag LOCUS_19420 51320 52654 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367224.1 protein_id gnl|my_center|LOCUS_19420 53081 54262 gene locus_tag LOCUS_19430 53081 54262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268746.1 protein_id gnl|my_center|LOCUS_19430 55279 54278 gene locus_tag LOCUS_19440 55279 54278 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207837.1 protein_id gnl|my_center|LOCUS_19440 55556 56485 gene locus_tag LOCUS_19450 gene rbcR 55556 56485 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206319.1 protein_id gnl|my_center|LOCUS_19450 56848 58074 gene locus_tag LOCUS_19460 gene ycsG 56848 58074 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206320.1 protein_id gnl|my_center|LOCUS_19460 58087 58851 gene locus_tag LOCUS_19470 58087 58851 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJK6 protein_id gnl|my_center|LOCUS_19470 58852 59664 gene locus_tag LOCUS_19480 58852 59664 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJK7 protein_id gnl|my_center|LOCUS_19480 59692 61281 gene locus_tag LOCUS_19490 gene ybgK 59692 61281 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206323.1 protein_id gnl|my_center|LOCUS_19490 61278 63008 gene locus_tag LOCUS_19500 gene bccA 61278 63008 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206324.1 protein_id gnl|my_center|LOCUS_19500 64311 63133 gene locus_tag LOCUS_19510 gene thlA 64311 63133 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_19510 65777 64368 gene locus_tag LOCUS_19520 gene atoE 65777 64368 CDS product short-chain fatty acid transporter scFAT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206695.1 protein_id gnl|my_center|LOCUS_19520 66529 65885 gene locus_tag LOCUS_19530 gene atoA 66529 65885 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_19530 67236 66532 gene locus_tag LOCUS_19540 gene atoD 67236 66532 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_19540 68317 67415 gene locus_tag LOCUS_19550 gene gltC 68317 67415 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206698.1 protein_id gnl|my_center|LOCUS_19550 68782 70200 gene locus_tag LOCUS_19560 68782 70200 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206705.1 protein_id gnl|my_center|LOCUS_19560 70275 71060 gene locus_tag LOCUS_19570 gene bdhA 70275 71060 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206706.1 protein_id gnl|my_center|LOCUS_19570 72160 71114 gene locus_tag LOCUS_19580 72160 71114 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206725.1 protein_id gnl|my_center|LOCUS_19580 73317 72157 gene locus_tag LOCUS_19590 gene pqqE 73317 72157 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWT8 protein_id gnl|my_center|LOCUS_19590 73589 73314 gene locus_tag LOCUS_19600 gene pqqD 73589 73314 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWB4 protein_id gnl|my_center|LOCUS_19600 >Feature sequence14 44 118 gene locus_tag LOCUS_t00280 44 118 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 274 1227 gene locus_tag LOCUS_19610 gene prs 274 1227 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_19610 1326 1622 gene locus_tag LOCUS_19620 gene rplY 1326 1622 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG5 protein_id gnl|my_center|LOCUS_19620 1643 2224 gene locus_tag LOCUS_19630 gene pth 1643 2224 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF04 protein_id gnl|my_center|LOCUS_19630 2361 2741 gene locus_tag LOCUS_19640 gene panD 2361 2741 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_19640 3130 3789 gene locus_tag LOCUS_19650 gene ribB 3130 3789 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ9 protein_id gnl|my_center|LOCUS_19650 4596 4111 gene locus_tag LOCUS_19660 4596 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064555.1 protein_id gnl|my_center|LOCUS_19660 4847 4593 gene locus_tag LOCUS_19670 4847 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4895 5827 gene locus_tag LOCUS_19680 4895 5827 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF0 protein_id gnl|my_center|LOCUS_19680 6454 5888 gene locus_tag LOCUS_19690 6454 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6745 7347 gene locus_tag LOCUS_19700 6745 7347 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_19700 7789 7349 gene locus_tag LOCUS_19710 gene cueR 7789 7349 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208141.1 protein_id gnl|my_center|LOCUS_19710 8369 9022 gene locus_tag LOCUS_19720 gene tpm 8369 9022 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q4 protein_id gnl|my_center|LOCUS_19720 9704 9180 gene locus_tag LOCUS_19730 9704 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_19730 9984 9775 gene locus_tag LOCUS_19740 9984 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 10351 12240 gene locus_tag LOCUS_19750 gene rpoD 10351 12240 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF3 protein_id gnl|my_center|LOCUS_19750 12346 12633 gene locus_tag LOCUS_19760 12346 12633 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116017.1 protein_id gnl|my_center|LOCUS_19760 12704 13363 gene locus_tag LOCUS_19770 gene lipB 12704 13363 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF5 protein_id gnl|my_center|LOCUS_19770 13442 13975 gene locus_tag LOCUS_19780 13442 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_19780 13978 15162 gene locus_tag LOCUS_19790 gene dhaT 13978 15162 CDS product alcohol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_19790 15423 16808 gene locus_tag LOCUS_19800 gene yeeF 15423 16808 CDS product putrescine/spermidine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207482.1 protein_id gnl|my_center|LOCUS_19800 17410 16856 gene locus_tag LOCUS_19810 gene wrbA 17410 16856 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207483.1 protein_id gnl|my_center|LOCUS_19810 17544 17924 gene locus_tag LOCUS_19820 17544 17924 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116344.1 protein_id gnl|my_center|LOCUS_19820 18398 17919 gene locus_tag LOCUS_19830 gene trmL 18398 17919 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG5 protein_id gnl|my_center|LOCUS_19830 19809 18436 gene locus_tag LOCUS_19840 gene cysG 19809 18436 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG6 protein_id gnl|my_center|LOCUS_19840 21145 19874 gene locus_tag LOCUS_19850 gene serS 21145 19874 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG7 protein_id gnl|my_center|LOCUS_19850 22032 21250 gene locus_tag LOCUS_19860 22032 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207489.1 protein_id gnl|my_center|LOCUS_19860 22889 22197 gene locus_tag LOCUS_19870 gene lolA 22889 22197 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_19870 23349 23092 gene locus_tag LOCUS_19880 gene rpmA 23349 23092 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F2 protein_id gnl|my_center|LOCUS_19880 23679 23368 gene locus_tag LOCUS_19890 gene rplU 23679 23368 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH1 protein_id gnl|my_center|LOCUS_19890 24123 25100 gene locus_tag LOCUS_19900 gene ispB 24123 25100 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_19900 25121 27175 gene locus_tag LOCUS_19910 25121 27175 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_19910 27966 29231 gene locus_tag LOCUS_19920 gene acrA 27966 29231 CDS product AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_19920 29244 32423 gene locus_tag LOCUS_19930 gene acrB2 29244 32423 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_19930 32420 33874 gene locus_tag LOCUS_19940 gene oprM 32420 33874 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_19940 33962 34339 gene locus_tag LOCUS_19950 33962 34339 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_19950 34349 34804 gene locus_tag LOCUS_19960 34349 34804 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_19960 35637 34831 gene locus_tag LOCUS_19970 35637 34831 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_19970 36341 35664 gene locus_tag LOCUS_19980 36341 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 36521 39424 gene locus_tag LOCUS_19990 gene valS 36521 39424 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMI4 protein_id gnl|my_center|LOCUS_19990 39673 39473 gene locus_tag LOCUS_20000 39673 39473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 39845 39660 gene locus_tag LOCUS_20010 39845 39660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 39977 40843 gene locus_tag LOCUS_20020 39977 40843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 42157 41105 gene locus_tag LOCUS_20030 42157 41105 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207503.1 protein_id gnl|my_center|LOCUS_20030 43123 42218 gene locus_tag LOCUS_20040 43123 42218 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_20040 43484 44701 gene locus_tag LOCUS_20050 43484 44701 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_20050 44818 45513 gene locus_tag LOCUS_20060 44818 45513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207508.1 protein_id gnl|my_center|LOCUS_20060 46974 45649 gene locus_tag LOCUS_20070 gene qseC 46974 45649 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 protein_id gnl|my_center|LOCUS_20070 47666 46986 gene locus_tag LOCUS_20080 gene qseB 47666 46986 CDS product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 protein_id gnl|my_center|LOCUS_20080 49327 48080 gene locus_tag LOCUS_20090 gene ampG4 49327 48080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_20090 49437 50087 gene locus_tag LOCUS_20100 gene plsC2 49437 50087 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_20100 50153 51070 gene locus_tag LOCUS_20110 gene ylbK 50153 51070 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_20110 51169 51639 gene locus_tag LOCUS_20120 51169 51639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_20120 51649 52506 gene locus_tag LOCUS_20130 gene qmcA 51649 52506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_20130 53490 52582 gene locus_tag LOCUS_20140 gene ispA 53490 52582 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_20140 54041 55336 gene locus_tag LOCUS_20150 gene aroP 54041 55336 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 protein_id gnl|my_center|LOCUS_20150 55411 55485 gene locus_tag LOCUS_t00290 55411 55485 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56120 55815 gene locus_tag LOCUS_20160 56120 55815 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 protein_id gnl|my_center|LOCUS_20160 56908 56195 gene locus_tag LOCUS_20170 gene kdpE 56908 56195 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207114.1 protein_id gnl|my_center|LOCUS_20170 59560 56918 gene locus_tag LOCUS_20180 gene kdpD 59560 56918 CDS product sensory kinase in two-component regulatory system wtih KdpE, regulates potassium transport system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207115.1 protein_id gnl|my_center|LOCUS_20180 60200 59571 gene locus_tag LOCUS_20190 gene kdpC 60200 59571 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR7 protein_id gnl|my_center|LOCUS_20190 62225 60210 gene locus_tag LOCUS_20200 gene kdpB 62225 60210 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR8 protein_id gnl|my_center|LOCUS_20200 63951 62242 gene locus_tag LOCUS_20210 gene kdpA 63951 62242 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR9 protein_id gnl|my_center|LOCUS_20210 64602 64150 gene locus_tag LOCUS_20220 gene putR 64602 64150 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376211.1 protein_id gnl|my_center|LOCUS_20220 64740 65369 gene locus_tag LOCUS_20230 gene rhtB 64740 65369 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206465.1 protein_id gnl|my_center|LOCUS_20230 65972 65487 gene locus_tag LOCUS_20240 65972 65487 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207592.1 protein_id gnl|my_center|LOCUS_20240 67608 65965 gene locus_tag LOCUS_20250 gene cysI 67608 65965 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207593.1 protein_id gnl|my_center|LOCUS_20250 <69480 67784 gene locus_tag LOCUS_20260 <69480 67784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207594.1:glucose dehydrogenase >Feature sequence15 1052 18 gene locus_tag LOCUS_20270 1052 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1823 1137 gene locus_tag LOCUS_20280 gene lolD 1823 1137 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL76 protein_id gnl|my_center|LOCUS_20280 3051 1816 gene locus_tag LOCUS_20290 gene lolC 3051 1816 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_20290 3352 3164 gene locus_tag LOCUS_20300 3352 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4280 3360 gene locus_tag LOCUS_20310 gene pagO 4280 3360 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_20310 4756 4289 gene locus_tag LOCUS_20320 4756 4289 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL79 protein_id gnl|my_center|LOCUS_20320 4979 5917 gene locus_tag LOCUS_20330 4979 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 protein_id gnl|my_center|LOCUS_20330 5955 6104 gene locus_tag LOCUS_20340 5955 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 7243 6164 gene locus_tag LOCUS_20350 gene serC 7243 6164 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL81 protein_id gnl|my_center|LOCUS_20350 7611 9050 gene locus_tag LOCUS_20360 7611 9050 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207407.1 protein_id gnl|my_center|LOCUS_20360 9064 10194 gene locus_tag LOCUS_20370 9064 10194 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207408.1 protein_id gnl|my_center|LOCUS_20370 10197 11327 gene locus_tag LOCUS_20380 10197 11327 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118383.1 protein_id gnl|my_center|LOCUS_20380 11324 12430 gene locus_tag LOCUS_20390 gene ybhR 11324 12430 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_20390 15198 12469 gene locus_tag LOCUS_20400 gene gyrA 15198 12469 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL86 protein_id gnl|my_center|LOCUS_20400 16026 15499 gene locus_tag LOCUS_20410 16026 15499 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_20410 17079 16144 gene locus_tag LOCUS_20420 gene etfA 17079 16144 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_20420 17846 17097 gene locus_tag LOCUS_20430 gene etfB 17846 17097 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_20430 19201 18284 gene locus_tag LOCUS_20440 gene xerC 19201 18284 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL90 protein_id gnl|my_center|LOCUS_20440 19849 19208 gene locus_tag LOCUS_20450 gene bioH 19849 19208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207415.1 protein_id gnl|my_center|LOCUS_20450 20791 19946 gene locus_tag LOCUS_20460 gene dapF 20791 19946 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL93 protein_id gnl|my_center|LOCUS_20460 22045 20795 gene locus_tag LOCUS_20470 gene lysA 22045 20795 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL94 protein_id gnl|my_center|LOCUS_20470 22279 22067 gene locus_tag LOCUS_20480 22279 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118887.1 protein_id gnl|my_center|LOCUS_20480 23815 22403 gene locus_tag LOCUS_20490 gene cycA 23815 22403 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207418.1 protein_id gnl|my_center|LOCUS_20490 24097 25476 gene locus_tag LOCUS_20500 gene radA 24097 25476 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL98 protein_id gnl|my_center|LOCUS_20500 25777 26769 gene locus_tag LOCUS_20510 25777 26769 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118912.1 protein_id gnl|my_center|LOCUS_20510 27806 26817 gene locus_tag LOCUS_20520 gene poxA 27806 26817 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_20520 28870 27803 gene locus_tag LOCUS_20530 gene pdxB 28870 27803 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA1 protein_id gnl|my_center|LOCUS_20530 29314 28979 gene locus_tag LOCUS_20540 29314 28979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 29616 31031 gene locus_tag LOCUS_20550 gene antA 29616 31031 CDS product anthranilate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206716.1 protein_id gnl|my_center|LOCUS_20550 31034 31525 gene locus_tag LOCUS_20560 gene antB 31034 31525 CDS product anthranilate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076809.1 protein_id gnl|my_center|LOCUS_20560 31537 32568 gene locus_tag LOCUS_20570 gene antC 31537 32568 CDS product anthranilate dioxygenase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206715.1 protein_id gnl|my_center|LOCUS_20570 33136 34194 gene locus_tag LOCUS_20580 gene eutR 33136 34194 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_20580 35409 34462 gene locus_tag LOCUS_20590 35409 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206713.1 protein_id gnl|my_center|LOCUS_20590 36005 35460 gene locus_tag LOCUS_20600 gene ntaB 36005 35460 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 protein_id gnl|my_center|LOCUS_20600 37263 36025 gene locus_tag LOCUS_20610 37263 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 protein_id gnl|my_center|LOCUS_20610 38109 37318 gene locus_tag LOCUS_20620 gene bacC 38109 37318 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 protein_id gnl|my_center|LOCUS_20620 39386 38139 gene locus_tag LOCUS_20630 gene tcbE 39386 38139 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206709.1 protein_id gnl|my_center|LOCUS_20630 40667 39666 gene locus_tag LOCUS_20640 gene xylS 40667 39666 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113834.1 protein_id gnl|my_center|LOCUS_20640 42195 40924 gene locus_tag LOCUS_20650 gene gdhA 42195 40924 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_20650 42690 42424 gene locus_tag LOCUS_20660 42690 42424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532395.1 protein_id gnl|my_center|LOCUS_20660 43484 42720 gene locus_tag LOCUS_20670 gene motB 43484 42720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206364.1 protein_id gnl|my_center|LOCUS_20670 44446 43487 gene locus_tag LOCUS_20680 44446 43487 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206363.1 protein_id gnl|my_center|LOCUS_20680 48308 44487 gene locus_tag LOCUS_20690 48308 44487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 49746 48343 gene locus_tag LOCUS_20700 49746 48343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206359.1 protein_id gnl|my_center|LOCUS_20700 50741 49743 gene locus_tag LOCUS_20710 50741 49743 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206358.1 protein_id gnl|my_center|LOCUS_20710 52513 50705 gene locus_tag LOCUS_20720 52513 50705 CDS product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206357.1 protein_id gnl|my_center|LOCUS_20720 52998 52525 gene locus_tag LOCUS_20730 52998 52525 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048404.1 protein_id gnl|my_center|LOCUS_20730 53571 53068 gene locus_tag LOCUS_20740 53571 53068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653195.1 protein_id gnl|my_center|LOCUS_20740 55098 53617 gene locus_tag LOCUS_20750 55098 53617 CDS product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206356.1 protein_id gnl|my_center|LOCUS_20750 55594 55091 gene locus_tag LOCUS_20760 55594 55091 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005041656.1 protein_id gnl|my_center|LOCUS_20760 56270 55614 gene locus_tag LOCUS_20770 56270 55614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206355.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence16 857 291 gene locus_tag LOCUS_20780 gene ppiA 857 291 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPD9 protein_id gnl|my_center|LOCUS_20780 2054 984 gene locus_tag LOCUS_20790 gene estA 2054 984 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207659.1 protein_id gnl|my_center|LOCUS_20790 2850 2605 gene locus_tag LOCUS_20800 2850 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207661.1 protein_id gnl|my_center|LOCUS_20800 4074 3211 gene locus_tag LOCUS_20810 4074 3211 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207662.1 protein_id gnl|my_center|LOCUS_20810 4183 5076 gene locus_tag LOCUS_20820 gene yafC 4183 5076 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207663.1 protein_id gnl|my_center|LOCUS_20820 5243 5797 gene locus_tag LOCUS_20830 gene grpE 5243 5797 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE5 protein_id gnl|my_center|LOCUS_20830 5917 7860 gene locus_tag LOCUS_20840 gene dnaK 5917 7860 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE6 protein_id gnl|my_center|LOCUS_20840 8421 8798 gene locus_tag LOCUS_20850 8421 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207668.1 protein_id gnl|my_center|LOCUS_20850 10149 8854 gene locus_tag LOCUS_20860 gene mltB 10149 8854 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_20860 11850 10699 gene locus_tag LOCUS_20870 gene purK 11850 10699 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_20870 12435 11920 gene locus_tag LOCUS_20880 gene purE 12435 11920 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_20880 13133 12786 gene locus_tag LOCUS_20890 13133 12786 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207671.1 protein_id gnl|my_center|LOCUS_20890 13397 14758 gene locus_tag LOCUS_20900 gene mpl 13397 14758 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF6 protein_id gnl|my_center|LOCUS_20900 14930 15526 gene locus_tag LOCUS_20910 14930 15526 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301859.1 protein_id gnl|my_center|LOCUS_20910 15828 16787 gene locus_tag LOCUS_20920 gene terC 15828 16787 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207675.1 protein_id gnl|my_center|LOCUS_20920 17378 16836 gene locus_tag LOCUS_20930 17378 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836309.1 protein_id gnl|my_center|LOCUS_20930 17542 18858 gene locus_tag LOCUS_20940 gene guaD 17542 18858 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_20940 19098 19604 gene locus_tag LOCUS_20950 gene hpt 19098 19604 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115408.1 protein_id gnl|my_center|LOCUS_20950 19771 20025 gene locus_tag LOCUS_20960 19771 20025 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_20960 20748 20071 gene locus_tag LOCUS_20970 gene dsbC 20748 20071 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207679.1 protein_id gnl|my_center|LOCUS_20970 22109 20946 gene locus_tag LOCUS_20980 22109 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206813.1 protein_id gnl|my_center|LOCUS_20980 23423 22122 gene locus_tag LOCUS_20990 gene tolC 23423 22122 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206814.1 protein_id gnl|my_center|LOCUS_20990 25049 23445 gene locus_tag LOCUS_21000 25049 23445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 protein_id gnl|my_center|LOCUS_21000 25879 25049 gene locus_tag LOCUS_21010 25879 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_21010 27577 26027 gene locus_tag LOCUS_21020 gene emrY 27577 26027 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206817.1 protein_id gnl|my_center|LOCUS_21020 28684 27608 gene locus_tag LOCUS_21030 gene emrA 28684 27608 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206818.1 protein_id gnl|my_center|LOCUS_21030 30528 29140 gene locus_tag LOCUS_21040 gene mnmE 30528 29140 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPG9 protein_id gnl|my_center|LOCUS_21040 32342 30591 gene locus_tag LOCUS_21050 gene yidC 32342 30591 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH0 protein_id gnl|my_center|LOCUS_21050 32668 32348 gene locus_tag LOCUS_21060 32668 32348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 33071 32679 gene locus_tag LOCUS_21070 gene rnpA 33071 32679 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH1 protein_id gnl|my_center|LOCUS_21070 33232 33098 gene locus_tag LOCUS_21080 gene rpmH 33232 33098 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH2 protein_id gnl|my_center|LOCUS_21080 33897 35294 gene locus_tag LOCUS_21090 gene dnaA 33897 35294 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH3 protein_id gnl|my_center|LOCUS_21090 35530 36678 gene locus_tag LOCUS_21100 35530 36678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 36694 37770 gene locus_tag LOCUS_21110 gene recF 36694 37770 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH6 protein_id gnl|my_center|LOCUS_21110 37823 40291 gene locus_tag LOCUS_21120 gene gyrB 37823 40291 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH7 protein_id gnl|my_center|LOCUS_21120 40644 40408 gene locus_tag LOCUS_21130 40644 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206240.1 protein_id gnl|my_center|LOCUS_21130 42966 41032 gene locus_tag LOCUS_21140 gene yheS 42966 41032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_21140 43347 44357 gene locus_tag LOCUS_21150 43347 44357 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_21150 44612 45616 gene locus_tag LOCUS_21160 44612 45616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_21160 45735 46070 gene locus_tag LOCUS_21170 gene erpA 45735 46070 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI5 protein_id gnl|my_center|LOCUS_21170 47262 46132 gene locus_tag LOCUS_21180 gene anmK 47262 46132 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI7 protein_id gnl|my_center|LOCUS_21180 47324 48556 gene locus_tag LOCUS_21190 gene tyrS 47324 48556 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI8 protein_id gnl|my_center|LOCUS_21190 49127 49381 gene locus_tag LOCUS_21200 49127 49381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 49620 51578 gene locus_tag LOCUS_21210 49620 51578 CDS product NAD 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44569 protein_id gnl|my_center|LOCUS_21210 >Feature sequence17 375 1256 gene locus_tag LOCUS_21220 375 1256 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205969.1 protein_id gnl|my_center|LOCUS_21220 1409 1867 gene locus_tag LOCUS_21230 gene rimI 1409 1867 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK1 protein_id gnl|my_center|LOCUS_21230 2689 1874 gene locus_tag LOCUS_21240 gene ate 2689 1874 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK2 protein_id gnl|my_center|LOCUS_21240 3439 2714 gene locus_tag LOCUS_21250 gene aat 3439 2714 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK3 protein_id gnl|my_center|LOCUS_21250 4459 3512 gene locus_tag LOCUS_21260 gene trxB 4459 3512 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK4 protein_id gnl|my_center|LOCUS_21260 4726 7782 gene locus_tag LOCUS_21270 gene ftsK 4726 7782 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205973.1 protein_id gnl|my_center|LOCUS_21270 8116 7829 gene locus_tag LOCUS_21280 8116 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_21280 8634 8362 gene locus_tag LOCUS_21290 gene minE 8634 8362 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK9 protein_id gnl|my_center|LOCUS_21290 9449 8637 gene locus_tag LOCUS_21300 gene minD 9449 8637 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL0 protein_id gnl|my_center|LOCUS_21300 10238 9516 gene locus_tag LOCUS_21310 gene minC 10238 9516 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL1 protein_id gnl|my_center|LOCUS_21310 11264 10362 gene locus_tag LOCUS_21320 11264 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_21320 12351 11425 gene locus_tag LOCUS_21330 gene yihG 12351 11425 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_21330 12602 13255 gene locus_tag LOCUS_21340 gene yiaD 12602 13255 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 protein_id gnl|my_center|LOCUS_21340 13381 15420 gene locus_tag LOCUS_21350 gene rep 13381 15420 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL5 protein_id gnl|my_center|LOCUS_21350 15445 15897 gene locus_tag LOCUS_21360 gene dut 15445 15897 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL6 protein_id gnl|my_center|LOCUS_21360 16089 17513 gene locus_tag LOCUS_21370 gene algC 16089 17513 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 protein_id gnl|my_center|LOCUS_21370 17524 18435 gene locus_tag LOCUS_21380 gene argB 17524 18435 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_21380 18562 19341 gene locus_tag LOCUS_21390 18562 19341 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121744.1 protein_id gnl|my_center|LOCUS_21390 19467 20297 gene locus_tag LOCUS_21400 19467 20297 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_21400 20396 21481 gene locus_tag LOCUS_21410 20396 21481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205981.1 protein_id gnl|my_center|LOCUS_21410 21478 21789 gene locus_tag LOCUS_21420 21478 21789 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM3 protein_id gnl|my_center|LOCUS_21420 22243 21845 gene locus_tag LOCUS_21430 gene bamE 22243 21845 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_21430 22355 22795 gene locus_tag LOCUS_21440 gene fur 22355 22795 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_21440 23992 22841 gene locus_tag LOCUS_21450 gene pilU 23992 22841 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 protein_id gnl|my_center|LOCUS_21450 24985 24029 gene locus_tag LOCUS_21460 gene pilT 24985 24029 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_21460 25188 25877 gene locus_tag LOCUS_21470 gene yggS 25188 25877 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_21470 26026 26871 gene locus_tag LOCUS_21480 gene uppP1 26026 26871 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V58 protein_id gnl|my_center|LOCUS_21480 27752 26967 gene locus_tag LOCUS_21490 27752 26967 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_21490 31559 27963 gene locus_tag LOCUS_21500 gene sbcC 31559 27963 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM9 protein_id gnl|my_center|LOCUS_21500 32819 31569 gene locus_tag LOCUS_21510 gene sbcD 32819 31569 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN0 protein_id gnl|my_center|LOCUS_21510 32943 33416 gene locus_tag LOCUS_21520 32943 33416 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205986.1 protein_id gnl|my_center|LOCUS_21520 34064 33495 gene locus_tag LOCUS_21530 34064 33495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206382.1 protein_id gnl|my_center|LOCUS_21530 34429 34875 gene locus_tag LOCUS_21540 34429 34875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 34942 35853 gene locus_tag LOCUS_21550 gene yfcH 34942 35853 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205990.1 protein_id gnl|my_center|LOCUS_21550 36971 35856 gene locus_tag LOCUS_21560 36971 35856 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205991.1 protein_id gnl|my_center|LOCUS_21560 38009 36996 gene locus_tag LOCUS_21570 gene hemB 38009 36996 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN7 protein_id gnl|my_center|LOCUS_21570 38119 38616 gene locus_tag LOCUS_21580 38119 38616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205992.1 protein_id gnl|my_center|LOCUS_21580 38944 40080 gene locus_tag LOCUS_21590 gene emrA 38944 40080 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_21590 40087 41634 gene locus_tag LOCUS_21600 gene emrB 40087 41634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_21600 41838 43799 gene locus_tag LOCUS_21610 gene ggt 41838 43799 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205994.1 protein_id gnl|my_center|LOCUS_21610 45344 43857 gene locus_tag LOCUS_21620 gene glpK 45344 43857 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT38 protein_id gnl|my_center|LOCUS_21620 45476 45835 gene locus_tag LOCUS_tm00010 45476 45835 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 46719 46087 gene locus_tag LOCUS_21630 46719 46087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 protein_id gnl|my_center|LOCUS_21630 46883 47158 gene locus_tag LOCUS_21640 46883 47158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122109.1 protein_id gnl|my_center|LOCUS_21640 47231 48094 gene locus_tag LOCUS_21650 47231 48094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206315.1 protein_id gnl|my_center|LOCUS_21650 48147 48803 gene locus_tag LOCUS_21660 48147 48803 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206316.1 protein_id gnl|my_center|LOCUS_21660 48800 49420 gene locus_tag LOCUS_21670 48800 49420 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_21670 49414 49593 gene locus_tag LOCUS_21680 49414 49593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206318.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence18 1567 986 gene locus_tag LOCUS_21690 1567 986 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207737.1 protein_id gnl|my_center|LOCUS_21690 2660 1653 gene locus_tag LOCUS_21700 2660 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_21700 3671 3285 gene locus_tag LOCUS_21710 3671 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207739.1 protein_id gnl|my_center|LOCUS_21710 3921 3664 gene locus_tag LOCUS_21720 3921 3664 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_21720 4110 5282 gene locus_tag LOCUS_21730 gene fadE 4110 5282 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207741.1 protein_id gnl|my_center|LOCUS_21730 6843 5347 gene locus_tag LOCUS_21740 gene hapE 6843 5347 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_21740 7386 7009 gene locus_tag LOCUS_21750 gene rplQ 7386 7009 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ06 protein_id gnl|my_center|LOCUS_21750 8412 7405 gene locus_tag LOCUS_21760 gene rpoA 8412 7405 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ07 protein_id gnl|my_center|LOCUS_21760 9054 8431 gene locus_tag LOCUS_21770 gene rpsD 9054 8431 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ08 protein_id gnl|my_center|LOCUS_21770 9453 9067 gene locus_tag LOCUS_21780 gene rpsK 9453 9067 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ09 protein_id gnl|my_center|LOCUS_21780 9829 9473 gene locus_tag LOCUS_21790 gene rpsM 9829 9473 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ10 protein_id gnl|my_center|LOCUS_21790 11431 10073 gene locus_tag LOCUS_21800 gene secY 11431 10073 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ12 protein_id gnl|my_center|LOCUS_21800 11878 11438 gene locus_tag LOCUS_21810 gene rplO 11878 11438 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ13 protein_id gnl|my_center|LOCUS_21810 12058 11882 gene locus_tag LOCUS_21820 gene rpmD 12058 11882 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ14 protein_id gnl|my_center|LOCUS_21820 12562 12065 gene locus_tag LOCUS_21830 gene rpsE 12562 12065 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ15 protein_id gnl|my_center|LOCUS_21830 12915 12565 gene locus_tag LOCUS_21840 gene rplR 12915 12565 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_21840 13463 12930 gene locus_tag LOCUS_21850 gene rplF 13463 12930 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ17 protein_id gnl|my_center|LOCUS_21850 13872 13477 gene locus_tag LOCUS_21860 gene rpsH 13872 13477 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ18 protein_id gnl|my_center|LOCUS_21860 14190 13885 gene locus_tag LOCUS_21870 gene rpsN 14190 13885 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ19 protein_id gnl|my_center|LOCUS_21870 14736 14200 gene locus_tag LOCUS_21880 gene rplE 14736 14200 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ20 protein_id gnl|my_center|LOCUS_21880 15072 14752 gene locus_tag LOCUS_21890 gene rplX 15072 14752 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ21 protein_id gnl|my_center|LOCUS_21890 15450 15082 gene locus_tag LOCUS_21900 gene rplN 15450 15082 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ22 protein_id gnl|my_center|LOCUS_21900 15798 15541 gene locus_tag LOCUS_21910 gene rpsQ 15798 15541 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_21910 15992 15795 gene locus_tag LOCUS_21920 gene rpmC 15992 15795 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF85 protein_id gnl|my_center|LOCUS_21920 16405 15992 gene locus_tag LOCUS_21930 gene rplP 16405 15992 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF86 protein_id gnl|my_center|LOCUS_21930 17161 16409 gene locus_tag LOCUS_21940 gene rpsC 17161 16409 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF87 protein_id gnl|my_center|LOCUS_21940 17492 17163 gene locus_tag LOCUS_21950 gene rplV 17492 17163 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF88 protein_id gnl|my_center|LOCUS_21950 17779 17504 gene locus_tag LOCUS_21960 gene rpsS 17779 17504 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF89 protein_id gnl|my_center|LOCUS_21960 18617 17793 gene locus_tag LOCUS_21970 gene rplB 18617 17793 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF90 protein_id gnl|my_center|LOCUS_21970 18949 18629 gene locus_tag LOCUS_21980 gene rplW 18949 18629 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF91 protein_id gnl|my_center|LOCUS_21980 19548 18946 gene locus_tag LOCUS_21990 gene rplD 19548 18946 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 protein_id gnl|my_center|LOCUS_21990 20198 19560 gene locus_tag LOCUS_22000 gene rplC 20198 19560 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF93 protein_id gnl|my_center|LOCUS_22000 20569 20258 gene locus_tag LOCUS_22010 gene rpsJ 20569 20258 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF94 protein_id gnl|my_center|LOCUS_22010 21564 20833 gene locus_tag LOCUS_22020 gene yfeJ 21564 20833 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116949.1 protein_id gnl|my_center|LOCUS_22020 21734 22927 gene locus_tag LOCUS_22030 gene metC 21734 22927 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207748.1 protein_id gnl|my_center|LOCUS_22030 22951 24489 gene locus_tag LOCUS_22040 gene yjgR 22951 24489 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_22040 24803 25702 gene locus_tag LOCUS_22050 gene alsR 24803 25702 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208376.1 protein_id gnl|my_center|LOCUS_22050 25788 26552 gene locus_tag LOCUS_22060 25788 26552 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207751.1 protein_id gnl|my_center|LOCUS_22060 26656 27084 gene locus_tag LOCUS_22070 26656 27084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207752.1 protein_id gnl|my_center|LOCUS_22070 27169 28023 gene locus_tag LOCUS_22080 gene engB 27169 28023 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA1 protein_id gnl|my_center|LOCUS_22080 28160 29107 gene locus_tag LOCUS_22090 28160 29107 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 protein_id gnl|my_center|LOCUS_22090 30434 29193 gene locus_tag LOCUS_22100 gene glt-4 30434 29193 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_22100 31388 30516 gene locus_tag LOCUS_22110 gene tesB 31388 30516 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_22110 31675 34239 gene locus_tag LOCUS_22120 gene plsB 31675 34239 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA5 protein_id gnl|my_center|LOCUS_22120 35273 34284 gene locus_tag LOCUS_22130 35273 34284 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207757.1 protein_id gnl|my_center|LOCUS_22130 36220 35405 gene locus_tag LOCUS_22140 36220 35405 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 protein_id gnl|my_center|LOCUS_22140 36244 38289 gene locus_tag LOCUS_22150 gene recG 36244 38289 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA8 protein_id gnl|my_center|LOCUS_22150 38282 38917 gene locus_tag LOCUS_22160 gene comF 38282 38917 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207759.1 protein_id gnl|my_center|LOCUS_22160 39325 38921 gene locus_tag LOCUS_22170 gene mutT 39325 38921 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207760.1 protein_id gnl|my_center|LOCUS_22170 39937 39338 gene locus_tag LOCUS_22180 39937 39338 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFB1 protein_id gnl|my_center|LOCUS_22180 40081 41094 gene locus_tag LOCUS_22190 gene corA 40081 41094 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116978.1 protein_id gnl|my_center|LOCUS_22190 41439 41146 gene locus_tag LOCUS_22200 41439 41146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078357.1 protein_id gnl|my_center|LOCUS_22200 42085 41453 gene locus_tag LOCUS_22210 gene ttg2D 42085 41453 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_22210 42775 42104 gene locus_tag LOCUS_22220 gene ttg2C 42775 42104 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207762.1 protein_id gnl|my_center|LOCUS_22220 43551 42775 gene locus_tag LOCUS_22230 gene ttg2B 43551 42775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117010.1 protein_id gnl|my_center|LOCUS_22230 44366 43548 gene locus_tag LOCUS_22240 gene ttg2A 44366 43548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207763.1 protein_id gnl|my_center|LOCUS_22240 46668 44746 gene locus_tag LOCUS_22250 gene deaD 46668 44746 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 protein_id gnl|my_center|LOCUS_22250 47865 47035 gene locus_tag LOCUS_22260 gene suhB 47865 47035 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207766.1 protein_id gnl|my_center|LOCUS_22260 <49290 47982 gene locus_tag LOCUS_22270 <49290 47982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFC1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence19 1666 734 gene locus_tag LOCUS_22280 gene dusC 1666 734 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_22280 2629 1820 gene locus_tag LOCUS_22290 2629 1820 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_22290 2775 4187 gene locus_tag LOCUS_22300 gene ffh 2775 4187 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW9 protein_id gnl|my_center|LOCUS_22300 4986 4255 gene locus_tag LOCUS_22310 gene coaX 4986 4255 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX0 protein_id gnl|my_center|LOCUS_22310 5754 4993 gene locus_tag LOCUS_22320 gene birA 5754 4993 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205928.1 protein_id gnl|my_center|LOCUS_22320 5785 6588 gene locus_tag LOCUS_22330 5785 6588 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_22330 6786 7493 gene locus_tag LOCUS_22340 6786 7493 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_22340 7591 11040 gene locus_tag LOCUS_22350 gene smc 7591 11040 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX4 protein_id gnl|my_center|LOCUS_22350 11042 12019 gene locus_tag LOCUS_22360 gene zipA 11042 12019 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX5 protein_id gnl|my_center|LOCUS_22360 12097 14127 gene locus_tag LOCUS_22370 gene ligA 12097 14127 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX6 protein_id gnl|my_center|LOCUS_22370 15325 14270 gene locus_tag LOCUS_22380 15325 14270 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_22380 15456 16031 gene locus_tag LOCUS_22390 15456 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 16047 16235 gene locus_tag LOCUS_22400 16047 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 16491 16955 gene locus_tag LOCUS_22410 gene bfrA 16491 16955 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX7 protein_id gnl|my_center|LOCUS_22410 17189 17941 gene locus_tag LOCUS_22420 17189 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 18572 18009 gene locus_tag LOCUS_22430 18572 18009 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_22430 18724 19443 gene locus_tag LOCUS_22440 gene bioH 18724 19443 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205936.1 protein_id gnl|my_center|LOCUS_22440 19540 20829 gene locus_tag LOCUS_22450 gene bioA 19540 20829 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY2 protein_id gnl|my_center|LOCUS_22450 20816 21973 gene locus_tag LOCUS_22460 gene bioF 20816 21973 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205938.1 protein_id gnl|my_center|LOCUS_22460 21970 22731 gene locus_tag LOCUS_22470 gene bioC 21970 22731 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY4 protein_id gnl|my_center|LOCUS_22470 22728 23369 gene locus_tag LOCUS_22480 gene bioD 22728 23369 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY5 protein_id gnl|my_center|LOCUS_22480 24549 23437 gene locus_tag LOCUS_22490 24549 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 25629 24688 gene locus_tag LOCUS_22500 gene rluB 25629 24688 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_22500 26261 25671 gene locus_tag LOCUS_22510 26261 25671 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY7 protein_id gnl|my_center|LOCUS_22510 27049 26258 gene locus_tag LOCUS_22520 27049 26258 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_22520 27332 28036 gene locus_tag LOCUS_22530 27332 28036 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816567.1 protein_id gnl|my_center|LOCUS_22530 28681 28064 gene locus_tag LOCUS_22540 28681 28064 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205941.1 protein_id gnl|my_center|LOCUS_22540 29445 28783 gene locus_tag LOCUS_22550 29445 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205942.1 protein_id gnl|my_center|LOCUS_22550 29542 30102 gene locus_tag LOCUS_22560 29542 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_22560 30174 30359 gene locus_tag LOCUS_22570 gene rpmF 30174 30359 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ2 protein_id gnl|my_center|LOCUS_22570 30513 31499 gene locus_tag LOCUS_22580 gene fabD 30513 31499 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ3 protein_id gnl|my_center|LOCUS_22580 31496 32230 gene locus_tag LOCUS_22590 gene fabG 31496 32230 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120395.1 protein_id gnl|my_center|LOCUS_22590 32316 32552 gene locus_tag LOCUS_22600 gene acpP 32316 32552 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ5 protein_id gnl|my_center|LOCUS_22600 32741 33217 gene locus_tag LOCUS_22610 gene ygaU 32741 33217 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_22610 34452 33220 gene locus_tag LOCUS_22620 34452 33220 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267867.1 protein_id gnl|my_center|LOCUS_22620 35306 34527 gene locus_tag LOCUS_22630 gene thiED 35306 34527 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_22630 35404 36078 gene locus_tag LOCUS_22640 35404 36078 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 protein_id gnl|my_center|LOCUS_22640 36239 37360 gene locus_tag LOCUS_22650 36239 37360 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207982.1 protein_id gnl|my_center|LOCUS_22650 37837 37385 gene locus_tag LOCUS_22660 37837 37385 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120291.1 protein_id gnl|my_center|LOCUS_22660 39385 38156 gene locus_tag LOCUS_22670 gene fabB 39385 38156 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205967.1 protein_id gnl|my_center|LOCUS_22670 39685 41070 gene locus_tag LOCUS_22680 39685 41070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205968.1 protein_id gnl|my_center|LOCUS_22680 41255 41629 gene locus_tag LOCUS_22690 gene rpsL 41255 41629 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ5 protein_id gnl|my_center|LOCUS_22690 41790 42260 gene locus_tag LOCUS_22700 gene rpsG 41790 42260 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ6 protein_id gnl|my_center|LOCUS_22700 42438 44576 gene locus_tag LOCUS_22710 gene fusA 42438 44576 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ7 protein_id gnl|my_center|LOCUS_22710 >Feature sequence20 76 2 gene locus_tag LOCUS_t00300 76 2 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 914 75 gene locus_tag LOCUS_22720 gene ispE 914 75 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_22720 1510 929 gene locus_tag LOCUS_22730 gene lolB 1510 929 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG8 protein_id gnl|my_center|LOCUS_22730 3151 1514 gene locus_tag LOCUS_22740 3151 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 protein_id gnl|my_center|LOCUS_22740 3305 4600 gene locus_tag LOCUS_22750 gene hemA 3305 4600 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH0 protein_id gnl|my_center|LOCUS_22750 6491 4602 gene locus_tag LOCUS_22760 gene dnaG 6491 4602 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH2 protein_id gnl|my_center|LOCUS_22760 7698 6643 gene locus_tag LOCUS_22770 gene comL 7698 6643 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH3 protein_id gnl|my_center|LOCUS_22770 7771 8823 gene locus_tag LOCUS_22780 gene rluD 7771 8823 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH4 protein_id gnl|my_center|LOCUS_22780 8838 9578 gene locus_tag LOCUS_22790 8838 9578 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH5 protein_id gnl|my_center|LOCUS_22790 9619 10170 gene locus_tag LOCUS_22800 gene wrbA 9619 10170 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075275.1 protein_id gnl|my_center|LOCUS_22800 10688 10212 gene locus_tag LOCUS_22810 gene smpB 10688 10212 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_22810 10830 11321 gene locus_tag LOCUS_22820 gene coaD 10830 11321 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH8 protein_id gnl|my_center|LOCUS_22820 11398 11586 gene locus_tag LOCUS_22830 gene fdx 11398 11586 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205956.1 protein_id gnl|my_center|LOCUS_22830 12032 12108 gene locus_tag LOCUS_t00310 12032 12108 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12337 12413 gene locus_tag LOCUS_t00320 12337 12413 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12559 13737 gene locus_tag LOCUS_22840 12559 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205957.1 protein_id gnl|my_center|LOCUS_22840 14828 13791 gene locus_tag LOCUS_22850 14828 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 16446 14821 gene locus_tag LOCUS_22860 gene nadE2 16446 14821 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_22860 16719 17180 gene locus_tag LOCUS_22870 16719 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 18523 17249 gene locus_tag LOCUS_22880 gene gltA 18523 17249 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME8 protein_id gnl|my_center|LOCUS_22880 19566 19967 gene locus_tag LOCUS_22890 gene sdhC 19566 19967 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207477.1 protein_id gnl|my_center|LOCUS_22890 19967 20332 gene locus_tag LOCUS_22900 gene sdhD 19967 20332 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME5 protein_id gnl|my_center|LOCUS_22900 20345 22243 gene locus_tag LOCUS_22910 gene sdhA 20345 22243 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME4 protein_id gnl|my_center|LOCUS_22910 22259 22969 gene locus_tag LOCUS_22920 gene sdhB 22259 22969 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 protein_id gnl|my_center|LOCUS_22920 23524 26364 gene locus_tag LOCUS_22930 gene sucA 23524 26364 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_22930 26364 27572 gene locus_tag LOCUS_22940 gene sucB 26364 27572 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY0 protein_id gnl|my_center|LOCUS_22940 27630 29063 gene locus_tag LOCUS_22950 gene lpdG 27630 29063 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX9 protein_id gnl|my_center|LOCUS_22950 29238 30404 gene locus_tag LOCUS_22960 gene sucC 29238 30404 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX8 protein_id gnl|my_center|LOCUS_22960 30418 31308 gene locus_tag LOCUS_22970 gene sucD 30418 31308 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX7 protein_id gnl|my_center|LOCUS_22970 32729 31716 gene locus_tag LOCUS_22980 gene trpS 32729 31716 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 protein_id gnl|my_center|LOCUS_22980 32935 33849 gene locus_tag LOCUS_22990 32935 33849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_22990 33886 34782 gene locus_tag LOCUS_23000 33886 34782 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_23000 35364 34807 gene locus_tag LOCUS_23010 35364 34807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 35559 37058 gene locus_tag LOCUS_23020 gene nhx7 35559 37058 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207471.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence21 652 32 gene locus_tag LOCUS_23030 652 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1102 656 gene locus_tag LOCUS_23040 gene tolR 1102 656 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_23040 1725 1102 gene locus_tag LOCUS_23050 gene tolQ 1725 1102 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207390.1 protein_id gnl|my_center|LOCUS_23050 2233 1826 gene locus_tag LOCUS_23060 2233 1826 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699892.1 protein_id gnl|my_center|LOCUS_23060 3160 2525 gene locus_tag LOCUS_23070 3160 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4242 3238 gene locus_tag LOCUS_23080 gene ruvB 4242 3238 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL50 protein_id gnl|my_center|LOCUS_23080 4855 4250 gene locus_tag LOCUS_23090 gene ruvA 4855 4250 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL49 protein_id gnl|my_center|LOCUS_23090 6300 4966 gene locus_tag LOCUS_23100 gene dgt 6300 4966 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_23100 6555 10391 gene locus_tag LOCUS_23110 gene purL 6555 10391 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL47 protein_id gnl|my_center|LOCUS_23110 11824 10628 gene locus_tag LOCUS_23120 11824 10628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970397.1 protein_id gnl|my_center|LOCUS_23120 11950 12270 gene locus_tag LOCUS_23130 11950 12270 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 protein_id gnl|my_center|LOCUS_23130 13060 12272 gene locus_tag LOCUS_23140 13060 12272 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_23140 13969 13169 gene locus_tag LOCUS_23150 gene paaG 13969 13169 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_23150 14069 14635 gene locus_tag LOCUS_23160 14069 14635 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119001.1 protein_id gnl|my_center|LOCUS_23160 14711 15259 gene locus_tag LOCUS_23170 14711 15259 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887707.1 protein_id gnl|my_center|LOCUS_23170 15784 15323 gene locus_tag LOCUS_23180 gene bcp 15784 15323 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207381.1 protein_id gnl|my_center|LOCUS_23180 16256 15846 gene locus_tag LOCUS_23190 16256 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073124.1 protein_id gnl|my_center|LOCUS_23190 16941 16270 gene locus_tag LOCUS_23200 gene queC 16941 16270 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL37 protein_id gnl|my_center|LOCUS_23200 17679 16969 gene locus_tag LOCUS_23210 gene queE 17679 16969 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL36 protein_id gnl|my_center|LOCUS_23210 18593 17772 gene locus_tag LOCUS_23220 gene dapD 18593 17772 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL35 protein_id gnl|my_center|LOCUS_23220 18900 19640 gene locus_tag LOCUS_23230 18900 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_23230 20623 19700 gene locus_tag LOCUS_23240 gene gltC 20623 19700 CDS product cys regulon transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_23240 21737 20676 gene locus_tag LOCUS_23250 gene cysA 21737 20676 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL32 protein_id gnl|my_center|LOCUS_23250 22637 21747 gene locus_tag LOCUS_23260 gene cysW 22637 21747 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 protein_id gnl|my_center|LOCUS_23260 23467 22634 gene locus_tag LOCUS_23270 gene cysT 23467 22634 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207377.1 protein_id gnl|my_center|LOCUS_23270 24153 23548 gene locus_tag LOCUS_23280 24153 23548 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118423.1 protein_id gnl|my_center|LOCUS_23280 25181 24180 gene locus_tag LOCUS_23290 gene cysP 25181 24180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207376.1 protein_id gnl|my_center|LOCUS_23290 25341 26156 gene locus_tag LOCUS_23300 gene pabC 25341 26156 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 protein_id gnl|my_center|LOCUS_23300 26242 27222 gene locus_tag LOCUS_23310 26242 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 protein_id gnl|my_center|LOCUS_23310 27232 27840 gene locus_tag LOCUS_23320 gene tmk 27232 27840 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL25 protein_id gnl|my_center|LOCUS_23320 29495 27861 gene locus_tag LOCUS_23330 gene nadB 29495 27861 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL23 protein_id gnl|my_center|LOCUS_23330 29711 31108 gene locus_tag LOCUS_23340 gene degP 29711 31108 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207372.1 protein_id gnl|my_center|LOCUS_23340 31217 31666 gene locus_tag LOCUS_23350 31217 31666 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_23350 31922 33739 gene locus_tag LOCUS_23360 gene lepA 31922 33739 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL5 protein_id gnl|my_center|LOCUS_23360 33758 34585 gene locus_tag LOCUS_23370 gene lepB 33758 34585 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_23370 34610 34987 gene locus_tag LOCUS_23380 34610 34987 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_23380 34959 35651 gene locus_tag LOCUS_23390 gene rnc 34959 35651 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL2 protein_id gnl|my_center|LOCUS_23390 35657 36694 gene locus_tag LOCUS_23400 gene era 35657 36694 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL1 protein_id gnl|my_center|LOCUS_23400 36707 36907 gene locus_tag LOCUS_23410 36707 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 36919 37629 gene locus_tag LOCUS_23420 gene recO 36919 37629 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK9 protein_id gnl|my_center|LOCUS_23420 37643 38368 gene locus_tag LOCUS_23430 gene pdxJ 37643 38368 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_23430 38379 39035 gene locus_tag LOCUS_23440 gene miaE 38379 39035 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence22 126 37 gene locus_tag LOCUS_t00330 126 37 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1342 869 gene locus_tag LOCUS_23450 gene greB 1342 869 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z217 protein_id gnl|my_center|LOCUS_23450 1858 1409 gene locus_tag LOCUS_23460 1858 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2975 2214 gene locus_tag LOCUS_23470 gene kipR 2975 2214 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206800.1 protein_id gnl|my_center|LOCUS_23470 4388 3117 gene locus_tag LOCUS_23480 gene citN 4388 3117 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206799.1 protein_id gnl|my_center|LOCUS_23480 5350 4424 gene locus_tag LOCUS_23490 gene drp35 5350 4424 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206798.1 protein_id gnl|my_center|LOCUS_23490 5585 6523 gene locus_tag LOCUS_23500 gene hmgCl 5585 6523 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_23500 6525 7724 gene locus_tag LOCUS_23510 6525 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 7767 9080 gene locus_tag LOCUS_23520 gene hpaX 7767 9080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206794.1 protein_id gnl|my_center|LOCUS_23520 9240 10538 gene locus_tag LOCUS_23530 9240 10538 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_23530 10696 10836 gene locus_tag LOCUS_23540 10696 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 11842 12864 gene locus_tag LOCUS_23550 gene yfhD 11842 12864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 protein_id gnl|my_center|LOCUS_23550 13324 12941 gene locus_tag LOCUS_23560 13324 12941 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_23560 14439 13534 gene locus_tag LOCUS_23570 gene ttcA 14439 13534 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLS9 protein_id gnl|my_center|LOCUS_23570 14944 15795 gene locus_tag LOCUS_23580 gene vII 14944 15795 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_23580 15947 16852 gene locus_tag LOCUS_23590 gene htpX 15947 16852 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT1 protein_id gnl|my_center|LOCUS_23590 17465 16890 gene locus_tag LOCUS_23600 17465 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207443.1 protein_id gnl|my_center|LOCUS_23600 18866 17520 gene locus_tag LOCUS_23610 18866 17520 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS2 protein_id gnl|my_center|LOCUS_23610 22169 19071 gene locus_tag LOCUS_23620 gene mexB 22169 19071 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207444.1 protein_id gnl|my_center|LOCUS_23620 22455 22832 gene locus_tag LOCUS_23630 gene dgkA 22455 22832 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766041.1 protein_id gnl|my_center|LOCUS_23630 24734 23100 gene locus_tag LOCUS_23640 gene groL 24734 23100 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT7 protein_id gnl|my_center|LOCUS_23640 25085 24795 gene locus_tag LOCUS_23650 gene groS 25085 24795 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_23650 26042 25266 gene locus_tag LOCUS_23660 26042 25266 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207450.1 protein_id gnl|my_center|LOCUS_23660 26964 26023 gene locus_tag LOCUS_23670 26964 26023 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115559.1 protein_id gnl|my_center|LOCUS_23670 27368 29197 gene locus_tag LOCUS_23680 gene pckG 27368 29197 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU3 protein_id gnl|my_center|LOCUS_23680 29321 29707 gene locus_tag LOCUS_23690 29321 29707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207890.1 protein_id gnl|my_center|LOCUS_23690 31293 29776 gene locus_tag LOCUS_23700 gene glpD 31293 29776 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207451.1 protein_id gnl|my_center|LOCUS_23700 31499 31927 gene locus_tag LOCUS_23710 31499 31927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115580.1 protein_id gnl|my_center|LOCUS_23710 32623 31955 gene locus_tag LOCUS_23720 32623 31955 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_23720 33727 32879 gene locus_tag LOCUS_23730 gene folD 33727 32879 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_23730 33881 33954 gene locus_tag LOCUS_t00340 33881 33954 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 33970 34055 gene locus_tag LOCUS_t00350 33970 34055 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34412 34164 gene locus_tag LOCUS_23740 34412 34164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 34512 35675 gene locus_tag LOCUS_23750 34512 35675 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_23750 35749 35834 gene locus_tag LOCUS_t00360 35749 35834 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 656 1312 gene locus_tag LOCUS_23760 656 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1599 3236 gene locus_tag LOCUS_23770 1599 3236 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919679.1 protein_id gnl|my_center|LOCUS_23770 3260 4363 gene locus_tag LOCUS_23780 3260 4363 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895534.1 protein_id gnl|my_center|LOCUS_23780 4387 5163 gene locus_tag LOCUS_23790 4387 5163 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086229.1 protein_id gnl|my_center|LOCUS_23790 5163 6311 gene locus_tag LOCUS_23800 5163 6311 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_23800 7145 6366 gene locus_tag LOCUS_23810 7145 6366 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919678.1 protein_id gnl|my_center|LOCUS_23810 7317 8072 gene locus_tag LOCUS_23820 7317 8072 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086235.1 protein_id gnl|my_center|LOCUS_23820 8236 9129 gene locus_tag LOCUS_23830 8236 9129 CDS product Smp-30/Cgr1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919672.1 protein_id gnl|my_center|LOCUS_23830 9139 11244 gene locus_tag LOCUS_23840 9139 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089116.1 protein_id gnl|my_center|LOCUS_23840 11290 11910 gene locus_tag LOCUS_23850 11290 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 11932 13524 gene locus_tag LOCUS_23860 11932 13524 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533498.1 protein_id gnl|my_center|LOCUS_23860 13538 14641 gene locus_tag LOCUS_23870 13538 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 14866 15936 gene locus_tag LOCUS_23880 14866 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53218 protein_id gnl|my_center|LOCUS_23880 16889 16131 gene locus_tag LOCUS_23890 16889 16131 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206302.1 protein_id gnl|my_center|LOCUS_23890 17337 17101 gene locus_tag LOCUS_23900 17337 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_23900 17943 18842 gene locus_tag LOCUS_23910 17943 18842 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_23910 18997 19911 gene locus_tag LOCUS_23920 18997 19911 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_23920 20089 21240 gene locus_tag LOCUS_23930 20089 21240 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182341.1 protein_id gnl|my_center|LOCUS_23930 21269 21430 gene locus_tag LOCUS_23940 21269 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 21436 22164 gene locus_tag LOCUS_23950 21436 22164 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23950 22312 22971 gene locus_tag LOCUS_23960 22312 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 22991 23230 gene locus_tag LOCUS_23970 22991 23230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23970 23568 23984 gene locus_tag LOCUS_23980 23568 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 23988 24401 gene locus_tag LOCUS_23990 23988 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 24856 24662 gene locus_tag LOCUS_24000 24856 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 24969 25217 gene locus_tag LOCUS_24010 24969 25217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 25222 25644 gene locus_tag LOCUS_24020 25222 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 26173 25859 gene locus_tag LOCUS_24030 26173 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222082.1 protein_id gnl|my_center|LOCUS_24030 27330 26173 gene locus_tag LOCUS_24040 27330 26173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 27554 27330 gene locus_tag LOCUS_24050 27554 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 27670 27867 gene locus_tag LOCUS_24060 27670 27867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 27929 28183 gene locus_tag LOCUS_24070 27929 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 30210 28906 gene locus_tag LOCUS_24080 30210 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 30485 30207 gene locus_tag LOCUS_24090 30485 30207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 31897 30488 gene locus_tag LOCUS_24100 31897 30488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 32294 32025 gene locus_tag LOCUS_24110 32294 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 32510 32313 gene locus_tag LOCUS_24120 32510 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence24 1222 2481 gene locus_tag LOCUS_24130 1222 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2798 3079 gene locus_tag LOCUS_24140 2798 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3174 3250 gene locus_tag LOCUS_t00370 3174 3250 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4639 3335 gene locus_tag LOCUS_24150 4639 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4829 5326 gene locus_tag LOCUS_24160 4829 5326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804627.1 protein_id gnl|my_center|LOCUS_24160 5361 6002 gene locus_tag LOCUS_24170 gene ycgM 5361 6002 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_24170 7552 6266 gene locus_tag LOCUS_24180 gene ynfM 7552 6266 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207888.1 protein_id gnl|my_center|LOCUS_24180 7784 8596 gene locus_tag LOCUS_24190 gene ynfL 7784 8596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207887.1 protein_id gnl|my_center|LOCUS_24190 9901 8657 gene locus_tag LOCUS_24200 9901 8657 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_24200 10014 10613 gene locus_tag LOCUS_24210 10014 10613 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_24210 10682 11317 gene locus_tag LOCUS_24220 gene leuE 10682 11317 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115157.1 protein_id gnl|my_center|LOCUS_24220 11761 11375 gene locus_tag LOCUS_24230 11761 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120526.1 protein_id gnl|my_center|LOCUS_24230 12502 11927 gene locus_tag LOCUS_24240 gene xpt 12502 11927 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPY5 protein_id gnl|my_center|LOCUS_24240 13365 12649 gene locus_tag LOCUS_24250 13365 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_24250 14204 13521 gene locus_tag LOCUS_24260 14204 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 protein_id gnl|my_center|LOCUS_24260 14701 16851 gene locus_tag LOCUS_24270 14701 16851 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 protein_id gnl|my_center|LOCUS_24270 17374 16895 gene locus_tag LOCUS_24280 gene ybeY 17374 16895 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPY1 protein_id gnl|my_center|LOCUS_24280 18540 17458 gene locus_tag LOCUS_24290 gene phoL 18540 17458 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_24290 20032 18581 gene locus_tag LOCUS_24300 gene miaB 20032 18581 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX9 protein_id gnl|my_center|LOCUS_24300 20254 22263 gene locus_tag LOCUS_24310 gene slt 20254 22263 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_24310 22301 22963 gene locus_tag LOCUS_24320 22301 22963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_24320 23143 24129 gene locus_tag LOCUS_24330 gene mdh 23143 24129 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX6 protein_id gnl|my_center|LOCUS_24330 24312 24560 gene locus_tag LOCUS_24340 24312 24560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_24340 25119 24592 gene locus_tag LOCUS_24350 25119 24592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207718.1 protein_id gnl|my_center|LOCUS_24350 25817 25209 gene locus_tag LOCUS_24360 25817 25209 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207717.1 protein_id gnl|my_center|LOCUS_24360 25930 26787 gene locus_tag LOCUS_24370 gene rlmJ 25930 26787 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX2 protein_id gnl|my_center|LOCUS_24370 26829 27662 gene locus_tag LOCUS_24380 gene pssA 26829 27662 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_24380 27679 28755 gene locus_tag LOCUS_24390 27679 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207715.1 protein_id gnl|my_center|LOCUS_24390 28745 28924 gene locus_tag LOCUS_24400 28745 28924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence25 1292 2209 gene locus_tag LOCUS_24410 1292 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2342 4285 gene locus_tag LOCUS_24420 2342 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_24420 4524 5117 gene locus_tag LOCUS_24430 4524 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5145 7382 gene locus_tag LOCUS_24440 5145 7382 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_24440 7379 8725 gene locus_tag LOCUS_24450 7379 8725 CDS product type I restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901210.1 protein_id gnl|my_center|LOCUS_24450 8761 11808 gene locus_tag LOCUS_24460 gene hsdR2 8761 11808 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_24460 11935 13047 gene locus_tag LOCUS_24470 11935 13047 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_24470 13040 13546 gene locus_tag LOCUS_24480 13040 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 13734 16472 gene locus_tag LOCUS_24490 13734 16472 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206125.1 protein_id gnl|my_center|LOCUS_24490 16493 17551 gene locus_tag LOCUS_24500 16493 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206126.1 protein_id gnl|my_center|LOCUS_24500 17553 19283 gene locus_tag LOCUS_24510 17553 19283 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206127.1 protein_id gnl|my_center|LOCUS_24510 19546 20844 gene locus_tag LOCUS_24520 gene mdtA 19546 20844 CDS product multidrug resistance protein MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNL2 protein_id gnl|my_center|LOCUS_24520 20854 24015 gene locus_tag LOCUS_24530 20854 24015 CDS product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_24530 24012 27188 gene locus_tag LOCUS_24540 gene mdtC 24012 27188 CDS product multidrug resistance protein MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCV9 protein_id gnl|my_center|LOCUS_24540 27204 28649 gene locus_tag LOCUS_24550 27204 28649 CDS product outer membrane efflux lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence26 1639 731 gene locus_tag LOCUS_24560 gene srpH 1639 731 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206475.1 protein_id gnl|my_center|LOCUS_24560 1856 4030 gene locus_tag LOCUS_24570 gene fatA 1856 4030 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206690.1 protein_id gnl|my_center|LOCUS_24570 4503 5789 gene locus_tag LOCUS_24580 gene livK 4503 5789 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_24580 5871 7517 gene locus_tag LOCUS_24590 5871 7517 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 protein_id gnl|my_center|LOCUS_24590 7524 8594 gene locus_tag LOCUS_24600 7524 8594 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269027.1 protein_id gnl|my_center|LOCUS_24600 8595 9422 gene locus_tag LOCUS_24610 8595 9422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_24610 9432 10130 gene locus_tag LOCUS_24620 9432 10130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 protein_id gnl|my_center|LOCUS_24620 10446 10628 gene locus_tag LOCUS_24630 10446 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 10659 10982 gene locus_tag LOCUS_24640 10659 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 11592 11155 gene locus_tag LOCUS_24650 11592 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 12041 13240 gene locus_tag LOCUS_24660 12041 13240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205933.1 protein_id gnl|my_center|LOCUS_24660 14742 13306 gene locus_tag LOCUS_24670 gene otsA 14742 13306 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205934.1 protein_id gnl|my_center|LOCUS_24670 15589 14735 gene locus_tag LOCUS_24680 gene otsB 15589 14735 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY0 protein_id gnl|my_center|LOCUS_24680 15975 16448 gene locus_tag LOCUS_24690 15975 16448 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887789.1 protein_id gnl|my_center|LOCUS_24690 16947 17462 gene locus_tag LOCUS_24700 gene femI 16947 17462 CDS product ECF sigma factor FemI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_24700 17456 18397 gene locus_tag LOCUS_24710 gene fecR 17456 18397 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206291.1 protein_id gnl|my_center|LOCUS_24710 18479 20950 gene locus_tag LOCUS_24720 gene bfrC 18479 20950 CDS product ferric siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064748.1 protein_id gnl|my_center|LOCUS_24720 21084 21899 gene locus_tag LOCUS_24730 21084 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 22241 24322 gene locus_tag LOCUS_24740 gene ppk 22241 24322 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_24740 24654 25943 gene locus_tag LOCUS_24750 gene met13 24654 25943 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206819.1 protein_id gnl|my_center|LOCUS_24750 26492 26034 gene locus_tag LOCUS_24760 26492 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_24760 26789 26865 gene locus_tag LOCUS_t00380 26789 26865 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27029 27253 gene locus_tag LOCUS_24770 27029 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070233.1 protein_id gnl|my_center|LOCUS_24770 27435 27647 gene locus_tag LOCUS_24780 gene cspV 27435 27647 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070223.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence27 1303 254 gene locus_tag LOCUS_24790 1303 254 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_24790 2793 1405 gene locus_tag LOCUS_24800 gene pdhD 2793 1405 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207656.1 protein_id gnl|my_center|LOCUS_24800 2936 4867 gene locus_tag LOCUS_24810 2936 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 5456 5034 gene locus_tag LOCUS_24820 5456 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 5784 5449 gene locus_tag LOCUS_24830 gene blh 5784 5449 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_24830 5910 6806 gene locus_tag LOCUS_24840 5910 6806 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207654.1 protein_id gnl|my_center|LOCUS_24840 6808 7233 gene locus_tag LOCUS_24850 gene thi3 6808 7233 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_24850 7247 7666 gene locus_tag LOCUS_24860 7247 7666 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116010.1 protein_id gnl|my_center|LOCUS_24860 8269 7775 gene locus_tag LOCUS_24870 8269 7775 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 protein_id gnl|my_center|LOCUS_24870 8791 8303 gene locus_tag LOCUS_24880 8791 8303 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC9 protein_id gnl|my_center|LOCUS_24880 8883 9197 gene locus_tag LOCUS_24890 gene glpE 8883 9197 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 protein_id gnl|my_center|LOCUS_24890 11113 9248 gene locus_tag LOCUS_24900 gene mnmC 11113 9248 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC7 protein_id gnl|my_center|LOCUS_24900 11598 11152 gene locus_tag LOCUS_24910 11598 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064163.1 protein_id gnl|my_center|LOCUS_24910 11905 11603 gene locus_tag LOCUS_24920 11905 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_24920 12552 11938 gene locus_tag LOCUS_24930 gene ispZ 12552 11938 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ2 protein_id gnl|my_center|LOCUS_24930 12598 13449 gene locus_tag LOCUS_24940 gene trpH 12598 13449 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_24940 14086 13463 gene locus_tag LOCUS_24950 gene yliJ 14086 13463 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206200.1 protein_id gnl|my_center|LOCUS_24950 15158 14238 gene locus_tag LOCUS_24960 15158 14238 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037803.1 protein_id gnl|my_center|LOCUS_24960 15257 16303 gene locus_tag LOCUS_24970 gene mocA 15257 16303 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709388.1 protein_id gnl|my_center|LOCUS_24970 17235 16324 gene locus_tag LOCUS_24980 17235 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064169.1 protein_id gnl|my_center|LOCUS_24980 18002 17232 gene locus_tag LOCUS_24990 gene radC 18002 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207648.1 protein_id gnl|my_center|LOCUS_24990 18113 19369 gene locus_tag LOCUS_25000 gene dfp 18113 19369 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_25000 19569 19871 gene locus_tag LOCUS_25010 19569 19871 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207686.1 protein_id gnl|my_center|LOCUS_25010 20386 19931 gene locus_tag LOCUS_25020 gene secB 20386 19931 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_25020 20673 20416 gene locus_tag LOCUS_25030 gene grx 20673 20416 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_25030 21081 20686 gene locus_tag LOCUS_25040 gene yibN 21081 20686 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_25040 22252 21194 gene locus_tag LOCUS_25050 gene engC 22252 21194 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS6 protein_id gnl|my_center|LOCUS_25050 22375 22926 gene locus_tag LOCUS_25060 gene orn 22375 22926 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_25060 23148 23879 gene locus_tag LOCUS_25070 23148 23879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_25070 24023 24826 gene locus_tag LOCUS_25080 gene fabI 24023 24826 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS9 protein_id gnl|my_center|LOCUS_25080 >Feature sequence28 <1 1179 gene locus_tag LOCUS_25090 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFJ8:elongation factor Tu 1236 1311 gene locus_tag LOCUS_t00390 1236 1311 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1387 1827 gene locus_tag LOCUS_25100 gene secE 1387 1827 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP5 protein_id gnl|my_center|LOCUS_25100 1835 2368 gene locus_tag LOCUS_25110 gene nusG 1835 2368 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP6 protein_id gnl|my_center|LOCUS_25110 2482 2910 gene locus_tag LOCUS_25120 gene rplK 2482 2910 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP7 protein_id gnl|my_center|LOCUS_25120 2914 3609 gene locus_tag LOCUS_25130 gene rplA 2914 3609 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP8 protein_id gnl|my_center|LOCUS_25130 3879 4385 gene locus_tag LOCUS_25140 gene rplJ 3879 4385 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP9 protein_id gnl|my_center|LOCUS_25140 4428 4793 gene locus_tag LOCUS_25150 gene rplL 4428 4793 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKQ0 protein_id gnl|my_center|LOCUS_25150 5102 9190 gene locus_tag LOCUS_25160 gene rpoB 5102 9190 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_25160 9279 13472 gene locus_tag LOCUS_25170 gene rpoC 9279 13472 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKQ3 protein_id gnl|my_center|LOCUS_25170 13719 14075 gene locus_tag LOCUS_25180 13719 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115127.1 protein_id gnl|my_center|LOCUS_25180 14559 14122 gene locus_tag LOCUS_25190 14559 14122 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_25190 14728 15603 gene locus_tag LOCUS_25200 gene ephD 14728 15603 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208201.1 protein_id gnl|my_center|LOCUS_25200 15723 17144 gene locus_tag LOCUS_25210 15723 17144 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 protein_id gnl|my_center|LOCUS_25210 17423 18049 gene locus_tag LOCUS_25220 gene ompW 17423 18049 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208202.1 protein_id gnl|my_center|LOCUS_25220 18282 18632 gene locus_tag LOCUS_25230 18282 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060531.1 protein_id gnl|my_center|LOCUS_25230 18737 20659 gene locus_tag LOCUS_25240 gene htpG 18737 20659 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKR1 protein_id gnl|my_center|LOCUS_25240 21490 20741 gene locus_tag LOCUS_25250 21490 20741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208204.1 protein_id gnl|my_center|LOCUS_25250 22025 22735 gene locus_tag LOCUS_25260 22025 22735 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207779.1 protein_id gnl|my_center|LOCUS_25260 22853 24151 gene locus_tag LOCUS_25270 gene dctA 22853 24151 CDS product transporter dicarboxylate/amino acid:cation Na+/H+ symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence29 369 1205 gene locus_tag LOCUS_25280 gene pcaU 369 1205 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_25280 1855 1610 gene locus_tag LOCUS_25290 1855 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 3768 1966 gene locus_tag LOCUS_25300 gene acdB 3768 1966 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206443.1 protein_id gnl|my_center|LOCUS_25300 4073 4495 gene locus_tag LOCUS_25310 4073 4495 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206442.1 protein_id gnl|my_center|LOCUS_25310 5735 4533 gene locus_tag LOCUS_25320 gene dcaY 5735 4533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206441.1 protein_id gnl|my_center|LOCUS_25320 7070 5754 gene locus_tag LOCUS_25330 gene dcaP 7070 5754 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733488.1 protein_id gnl|my_center|LOCUS_25330 7829 7155 gene locus_tag LOCUS_25340 gene dcaJ 7829 7155 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206440.1 protein_id gnl|my_center|LOCUS_25340 8497 7826 gene locus_tag LOCUS_25350 gene dcaI 8497 7826 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608696.1 protein_id gnl|my_center|LOCUS_25350 10094 8787 gene locus_tag LOCUS_25360 gene dcaK 10094 8787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206439.1 protein_id gnl|my_center|LOCUS_25360 11286 10132 gene locus_tag LOCUS_25370 gene dcaA 11286 10132 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_25370 11605 12390 gene locus_tag LOCUS_25380 gene dcaE 11605 12390 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_25380 12423 13184 gene locus_tag LOCUS_25390 gene dcaG 12423 13184 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206437.1 protein_id gnl|my_center|LOCUS_25390 13233 14750 gene locus_tag LOCUS_25400 gene dcaH 13233 14750 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_25400 14771 15976 gene locus_tag LOCUS_25410 gene dcaF 14771 15976 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_25410 16089 16934 gene locus_tag LOCUS_25420 gene dcaR 16089 16934 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081480.1 protein_id gnl|my_center|LOCUS_25420 18192 16969 gene locus_tag LOCUS_25430 gene caiB 18192 16969 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_25430 18373 19572 gene locus_tag LOCUS_25440 gene ygaY 18373 19572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206434.1 protein_id gnl|my_center|LOCUS_25440 20461 19616 gene locus_tag LOCUS_25450 gene pcaR 20461 19616 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996082.1 protein_id gnl|my_center|LOCUS_25450 21804 20587 gene locus_tag LOCUS_25460 gene caiB 21804 20587 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_25460 22235 23377 gene locus_tag LOCUS_25470 gene mucK 22235 23377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 protein_id gnl|my_center|LOCUS_25470 23508 23708 gene locus_tag LOCUS_25480 23508 23708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence30 887 219 gene locus_tag LOCUS_25490 887 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065252.1 protein_id gnl|my_center|LOCUS_25490 1340 906 gene locus_tag LOCUS_25500 gene sspB 1340 906 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_25500 2002 1352 gene locus_tag LOCUS_25510 gene sspA 2002 1352 CDS product starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065247.1 protein_id gnl|my_center|LOCUS_25510 2617 2231 gene locus_tag LOCUS_25520 gene rpsI 2617 2231 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK4 protein_id gnl|my_center|LOCUS_25520 3058 2630 gene locus_tag LOCUS_25530 gene rplM 3058 2630 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK3 protein_id gnl|my_center|LOCUS_25530 3363 4331 gene locus_tag LOCUS_25540 gene pdxA 3363 4331 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK2 protein_id gnl|my_center|LOCUS_25540 4354 5166 gene locus_tag LOCUS_25550 gene rsmA 4354 5166 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT8 protein_id gnl|my_center|LOCUS_25550 5169 6020 gene locus_tag LOCUS_25560 gene apaH 5169 6020 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ9 protein_id gnl|my_center|LOCUS_25560 6745 6077 gene locus_tag LOCUS_25570 gene lrgB 6745 6077 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 protein_id gnl|my_center|LOCUS_25570 7130 6759 gene locus_tag LOCUS_25580 7130 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 protein_id gnl|my_center|LOCUS_25580 8509 7175 gene locus_tag LOCUS_25590 gene hflX 8509 7175 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ5 protein_id gnl|my_center|LOCUS_25590 8733 8593 gene locus_tag LOCUS_25600 8733 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8900 9715 gene locus_tag LOCUS_25610 gene plsC 8900 9715 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_25610 11267 9708 gene locus_tag LOCUS_25620 gene plD 11267 9708 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117884.1 protein_id gnl|my_center|LOCUS_25620 11449 12459 gene locus_tag LOCUS_25630 11449 12459 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_25630 13260 12478 gene locus_tag LOCUS_25640 13260 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 14684 13374 gene locus_tag LOCUS_25650 gene yhjE 14684 13374 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207605.1 protein_id gnl|my_center|LOCUS_25650 15551 14826 gene locus_tag LOCUS_25660 gene yqfA 15551 14826 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207604.1 protein_id gnl|my_center|LOCUS_25660 15571 16794 gene locus_tag LOCUS_25670 gene gstcD 15571 16794 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_25670 16815 17267 gene locus_tag LOCUS_25680 16815 17267 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207602.1 protein_id gnl|my_center|LOCUS_25680 17393 18007 gene locus_tag LOCUS_25690 17393 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 18010 18387 gene locus_tag LOCUS_25700 18010 18387 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207383.1 protein_id gnl|my_center|LOCUS_25700 19269 18412 gene locus_tag LOCUS_25710 gene yjjU 19269 18412 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207601.1 protein_id gnl|my_center|LOCUS_25710 19521 19285 gene locus_tag LOCUS_25720 19521 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280981.1 protein_id gnl|my_center|LOCUS_25720 21809 19674 gene locus_tag LOCUS_25730 21809 19674 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_25730 22263 21820 gene locus_tag LOCUS_25740 22263 21820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence31 235 1353 gene locus_tag LOCUS_25750 gene hcaK 235 1353 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411707.1 protein_id gnl|my_center|LOCUS_25750 1417 1896 gene locus_tag LOCUS_25760 1417 1896 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206159.1 protein_id gnl|my_center|LOCUS_25760 2520 1903 gene locus_tag LOCUS_25770 2520 1903 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 protein_id gnl|my_center|LOCUS_25770 2902 3864 gene locus_tag LOCUS_25780 2902 3864 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_25780 3924 4751 gene locus_tag LOCUS_25790 gene ephD 3924 4751 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_25790 4843 6372 gene locus_tag LOCUS_25800 gene hapE 4843 6372 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_25800 6450 7331 gene locus_tag LOCUS_25810 6450 7331 CDS product S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI60 protein_id gnl|my_center|LOCUS_25810 7469 7975 gene locus_tag LOCUS_25820 7469 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 protein_id gnl|my_center|LOCUS_25820 9428 8040 gene locus_tag LOCUS_25830 gene accC 9428 8040 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115704.1 protein_id gnl|my_center|LOCUS_25830 9867 9445 gene locus_tag LOCUS_25840 gene accB 9867 9445 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 protein_id gnl|my_center|LOCUS_25840 10344 9895 gene locus_tag LOCUS_25850 gene aroQ 10344 9895 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGI2 protein_id gnl|my_center|LOCUS_25850 12239 11427 gene locus_tag LOCUS_25860 gene folE2 12239 11427 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q882P7 protein_id gnl|my_center|LOCUS_25860 13567 12359 gene locus_tag LOCUS_25870 13567 12359 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_25870 14463 13756 gene locus_tag LOCUS_25880 14463 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207984.1 protein_id gnl|my_center|LOCUS_25880 15634 14633 gene locus_tag LOCUS_25890 15634 14633 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 protein_id gnl|my_center|LOCUS_25890 17273 15855 gene locus_tag LOCUS_25900 gene aspA 17273 15855 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206691.1 protein_id gnl|my_center|LOCUS_25900 17410 18300 gene locus_tag LOCUS_25910 gene yjiE 17410 18300 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206693.1 protein_id gnl|my_center|LOCUS_25910 18390 18590 gene locus_tag LOCUS_25920 18390 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 18785 19246 gene locus_tag LOCUS_25930 18785 19246 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 protein_id gnl|my_center|LOCUS_25930 19574 19317 gene locus_tag LOCUS_25940 19574 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 20716 19712 gene locus_tag LOCUS_25950 gene cioB 20716 19712 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206500.1 protein_id gnl|my_center|LOCUS_25950 <22142 20719 gene locus_tag LOCUS_25960 <22142 20719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206501.1:cytochrome ubiquinol oxidase subunit I >Feature sequence32 830 2629 gene locus_tag LOCUS_25970 gene shlB 830 2629 CDS product hemolysin activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206788.1 protein_id gnl|my_center|LOCUS_25970 2715 13850 gene locus_tag LOCUS_25980 2715 13850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 13852 14322 gene locus_tag LOCUS_25990 13852 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 14692 15153 gene locus_tag LOCUS_26000 14692 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 15243 16769 gene locus_tag LOCUS_26010 15243 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 16778 17209 gene locus_tag LOCUS_26020 16778 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 17209 17472 gene locus_tag LOCUS_26030 17209 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222093.1 protein_id gnl|my_center|LOCUS_26030 17533 17778 gene locus_tag LOCUS_26040 17533 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 17775 18617 gene locus_tag LOCUS_26050 17775 18617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 18703 20103 gene locus_tag LOCUS_26060 18703 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 20109 20480 gene locus_tag LOCUS_26070 20109 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704129.1 protein_id gnl|my_center|LOCUS_26070 20618 20770 gene locus_tag LOCUS_26080 20618 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence33 1748 396 gene locus_tag LOCUS_26090 1748 396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802478.1 protein_id gnl|my_center|LOCUS_26090 2742 1873 gene locus_tag LOCUS_26100 2742 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 protein_id gnl|my_center|LOCUS_26100 3225 4154 gene locus_tag LOCUS_26110 3225 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105037.1 protein_id gnl|my_center|LOCUS_26110 4185 4970 gene locus_tag LOCUS_26120 4185 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 5083 5520 gene locus_tag LOCUS_26130 5083 5520 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 protein_id gnl|my_center|LOCUS_26130 6980 6003 gene locus_tag LOCUS_26140 6980 6003 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 protein_id gnl|my_center|LOCUS_26140 8193 7051 gene locus_tag LOCUS_26150 8193 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089165.1 protein_id gnl|my_center|LOCUS_26150 9368 8208 gene locus_tag LOCUS_26160 9368 8208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089168.1 protein_id gnl|my_center|LOCUS_26160 9738 9379 gene locus_tag LOCUS_26170 9738 9379 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_26170 10667 9738 gene locus_tag LOCUS_26180 10667 9738 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089167.1 protein_id gnl|my_center|LOCUS_26180 10886 12049 gene locus_tag LOCUS_26190 10886 12049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089164.1 protein_id gnl|my_center|LOCUS_26190 12439 13053 gene locus_tag LOCUS_26200 12439 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_26200 13374 13057 gene locus_tag LOCUS_26210 13374 13057 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073056.1 protein_id gnl|my_center|LOCUS_26210 14702 13371 gene locus_tag LOCUS_26220 14702 13371 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880613.1 protein_id gnl|my_center|LOCUS_26220 15045 15899 gene locus_tag LOCUS_26230 gene yfdC 15045 15899 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 protein_id gnl|my_center|LOCUS_26230 16228 16025 gene locus_tag LOCUS_26240 16228 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073749.1 protein_id gnl|my_center|LOCUS_26240 18112 16370 gene locus_tag LOCUS_26250 gene oatA 18112 16370 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208060.1 protein_id gnl|my_center|LOCUS_26250 18461 18318 gene locus_tag LOCUS_26260 18461 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence34 1463 2032 gene locus_tag LOCUS_26270 1463 2032 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538671.1 protein_id gnl|my_center|LOCUS_26270 2090 2638 gene locus_tag LOCUS_26280 gene yncA 2090 2638 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206563.1 protein_id gnl|my_center|LOCUS_26280 2728 3300 gene locus_tag LOCUS_26290 2728 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207168.1 protein_id gnl|my_center|LOCUS_26290 3273 3773 gene locus_tag LOCUS_26300 3273 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207169.1 protein_id gnl|my_center|LOCUS_26300 3793 4479 gene locus_tag LOCUS_26310 gene cusR 3793 4479 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207170.1 protein_id gnl|my_center|LOCUS_26310 5821 4493 gene locus_tag LOCUS_26320 gene colS 5821 4493 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207171.1 protein_id gnl|my_center|LOCUS_26320 6919 5864 gene locus_tag LOCUS_26330 gene cfa 6919 5864 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 protein_id gnl|my_center|LOCUS_26330 7712 6933 gene locus_tag LOCUS_26340 7712 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207173.1 protein_id gnl|my_center|LOCUS_26340 8945 7746 gene locus_tag LOCUS_26350 gene cfa 8945 7746 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207174.1 protein_id gnl|my_center|LOCUS_26350 9734 8949 gene locus_tag LOCUS_26360 9734 8949 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207175.1 protein_id gnl|my_center|LOCUS_26360 11009 9750 gene locus_tag LOCUS_26370 11009 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 11995 11024 gene locus_tag LOCUS_26380 gene desC 11995 11024 CDS product stearoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207178.1 protein_id gnl|my_center|LOCUS_26380 12681 12121 gene locus_tag LOCUS_26390 gene blc 12681 12121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770558.1 protein_id gnl|my_center|LOCUS_26390 13659 12886 gene locus_tag LOCUS_26400 13659 12886 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK9 protein_id gnl|my_center|LOCUS_26400 13957 14865 gene locus_tag LOCUS_26410 13957 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 16257 15298 gene locus_tag LOCUS_26420 16257 15298 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089148.1 protein_id gnl|my_center|LOCUS_26420 16675 17724 gene locus_tag LOCUS_26430 16675 17724 CDS product phenylacetaldoxime dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266125.1 protein_id gnl|my_center|LOCUS_26430 17809 18687 gene locus_tag LOCUS_26440 17809 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266124.1 protein_id gnl|my_center|LOCUS_26440 18825 19280 gene locus_tag LOCUS_26450 18825 19280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence35 851 2134 gene locus_tag LOCUS_26460 gene tolB 851 2134 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL57 protein_id gnl|my_center|LOCUS_26460 2165 2734 gene locus_tag LOCUS_26470 gene pal 2165 2734 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_26470 2999 2802 gene locus_tag LOCUS_26480 2999 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067763.1 protein_id gnl|my_center|LOCUS_26480 3178 4149 gene locus_tag LOCUS_26490 gene fbp 3178 4149 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL60 protein_id gnl|my_center|LOCUS_26490 4202 4978 gene locus_tag LOCUS_26500 4202 4978 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_26500 5142 5759 gene locus_tag LOCUS_26510 5142 5759 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118814.1 protein_id gnl|my_center|LOCUS_26510 5746 6066 gene locus_tag LOCUS_26520 5746 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118556.1 protein_id gnl|my_center|LOCUS_26520 6056 6454 gene locus_tag LOCUS_26530 6056 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118619.1 protein_id gnl|my_center|LOCUS_26530 8905 6503 gene locus_tag LOCUS_26540 8905 6503 CDS product CSLREA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207394.1 protein_id gnl|my_center|LOCUS_26540 10738 8915 gene locus_tag LOCUS_26550 10738 8915 CDS product rhombotarget A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207395.1 protein_id gnl|my_center|LOCUS_26550 11560 10853 gene locus_tag LOCUS_26560 gene dnaA 11560 10853 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_26560 12771 11581 gene locus_tag LOCUS_26570 gene rp630 12771 11581 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_26570 12906 13976 gene locus_tag LOCUS_26580 gene purM 12906 13976 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_26580 13973 14602 gene locus_tag LOCUS_26590 gene purN 13973 14602 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL71 protein_id gnl|my_center|LOCUS_26590 15465 14662 gene locus_tag LOCUS_26600 15465 14662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_26600 16493 15477 gene locus_tag LOCUS_26610 gene nhaA 16493 15477 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_26610 16654 17640 gene locus_tag LOCUS_26620 gene htrB 16654 17640 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_26620 19156 17573 gene locus_tag LOCUS_26630 19156 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence36 424 966 gene locus_tag LOCUS_26640 424 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1036 2034 gene locus_tag LOCUS_26650 gene cysK 1036 2034 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJZ5 protein_id gnl|my_center|LOCUS_26650 2714 2133 gene locus_tag LOCUS_26660 gene slt 2714 2133 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208138.1 protein_id gnl|my_center|LOCUS_26660 3835 2894 gene locus_tag LOCUS_26670 3835 2894 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 protein_id gnl|my_center|LOCUS_26670 4518 3832 gene locus_tag LOCUS_26680 4518 3832 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 protein_id gnl|my_center|LOCUS_26680 4972 4532 gene locus_tag LOCUS_26690 4972 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 6333 4969 gene locus_tag LOCUS_26700 6333 4969 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 protein_id gnl|my_center|LOCUS_26700 8097 6349 gene locus_tag LOCUS_26710 8097 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105550.1 protein_id gnl|my_center|LOCUS_26710 8758 8117 gene locus_tag LOCUS_26720 8758 8117 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 protein_id gnl|my_center|LOCUS_26720 8906 9373 gene locus_tag LOCUS_26730 gene ybaK 8906 9373 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ8 protein_id gnl|my_center|LOCUS_26730 9525 11090 gene locus_tag LOCUS_26740 9525 11090 CDS product histidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206642.1 protein_id gnl|my_center|LOCUS_26740 11339 13480 gene locus_tag LOCUS_26750 gene cbbY 11339 13480 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206637.1 protein_id gnl|my_center|LOCUS_26750 14364 13672 gene locus_tag LOCUS_26760 gene ywbG 14364 13672 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206486.1 protein_id gnl|my_center|LOCUS_26760 14789 14361 gene locus_tag LOCUS_26770 gene cidA 14789 14361 CDS product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206485.1 protein_id gnl|my_center|LOCUS_26770 14888 15799 gene locus_tag LOCUS_26780 gene gltC 14888 15799 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206484.1 protein_id gnl|my_center|LOCUS_26780 15850 16287 gene locus_tag LOCUS_26790 15850 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069081.1 protein_id gnl|my_center|LOCUS_26790 16284 16694 gene locus_tag LOCUS_26800 16284 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 protein_id gnl|my_center|LOCUS_26800 16699 17577 gene locus_tag LOCUS_26810 16699 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_26810 17582 17941 gene locus_tag LOCUS_26820 17582 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence37 508 1311 gene locus_tag LOCUS_26830 gene catD 508 1311 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206900.1 protein_id gnl|my_center|LOCUS_26830 1594 2937 gene locus_tag LOCUS_26840 1594 2937 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 protein_id gnl|my_center|LOCUS_26840 3397 2981 gene locus_tag LOCUS_26850 3397 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3496 4509 gene locus_tag LOCUS_26860 3496 4509 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208299.1 protein_id gnl|my_center|LOCUS_26860 5597 4563 gene locus_tag LOCUS_26870 gene yesN 5597 4563 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_26870 7057 5747 gene locus_tag LOCUS_26880 7057 5747 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206267.1 protein_id gnl|my_center|LOCUS_26880 8142 7132 gene locus_tag LOCUS_26890 gene yerI 8142 7132 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 protein_id gnl|my_center|LOCUS_26890 8325 9740 gene locus_tag LOCUS_26900 gene eutP 8325 9740 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206269.1 protein_id gnl|my_center|LOCUS_26900 9837 10310 gene locus_tag LOCUS_26910 9837 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_26910 10353 12458 gene locus_tag LOCUS_26920 gene foxA 10353 12458 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 protein_id gnl|my_center|LOCUS_26920 13416 12508 gene locus_tag LOCUS_26930 13416 12508 CDS product bestrophin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113810.1 protein_id gnl|my_center|LOCUS_26930 14530 13823 gene locus_tag LOCUS_26940 14530 13823 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547194.1 protein_id gnl|my_center|LOCUS_26940 14974 15960 gene locus_tag LOCUS_26950 14974 15960 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_26950 15987 16829 gene locus_tag LOCUS_26960 15987 16829 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082922.1 protein_id gnl|my_center|LOCUS_26960 16822 17616 gene locus_tag LOCUS_26970 16822 17616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence38 355 1581 gene locus_tag LOCUS_26980 gene pilC 355 1581 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_26980 1581 2441 gene locus_tag LOCUS_26990 gene pilD 1581 2441 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA6 protein_id gnl|my_center|LOCUS_26990 2447 3034 gene locus_tag LOCUS_27000 gene coaE 2447 3034 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_27000 3948 3031 gene locus_tag LOCUS_27010 3948 3031 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_27010 4735 3989 gene locus_tag LOCUS_27020 gene rlmB 4735 3989 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA3 protein_id gnl|my_center|LOCUS_27020 5161 4835 gene locus_tag LOCUS_27030 5161 4835 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_27030 6547 5240 gene locus_tag LOCUS_27040 6547 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208223.1 protein_id gnl|my_center|LOCUS_27040 6663 8324 gene locus_tag LOCUS_27050 gene recN 6663 8324 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU0 protein_id gnl|my_center|LOCUS_27050 8440 8994 gene locus_tag LOCUS_27060 8440 8994 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT9 protein_id gnl|my_center|LOCUS_27060 8987 9430 gene locus_tag LOCUS_27070 8987 9430 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT8 protein_id gnl|my_center|LOCUS_27070 10509 9493 gene locus_tag LOCUS_27080 gene ydhJ 10509 9493 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 protein_id gnl|my_center|LOCUS_27080 10753 10544 gene locus_tag LOCUS_27090 10753 10544 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115096.1 protein_id gnl|my_center|LOCUS_27090 12839 10740 gene locus_tag LOCUS_27100 12839 10740 CDS product fusaric acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208221.1 protein_id gnl|my_center|LOCUS_27100 13293 14075 gene locus_tag LOCUS_27110 gene pcaU 13293 14075 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114686.1 protein_id gnl|my_center|LOCUS_27110 14737 14129 gene locus_tag LOCUS_27120 14737 14129 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_27120 15594 14734 gene locus_tag LOCUS_27130 gene ada 15594 14734 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208219.1 protein_id gnl|my_center|LOCUS_27130 16296 15709 gene locus_tag LOCUS_27140 gene pgsA 16296 15709 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_27140 17195 16404 gene locus_tag LOCUS_27150 17195 16404 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208217.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence39 43 118 gene locus_tag LOCUS_t00400 43 118 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1390 215 gene locus_tag LOCUS_27160 gene noxB 1390 215 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206115.1 protein_id gnl|my_center|LOCUS_27160 3156 1561 gene locus_tag LOCUS_27170 gene yejF 3156 1561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_27170 4141 3131 gene locus_tag LOCUS_27180 gene yejE 4141 3131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_27180 5208 4141 gene locus_tag LOCUS_27190 gene yejB 5208 4141 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206112.1 protein_id gnl|my_center|LOCUS_27190 7083 5236 gene locus_tag LOCUS_27200 7083 5236 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 protein_id gnl|my_center|LOCUS_27200 10320 7099 gene locus_tag LOCUS_27210 gene mltD 10320 7099 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 protein_id gnl|my_center|LOCUS_27210 10532 11884 gene locus_tag LOCUS_27220 gene dnaQ 10532 11884 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHH4 protein_id gnl|my_center|LOCUS_27220 12000 13640 gene locus_tag LOCUS_27230 12000 13640 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206108.1 protein_id gnl|my_center|LOCUS_27230 13640 14389 gene locus_tag LOCUS_27240 gene nudC 13640 14389 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 protein_id gnl|my_center|LOCUS_27240 15285 14401 gene locus_tag LOCUS_27250 gene afmiD 15285 14401 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206106.1 protein_id gnl|my_center|LOCUS_27250 15970 15275 gene locus_tag LOCUS_27260 15970 15275 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_27260 16478 16056 gene locus_tag LOCUS_27270 16478 16056 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH09 protein_id gnl|my_center|LOCUS_27270 >Feature sequence40 1645 419 gene locus_tag LOCUS_27280 gene gcdH 1645 419 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 protein_id gnl|my_center|LOCUS_27280 1897 2844 gene locus_tag LOCUS_27290 gene gcvA 1897 2844 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 protein_id gnl|my_center|LOCUS_27290 3178 2852 gene locus_tag LOCUS_27300 3178 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121003.1 protein_id gnl|my_center|LOCUS_27300 3348 3785 gene locus_tag LOCUS_27310 3348 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_27310 3892 4791 gene locus_tag LOCUS_27320 gene ltrA 3892 4791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120927.1 protein_id gnl|my_center|LOCUS_27320 6071 4980 gene locus_tag LOCUS_27330 gene abhD3 6071 4980 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 protein_id gnl|my_center|LOCUS_27330 8217 6193 gene locus_tag LOCUS_27340 gene fadH 8217 6193 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 protein_id gnl|my_center|LOCUS_27340 8341 8883 gene locus_tag LOCUS_27350 8341 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206944.1 protein_id gnl|my_center|LOCUS_27350 8893 9810 gene locus_tag LOCUS_27360 gene bioH 8893 9810 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_27360 10127 11422 gene locus_tag LOCUS_27370 gene pcaT 10127 11422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206689.1 protein_id gnl|my_center|LOCUS_27370 11544 12245 gene locus_tag LOCUS_27380 gene npdA 11544 12245 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM95 protein_id gnl|my_center|LOCUS_27380 12626 14119 gene locus_tag LOCUS_27390 gene putP 12626 14119 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_27390 14656 14153 gene locus_tag LOCUS_27400 gene lrp 14656 14153 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence41 <1 2264 gene locus_tag LOCUS_27410 <1 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207470.1:type I secretion C-terminal target domain-containing protein 2865 2416 gene locus_tag LOCUS_27420 gene uspA 2865 2416 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFV2 protein_id gnl|my_center|LOCUS_27420 3101 3436 gene locus_tag LOCUS_27430 gene atl1 3101 3436 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_27430 3916 3458 gene locus_tag LOCUS_27440 gene uspA1 3916 3458 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW6 protein_id gnl|my_center|LOCUS_27440 4536 4060 gene locus_tag LOCUS_27450 gene greA 4536 4060 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW2 protein_id gnl|my_center|LOCUS_27450 7859 4626 gene locus_tag LOCUS_27460 gene carB 7859 4626 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW1 protein_id gnl|my_center|LOCUS_27460 9013 7874 gene locus_tag LOCUS_27470 gene carA 9013 7874 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW0 protein_id gnl|my_center|LOCUS_27470 9359 9787 gene locus_tag LOCUS_27480 9359 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 10360 9824 gene locus_tag LOCUS_27490 10360 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 protein_id gnl|my_center|LOCUS_27490 10699 10373 gene locus_tag LOCUS_27500 10699 10373 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_27500 10948 11547 gene locus_tag LOCUS_27510 gene rlmE 10948 11547 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_27510 11780 13576 gene locus_tag LOCUS_27520 gene ftsH 11780 13576 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV4 protein_id gnl|my_center|LOCUS_27520 13705 14556 gene locus_tag LOCUS_27530 13705 14556 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV3 protein_id gnl|my_center|LOCUS_27530 14640 14954 gene locus_tag LOCUS_27540 14640 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115563.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence42 345 1169 gene locus_tag LOCUS_27550 345 1169 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_27550 1987 1289 gene locus_tag LOCUS_27560 1987 1289 CDS product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097230.1 protein_id gnl|my_center|LOCUS_27560 3588 2131 gene locus_tag LOCUS_27570 gene pucI 3588 2131 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206510.1 protein_id gnl|my_center|LOCUS_27570 4697 3648 gene locus_tag LOCUS_27580 4697 3648 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523466.1 protein_id gnl|my_center|LOCUS_27580 5078 5800 gene locus_tag LOCUS_27590 5078 5800 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206511.1 protein_id gnl|my_center|LOCUS_27590 6633 5854 gene locus_tag LOCUS_27600 gene fpr 6633 5854 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118187.1 protein_id gnl|my_center|LOCUS_27600 6770 7465 gene locus_tag LOCUS_27610 6770 7465 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_27610 8400 7462 gene locus_tag LOCUS_27620 8400 7462 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324795.1 protein_id gnl|my_center|LOCUS_27620 8538 10295 gene locus_tag LOCUS_27630 gene xcpR 8538 10295 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_27630 10387 10743 gene locus_tag LOCUS_27640 10387 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207222.1 protein_id gnl|my_center|LOCUS_27640 10851 11507 gene locus_tag LOCUS_27650 gene qseB 10851 11507 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 protein_id gnl|my_center|LOCUS_27650 11512 12861 gene locus_tag LOCUS_27660 gene qseC 11512 12861 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207220.1 protein_id gnl|my_center|LOCUS_27660 13107 12940 gene locus_tag LOCUS_27670 13107 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 13246 14130 gene locus_tag LOCUS_27680 13246 14130 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207219.1 protein_id gnl|my_center|LOCUS_27680 14713 14147 gene locus_tag LOCUS_27690 14713 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207218.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence43 1478 3 gene locus_tag LOCUS_27700 gene uvrC 1478 3 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS7 protein_id gnl|my_center|LOCUS_27700 2126 1569 gene locus_tag LOCUS_27710 2126 1569 CDS product peptidoglycan hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208215.1 protein_id gnl|my_center|LOCUS_27710 3216 2302 gene locus_tag LOCUS_27720 gene aspH 3216 2302 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000673.1 protein_id gnl|my_center|LOCUS_27720 4386 3382 gene locus_tag LOCUS_27730 4386 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4788 6941 gene locus_tag LOCUS_27740 gene fadB 4788 6941 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS1 protein_id gnl|my_center|LOCUS_27740 6955 8127 gene locus_tag LOCUS_27750 gene fadA 6955 8127 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_27750 8668 8174 gene locus_tag LOCUS_27760 8668 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208209.1 protein_id gnl|my_center|LOCUS_27760 9679 8921 gene locus_tag LOCUS_27770 9679 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208207.1 protein_id gnl|my_center|LOCUS_27770 9847 10554 gene locus_tag LOCUS_27780 gene dsb 9847 10554 CDS product dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 protein_id gnl|my_center|LOCUS_27780 11202 10975 gene locus_tag LOCUS_27790 11202 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115208.1 protein_id gnl|my_center|LOCUS_27790 11557 11787 gene locus_tag LOCUS_27800 11557 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 12028 13212 gene locus_tag LOCUS_27810 12028 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 protein_id gnl|my_center|LOCUS_27810 13710 14531 gene locus_tag LOCUS_27820 gene metR 13710 14531 CDS product cell density-dependent motility repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207780.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence44 313 519 gene locus_tag LOCUS_27830 313 519 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 protein_id gnl|my_center|LOCUS_27830 1116 529 gene locus_tag LOCUS_27840 gene mdmC 1116 529 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_27840 1377 1159 gene locus_tag LOCUS_27850 1377 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_27850 2029 1586 gene locus_tag LOCUS_27860 2029 1586 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH28 protein_id gnl|my_center|LOCUS_27860 2873 2604 gene locus_tag LOCUS_27870 2873 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 3331 5529 gene locus_tag LOCUS_27880 gene foxA 3331 5529 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207935.1 protein_id gnl|my_center|LOCUS_27880 7048 5594 gene locus_tag LOCUS_27890 gene ybaR 7048 5594 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 protein_id gnl|my_center|LOCUS_27890 7694 7897 gene locus_tag LOCUS_27900 7694 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 8298 9617 gene locus_tag LOCUS_27910 8298 9617 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_27910 9680 10678 gene locus_tag LOCUS_27920 gene add 9680 10678 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_27920 11287 10733 gene locus_tag LOCUS_27930 gene yceJ 11287 10733 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206183.1 protein_id gnl|my_center|LOCUS_27930 11512 11898 gene locus_tag LOCUS_27940 11512 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206184.1 protein_id gnl|my_center|LOCUS_27940 11915 12484 gene locus_tag LOCUS_27950 gene rnhB 11915 12484 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI71 protein_id gnl|my_center|LOCUS_27950 >Feature sequence45 <1 576 gene locus_tag LOCUS_27960 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KF80:3-dehydroquinate dehydratase 596 2056 gene locus_tag LOCUS_27970 gene quiC 596 2056 CDS product 3-dehydroshikimate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206926.1 protein_id gnl|my_center|LOCUS_27970 2124 3443 gene locus_tag LOCUS_27980 gene quiX 2124 3443 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF78 protein_id gnl|my_center|LOCUS_27980 3618 6047 gene locus_tag LOCUS_27990 gene quiA 3618 6047 CDS product quinate/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206924.1 protein_id gnl|my_center|LOCUS_27990 7298 6120 gene locus_tag LOCUS_28000 7298 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8280 7465 gene locus_tag LOCUS_28010 gene pobR 8280 7465 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206420.1 protein_id gnl|my_center|LOCUS_28010 8415 9629 gene locus_tag LOCUS_28020 gene pobA 8415 9629 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114537.1 protein_id gnl|my_center|LOCUS_28020 11419 9677 gene locus_tag LOCUS_28030 11419 9677 CDS product chlorogenate esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206151.1 protein_id gnl|my_center|LOCUS_28030 11831 11442 gene locus_tag LOCUS_28040 11831 11442 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence46 <1 873 gene locus_tag LOCUS_28050 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001033293.1:adhesin 930 1775 gene locus_tag LOCUS_28060 930 1775 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184872.1 protein_id gnl|my_center|LOCUS_28060 2012 2245 gene locus_tag LOCUS_28070 2012 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3090 2290 gene locus_tag LOCUS_28080 gene uppP3 3090 2290 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KML1 protein_id gnl|my_center|LOCUS_28080 3642 3421 gene locus_tag LOCUS_28090 3642 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120955.1 protein_id gnl|my_center|LOCUS_28090 4069 3842 gene locus_tag LOCUS_28100 4069 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011679.1 protein_id gnl|my_center|LOCUS_28100 5406 4321 gene locus_tag LOCUS_28110 gene trmA 5406 4321 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_28110 <8140 5744 gene locus_tag LOCUS_28120 <8140 5744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM92:bifunctional protein PutA >Feature sequence47 304 915 gene locus_tag LOCUS_28130 304 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_28130 962 1840 gene locus_tag LOCUS_28140 gene murI 962 1840 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF8 protein_id gnl|my_center|LOCUS_28140 1947 2984 gene locus_tag LOCUS_28150 1947 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208258.1 protein_id gnl|my_center|LOCUS_28150 3043 4065 gene locus_tag LOCUS_28160 gene hemH 3043 4065 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_28160 4081 4725 gene locus_tag LOCUS_28170 gene ycbL 4081 4725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_28170 4974 4768 gene locus_tag LOCUS_28180 4974 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6125 5187 gene locus_tag LOCUS_28190 gene hemF 6125 5187 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC3 protein_id gnl|my_center|LOCUS_28190 6842 6240 gene locus_tag LOCUS_28200 gene ribA 6842 6240 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC2 protein_id gnl|my_center|LOCUS_28200 >Feature sequence48 846 770 gene locus_tag LOCUS_t00410 846 770 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 947 858 gene locus_tag LOCUS_t00420 947 858 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1175 3628 gene locus_tag LOCUS_28210 gene rnr 1175 3628 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPZ5 protein_id gnl|my_center|LOCUS_28210 4031 6070 gene locus_tag LOCUS_28220 gene prlC 4031 6070 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_28220 6076 6315 gene locus_tag LOCUS_28230 6076 6315 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117042.1 protein_id gnl|my_center|LOCUS_28230 <7851 6360 gene locus_tag LOCUS_28240 <7851 6360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207736.1:membrane protein >Feature sequence49 305 1138 gene locus_tag LOCUS_28250 gene hcaA 305 1138 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206158.1 protein_id gnl|my_center|LOCUS_28250 1175 2626 gene locus_tag LOCUS_28260 gene hcaB 1175 2626 CDS product salicylaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206157.1 protein_id gnl|my_center|LOCUS_28260 2712 4592 gene locus_tag LOCUS_28270 gene hcaC 2712 4592 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206156.1 protein_id gnl|my_center|LOCUS_28270 4662 5801 gene locus_tag LOCUS_28280 gene hcaD 4662 5801 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206155.1 protein_id gnl|my_center|LOCUS_28280 5877 7127 gene locus_tag LOCUS_28290 5877 7127 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206154.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence50 1263 682 gene locus_tag LOCUS_28300 1263 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206370.1 protein_id gnl|my_center|LOCUS_28300 2077 1274 gene locus_tag LOCUS_28310 2077 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206369.1 protein_id gnl|my_center|LOCUS_28310 3456 2089 gene locus_tag LOCUS_28320 3456 2089 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206368.1 protein_id gnl|my_center|LOCUS_28320 4576 3473 gene locus_tag LOCUS_28330 4576 3473 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206367.1 protein_id gnl|my_center|LOCUS_28330 6631 4592 gene locus_tag LOCUS_28340 gene clpV1 6631 4592 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206366.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence51 510 1865 gene locus_tag LOCUS_28350 gene pcaB 510 1865 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206931.1 protein_id gnl|my_center|LOCUS_28350 1862 2662 gene locus_tag LOCUS_28360 gene pcaD 1862 2662 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 protein_id gnl|my_center|LOCUS_28360 2703 4058 gene locus_tag LOCUS_28370 gene pcaK 2703 4058 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206929.1 protein_id gnl|my_center|LOCUS_28370 4074 4478 gene locus_tag LOCUS_28380 gene pcaC 4074 4478 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701356.1 protein_id gnl|my_center|LOCUS_28380 4500 5225 gene locus_tag LOCUS_28390 gene pcaH 4500 5225 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077913.1 protein_id gnl|my_center|LOCUS_28390 5243 5872 gene locus_tag LOCUS_28400 gene pcaG 5243 5872 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206928.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence52 259 62 gene locus_tag LOCUS_28410 259 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1126 284 gene locus_tag LOCUS_28420 1126 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1973 1581 gene locus_tag LOCUS_28430 1973 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2592 1975 gene locus_tag LOCUS_28440 2592 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3455 2955 gene locus_tag LOCUS_28450 3455 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3816 3460 gene locus_tag LOCUS_28460 3816 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 4603 5784 gene locus_tag LOCUS_28470 4603 5784 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence53 1433 519 gene locus_tag LOCUS_28480 gene pqqB 1433 519 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G0Z8 protein_id gnl|my_center|LOCUS_28480 3428 1806 gene locus_tag LOCUS_28490 3428 1806 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206466.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence54 <1 2808 gene locus_tag LOCUS_28500 <1 2808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206467.1:hybrid sensor histidine kinase/response regulator 2805 3767 gene locus_tag LOCUS_28510 gene pleD 2805 3767 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206468.1 protein_id gnl|my_center|LOCUS_28510 3847 4114 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaaatcatctatgcgatgacgaac >Feature sequence55 470 1588 gene locus_tag LOCUS_28520 gene amacR 470 1588 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207596.1 protein_id gnl|my_center|LOCUS_28520 1775 2986 gene locus_tag LOCUS_28530 gene oprB 1775 2986 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNS1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence56 128 1231 gene locus_tag LOCUS_28540 128 1231 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266553.1 protein_id gnl|my_center|LOCUS_28540 1925 2380 gene locus_tag LOCUS_28550 gene fecI 1925 2380 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 protein_id gnl|my_center|LOCUS_28550 2381 3397 gene locus_tag LOCUS_28560 gene fecR 2381 3397 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206008.1 protein_id gnl|my_center|LOCUS_28560 3537 3671 gene locus_tag LOCUS_28570 3537 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence57 563 45 gene locus_tag LOCUS_28580 563 45 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098902.1 protein_id gnl|my_center|LOCUS_28580 1703 735 gene locus_tag LOCUS_28590 1703 735 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207214.1 protein_id gnl|my_center|LOCUS_28590 1876 2985 gene locus_tag LOCUS_28600 gene pheA 1876 2985 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 protein_id gnl|my_center|LOCUS_28600 3091 3624 gene locus_tag LOCUS_28610 3091 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence58 1443 82 gene locus_tag LOCUS_28620 1443 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2116 1433 gene locus_tag LOCUS_28630 2116 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 <3657 2113 gene locus_tag LOCUS_28640 <3657 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system protein >Feature sequence59 18 230 gene locus_tag LOCUS_28650 18 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 233 613 gene locus_tag LOCUS_28660 233 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 617 808 gene locus_tag LOCUS_28670 617 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 811 1461 gene locus_tag LOCUS_28680 811 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1449 1844 gene locus_tag LOCUS_28690 1449 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1871 2152 gene locus_tag LOCUS_28700 1871 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2124 2348 gene locus_tag LOCUS_28710 2124 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence60 2006 2329 gene locus_tag LOCUS_28720 2006 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence61 343 735 gene locus_tag LOCUS_28730 343 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 742 1959 gene locus_tag LOCUS_28740 gene cheR 742 1959 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207695.1 protein_id gnl|my_center|LOCUS_28740 1977 2456 gene locus_tag LOCUS_28750 gene psaB 1977 2456 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117846.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence62 888 82 gene locus_tag LOCUS_28760 888 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1074 1607 gene locus_tag LOCUS_28770 1074 1607 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480324.1 protein_id gnl|my_center|LOCUS_28770 <2175 1659 gene locus_tag LOCUS_28780 <2175 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207597.1:AraC family transcriptional regulator >Feature sequence63 178 1767 gene locus_tag LOCUS_28790 178 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence64 735 1505 gene locus_tag LOCUS_28800 735 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence65 1166 654 gene locus_tag LOCUS_28810 1166 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1447 1142 gene locus_tag LOCUS_28820 1447 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence66 >Feature sequence67 1398 202 gene locus_tag LOCUS_28830 1398 202 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361987.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence68 23 778 gene locus_tag LOCUS_28840 23 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 760 1200 gene locus_tag LOCUS_28850 760 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence69 152 1285 gene locus_tag LOCUS_28860 152 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence70 435 145 gene locus_tag LOCUS_28870 435 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1088 432 gene locus_tag LOCUS_28880 1088 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence71 299 844 gene locus_tag LOCUS_28890 299 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1222 956 gene locus_tag LOCUS_28900 1222 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence72 857 6 gene locus_tag LOCUS_28910 857 6 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477748.1 protein_id gnl|my_center|LOCUS_28910 1165 872 gene locus_tag LOCUS_28920 gene tnpA 1165 872 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815641.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence73 >Feature sequence74 >Feature sequence75 1024 128 gene locus_tag LOCUS_28930 1024 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence76 875 405 gene locus_tag LOCUS_28940 875 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence77 744 292 gene locus_tag LOCUS_28950 744 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950