>Feature sequence01 1682 438 gene locus_tag LOCUS_00010 gene mucK 1682 438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 protein_id gnl|my_center|LOCUS_00010 2891 1737 gene locus_tag LOCUS_00020 gene dcaA 2891 1737 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206430.1 protein_id gnl|my_center|LOCUS_00020 3228 4445 gene locus_tag LOCUS_00030 gene caiB 3228 4445 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_00030 4549 5394 gene locus_tag LOCUS_00040 gene pcaR 4549 5394 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996082.1 protein_id gnl|my_center|LOCUS_00040 6608 5430 gene locus_tag LOCUS_00050 gene ygaY 6608 5430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206434.1 protein_id gnl|my_center|LOCUS_00050 7935 6658 gene locus_tag LOCUS_00060 gene mucK 7935 6658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 protein_id gnl|my_center|LOCUS_00060 9112 7958 gene locus_tag LOCUS_00070 gene dcaA 9112 7958 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_00070 9359 10576 gene locus_tag LOCUS_00080 gene caiB 9359 10576 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_00080 11471 10620 gene locus_tag LOCUS_00090 gene dcaR 11471 10620 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081480.1 protein_id gnl|my_center|LOCUS_00090 12785 11580 gene locus_tag LOCUS_00100 gene dcaF 12785 11580 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206435.1 protein_id gnl|my_center|LOCUS_00100 13395 14549 gene locus_tag LOCUS_00110 gene dcaA 13395 14549 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069932.1 protein_id gnl|my_center|LOCUS_00110 14611 15882 gene locus_tag LOCUS_00120 gene mucK 14611 15882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206429.1 protein_id gnl|my_center|LOCUS_00120 15932 16606 gene locus_tag LOCUS_00130 gene dcaI 15932 16606 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608696.1 protein_id gnl|my_center|LOCUS_00130 16603 17253 gene locus_tag LOCUS_00140 gene dcaJ 16603 17253 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206440.1 protein_id gnl|my_center|LOCUS_00140 17295 18560 gene locus_tag LOCUS_00150 gene dcaP 17295 18560 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733488.1 protein_id gnl|my_center|LOCUS_00150 18585 19787 gene locus_tag LOCUS_00160 gene dcaY 18585 19787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206441.1 protein_id gnl|my_center|LOCUS_00160 20336 19902 gene locus_tag LOCUS_00170 20336 19902 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206442.1 protein_id gnl|my_center|LOCUS_00170 21159 20509 gene locus_tag LOCUS_00180 21159 20509 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206972.1 protein_id gnl|my_center|LOCUS_00180 21808 21470 gene locus_tag LOCUS_00190 21808 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22148 21954 gene locus_tag LOCUS_00200 22148 21954 CDS product exodeoxyribonuclease VII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206229.1 protein_id gnl|my_center|LOCUS_00200 23406 22141 gene locus_tag LOCUS_00210 gene xseA 23406 22141 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KID5 protein_id gnl|my_center|LOCUS_00210 26442 24049 gene locus_tag LOCUS_00220 gene gcd 26442 24049 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207594.1 protein_id gnl|my_center|LOCUS_00220 27789 26545 gene locus_tag LOCUS_00230 gene oprB 27789 26545 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNS1 protein_id gnl|my_center|LOCUS_00230 28166 28603 gene locus_tag LOCUS_00240 28166 28603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29721 28726 gene locus_tag LOCUS_00250 gene nasF 29721 28726 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207015.1 protein_id gnl|my_center|LOCUS_00250 30312 29725 gene locus_tag LOCUS_00260 gene nasT 30312 29725 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115726.1 protein_id gnl|my_center|LOCUS_00260 30811 32070 gene locus_tag LOCUS_00270 gene crnA 30811 32070 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_00270 32111 34657 gene locus_tag LOCUS_00280 gene nasB 32111 34657 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_00280 34682 36292 gene locus_tag LOCUS_00290 gene nasD 34682 36292 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207013.1 protein_id gnl|my_center|LOCUS_00290 36324 36521 gene locus_tag LOCUS_00300 36324 36521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36575 39355 gene locus_tag LOCUS_00310 gene nasA 36575 39355 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 protein_id gnl|my_center|LOCUS_00310 39352 39990 gene locus_tag LOCUS_00320 gene mobA 39352 39990 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207011.1 protein_id gnl|my_center|LOCUS_00320 40132 41175 gene locus_tag LOCUS_00330 gene moaA 40132 41175 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGG5 protein_id gnl|my_center|LOCUS_00330 41177 41428 gene locus_tag LOCUS_00340 41177 41428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187654.1 protein_id gnl|my_center|LOCUS_00340 41430 41885 gene locus_tag LOCUS_00350 gene moaE 41430 41885 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207008.1 protein_id gnl|my_center|LOCUS_00350 42034 42957 gene locus_tag LOCUS_00360 gene moaCB 42034 42957 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_00360 42954 44195 gene locus_tag LOCUS_00370 gene moeA 42954 44195 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207006.1 protein_id gnl|my_center|LOCUS_00370 44210 44971 gene locus_tag LOCUS_00380 gene modA 44210 44971 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 protein_id gnl|my_center|LOCUS_00380 44980 45663 gene locus_tag LOCUS_00390 gene modB 44980 45663 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206719.1 protein_id gnl|my_center|LOCUS_00390 45665 46321 gene locus_tag LOCUS_00400 gene modC 45665 46321 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206720.1 protein_id gnl|my_center|LOCUS_00400 47234 46374 gene locus_tag LOCUS_00410 47234 46374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637618.2 protein_id gnl|my_center|LOCUS_00410 49572 47458 gene locus_tag LOCUS_00420 gene paaN 49572 47458 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206394.1 protein_id gnl|my_center|LOCUS_00420 49834 50778 gene locus_tag LOCUS_00430 gene paaA 49834 50778 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206395.1 protein_id gnl|my_center|LOCUS_00430 50821 51111 gene locus_tag LOCUS_00440 gene paaB 50821 51111 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984048.1 protein_id gnl|my_center|LOCUS_00440 51124 51879 gene locus_tag LOCUS_00450 gene paaC 51124 51879 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206396.1 protein_id gnl|my_center|LOCUS_00450 51904 52404 gene locus_tag LOCUS_00460 gene paaD 51904 52404 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177939.1 protein_id gnl|my_center|LOCUS_00460 52440 53495 gene locus_tag LOCUS_00470 gene paaE 52440 53495 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206397.1 protein_id gnl|my_center|LOCUS_00470 53541 54332 gene locus_tag LOCUS_00480 gene paaG 53541 54332 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_00480 54431 55723 gene locus_tag LOCUS_00490 gene paaK 54431 55723 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKA3 protein_id gnl|my_center|LOCUS_00490 55782 56723 gene locus_tag LOCUS_00500 gene paaX 55782 56723 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062822.1 protein_id gnl|my_center|LOCUS_00500 56760 57374 gene locus_tag LOCUS_00510 gene paaY 56760 57374 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206404.1 protein_id gnl|my_center|LOCUS_00510 58277 57396 gene locus_tag LOCUS_00520 gene mauR 58277 57396 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208095.1 protein_id gnl|my_center|LOCUS_00520 58442 59959 gene locus_tag LOCUS_00530 gene mmsA 58442 59959 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208096.1 protein_id gnl|my_center|LOCUS_00530 59975 60865 gene locus_tag LOCUS_00540 gene mmsB 59975 60865 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJC0 protein_id gnl|my_center|LOCUS_00540 60943 62601 gene locus_tag LOCUS_00550 60943 62601 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_00550 62601 63779 gene locus_tag LOCUS_00560 gene mmgC 62601 63779 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160774.1 protein_id gnl|my_center|LOCUS_00560 63824 64597 gene locus_tag LOCUS_00570 gene fadB1 63824 64597 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069758.1 protein_id gnl|my_center|LOCUS_00570 64610 65635 gene locus_tag LOCUS_00580 gene hibcH 64610 65635 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208100.1 protein_id gnl|my_center|LOCUS_00580 65755 67092 gene locus_tag LOCUS_00590 gene shiA 65755 67092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208101.1 protein_id gnl|my_center|LOCUS_00590 67647 68705 gene locus_tag LOCUS_00600 67647 68705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 68708 70276 gene locus_tag LOCUS_00610 68708 70276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70266 72584 gene locus_tag LOCUS_00620 70266 72584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72586 73023 gene locus_tag LOCUS_00630 72586 73023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73221 73012 gene locus_tag LOCUS_00640 73221 73012 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_00640 73308 73805 gene locus_tag LOCUS_00650 73308 73805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73942 74250 gene locus_tag LOCUS_00660 73942 74250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 76963 74300 gene locus_tag LOCUS_00670 76963 74300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 77172 82970 gene locus_tag LOCUS_00680 77172 82970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 82997 84109 gene locus_tag LOCUS_00690 82997 84109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 84093 85070 gene locus_tag LOCUS_00700 84093 85070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86429 85491 gene locus_tag LOCUS_00710 86429 85491 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206446.1 protein_id gnl|my_center|LOCUS_00710 86631 90110 gene locus_tag LOCUS_00720 gene iorA 86631 90110 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206445.1 protein_id gnl|my_center|LOCUS_00720 93583 90446 gene locus_tag LOCUS_00730 gene czcA 93583 90446 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207844.1 protein_id gnl|my_center|LOCUS_00730 94811 93573 gene locus_tag LOCUS_00740 gene czcB 94811 93573 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207845.1 protein_id gnl|my_center|LOCUS_00740 95030 94812 gene locus_tag LOCUS_00750 95030 94812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00750 96137 95130 gene locus_tag LOCUS_00760 96137 95130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00760 96553 96185 gene locus_tag LOCUS_00770 96553 96185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207849.1 protein_id gnl|my_center|LOCUS_00770 98036 96768 gene locus_tag LOCUS_00780 98036 96768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073461.1 protein_id gnl|my_center|LOCUS_00780 98649 100334 gene locus_tag LOCUS_00790 98649 100334 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 protein_id gnl|my_center|LOCUS_00790 100383 101984 gene locus_tag LOCUS_00800 gene asdA 100383 101984 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIH4 protein_id gnl|my_center|LOCUS_00800 103170 102259 gene locus_tag LOCUS_00810 103170 102259 CDS product bestrophin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113810.1 protein_id gnl|my_center|LOCUS_00810 103366 104670 gene locus_tag LOCUS_00820 103366 104670 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974376.1 protein_id gnl|my_center|LOCUS_00820 104663 104941 gene locus_tag LOCUS_00830 104663 104941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 105954 104968 gene locus_tag LOCUS_00840 105954 104968 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_00840 106764 105973 gene locus_tag LOCUS_00850 gene paaG 106764 105973 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_00850 107709 106786 gene locus_tag LOCUS_00860 107709 106786 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038806.1 protein_id gnl|my_center|LOCUS_00860 108461 107706 gene locus_tag LOCUS_00870 108461 107706 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246688.1 protein_id gnl|my_center|LOCUS_00870 110371 109139 gene locus_tag LOCUS_00880 110371 109139 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 protein_id gnl|my_center|LOCUS_00880 111438 111103 gene locus_tag LOCUS_00890 111438 111103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 111891 112439 gene locus_tag LOCUS_00900 111891 112439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 112681 114543 gene locus_tag LOCUS_00910 112681 114543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206735.1 protein_id gnl|my_center|LOCUS_00910 115092 114601 gene locus_tag LOCUS_00920 115092 114601 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_00920 115393 115701 gene locus_tag LOCUS_00930 gene arsR 115393 115701 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121379.1 protein_id gnl|my_center|LOCUS_00930 115822 117564 gene locus_tag LOCUS_00940 115822 117564 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_00940 117756 118949 gene locus_tag LOCUS_00950 gene sstT 117756 118949 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA2 protein_id gnl|my_center|LOCUS_00950 118984 119670 gene locus_tag LOCUS_00960 118984 119670 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 protein_id gnl|my_center|LOCUS_00960 119677 120213 gene locus_tag LOCUS_00970 gene yaiL 119677 120213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121466.1 protein_id gnl|my_center|LOCUS_00970 120315 121601 gene locus_tag LOCUS_00980 120315 121601 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 protein_id gnl|my_center|LOCUS_00980 122117 121899 gene locus_tag LOCUS_00990 122117 121899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 122493 122813 gene locus_tag LOCUS_01000 122493 122813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01000 122893 123033 gene locus_tag LOCUS_01010 122893 123033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 123040 123438 gene locus_tag LOCUS_01020 123040 123438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 123575 124615 gene locus_tag LOCUS_01030 123575 124615 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073373.1 protein_id gnl|my_center|LOCUS_01030 124850 126457 gene locus_tag LOCUS_01040 124850 126457 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_01040 127131 126709 gene locus_tag LOCUS_01050 127131 126709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206923.1 protein_id gnl|my_center|LOCUS_01050 127459 127836 gene locus_tag LOCUS_01060 127459 127836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 127855 128790 gene locus_tag LOCUS_01070 127855 128790 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324795.1 protein_id gnl|my_center|LOCUS_01070 129092 130948 gene locus_tag LOCUS_01080 129092 130948 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206581.1 protein_id gnl|my_center|LOCUS_01080 130948 131397 gene locus_tag LOCUS_01090 130948 131397 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121358.1 protein_id gnl|my_center|LOCUS_01090 131494 132522 gene locus_tag LOCUS_01100 gene appY 131494 132522 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_01100 132593 132967 gene locus_tag LOCUS_01110 gene gcvH 132593 132967 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM96 protein_id gnl|my_center|LOCUS_01110 133314 134435 gene locus_tag LOCUS_01120 gene ywoG 133314 134435 CDS product putative MFS-type transporter YwoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94577 protein_id gnl|my_center|LOCUS_01120 135539 134493 gene locus_tag LOCUS_01130 gene aroF 135539 134493 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFQ9 protein_id gnl|my_center|LOCUS_01130 136361 137419 gene locus_tag LOCUS_01140 gene hpd 136361 137419 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119157.1 protein_id gnl|my_center|LOCUS_01140 138309 137530 gene locus_tag LOCUS_01150 gene araD 138309 137530 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 protein_id gnl|my_center|LOCUS_01150 138781 140166 gene locus_tag LOCUS_01160 gene aroP 138781 140166 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119258.1 protein_id gnl|my_center|LOCUS_01160 140260 141474 gene locus_tag LOCUS_01170 gene tyrB 140260 141474 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT1 protein_id gnl|my_center|LOCUS_01170 142659 141550 gene locus_tag LOCUS_01180 142659 141550 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTA6 protein_id gnl|my_center|LOCUS_01180 142799 144352 gene locus_tag LOCUS_01190 gene plD 142799 144352 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206732.1 protein_id gnl|my_center|LOCUS_01190 144450 144890 gene locus_tag LOCUS_01200 144450 144890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 146419 144965 gene locus_tag LOCUS_01210 gene aspA 146419 144965 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q328C9 protein_id gnl|my_center|LOCUS_01210 146861 148351 gene locus_tag LOCUS_01220 gene putP 146861 148351 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_01220 148872 148384 gene locus_tag LOCUS_01230 gene lrp 148872 148384 CDS product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 protein_id gnl|my_center|LOCUS_01230 149009 152761 gene locus_tag LOCUS_01240 gene putA 149009 152761 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM92 protein_id gnl|my_center|LOCUS_01240 153433 152843 gene locus_tag LOCUS_01250 153433 152843 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 protein_id gnl|my_center|LOCUS_01250 154363 153620 gene locus_tag LOCUS_01260 154363 153620 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_01260 155074 154376 gene locus_tag LOCUS_01270 gene gpmA 155074 154376 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_01270 156192 155071 gene locus_tag LOCUS_01280 156192 155071 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_01280 157454 156213 gene locus_tag LOCUS_01290 157454 156213 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 protein_id gnl|my_center|LOCUS_01290 157546 158466 gene locus_tag LOCUS_01300 gene leuO 157546 158466 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206919.1 protein_id gnl|my_center|LOCUS_01300 159935 158463 gene locus_tag LOCUS_01310 159935 158463 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090459.1 protein_id gnl|my_center|LOCUS_01310 160138 159989 gene locus_tag LOCUS_01320 160138 159989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 160943 160131 gene locus_tag LOCUS_01330 160943 160131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076457.1 protein_id gnl|my_center|LOCUS_01330 162210 161206 gene locus_tag LOCUS_01340 gene cioB 162210 161206 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206500.1 protein_id gnl|my_center|LOCUS_01340 163648 162203 gene locus_tag LOCUS_01350 gene cioA 163648 162203 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206501.1 protein_id gnl|my_center|LOCUS_01350 164366 163932 gene locus_tag LOCUS_01360 164366 163932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_01360 164635 165072 gene locus_tag LOCUS_01370 164635 165072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 165069 166271 gene locus_tag LOCUS_01380 gene ybfD 165069 166271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 protein_id gnl|my_center|LOCUS_01380 166848 166357 gene locus_tag LOCUS_01390 166848 166357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115670.1 protein_id gnl|my_center|LOCUS_01390 167101 167325 gene locus_tag LOCUS_01400 167101 167325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 167401 167613 gene locus_tag LOCUS_01410 167401 167613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 167850 168125 gene locus_tag LOCUS_01420 167850 168125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 168696 169052 gene locus_tag LOCUS_01430 168696 169052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206096.1 protein_id gnl|my_center|LOCUS_01430 169711 169235 gene locus_tag LOCUS_01440 169711 169235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 170065 170289 gene locus_tag LOCUS_01450 170065 170289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 172353 170959 gene locus_tag LOCUS_01460 gene fumC 172353 170959 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF2 protein_id gnl|my_center|LOCUS_01460 173485 172478 gene locus_tag LOCUS_01470 gene galE 173485 172478 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207002.1 protein_id gnl|my_center|LOCUS_01470 174566 173769 gene locus_tag LOCUS_01480 174566 173769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 174770 175126 gene locus_tag LOCUS_01490 174770 175126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 175599 175150 gene locus_tag LOCUS_01500 175599 175150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 176940 175606 gene locus_tag LOCUS_01510 176940 175606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_01510 177459 176962 gene locus_tag LOCUS_01520 177459 176962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 178301 177456 gene locus_tag LOCUS_01530 178301 177456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 178458 178736 gene locus_tag LOCUS_01540 178458 178736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 178967 178743 gene locus_tag LOCUS_01550 178967 178743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673491.1 protein_id gnl|my_center|LOCUS_01550 179334 180470 gene locus_tag LOCUS_01560 gene ompW 179334 180470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_01560 180674 180967 gene locus_tag LOCUS_01570 180674 180967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 180964 181608 gene locus_tag LOCUS_01580 180964 181608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 182480 181728 gene locus_tag LOCUS_01590 182480 181728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 183040 182477 gene locus_tag LOCUS_01600 183040 182477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 183335 183105 gene locus_tag LOCUS_01610 183335 183105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 185226 183328 gene locus_tag LOCUS_01620 185226 183328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 185920 185240 gene locus_tag LOCUS_01630 185920 185240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 186319 185924 gene locus_tag LOCUS_01640 186319 185924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 186612 186316 gene locus_tag LOCUS_01650 186612 186316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 187901 186609 gene locus_tag LOCUS_01660 187901 186609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 189638 188022 gene locus_tag LOCUS_01670 189638 188022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 191606 189642 gene locus_tag LOCUS_01680 191606 189642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 192021 191596 gene locus_tag LOCUS_01690 192021 191596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 195932 192021 gene locus_tag LOCUS_01700 195932 192021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 196690 196106 gene locus_tag LOCUS_01710 196690 196106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 197357 196773 gene locus_tag LOCUS_01720 197357 196773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 197829 197443 gene locus_tag LOCUS_01730 197829 197443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 198873 198127 gene locus_tag LOCUS_01740 198873 198127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 199057 198863 gene locus_tag LOCUS_01750 199057 198863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 199489 199067 gene locus_tag LOCUS_01760 199489 199067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 199964 199482 gene locus_tag LOCUS_01770 199964 199482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 200414 199974 gene locus_tag LOCUS_01780 200414 199974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 protein_id gnl|my_center|LOCUS_01780 200773 200423 gene locus_tag LOCUS_01790 200773 200423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 201857 200784 gene locus_tag LOCUS_01800 201857 200784 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975797.1 protein_id gnl|my_center|LOCUS_01800 202247 201861 gene locus_tag LOCUS_01810 202247 201861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 203215 202244 gene locus_tag LOCUS_01820 203215 202244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 204480 203275 gene locus_tag LOCUS_01830 204480 203275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 205937 204477 gene locus_tag LOCUS_01840 205937 204477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244120.1 protein_id gnl|my_center|LOCUS_01840 207098 205947 gene locus_tag LOCUS_01850 207098 205947 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095977.1 protein_id gnl|my_center|LOCUS_01850 207648 207199 gene locus_tag LOCUS_01860 207648 207199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267982.1 protein_id gnl|my_center|LOCUS_01860 208353 207709 gene locus_tag LOCUS_01870 208353 207709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097719.1 protein_id gnl|my_center|LOCUS_01870 208753 208310 gene locus_tag LOCUS_01880 208753 208310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 209021 208806 gene locus_tag LOCUS_01890 209021 208806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 209249 209097 gene locus_tag LOCUS_01900 209249 209097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 209532 209272 gene locus_tag LOCUS_01910 209532 209272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 210709 210269 gene locus_tag LOCUS_01920 210709 210269 CDS product blue light sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206997.1 protein_id gnl|my_center|LOCUS_01920 211388 211068 gene locus_tag LOCUS_01930 211388 211068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 211886 211431 gene locus_tag LOCUS_01940 211886 211431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 212176 211910 gene locus_tag LOCUS_01950 212176 211910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 212903 212427 gene locus_tag LOCUS_01960 212903 212427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 213313 212903 gene locus_tag LOCUS_01970 213313 212903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705908.1 protein_id gnl|my_center|LOCUS_01970 214266 213313 gene locus_tag LOCUS_01980 214266 213313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 214583 214263 gene locus_tag LOCUS_01990 214583 214263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 214843 214580 gene locus_tag LOCUS_02000 214843 214580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 215351 214893 gene locus_tag LOCUS_02010 215351 214893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 215627 215373 gene locus_tag LOCUS_02020 215627 215373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 215782 216450 gene locus_tag LOCUS_02030 gene ymfK 215782 216450 CDS product repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859460.1 protein_id gnl|my_center|LOCUS_02030 216547 217875 gene locus_tag LOCUS_02040 216547 217875 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_02040 217885 219534 gene locus_tag LOCUS_02050 217885 219534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 219622 220437 gene locus_tag LOCUS_02060 219622 220437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 220434 222332 gene locus_tag LOCUS_02070 220434 222332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 222518 222778 gene locus_tag LOCUS_02080 222518 222778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 222778 223596 gene locus_tag LOCUS_02090 222778 223596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 223617 225230 gene locus_tag LOCUS_02100 223617 225230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 225461 225739 gene locus_tag LOCUS_02110 225461 225739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 226707 225736 gene locus_tag LOCUS_02120 226707 225736 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 protein_id gnl|my_center|LOCUS_02120 227053 227421 gene locus_tag LOCUS_02130 gene tusD 227053 227421 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 protein_id gnl|my_center|LOCUS_02130 227465 227815 gene locus_tag LOCUS_02140 227465 227815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115699.1 protein_id gnl|my_center|LOCUS_02140 227834 228118 gene locus_tag LOCUS_02150 227834 228118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 228135 228449 gene locus_tag LOCUS_02160 gene tusE 228135 228449 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF7 protein_id gnl|my_center|LOCUS_02160 229364 229822 gene locus_tag LOCUS_02170 gene aroQ 229364 229822 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGI2 protein_id gnl|my_center|LOCUS_02170 229839 230258 gene locus_tag LOCUS_02180 gene accB 229839 230258 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 protein_id gnl|my_center|LOCUS_02180 230274 231647 gene locus_tag LOCUS_02190 gene accC 230274 231647 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115704.1 protein_id gnl|my_center|LOCUS_02190 232234 231746 gene locus_tag LOCUS_02200 232234 231746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 protein_id gnl|my_center|LOCUS_02200 232471 233961 gene locus_tag LOCUS_02210 232471 233961 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731449.1 protein_id gnl|my_center|LOCUS_02210 234528 234292 gene locus_tag LOCUS_02220 234528 234292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 235074 234934 gene locus_tag LOCUS_02230 235074 234934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 235637 235329 gene locus_tag LOCUS_02240 235637 235329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 236017 235724 gene locus_tag LOCUS_02250 236017 235724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 236503 236375 gene locus_tag LOCUS_02260 236503 236375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 237282 238385 gene locus_tag LOCUS_02270 237282 238385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 238783 239223 gene locus_tag LOCUS_02280 238783 239223 CDS product blue light sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206997.1 protein_id gnl|my_center|LOCUS_02280 239666 239358 gene locus_tag LOCUS_02290 239666 239358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 240316 239873 gene locus_tag LOCUS_02300 240316 239873 CDS product blue light sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206997.1 protein_id gnl|my_center|LOCUS_02300 241878 241309 gene locus_tag LOCUS_02310 241878 241309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 242368 242141 gene locus_tag LOCUS_02320 242368 242141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 243978 242776 gene locus_tag LOCUS_02330 243978 242776 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207959.1 protein_id gnl|my_center|LOCUS_02330 244744 243971 gene locus_tag LOCUS_02340 gene hdhA 244744 243971 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AET8 protein_id gnl|my_center|LOCUS_02340 245059 245424 gene locus_tag LOCUS_02350 245059 245424 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207058.1 protein_id gnl|my_center|LOCUS_02350 246702 245782 gene locus_tag LOCUS_02360 gene iroE 246702 245782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271276.1 protein_id gnl|my_center|LOCUS_02360 247331 246855 gene locus_tag LOCUS_02370 247331 246855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_02370 248190 247594 gene locus_tag LOCUS_02380 gene ybjG 248190 247594 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 protein_id gnl|my_center|LOCUS_02380 248426 249106 gene locus_tag LOCUS_02390 248426 249106 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206937.1 protein_id gnl|my_center|LOCUS_02390 249391 249182 gene locus_tag LOCUS_02400 gene cspA 249391 249182 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 protein_id gnl|my_center|LOCUS_02400 249456 249632 gene locus_tag LOCUS_02410 249456 249632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 249717 249641 gene locus_tag LOCUS_t00010 249717 249641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 249998 249804 gene locus_tag LOCUS_02420 249998 249804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 250519 250097 gene locus_tag LOCUS_02430 gene lytH 250519 250097 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207998.1 protein_id gnl|my_center|LOCUS_02430 251106 250663 gene locus_tag LOCUS_02440 251106 250663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 251574 251341 gene locus_tag LOCUS_02450 251574 251341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 251839 252318 gene locus_tag LOCUS_02460 251839 252318 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206192.1 protein_id gnl|my_center|LOCUS_02460 253444 252353 gene locus_tag LOCUS_02470 gene aroC 253444 252353 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ2 protein_id gnl|my_center|LOCUS_02470 254467 253457 gene locus_tag LOCUS_02480 gene prmB 254467 253457 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ1 protein_id gnl|my_center|LOCUS_02480 254941 254597 gene locus_tag LOCUS_02490 254941 254597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 255159 255461 gene locus_tag LOCUS_02500 255159 255461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206634.1 protein_id gnl|my_center|LOCUS_02500 255679 257052 gene locus_tag LOCUS_02510 gene cabC1 255679 257052 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_02510 257287 258567 gene locus_tag LOCUS_02520 gene acdA 257287 258567 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206632.1 protein_id gnl|my_center|LOCUS_02520 258599 259798 gene locus_tag LOCUS_02530 gene acadM 258599 259798 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206631.1 protein_id gnl|my_center|LOCUS_02530 259890 260381 gene locus_tag LOCUS_02540 259890 260381 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 protein_id gnl|my_center|LOCUS_02540 262308 260437 gene locus_tag LOCUS_02550 gene ppiD 262308 260437 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ1 protein_id gnl|my_center|LOCUS_02550 262709 262437 gene locus_tag LOCUS_02560 gene hup 262709 262437 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_02560 263343 262867 gene locus_tag LOCUS_02570 263343 262867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069443.1 protein_id gnl|my_center|LOCUS_02570 263546 264190 gene locus_tag LOCUS_02580 263546 264190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206628.1 protein_id gnl|my_center|LOCUS_02580 264302 264775 gene locus_tag LOCUS_02590 264302 264775 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_02590 264777 265994 gene locus_tag LOCUS_02600 gene iscS 264777 265994 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY6 protein_id gnl|my_center|LOCUS_02600 266063 266449 gene locus_tag LOCUS_02610 gene nifU 266063 266449 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY5 protein_id gnl|my_center|LOCUS_02610 266484 266804 gene locus_tag LOCUS_02620 266484 266804 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_02620 266887 267402 gene locus_tag LOCUS_02630 gene hscB 266887 267402 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY3 protein_id gnl|my_center|LOCUS_02630 267440 269299 gene locus_tag LOCUS_02640 gene hscA 267440 269299 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY2 protein_id gnl|my_center|LOCUS_02640 269317 269655 gene locus_tag LOCUS_02650 gene fdx 269317 269655 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_02650 271217 269709 gene locus_tag LOCUS_02660 gene cyaA 271217 269709 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206624.1 protein_id gnl|my_center|LOCUS_02660 271716 271282 gene locus_tag LOCUS_02670 271716 271282 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_02670 275448 271945 gene locus_tag LOCUS_02680 gene mfd 275448 271945 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX8 protein_id gnl|my_center|LOCUS_02680 275862 275503 gene locus_tag LOCUS_02690 275862 275503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206622.1 protein_id gnl|my_center|LOCUS_02690 276809 276036 gene locus_tag LOCUS_02700 276809 276036 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_02700 277334 276825 gene locus_tag LOCUS_02710 gene menG 277334 276825 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_02710 278013 277348 gene locus_tag LOCUS_02720 gene yraR 278013 277348 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206619.1 protein_id gnl|my_center|LOCUS_02720 278227 278496 gene locus_tag LOCUS_02730 gene rpsT 278227 278496 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_02730 279440 278721 gene locus_tag LOCUS_02740 gene gpmA 279440 278721 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_02740 280417 279530 gene locus_tag LOCUS_02750 gene cysQ 280417 279530 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206618.1 protein_id gnl|my_center|LOCUS_02750 280753 280607 gene locus_tag LOCUS_02760 280753 280607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 281135 281821 gene locus_tag LOCUS_02770 gene yrfG 281135 281821 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206980.1 protein_id gnl|my_center|LOCUS_02770 281805 282245 gene locus_tag LOCUS_02780 gene hslR 281805 282245 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW4 protein_id gnl|my_center|LOCUS_02780 282394 283440 gene locus_tag LOCUS_02790 gene recA 282394 283440 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW5 protein_id gnl|my_center|LOCUS_02790 283494 283979 gene locus_tag LOCUS_02800 gene recX 283494 283979 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW6 protein_id gnl|my_center|LOCUS_02800 284424 285245 gene locus_tag LOCUS_02810 284424 285245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206981.1 protein_id gnl|my_center|LOCUS_02810 286105 285317 gene locus_tag LOCUS_02820 gene lpxA2 286105 285317 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 protein_id gnl|my_center|LOCUS_02820 286592 286113 gene locus_tag LOCUS_02830 gene fabZ 286592 286113 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC6 protein_id gnl|my_center|LOCUS_02830 287666 286596 gene locus_tag LOCUS_02840 gene lpxD 287666 286596 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC7 protein_id gnl|my_center|LOCUS_02840 288167 287670 gene locus_tag LOCUS_02850 gene ompH 288167 287670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206985.1 protein_id gnl|my_center|LOCUS_02850 290718 288214 gene locus_tag LOCUS_02860 gene yaeT 290718 288214 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC9 protein_id gnl|my_center|LOCUS_02860 292101 290743 gene locus_tag LOCUS_02870 292101 290743 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_02870 293297 292101 gene locus_tag LOCUS_02880 gene dxr 293297 292101 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD2 protein_id gnl|my_center|LOCUS_02880 294122 293298 gene locus_tag LOCUS_02890 gene cdsA 294122 293298 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD3 protein_id gnl|my_center|LOCUS_02890 294875 294126 gene locus_tag LOCUS_02900 gene ispU 294875 294126 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD4 protein_id gnl|my_center|LOCUS_02900 295433 294879 gene locus_tag LOCUS_02910 gene frr 295433 294879 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD5 protein_id gnl|my_center|LOCUS_02910 296239 295511 gene locus_tag LOCUS_02920 gene pyrH 296239 295511 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD6 protein_id gnl|my_center|LOCUS_02920 297641 296298 gene locus_tag LOCUS_02930 gene yliG 297641 296298 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD7 protein_id gnl|my_center|LOCUS_02930 298008 299117 gene locus_tag LOCUS_02940 gene glnL 298008 299117 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115631.1 protein_id gnl|my_center|LOCUS_02940 299104 300579 gene locus_tag LOCUS_02950 gene glnG 299104 300579 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206993.1 protein_id gnl|my_center|LOCUS_02950 300779 301414 gene locus_tag LOCUS_02960 300779 301414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206270.1 protein_id gnl|my_center|LOCUS_02960 302619 301477 gene locus_tag LOCUS_02970 gene prpC 302619 301477 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_02970 303520 302624 gene locus_tag LOCUS_02980 gene prpB 303520 302624 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0X5 protein_id gnl|my_center|LOCUS_02980 303838 304416 gene locus_tag LOCUS_02990 gene mtrR 303838 304416 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 protein_id gnl|my_center|LOCUS_02990 304520 305440 gene locus_tag LOCUS_03000 gene argF 304520 305440 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_03000 305536 306003 gene locus_tag LOCUS_03010 305536 306003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 306391 306038 gene locus_tag LOCUS_03020 306391 306038 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR0 protein_id gnl|my_center|LOCUS_03020 308723 306447 gene locus_tag LOCUS_03030 gene clpA 308723 306447 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073979.1 protein_id gnl|my_center|LOCUS_03030 309146 308733 gene locus_tag LOCUS_03040 gene clpS 309146 308733 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR2 protein_id gnl|my_center|LOCUS_03040 309855 309163 gene locus_tag LOCUS_03050 309855 309163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206946.1 protein_id gnl|my_center|LOCUS_03050 311038 309989 gene locus_tag LOCUS_03060 gene argC 311038 309989 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR4 protein_id gnl|my_center|LOCUS_03060 311799 311125 gene locus_tag LOCUS_03070 311799 311125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206949.1 protein_id gnl|my_center|LOCUS_03070 312470 311799 gene locus_tag LOCUS_03080 gene rpiA 312470 311799 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR7 protein_id gnl|my_center|LOCUS_03080 312576 314114 gene locus_tag LOCUS_03090 gene ilvA 312576 314114 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR8 protein_id gnl|my_center|LOCUS_03090 314361 315011 gene locus_tag LOCUS_03100 gene trkA 314361 315011 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206952.1 protein_id gnl|my_center|LOCUS_03100 315013 316359 gene locus_tag LOCUS_03110 gene ntpJ 315013 316359 CDS product potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206953.1 protein_id gnl|my_center|LOCUS_03110 317476 316403 gene locus_tag LOCUS_03120 gene pldA 317476 316403 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_03120 320441 317502 gene locus_tag LOCUS_03130 gene preP2 320441 317502 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_03130 320788 321792 gene locus_tag LOCUS_03140 320788 321792 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_03140 321794 322117 gene locus_tag LOCUS_03150 321794 322117 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121079.1 protein_id gnl|my_center|LOCUS_03150 322132 322743 gene locus_tag LOCUS_03160 322132 322743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121106.1 protein_id gnl|my_center|LOCUS_03160 324038 322809 gene locus_tag LOCUS_03170 gene caiB 324038 322809 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208447.1 protein_id gnl|my_center|LOCUS_03170 325389 324076 gene locus_tag LOCUS_03180 gene mucK 325389 324076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208446.1 protein_id gnl|my_center|LOCUS_03180 326826 325603 gene locus_tag LOCUS_03190 gene gcdH 326826 325603 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 protein_id gnl|my_center|LOCUS_03190 327055 327990 gene locus_tag LOCUS_03200 gene gcvA 327055 327990 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 protein_id gnl|my_center|LOCUS_03200 328331 328005 gene locus_tag LOCUS_03210 328331 328005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121003.1 protein_id gnl|my_center|LOCUS_03210 328619 329521 gene locus_tag LOCUS_03220 gene ltrA 328619 329521 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120927.1 protein_id gnl|my_center|LOCUS_03220 330701 329907 gene locus_tag LOCUS_03230 gene map 330701 329907 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFU1 protein_id gnl|my_center|LOCUS_03230 331092 332393 gene locus_tag LOCUS_03240 gene braZ 331092 332393 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFU2 protein_id gnl|my_center|LOCUS_03240 333123 332734 gene locus_tag LOCUS_03250 333123 332734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 333758 333997 gene locus_tag LOCUS_03260 333758 333997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 334526 334062 gene locus_tag LOCUS_03270 334526 334062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_03270 334990 335457 gene locus_tag LOCUS_03280 334990 335457 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 protein_id gnl|my_center|LOCUS_03280 336117 335464 gene locus_tag LOCUS_03290 336117 335464 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206617.1 protein_id gnl|my_center|LOCUS_03290 337158 336373 gene locus_tag LOCUS_03300 gene budC 337158 336373 CDS product diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 protein_id gnl|my_center|LOCUS_03300 338288 337230 gene locus_tag LOCUS_03310 gene bdh1 338288 337230 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_03310 339765 338365 gene locus_tag LOCUS_03320 gene acoD 339765 338365 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK1 protein_id gnl|my_center|LOCUS_03320 341325 339775 gene locus_tag LOCUS_03330 gene acoC 341325 339775 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNK0 protein_id gnl|my_center|LOCUS_03330 342346 341327 gene locus_tag LOCUS_03340 gene acoB 342346 341327 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792520.1 protein_id gnl|my_center|LOCUS_03340 343325 342363 gene locus_tag LOCUS_03350 gene acoA 343325 342363 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177517.1 protein_id gnl|my_center|LOCUS_03350 343664 344647 gene locus_tag LOCUS_03360 gene lipA 343664 344647 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ7 protein_id gnl|my_center|LOCUS_03360 344904 346031 gene locus_tag LOCUS_03370 344904 346031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069347.1 protein_id gnl|my_center|LOCUS_03370 347028 346084 gene locus_tag LOCUS_03380 347028 346084 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206846.1 protein_id gnl|my_center|LOCUS_03380 347282 348562 gene locus_tag LOCUS_03390 gene dadA 347282 348562 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G2B9 protein_id gnl|my_center|LOCUS_03390 350798 348633 gene locus_tag LOCUS_03400 gene glcB 350798 348633 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV4 protein_id gnl|my_center|LOCUS_03400 352295 351159 gene locus_tag LOCUS_03410 gene yhcM 352295 351159 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV3 protein_id gnl|my_center|LOCUS_03410 353390 352383 gene locus_tag LOCUS_03420 353390 352383 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206604.1 protein_id gnl|my_center|LOCUS_03420 353543 355054 gene locus_tag LOCUS_03430 353543 355054 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206603.1 protein_id gnl|my_center|LOCUS_03430 355102 356010 gene locus_tag LOCUS_03440 355102 356010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 protein_id gnl|my_center|LOCUS_03440 356815 356135 gene locus_tag LOCUS_03450 gene pyrF 356815 356135 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_03450 357477 356929 gene locus_tag LOCUS_03460 gene ydcN 357477 356929 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117406.1 protein_id gnl|my_center|LOCUS_03460 357568 358224 gene locus_tag LOCUS_03470 357568 358224 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099346.1 protein_id gnl|my_center|LOCUS_03470 358365 358547 gene locus_tag LOCUS_03480 358365 358547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 358997 358632 gene locus_tag LOCUS_03490 358997 358632 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121360.1 protein_id gnl|my_center|LOCUS_03490 359324 359019 gene locus_tag LOCUS_03500 gene himD 359324 359019 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_03500 361154 359481 gene locus_tag LOCUS_03510 gene rpsA 361154 359481 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD7 protein_id gnl|my_center|LOCUS_03510 361943 361260 gene locus_tag LOCUS_03520 gene cmk 361943 361260 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD6 protein_id gnl|my_center|LOCUS_03520 362388 361954 gene locus_tag LOCUS_03530 362388 361954 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 protein_id gnl|my_center|LOCUS_03530 362962 362471 gene locus_tag LOCUS_03540 gene yfhC 362962 362471 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_03540 364090 362966 gene locus_tag LOCUS_03550 gene hibch 364090 362966 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206599.1 protein_id gnl|my_center|LOCUS_03550 364800 364087 gene locus_tag LOCUS_03560 gene ung 364800 364087 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_03560 365441 364845 gene locus_tag LOCUS_03570 365441 364845 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_03570 366482 365538 gene locus_tag LOCUS_03580 gene xcpX 366482 365538 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_03580 367140 366505 gene locus_tag LOCUS_03590 gene xcpW 367140 366505 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_03590 367523 367137 gene locus_tag LOCUS_03600 gene xcpV 367523 367137 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121425.1 protein_id gnl|my_center|LOCUS_03600 368076 367513 gene locus_tag LOCUS_03610 368076 367513 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206596.1 protein_id gnl|my_center|LOCUS_03610 368705 368091 gene locus_tag LOCUS_03620 368705 368091 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_03620 369512 368739 gene locus_tag LOCUS_03630 gene ycfH 369512 368739 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_03630 369897 369556 gene locus_tag LOCUS_03640 gene pilZ 369897 369556 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_03640 370899 369916 gene locus_tag LOCUS_03650 gene holB 370899 369916 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 protein_id gnl|my_center|LOCUS_03650 371678 370917 gene locus_tag LOCUS_03660 gene kdsB 371678 370917 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC2 protein_id gnl|my_center|LOCUS_03660 372698 371688 gene locus_tag LOCUS_03670 gene lpxK 372698 371688 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC1 protein_id gnl|my_center|LOCUS_03670 374429 372702 gene locus_tag LOCUS_03680 gene msbA 374429 372702 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC0 protein_id gnl|my_center|LOCUS_03680 374851 374429 gene locus_tag LOCUS_03690 gene exbD 374851 374429 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_03690 375498 374866 gene locus_tag LOCUS_03700 375498 374866 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_03700 376430 375543 gene locus_tag LOCUS_03710 gene spoOJ 376430 375543 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206589.1 protein_id gnl|my_center|LOCUS_03710 377209 376427 gene locus_tag LOCUS_03720 gene soj 377209 376427 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_03720 377866 377234 gene locus_tag LOCUS_03730 gene gidB 377866 377234 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB5 protein_id gnl|my_center|LOCUS_03730 378641 377937 gene locus_tag LOCUS_03740 gene mpg1 378641 377937 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_03740 379654 378641 gene locus_tag LOCUS_03750 379654 378641 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 protein_id gnl|my_center|LOCUS_03750 379775 382216 gene locus_tag LOCUS_03760 gene lptD 379775 382216 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB2 protein_id gnl|my_center|LOCUS_03760 382216 383526 gene locus_tag LOCUS_03770 gene surA 382216 383526 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB1 protein_id gnl|my_center|LOCUS_03770 384199 383651 gene locus_tag LOCUS_03780 384199 383651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 385235 384291 gene locus_tag LOCUS_03790 gene miaA 385235 384291 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH83 protein_id gnl|my_center|LOCUS_03790 387206 385242 gene locus_tag LOCUS_03800 gene mutL 387206 385242 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH84 protein_id gnl|my_center|LOCUS_03800 387672 387196 gene locus_tag LOCUS_03810 387672 387196 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_03810 387818 388729 gene locus_tag LOCUS_03820 387818 388729 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207101.1 protein_id gnl|my_center|LOCUS_03820 388838 389152 gene locus_tag LOCUS_03830 388838 389152 CDS product RelB/DinJ family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068595.1 protein_id gnl|my_center|LOCUS_03830 389921 389214 gene locus_tag LOCUS_03840 gene rsuA 389921 389214 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH89 protein_id gnl|my_center|LOCUS_03840 391054 390185 gene locus_tag LOCUS_03850 gene tnpA 391054 390185 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071273.1 protein_id gnl|my_center|LOCUS_03850 391294 391746 gene locus_tag LOCUS_03860 391294 391746 CDS product UPF0756 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHP9 protein_id gnl|my_center|LOCUS_03860 392677 391760 gene locus_tag LOCUS_03870 gene metR 392677 391760 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 protein_id gnl|my_center|LOCUS_03870 394613 393387 gene locus_tag LOCUS_03880 gene gltS 394613 393387 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 protein_id gnl|my_center|LOCUS_03880 394966 396174 gene locus_tag LOCUS_03890 gene ydhP 394966 396174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207106.1 protein_id gnl|my_center|LOCUS_03890 397423 396476 gene locus_tag LOCUS_03900 gene yclQ 397423 396476 CDS product putative ABC transporter solute-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94421 protein_id gnl|my_center|LOCUS_03900 398197 397433 gene locus_tag LOCUS_03910 gene yclP 398197 397433 CDS product putative ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94420 protein_id gnl|my_center|LOCUS_03910 399144 398182 gene locus_tag LOCUS_03920 gene yclO 399144 398182 CDS product putative ABC transporter permease protein YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94419 protein_id gnl|my_center|LOCUS_03920 400090 399137 gene locus_tag LOCUS_03930 gene yclN 400090 399137 CDS product putative ABC transporter permease protein YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94418 protein_id gnl|my_center|LOCUS_03930 400542 401027 gene locus_tag LOCUS_03940 gene lrp 400542 401027 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206234.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 401370 401152 gene locus_tag LOCUS_03950 401370 401152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 401702 401520 gene locus_tag LOCUS_03960 401702 401520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 403018 401774 gene locus_tag LOCUS_03970 403018 401774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 405789 403150 gene locus_tag LOCUS_03980 gene acnB 405789 403150 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHQ6 protein_id gnl|my_center|LOCUS_03980 406584 406225 gene locus_tag LOCUS_03990 406584 406225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073636.1 protein_id gnl|my_center|LOCUS_03990 407033 406677 gene locus_tag LOCUS_04000 407033 406677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 411740 407226 gene locus_tag LOCUS_04010 411740 407226 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207109.1 protein_id gnl|my_center|LOCUS_04010 414526 411770 gene locus_tag LOCUS_04020 gene ytfM 414526 411770 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207110.1 protein_id gnl|my_center|LOCUS_04020 414697 416016 gene locus_tag LOCUS_04030 gene lplT 414697 416016 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 protein_id gnl|my_center|LOCUS_04030 416019 416654 gene locus_tag LOCUS_04040 gene coq7 416019 416654 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_04040 417158 416715 gene locus_tag LOCUS_04050 417158 416715 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207119.1 protein_id gnl|my_center|LOCUS_04050 417495 417115 gene locus_tag LOCUS_04060 gene folB 417495 417115 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHS1 protein_id gnl|my_center|LOCUS_04060 418819 417515 gene locus_tag LOCUS_04070 418819 417515 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_04070 419648 418866 gene locus_tag LOCUS_04080 gene moeB 419648 418866 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_04080 419962 420462 gene locus_tag LOCUS_04090 419962 420462 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037408.1 protein_id gnl|my_center|LOCUS_04090 422231 420549 gene locus_tag LOCUS_04100 422231 420549 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_04100 423585 422449 gene locus_tag LOCUS_04110 gene acads 423585 422449 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_04110 424373 423603 gene locus_tag LOCUS_04120 424373 423603 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207124.1 protein_id gnl|my_center|LOCUS_04120 424547 425572 gene locus_tag LOCUS_04130 gene rrp12 424547 425572 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 protein_id gnl|my_center|LOCUS_04130 426753 425929 gene locus_tag LOCUS_04140 gene hemK 426753 425929 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT0 protein_id gnl|my_center|LOCUS_04140 427841 426753 gene locus_tag LOCUS_04150 gene prfA 427841 426753 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT1 protein_id gnl|my_center|LOCUS_04150 428206 428640 gene locus_tag LOCUS_04160 428206 428640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068514.1 protein_id gnl|my_center|LOCUS_04160 428827 429327 gene locus_tag LOCUS_04170 428827 429327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 protein_id gnl|my_center|LOCUS_04170 429461 430465 gene locus_tag LOCUS_04180 gene yhbW 429461 430465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068512.1 protein_id gnl|my_center|LOCUS_04180 430799 431596 gene locus_tag LOCUS_04190 430799 431596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704779.1 protein_id gnl|my_center|LOCUS_04190 431618 432178 gene locus_tag LOCUS_04200 431618 432178 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207131.1 protein_id gnl|my_center|LOCUS_04200 432996 432235 gene locus_tag LOCUS_04210 432996 432235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 433925 433089 gene locus_tag LOCUS_04220 433925 433089 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU2 protein_id gnl|my_center|LOCUS_04220 434080 436458 gene locus_tag LOCUS_04230 gene ppsA 434080 436458 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU3 protein_id gnl|my_center|LOCUS_04230 436936 436679 gene locus_tag LOCUS_04240 436936 436679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 437399 437887 gene locus_tag LOCUS_04250 437399 437887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208378.1 protein_id gnl|my_center|LOCUS_04250 438518 439285 gene locus_tag LOCUS_04260 438518 439285 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119677.1 protein_id gnl|my_center|LOCUS_04260 439578 440645 gene locus_tag LOCUS_04270 gene cyoA 439578 440645 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU5 protein_id gnl|my_center|LOCUS_04270 440649 442631 gene locus_tag LOCUS_04280 gene cyoB 440649 442631 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068497.1 protein_id gnl|my_center|LOCUS_04280 442636 443256 gene locus_tag LOCUS_04290 gene cyoC 442636 443256 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119759.1 protein_id gnl|my_center|LOCUS_04290 443256 443582 gene locus_tag LOCUS_04300 gene cyoD 443256 443582 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094534.1 protein_id gnl|my_center|LOCUS_04300 443593 444471 gene locus_tag LOCUS_04310 gene cyoE 443593 444471 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU9 protein_id gnl|my_center|LOCUS_04310 444682 445068 gene locus_tag LOCUS_04320 gene rpsF 444682 445068 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV0 protein_id gnl|my_center|LOCUS_04320 445080 445307 gene locus_tag LOCUS_04330 gene rpsR 445080 445307 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV1 protein_id gnl|my_center|LOCUS_04330 445316 445762 gene locus_tag LOCUS_04340 gene rplI 445316 445762 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_04340 445953 447398 gene locus_tag LOCUS_04350 gene dnaB 445953 447398 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV3 protein_id gnl|my_center|LOCUS_04350 448083 449153 gene locus_tag LOCUS_04360 gene alr 448083 449153 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV4 protein_id gnl|my_center|LOCUS_04360 449591 449169 gene locus_tag LOCUS_04370 449591 449169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_04370 450380 449646 gene locus_tag LOCUS_04380 450380 449646 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207137.1 protein_id gnl|my_center|LOCUS_04380 451286 450687 gene locus_tag LOCUS_04390 451286 450687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207139.1 protein_id gnl|my_center|LOCUS_04390 452901 451315 gene locus_tag LOCUS_04400 452901 451315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207140.1 protein_id gnl|my_center|LOCUS_04400 453137 454141 gene locus_tag LOCUS_04410 453137 454141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 456401 454521 gene locus_tag LOCUS_04420 gene mnmG 456401 454521 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW1 protein_id gnl|my_center|LOCUS_04420 456654 457001 gene locus_tag LOCUS_04430 456654 457001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 457168 458049 gene locus_tag LOCUS_04440 457168 458049 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_04440 458171 459073 gene locus_tag LOCUS_04450 gene prmA 458171 459073 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW3 protein_id gnl|my_center|LOCUS_04450 459090 459959 gene locus_tag LOCUS_04460 459090 459959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207144.1 protein_id gnl|my_center|LOCUS_04460 460320 460589 gene locus_tag LOCUS_04470 gene fis 460320 460589 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000816.1 protein_id gnl|my_center|LOCUS_04470 460659 462233 gene locus_tag LOCUS_04480 gene purH 460659 462233 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW6 protein_id gnl|my_center|LOCUS_04480 462379 463662 gene locus_tag LOCUS_04490 gene purD 462379 463662 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW7 protein_id gnl|my_center|LOCUS_04490 463788 464519 gene locus_tag LOCUS_04500 gene gloB 463788 464519 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHX1 protein_id gnl|my_center|LOCUS_04500 464867 465070 gene locus_tag LOCUS_04510 464867 465070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119766.1 protein_id gnl|my_center|LOCUS_04510 465298 465214 gene locus_tag LOCUS_t00020 465298 465214 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 465398 465314 gene locus_tag LOCUS_t00030 465398 465314 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 466310 465516 gene locus_tag LOCUS_04520 466310 465516 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207194.1 protein_id gnl|my_center|LOCUS_04520 467811 466303 gene locus_tag LOCUS_04530 467811 466303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_04530 467985 468857 gene locus_tag LOCUS_04540 467985 468857 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 protein_id gnl|my_center|LOCUS_04540 469669 468962 gene locus_tag LOCUS_04550 gene bla 469669 468962 CDS product OXA-213 family carbapenem-hydrolyzing class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206564.1 protein_id gnl|my_center|LOCUS_04550 470864 469848 gene locus_tag LOCUS_04560 gene tsaD 470864 469848 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII7 protein_id gnl|my_center|LOCUS_04560 471012 471227 gene locus_tag LOCUS_04570 gene rpsU 471012 471227 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII8 protein_id gnl|my_center|LOCUS_04570 471235 471708 gene locus_tag LOCUS_04580 471235 471708 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_04580 473193 471727 gene locus_tag LOCUS_04590 473193 471727 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ0 protein_id gnl|my_center|LOCUS_04590 474222 473251 gene locus_tag LOCUS_04600 gene tkrA 474222 473251 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115253.1 protein_id gnl|my_center|LOCUS_04600 474915 474244 gene locus_tag LOCUS_04610 474915 474244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207197.1 protein_id gnl|my_center|LOCUS_04610 476936 475047 gene locus_tag LOCUS_04620 476936 475047 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207198.1 protein_id gnl|my_center|LOCUS_04620 478555 477017 gene locus_tag LOCUS_04630 gene purF 478555 477017 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ4 protein_id gnl|my_center|LOCUS_04630 479167 478580 gene locus_tag LOCUS_04640 479167 478580 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 protein_id gnl|my_center|LOCUS_04640 480175 479171 gene locus_tag LOCUS_04650 gene pyrD 480175 479171 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ6 protein_id gnl|my_center|LOCUS_04650 480745 480266 gene locus_tag LOCUS_04660 480745 480266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207201.1 protein_id gnl|my_center|LOCUS_04660 481887 480745 gene locus_tag LOCUS_04670 481887 480745 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ8 protein_id gnl|my_center|LOCUS_04670 482374 481919 gene locus_tag LOCUS_04680 482374 481919 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_04680 483515 482442 gene locus_tag LOCUS_04690 gene gpsA 483515 482442 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_04690 484129 483554 gene locus_tag LOCUS_04700 484129 483554 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_04700 484338 484721 gene locus_tag LOCUS_04710 484338 484721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_04710 485931 484780 gene locus_tag LOCUS_04720 gene rhlB 485931 484780 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK3 protein_id gnl|my_center|LOCUS_04720 486245 486033 gene locus_tag LOCUS_04730 gene cspG 486245 486033 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 protein_id gnl|my_center|LOCUS_04730 486633 486872 gene locus_tag LOCUS_04740 486633 486872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 487007 487876 gene locus_tag LOCUS_04750 gene rpoH 487007 487876 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_04750 488010 488375 gene locus_tag LOCUS_04760 488010 488375 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_04760 488392 488589 gene locus_tag LOCUS_04770 gene thiS 488392 488589 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115323.1 protein_id gnl|my_center|LOCUS_04770 488604 489389 gene locus_tag LOCUS_04780 gene thiG 488604 489389 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL0 protein_id gnl|my_center|LOCUS_04780 490049 489438 gene locus_tag LOCUS_04790 gene gstB 490049 489438 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121577.1 protein_id gnl|my_center|LOCUS_04790 490312 491028 gene locus_tag LOCUS_04800 gene trmB 490312 491028 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI97 protein_id gnl|my_center|LOCUS_04800 491741 491067 gene locus_tag LOCUS_04810 gene cmoA 491741 491067 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 protein_id gnl|my_center|LOCUS_04810 492574 491792 gene locus_tag LOCUS_04820 492574 491792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 protein_id gnl|my_center|LOCUS_04820 493660 492662 gene locus_tag LOCUS_04830 493660 492662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208214.1 protein_id gnl|my_center|LOCUS_04830 495438 493978 gene locus_tag LOCUS_04840 495438 493978 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206198.1 protein_id gnl|my_center|LOCUS_04840 496876 495641 gene locus_tag LOCUS_04850 gene pyrX 496876 495641 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_04850 497903 496887 gene locus_tag LOCUS_04860 gene pyrB 497903 496887 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI91 protein_id gnl|my_center|LOCUS_04860 498460 498125 gene locus_tag LOCUS_04870 498460 498125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206195.1 protein_id gnl|my_center|LOCUS_04870 498762 500966 gene locus_tag LOCUS_04880 gene ycbY 498762 500966 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI89 protein_id gnl|my_center|LOCUS_04880 503615 501036 gene locus_tag LOCUS_04890 gene clpB 503615 501036 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI86 protein_id gnl|my_center|LOCUS_04890 504275 503853 gene locus_tag LOCUS_04900 504275 503853 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_04900 504422 505138 gene locus_tag LOCUS_04910 gene crp 504422 505138 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 protein_id gnl|my_center|LOCUS_04910 505379 506428 gene locus_tag LOCUS_04920 gene tas 505379 506428 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206188.1 protein_id gnl|my_center|LOCUS_04920 507259 506480 gene locus_tag LOCUS_04930 gene oma1 507259 506480 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121572.1 protein_id gnl|my_center|LOCUS_04930 507885 507577 gene locus_tag LOCUS_04940 507885 507577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121533.1 protein_id gnl|my_center|LOCUS_04940 509349 508030 gene locus_tag LOCUS_04950 gene purA 509349 508030 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI77 protein_id gnl|my_center|LOCUS_04950 510586 509420 gene locus_tag LOCUS_04960 gene hisZ 510586 509420 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI76 protein_id gnl|my_center|LOCUS_04960 511233 510913 gene locus_tag LOCUS_04970 511233 510913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 512337 511315 gene locus_tag LOCUS_04980 gene epD 512337 511315 CDS product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_04980 512592 515285 gene locus_tag LOCUS_04990 gene alaS 512592 515285 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI74 protein_id gnl|my_center|LOCUS_04990 515351 516631 gene locus_tag LOCUS_05000 gene lysC 515351 516631 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI73 protein_id gnl|my_center|LOCUS_05000 516886 517140 gene locus_tag LOCUS_05010 gene csrA 516886 517140 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI72 protein_id gnl|my_center|LOCUS_05010 517797 517222 gene locus_tag LOCUS_05020 gene rnhB 517797 517222 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI71 protein_id gnl|my_center|LOCUS_05020 518239 517859 gene locus_tag LOCUS_05030 518239 517859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206184.1 protein_id gnl|my_center|LOCUS_05030 519554 518343 gene locus_tag LOCUS_05040 519554 518343 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_05040 520324 519569 gene locus_tag LOCUS_05050 520324 519569 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_05050 521465 520467 gene locus_tag LOCUS_05060 gene add 521465 520467 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_05060 522858 521539 gene locus_tag LOCUS_05070 522858 521539 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_05070 523561 523340 gene locus_tag LOCUS_05080 523561 523340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 523890 525344 gene locus_tag LOCUS_05090 gene ybaR 523890 525344 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 protein_id gnl|my_center|LOCUS_05090 525772 525467 gene locus_tag LOCUS_05100 525772 525467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 526771 526559 gene locus_tag LOCUS_05110 526771 526559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 527323 527760 gene locus_tag LOCUS_05120 527323 527760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 527992 527916 gene locus_tag LOCUS_t00040 527992 527916 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 530024 528018 gene locus_tag LOCUS_05130 530024 528018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 530935 530027 gene locus_tag LOCUS_05140 530935 530027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_05140 531906 530947 gene locus_tag LOCUS_05150 531906 530947 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_05150 532288 531986 gene locus_tag LOCUS_05160 532288 531986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980869.1 protein_id gnl|my_center|LOCUS_05160 534393 532288 gene locus_tag LOCUS_05170 gene cstA 534393 532288 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207301.1 protein_id gnl|my_center|LOCUS_05170 535143 534574 gene locus_tag LOCUS_05180 gene efp 535143 534574 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJV8 protein_id gnl|my_center|LOCUS_05180 535214 536230 gene locus_tag LOCUS_05190 535214 536230 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_05190 536246 538000 gene locus_tag LOCUS_05200 536246 538000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207304.1 protein_id gnl|my_center|LOCUS_05200 537982 540117 gene locus_tag LOCUS_05210 537982 540117 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207305.1 protein_id gnl|my_center|LOCUS_05210 540403 540179 gene locus_tag LOCUS_05220 gene rpmE 540403 540179 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJW3 protein_id gnl|my_center|LOCUS_05220 541609 540608 gene locus_tag LOCUS_05230 541609 540608 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207306.1 protein_id gnl|my_center|LOCUS_05230 542170 541769 gene locus_tag LOCUS_05240 gene gloA 542170 541769 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118996.1 protein_id gnl|my_center|LOCUS_05240 544326 542173 gene locus_tag LOCUS_05250 gene ampG4 544326 542173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207307.1 protein_id gnl|my_center|LOCUS_05250 544529 547141 gene locus_tag LOCUS_05260 gene ycbZ 544529 547141 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067989.1 protein_id gnl|my_center|LOCUS_05260 547538 547197 gene locus_tag LOCUS_05270 gene grxD 547538 547197 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_05270 547700 548914 gene locus_tag LOCUS_05280 gene argD 547700 548914 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_05280 549899 548970 gene locus_tag LOCUS_05290 gene aaeR 549899 548970 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 protein_id gnl|my_center|LOCUS_05290 550819 549998 gene locus_tag LOCUS_05300 gene nlpD 550819 549998 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_05300 551714 550941 gene locus_tag LOCUS_05310 gene surE 551714 550941 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX0 protein_id gnl|my_center|LOCUS_05310 551851 552192 gene locus_tag LOCUS_05320 551851 552192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 552353 552751 gene locus_tag LOCUS_05330 552353 552751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118406.1 protein_id gnl|my_center|LOCUS_05330 552870 554018 gene locus_tag LOCUS_05340 gene dacC 552870 554018 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_05340 554117 554653 gene locus_tag LOCUS_05350 gene yrdA 554117 554653 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 protein_id gnl|my_center|LOCUS_05350 555501 555986 gene locus_tag LOCUS_05360 gene nudJ 555501 555986 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119006.1 protein_id gnl|my_center|LOCUS_05360 555979 557124 gene locus_tag LOCUS_05370 gene trmU 555979 557124 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX6 protein_id gnl|my_center|LOCUS_05370 557142 557873 gene locus_tag LOCUS_05380 gene hflD 557142 557873 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX7 protein_id gnl|my_center|LOCUS_05380 557929 559317 gene locus_tag LOCUS_05390 gene purB 557929 559317 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX8 protein_id gnl|my_center|LOCUS_05390 559410 560057 gene locus_tag LOCUS_05400 gene yjdF 559410 560057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 protein_id gnl|my_center|LOCUS_05400 560626 561228 gene locus_tag LOCUS_05410 560626 561228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227179.1 protein_id gnl|my_center|LOCUS_05410 562286 561324 gene locus_tag LOCUS_05420 gene sohB 562286 561324 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207313.1 protein_id gnl|my_center|LOCUS_05420 563007 562336 gene locus_tag LOCUS_05430 563007 562336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 564008 563100 gene locus_tag LOCUS_05440 gene pstB 564008 563100 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY2 protein_id gnl|my_center|LOCUS_05440 565419 564022 gene locus_tag LOCUS_05450 gene pstA 565419 564022 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY3 protein_id gnl|my_center|LOCUS_05450 566795 565416 gene locus_tag LOCUS_05460 gene pstC 566795 565416 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKD9 protein_id gnl|my_center|LOCUS_05460 567927 566896 gene locus_tag LOCUS_05470 gene sphX 567927 566896 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118975.1 protein_id gnl|my_center|LOCUS_05470 570120 568738 gene locus_tag LOCUS_05480 gene aroP 570120 568738 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207315.1 protein_id gnl|my_center|LOCUS_05480 571990 570269 gene locus_tag LOCUS_05490 gene pdc1 571990 570269 CDS product pyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207316.1 protein_id gnl|my_center|LOCUS_05490 572127 572606 gene locus_tag LOCUS_05500 gene lrp 572127 572606 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700117.1 protein_id gnl|my_center|LOCUS_05500 574243 572711 gene locus_tag LOCUS_05510 gene ddc 574243 572711 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 protein_id gnl|my_center|LOCUS_05510 575620 574247 gene locus_tag LOCUS_05520 gene dat 575620 574247 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 protein_id gnl|my_center|LOCUS_05520 576090 576791 gene locus_tag LOCUS_05530 576090 576791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_05530 578281 577163 gene locus_tag LOCUS_05540 gene des6 578281 577163 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_05540 579350 578295 gene locus_tag LOCUS_05550 gene hmp 579350 578295 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207321.1 protein_id gnl|my_center|LOCUS_05550 579488 580183 gene locus_tag LOCUS_05560 579488 580183 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118668.1 protein_id gnl|my_center|LOCUS_05560 580359 580748 gene locus_tag LOCUS_05570 580359 580748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 583637 580809 gene locus_tag LOCUS_05580 gene hepA 583637 580809 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF2 protein_id gnl|my_center|LOCUS_05580 584432 583788 gene locus_tag LOCUS_05590 gene rluA 584432 583788 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_05590 585095 584604 gene locus_tag LOCUS_05600 585095 584604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 585282 586064 gene locus_tag LOCUS_05610 585282 586064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 587472 586171 gene locus_tag LOCUS_05620 gene hemL 587472 586171 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF5 protein_id gnl|my_center|LOCUS_05620 588146 587517 gene locus_tag LOCUS_05630 gene thiE 588146 587517 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF6 protein_id gnl|my_center|LOCUS_05630 588599 588219 gene locus_tag LOCUS_05640 588599 588219 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207325.1 protein_id gnl|my_center|LOCUS_05640 588917 590398 gene locus_tag LOCUS_05650 gene ygiF 588917 590398 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 protein_id gnl|my_center|LOCUS_05650 591098 590466 gene locus_tag LOCUS_05660 591098 590466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_05660 591207 591602 gene locus_tag LOCUS_05670 591207 591602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 protein_id gnl|my_center|LOCUS_05670 591716 592786 gene locus_tag LOCUS_05680 591716 592786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 595648 592877 gene locus_tag LOCUS_05690 595648 592877 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039220.1 protein_id gnl|my_center|LOCUS_05690 597193 595802 gene locus_tag LOCUS_05700 gene ydjN 597193 595802 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207331.1 protein_id gnl|my_center|LOCUS_05700 598546 597719 gene locus_tag LOCUS_05710 598546 597719 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207330.1 protein_id gnl|my_center|LOCUS_05710 598628 599221 gene locus_tag LOCUS_05720 598628 599221 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267649.1 protein_id gnl|my_center|LOCUS_05720 600531 599275 gene locus_tag LOCUS_05730 gene icd 600531 599275 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKG9 protein_id gnl|my_center|LOCUS_05730 600723 601547 gene locus_tag LOCUS_05740 gene rluE 600723 601547 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH0 protein_id gnl|my_center|LOCUS_05740 601881 602897 gene locus_tag LOCUS_05750 601881 602897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 605359 603122 gene locus_tag LOCUS_05760 gene icd2 605359 603122 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_05760 607579 605876 gene locus_tag LOCUS_05770 607579 605876 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207339.1 protein_id gnl|my_center|LOCUS_05770 607760 609073 gene locus_tag LOCUS_05780 gene dacD 607760 609073 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207340.1 protein_id gnl|my_center|LOCUS_05780 609189 610460 gene locus_tag LOCUS_05790 gene ndh 609189 610460 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207341.1 protein_id gnl|my_center|LOCUS_05790 610599 611081 gene locus_tag LOCUS_05800 gene slyD 610599 611081 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_05800 611219 612673 gene locus_tag LOCUS_05810 gene phrB 611219 612673 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207343.1 protein_id gnl|my_center|LOCUS_05810 613146 614528 gene locus_tag LOCUS_05820 gene sahH 613146 614528 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ86 protein_id gnl|my_center|LOCUS_05820 614610 615446 gene locus_tag LOCUS_05830 gene metF 614610 615446 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ87 protein_id gnl|my_center|LOCUS_05830 615487 616206 gene locus_tag LOCUS_05840 615487 616206 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_05840 616561 618831 gene locus_tag LOCUS_05850 gene maeB 616561 618831 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_05850 618917 620164 gene locus_tag LOCUS_05860 gene cca 618917 620164 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ91 protein_id gnl|my_center|LOCUS_05860 621398 620217 gene locus_tag LOCUS_05870 gene algW 621398 620217 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 protein_id gnl|my_center|LOCUS_05870 621569 622327 gene locus_tag LOCUS_05880 621569 622327 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ93 protein_id gnl|my_center|LOCUS_05880 622477 623103 gene locus_tag LOCUS_05890 gene sodB 622477 623103 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_05890 623249 623324 gene locus_tag LOCUS_t00050 623249 623324 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 753 208 gene locus_tag LOCUS_05900 753 208 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 protein_id gnl|my_center|LOCUS_05900 1855 989 gene locus_tag LOCUS_05910 1855 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2839 2147 gene locus_tag LOCUS_05920 2839 2147 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_05920 3375 4853 gene locus_tag LOCUS_05930 3375 4853 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL7 protein_id gnl|my_center|LOCUS_05930 5080 5889 gene locus_tag LOCUS_05940 gene zupT 5080 5889 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z6 protein_id gnl|my_center|LOCUS_05940 7220 5913 gene locus_tag LOCUS_05950 gene sun 7220 5913 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL5 protein_id gnl|my_center|LOCUS_05950 8179 7217 gene locus_tag LOCUS_05960 gene fmt 8179 7217 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL4 protein_id gnl|my_center|LOCUS_05960 8495 10180 gene locus_tag LOCUS_05970 gene ilvD 8495 10180 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F219 protein_id gnl|my_center|LOCUS_05970 10255 11559 gene locus_tag LOCUS_05980 10255 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208012.1 protein_id gnl|my_center|LOCUS_05980 12370 11624 gene locus_tag LOCUS_05990 12370 11624 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_05990 12555 13298 gene locus_tag LOCUS_06000 12555 13298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 protein_id gnl|my_center|LOCUS_06000 14200 13295 gene locus_tag LOCUS_06010 gene gltC 14200 13295 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208010.1 protein_id gnl|my_center|LOCUS_06010 15584 14289 gene locus_tag LOCUS_06020 gene ycdG 15584 14289 CDS product pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 protein_id gnl|my_center|LOCUS_06020 15596 15772 gene locus_tag LOCUS_06030 15596 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 18632 15948 gene locus_tag LOCUS_06040 gene ppc 18632 15948 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 protein_id gnl|my_center|LOCUS_06040 19416 18784 gene locus_tag LOCUS_06050 19416 18784 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119184.1 protein_id gnl|my_center|LOCUS_06050 19562 20668 gene locus_tag LOCUS_06060 gene mdtA 19562 20668 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 protein_id gnl|my_center|LOCUS_06060 20665 23793 gene locus_tag LOCUS_06070 gene nolG 20665 23793 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_06070 23938 24315 gene locus_tag LOCUS_06080 23938 24315 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119294.1 protein_id gnl|my_center|LOCUS_06080 24419 25531 gene locus_tag LOCUS_06090 gene dnaJ 24419 25531 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI50 protein_id gnl|my_center|LOCUS_06090 26002 25643 gene locus_tag LOCUS_06100 26002 25643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 26299 27120 gene locus_tag LOCUS_06110 gene dapB 26299 27120 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_06110 27221 27841 gene locus_tag LOCUS_06120 27221 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066572.1 protein_id gnl|my_center|LOCUS_06120 29048 27882 gene locus_tag LOCUS_06130 gene ydhP 29048 27882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066574.1 protein_id gnl|my_center|LOCUS_06130 29858 29055 gene locus_tag LOCUS_06140 29858 29055 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811193.1 protein_id gnl|my_center|LOCUS_06140 29969 30877 gene locus_tag LOCUS_06150 gene yafC 29969 30877 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208002.1 protein_id gnl|my_center|LOCUS_06150 31230 30856 gene locus_tag LOCUS_06160 31230 30856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 31320 32747 gene locus_tag LOCUS_06170 gene ydcR 31320 32747 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 protein_id gnl|my_center|LOCUS_06170 33772 32744 gene locus_tag LOCUS_06180 gene yjgB 33772 32744 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_06180 34362 33769 gene locus_tag LOCUS_06190 gene tag 34362 33769 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066585.1 protein_id gnl|my_center|LOCUS_06190 34642 34397 gene locus_tag LOCUS_06200 34642 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066589.1 protein_id gnl|my_center|LOCUS_06200 35188 34652 gene locus_tag LOCUS_06210 gene lytH 35188 34652 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207998.1 protein_id gnl|my_center|LOCUS_06210 36286 35240 gene locus_tag LOCUS_06220 gene mutY 36286 35240 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 protein_id gnl|my_center|LOCUS_06220 36847 36482 gene locus_tag LOCUS_06230 gene mg132 36847 36482 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207996.1 protein_id gnl|my_center|LOCUS_06230 37667 36933 gene locus_tag LOCUS_06240 37667 36933 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_06240 38005 37847 gene locus_tag LOCUS_06250 38005 37847 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI32 protein_id gnl|my_center|LOCUS_06250 38195 38647 gene locus_tag LOCUS_06260 38195 38647 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_06260 39311 38694 gene locus_tag LOCUS_06270 39311 38694 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_06270 39384 39788 gene locus_tag LOCUS_06280 39384 39788 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206102.1 protein_id gnl|my_center|LOCUS_06280 39919 41091 gene locus_tag LOCUS_06290 gene yliI 39919 41091 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207995.1 protein_id gnl|my_center|LOCUS_06290 41235 42506 gene locus_tag LOCUS_06300 gene rarA 41235 42506 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_06300 43036 43272 gene locus_tag LOCUS_06310 43036 43272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 43630 45201 gene locus_tag LOCUS_06320 43630 45201 CDS product histidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206642.1 protein_id gnl|my_center|LOCUS_06320 46041 45322 gene locus_tag LOCUS_06330 gene purC 46041 45322 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_06330 46686 46078 gene locus_tag LOCUS_06340 46686 46078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207991.1 protein_id gnl|my_center|LOCUS_06340 47596 46700 gene locus_tag LOCUS_06350 gene dapA 47596 46700 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_06350 48297 49499 gene locus_tag LOCUS_06360 48297 49499 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_308435.2 protein_id gnl|my_center|LOCUS_06360 49645 50289 gene locus_tag LOCUS_06370 gene pncA 49645 50289 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207990.1 protein_id gnl|my_center|LOCUS_06370 50408 50674 gene locus_tag LOCUS_06380 50408 50674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06380 50622 51368 gene locus_tag LOCUS_06390 50622 51368 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 53144 51771 gene locus_tag LOCUS_06400 gene ydcR 53144 51771 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207005.1 protein_id gnl|my_center|LOCUS_06400 53296 54204 gene locus_tag LOCUS_06410 53296 54204 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970748.1 protein_id gnl|my_center|LOCUS_06410 56118 54280 gene locus_tag LOCUS_06420 gene glmS 56118 54280 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ8 protein_id gnl|my_center|LOCUS_06420 57494 56130 gene locus_tag LOCUS_06430 gene glmU 57494 56130 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_06430 58022 57516 gene locus_tag LOCUS_06440 gene pgpA 58022 57516 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ6 protein_id gnl|my_center|LOCUS_06440 58932 58015 gene locus_tag LOCUS_06450 gene thiL 58932 58015 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_06450 59394 58945 gene locus_tag LOCUS_06460 gene nusB 59394 58945 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ4 protein_id gnl|my_center|LOCUS_06460 59868 59398 gene locus_tag LOCUS_06470 gene ribH 59868 59398 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ3 protein_id gnl|my_center|LOCUS_06470 61001 59880 gene locus_tag LOCUS_06480 gene ribB 61001 59880 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_06480 62423 61284 gene locus_tag LOCUS_06490 62423 61284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207968.1 protein_id gnl|my_center|LOCUS_06490 62690 63847 gene locus_tag LOCUS_06500 gene serB 62690 63847 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207967.1 protein_id gnl|my_center|LOCUS_06500 64259 64594 gene locus_tag LOCUS_06510 64259 64594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119105.1 protein_id gnl|my_center|LOCUS_06510 64747 65226 gene locus_tag LOCUS_06520 64747 65226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119134.1 protein_id gnl|my_center|LOCUS_06520 65717 65277 gene locus_tag LOCUS_06530 gene dtd 65717 65277 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY7 protein_id gnl|my_center|LOCUS_06530 65924 67444 gene locus_tag LOCUS_06540 65924 67444 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JE8 protein_id gnl|my_center|LOCUS_06540 67643 68068 gene locus_tag LOCUS_06550 67643 68068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 68241 69449 gene locus_tag LOCUS_06560 gene pncB 68241 69449 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYM9 protein_id gnl|my_center|LOCUS_06560 69561 70409 gene locus_tag LOCUS_06570 gene rhdA 69561 70409 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY5 protein_id gnl|my_center|LOCUS_06570 70406 71257 gene locus_tag LOCUS_06580 gene psd 70406 71257 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_06580 72662 71304 gene locus_tag LOCUS_06590 gene phoR 72662 71304 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121907.1 protein_id gnl|my_center|LOCUS_06590 73382 72672 gene locus_tag LOCUS_06600 gene phoB 73382 72672 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_06600 74298 73621 gene locus_tag LOCUS_06610 74298 73621 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_06610 74497 75348 gene locus_tag LOCUS_06620 gene ephD 74497 75348 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_06620 76802 75435 gene locus_tag LOCUS_06630 gene ypnP 76802 75435 CDS product multidrug resistance protein, MATE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804387.1 protein_id gnl|my_center|LOCUS_06630 78074 76920 gene locus_tag LOCUS_06640 gene ybdL 78074 76920 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207957.1 protein_id gnl|my_center|LOCUS_06640 79408 78107 gene locus_tag LOCUS_06650 79408 78107 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066720.1 protein_id gnl|my_center|LOCUS_06650 80007 79441 gene locus_tag LOCUS_06660 80007 79441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122008.1 protein_id gnl|my_center|LOCUS_06660 80599 80060 gene locus_tag LOCUS_06670 80599 80060 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_06670 80806 82383 gene locus_tag LOCUS_06680 gene gshA 80806 82383 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG2 protein_id gnl|my_center|LOCUS_06680 82407 82931 gene locus_tag LOCUS_06690 gene dsbB 82407 82931 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_06690 84399 83068 gene locus_tag LOCUS_06700 84399 83068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121854.1 protein_id gnl|my_center|LOCUS_06700 84624 85211 gene locus_tag LOCUS_06710 gene yqiA 84624 85211 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207947.1 protein_id gnl|my_center|LOCUS_06710 85227 87107 gene locus_tag LOCUS_06720 gene parE 85227 87107 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF2 protein_id gnl|my_center|LOCUS_06720 87946 87209 gene locus_tag LOCUS_06730 gene tsx 87946 87209 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_06730 88579 88992 gene locus_tag LOCUS_06740 88579 88992 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985299.1 protein_id gnl|my_center|LOCUS_06740 89111 89653 gene locus_tag LOCUS_06750 89111 89653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066773.1 protein_id gnl|my_center|LOCUS_06750 89668 90435 gene locus_tag LOCUS_06760 89668 90435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207941.1 protein_id gnl|my_center|LOCUS_06760 91506 90595 gene locus_tag LOCUS_06770 gene est 91506 90595 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_06770 91666 92103 gene locus_tag LOCUS_06780 91666 92103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_06780 92489 92169 gene locus_tag LOCUS_06790 gene yffB 92489 92169 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_06790 93794 92973 gene locus_tag LOCUS_06800 gene crc 93794 92973 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 protein_id gnl|my_center|LOCUS_06800 93834 94484 gene locus_tag LOCUS_06810 gene pyrE 93834 94484 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_06810 94794 95738 gene locus_tag LOCUS_06820 gene gshB 94794 95738 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_06820 96971 95775 gene locus_tag LOCUS_06830 96971 95775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895662.1 protein_id gnl|my_center|LOCUS_06830 97381 98478 gene locus_tag LOCUS_06840 gene murG 97381 98478 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC8 protein_id gnl|my_center|LOCUS_06840 98492 99940 gene locus_tag LOCUS_06850 gene murC 98492 99940 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_06850 99993 100928 gene locus_tag LOCUS_06860 gene ddlB 99993 100928 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_06860 100932 101789 gene locus_tag LOCUS_06870 gene ftsQ 100932 101789 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC5 protein_id gnl|my_center|LOCUS_06870 101857 103119 gene locus_tag LOCUS_06880 gene ftsA 101857 103119 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC4 protein_id gnl|my_center|LOCUS_06880 103282 104469 gene locus_tag LOCUS_06890 gene ftsZ 103282 104469 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC3 protein_id gnl|my_center|LOCUS_06890 104600 105502 gene locus_tag LOCUS_06900 gene lpxC 104600 105502 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC2 protein_id gnl|my_center|LOCUS_06900 106056 105601 gene locus_tag LOCUS_06910 106056 105601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121887.1 protein_id gnl|my_center|LOCUS_06910 106148 106834 gene locus_tag LOCUS_06920 gene yebA 106148 106834 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121983.1 protein_id gnl|my_center|LOCUS_06920 107042 109759 gene locus_tag LOCUS_06930 gene aceE 107042 109759 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB9 protein_id gnl|my_center|LOCUS_06930 109765 111804 gene locus_tag LOCUS_06940 gene aceF 109765 111804 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB8 protein_id gnl|my_center|LOCUS_06940 112137 112757 gene locus_tag LOCUS_06950 112137 112757 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_06950 112937 113734 gene locus_tag LOCUS_06960 112937 113734 CDS product CDP-abequose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 protein_id gnl|my_center|LOCUS_06960 113827 114189 gene locus_tag LOCUS_06970 113827 114189 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114955.1 protein_id gnl|my_center|LOCUS_06970 114363 115829 gene locus_tag LOCUS_06980 gene guaB 114363 115829 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB3 protein_id gnl|my_center|LOCUS_06980 115970 117316 gene locus_tag LOCUS_06990 gene glmM 115970 117316 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB2 protein_id gnl|my_center|LOCUS_06990 117320 117973 gene locus_tag LOCUS_07000 gene pdxH 117320 117973 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB1 protein_id gnl|my_center|LOCUS_07000 117974 119686 gene locus_tag LOCUS_07010 gene recJ 117974 119686 CDS product ssDNA exonuclease, 5'--> 3' specific, Mg dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_004997053.1 protein_id gnl|my_center|LOCUS_07010 120614 119829 gene locus_tag LOCUS_07020 120614 119829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 protein_id gnl|my_center|LOCUS_07020 121047 120919 gene locus_tag LOCUS_07030 121047 120919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 121216 122271 gene locus_tag LOCUS_07040 gene prfB 121216 122271 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA8 protein_id gnl|my_center|LOCUS_07040 122889 122344 gene locus_tag LOCUS_07050 gene dedA 122889 122344 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_07050 123632 123195 gene locus_tag LOCUS_07060 123632 123195 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207602.1 protein_id gnl|my_center|LOCUS_07060 123940 124245 gene locus_tag LOCUS_07070 123940 124245 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121891.1 protein_id gnl|my_center|LOCUS_07070 124288 125343 gene locus_tag LOCUS_07080 gene nemA 124288 125343 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207922.1 protein_id gnl|my_center|LOCUS_07080 125431 126708 gene locus_tag LOCUS_07090 gene kdtA 125431 126708 CDS product 3-deoxy-D-manno-2-octulosonate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207921.1 protein_id gnl|my_center|LOCUS_07090 126721 127434 gene locus_tag LOCUS_07100 126721 127434 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA4 protein_id gnl|my_center|LOCUS_07100 128400 127408 gene locus_tag LOCUS_07110 128400 127408 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_07110 129062 128499 gene locus_tag LOCUS_07120 129062 128499 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066837.1 protein_id gnl|my_center|LOCUS_07120 129362 131308 gene locus_tag LOCUS_07130 gene acsA2 129362 131308 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207919.1 protein_id gnl|my_center|LOCUS_07130 131427 132611 gene locus_tag LOCUS_07140 131427 132611 CDS product FMNH2-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_07140 133909 132800 gene locus_tag LOCUS_07150 gene ssuD 133909 132800 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207915.1 protein_id gnl|my_center|LOCUS_07150 134667 133930 gene locus_tag LOCUS_07160 gene msuE 134667 133930 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207914.1 protein_id gnl|my_center|LOCUS_07160 135035 135685 gene locus_tag LOCUS_07170 gene agmR 135035 135685 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_07170 136513 135746 gene locus_tag LOCUS_07180 136513 135746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207913.1 protein_id gnl|my_center|LOCUS_07180 140416 136910 gene locus_tag LOCUS_07190 gene luxQ 140416 136910 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207912.1 protein_id gnl|my_center|LOCUS_07190 140600 140944 gene locus_tag LOCUS_07200 140600 140944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 protein_id gnl|my_center|LOCUS_07200 140946 142661 gene locus_tag LOCUS_07210 140946 142661 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 protein_id gnl|my_center|LOCUS_07210 143750 142710 gene locus_tag LOCUS_07220 143750 142710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 144036 143845 gene locus_tag LOCUS_07230 144036 143845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 144075 144791 gene locus_tag LOCUS_07240 144075 144791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_07240 144957 146924 gene locus_tag LOCUS_07250 gene betT 144957 146924 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207909.1 protein_id gnl|my_center|LOCUS_07250 147911 146985 gene locus_tag LOCUS_07260 147911 146985 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207908.1 protein_id gnl|my_center|LOCUS_07260 149299 150996 gene locus_tag LOCUS_07270 gene pleD 149299 150996 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207907.1 protein_id gnl|my_center|LOCUS_07270 154076 151245 gene locus_tag LOCUS_07280 gene uvrA 154076 151245 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGS6 protein_id gnl|my_center|LOCUS_07280 154858 154184 gene locus_tag LOCUS_07290 gene thiED 154858 154184 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGR9 protein_id gnl|my_center|LOCUS_07290 155198 156181 gene locus_tag LOCUS_07300 155198 156181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_07300 156406 156197 gene locus_tag LOCUS_07310 156406 156197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 156330 157694 gene locus_tag LOCUS_07320 gene yajR 156330 157694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_07320 157746 158330 gene locus_tag LOCUS_07330 gene ssb 157746 158330 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGR6 protein_id gnl|my_center|LOCUS_07330 159342 158476 gene locus_tag LOCUS_07340 gene yhxC 159342 158476 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432004.1 protein_id gnl|my_center|LOCUS_07340 159745 159419 gene locus_tag LOCUS_07350 159745 159419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132045.1 protein_id gnl|my_center|LOCUS_07350 160669 160022 gene locus_tag LOCUS_07360 160669 160022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 163106 160983 gene locus_tag LOCUS_07370 gene katE 163106 160983 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206461.1 protein_id gnl|my_center|LOCUS_07370 163629 163159 gene locus_tag LOCUS_07380 163629 163159 CDS product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206459.1 protein_id gnl|my_center|LOCUS_07380 164290 165708 gene locus_tag LOCUS_07390 164290 165708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206460.1 protein_id gnl|my_center|LOCUS_07390 166137 167435 gene locus_tag LOCUS_07400 166137 167435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 protein_id gnl|my_center|LOCUS_07400 167442 168278 gene locus_tag LOCUS_07410 gene chiG 167442 168278 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207892.1 protein_id gnl|my_center|LOCUS_07410 168381 168306 gene locus_tag LOCUS_t00060 168381 168306 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 169577 168519 gene locus_tag LOCUS_07420 gene aspQ 169577 168519 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206524.1 protein_id gnl|my_center|LOCUS_07420 170140 170051 gene locus_tag LOCUS_t00070 170140 170051 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 170261 172138 gene locus_tag LOCUS_07430 gene trkD 170261 172138 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGN4 protein_id gnl|my_center|LOCUS_07430 172299 173372 gene locus_tag LOCUS_07440 172299 173372 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207873.1 protein_id gnl|my_center|LOCUS_07440 173431 173685 gene locus_tag LOCUS_07450 173431 173685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207871.1 protein_id gnl|my_center|LOCUS_07450 174732 173725 gene locus_tag LOCUS_07460 174732 173725 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_07460 174847 175491 gene locus_tag LOCUS_07470 174847 175491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_07470 176573 175815 gene locus_tag LOCUS_07480 gene hisF 176573 175815 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_07480 176686 177636 gene locus_tag LOCUS_07490 gene thrB 176686 177636 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_07490 177642 178262 gene locus_tag LOCUS_07500 177642 178262 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207865.1 protein_id gnl|my_center|LOCUS_07500 178294 178689 gene locus_tag LOCUS_07510 178294 178689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 protein_id gnl|my_center|LOCUS_07510 179666 178719 gene locus_tag LOCUS_07520 179666 178719 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 protein_id gnl|my_center|LOCUS_07520 180624 179884 gene locus_tag LOCUS_07530 gene hisA 180624 179884 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_07530 181703 181047 gene locus_tag LOCUS_07540 gene wrn 181703 181047 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_07540 182310 181777 gene locus_tag LOCUS_07550 182310 181777 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067011.1 protein_id gnl|my_center|LOCUS_07550 183096 182479 gene locus_tag LOCUS_07560 gene hisH 183096 182479 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_07560 183689 183096 gene locus_tag LOCUS_07570 gene hisB 183689 183096 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL4 protein_id gnl|my_center|LOCUS_07570 183794 184171 gene locus_tag LOCUS_07580 183794 184171 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116928.1 protein_id gnl|my_center|LOCUS_07580 184338 184413 gene locus_tag LOCUS_t00080 184338 184413 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 184537 184612 gene locus_tag LOCUS_t00090 184537 184612 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 184818 185324 gene locus_tag LOCUS_07590 184818 185324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 186910 185396 gene locus_tag LOCUS_07600 gene cat1 186910 185396 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 protein_id gnl|my_center|LOCUS_07600 188570 187113 gene locus_tag LOCUS_07610 gene envZ 188570 187113 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_07610 189545 188781 gene locus_tag LOCUS_07620 gene ompR 189545 188781 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_07620 189882 192239 gene locus_tag LOCUS_07630 gene tex 189882 192239 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116875.1 protein_id gnl|my_center|LOCUS_07630 192324 194300 gene locus_tag LOCUS_07640 192324 194300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_07640 194460 196706 gene locus_tag LOCUS_07650 gene ychM 194460 196706 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067022.1 protein_id gnl|my_center|LOCUS_07650 197653 196766 gene locus_tag LOCUS_07660 197653 196766 CDS product fatty acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_07660 199341 198064 gene locus_tag LOCUS_07670 gene metY 199341 198064 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_07670 199626 201287 gene locus_tag LOCUS_07680 gene yjjK 199626 201287 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207852.1 protein_id gnl|my_center|LOCUS_07680 201520 202446 gene locus_tag LOCUS_07690 gene czcD 201520 202446 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207843.1 protein_id gnl|my_center|LOCUS_07690 202798 202460 gene locus_tag LOCUS_07700 202798 202460 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078496.1 protein_id gnl|my_center|LOCUS_07700 202980 202905 gene locus_tag LOCUS_t00100 202980 202905 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 203089 203014 gene locus_tag LOCUS_t00110 203089 203014 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 204657 203146 gene locus_tag LOCUS_07710 gene gltX 204657 203146 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 protein_id gnl|my_center|LOCUS_07710 205112 204771 gene locus_tag LOCUS_07720 205112 204771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116889.1 protein_id gnl|my_center|LOCUS_07720 205568 206584 gene locus_tag LOCUS_07730 gene sbp 205568 206584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207839.1 protein_id gnl|my_center|LOCUS_07730 206786 207697 gene locus_tag LOCUS_07740 gene mraW 206786 207697 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG25 protein_id gnl|my_center|LOCUS_07740 207709 208056 gene locus_tag LOCUS_07750 gene ftsL 207709 208056 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG24 protein_id gnl|my_center|LOCUS_07750 208067 209890 gene locus_tag LOCUS_07760 gene ftsI 208067 209890 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_07760 209903 211402 gene locus_tag LOCUS_07770 gene murE 209903 211402 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG22 protein_id gnl|my_center|LOCUS_07770 211411 212817 gene locus_tag LOCUS_07780 gene murF 211411 212817 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG21 protein_id gnl|my_center|LOCUS_07780 212817 213935 gene locus_tag LOCUS_07790 gene mraY 212817 213935 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG20 protein_id gnl|my_center|LOCUS_07790 214002 214808 gene locus_tag LOCUS_07800 gene rrmA 214002 214808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_07800 217326 214855 gene locus_tag LOCUS_07810 gene ponA 217326 214855 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 protein_id gnl|my_center|LOCUS_07810 217563 218621 gene locus_tag LOCUS_07820 gene pilM 217563 218621 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804529.1 protein_id gnl|my_center|LOCUS_07820 218621 219280 gene locus_tag LOCUS_07830 gene pilN 218621 219280 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_07830 219277 219987 gene locus_tag LOCUS_07840 gene pilO 219277 219987 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_07840 219984 220511 gene locus_tag LOCUS_07850 gene pilP 219984 220511 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_07850 220529 222709 gene locus_tag LOCUS_07860 gene pilQ 220529 222709 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_07860 222746 223297 gene locus_tag LOCUS_07870 gene aroK 222746 223297 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG11 protein_id gnl|my_center|LOCUS_07870 223316 224401 gene locus_tag LOCUS_07880 gene aroB 223316 224401 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG10 protein_id gnl|my_center|LOCUS_07880 224409 225272 gene locus_tag LOCUS_07890 224409 225272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207827.1 protein_id gnl|my_center|LOCUS_07890 225735 230210 gene locus_tag LOCUS_07900 gene gltB 225735 230210 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207826.1 protein_id gnl|my_center|LOCUS_07900 230283 231704 gene locus_tag LOCUS_07910 gene gltD 230283 231704 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_07910 232074 232940 gene locus_tag LOCUS_07920 232074 232940 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207824.1 protein_id gnl|my_center|LOCUS_07920 233161 233751 gene locus_tag LOCUS_07930 233161 233751 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117090.1 protein_id gnl|my_center|LOCUS_07930 233773 234837 gene locus_tag LOCUS_07940 233773 234837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207823.1 protein_id gnl|my_center|LOCUS_07940 234831 235391 gene locus_tag LOCUS_07950 234831 235391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207822.1 protein_id gnl|my_center|LOCUS_07950 235592 236062 gene locus_tag LOCUS_07960 gene pilE 235592 236062 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_07960 236620 236156 gene locus_tag LOCUS_07970 gene bfrB 236620 236156 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ9 protein_id gnl|my_center|LOCUS_07970 237136 236927 gene locus_tag LOCUS_07980 gene bfd 237136 236927 CDS product regulatory or redox protein complexing with Bfr in iron storage and mobility inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000629.1 protein_id gnl|my_center|LOCUS_07980 237719 237336 gene locus_tag LOCUS_07990 237719 237336 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_07990 239907 237808 gene locus_tag LOCUS_08000 gene spoT 239907 237808 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_08000 240393 240112 gene locus_tag LOCUS_08010 gene rpoZ 240393 240112 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ3 protein_id gnl|my_center|LOCUS_08010 241093 240470 gene locus_tag LOCUS_08020 gene gmk 241093 240470 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ2 protein_id gnl|my_center|LOCUS_08020 241227 242177 gene locus_tag LOCUS_08030 gene ispH 241227 242177 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_08030 242330 242788 gene locus_tag LOCUS_08040 gene fimT 242330 242788 CDS product pre-pilin like leader sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 protein_id gnl|my_center|LOCUS_08040 242785 243282 gene locus_tag LOCUS_08050 242785 243282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 243285 244277 gene locus_tag LOCUS_08060 gene comB 243285 244277 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 protein_id gnl|my_center|LOCUS_08060 244274 245044 gene locus_tag LOCUS_08070 gene pilX 244274 245044 CDS product type IV fimbrial biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207812.1 protein_id gnl|my_center|LOCUS_08070 245045 248881 gene locus_tag LOCUS_08080 gene comC 245045 248881 CDS product pilus assembly protein PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207811.1 protein_id gnl|my_center|LOCUS_08080 248892 249377 gene locus_tag LOCUS_08090 gene comE 248892 249377 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207810.1 protein_id gnl|my_center|LOCUS_08090 249371 249832 gene locus_tag LOCUS_08100 gene pilE 249371 249832 CDS product pilus assembly protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_08100 249976 250233 gene locus_tag LOCUS_08110 gene rpsP 249976 250233 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY3 protein_id gnl|my_center|LOCUS_08110 250254 250802 gene locus_tag LOCUS_08120 gene rimM 250254 250802 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_08120 250846 251595 gene locus_tag LOCUS_08130 gene trmD 250846 251595 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY1 protein_id gnl|my_center|LOCUS_08130 251770 252144 gene locus_tag LOCUS_08140 gene rplS 251770 252144 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY0 protein_id gnl|my_center|LOCUS_08140 253175 252204 gene locus_tag LOCUS_08150 gene lip 253175 252204 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_08150 254263 253277 gene locus_tag LOCUS_08160 gene lip 254263 253277 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 protein_id gnl|my_center|LOCUS_08160 255725 254697 gene locus_tag LOCUS_08170 gene lifO 255725 254697 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX8 protein_id gnl|my_center|LOCUS_08170 255875 256780 gene locus_tag LOCUS_08180 gene truB 255875 256780 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX7 protein_id gnl|my_center|LOCUS_08180 256818 257594 gene locus_tag LOCUS_08190 256818 257594 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX6 protein_id gnl|my_center|LOCUS_08190 257787 258242 gene locus_tag LOCUS_08200 257787 258242 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_08200 259126 258290 gene locus_tag LOCUS_08210 259126 258290 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207805.1 protein_id gnl|my_center|LOCUS_08210 259125 259250 gene locus_tag LOCUS_08220 259125 259250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 260172 259267 gene locus_tag LOCUS_08230 260172 259267 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207804.1 protein_id gnl|my_center|LOCUS_08230 261513 260281 gene locus_tag LOCUS_08240 gene serA 261513 260281 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_08240 261914 263323 gene locus_tag LOCUS_08250 261914 263323 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_08250 263402 263767 gene locus_tag LOCUS_08260 263402 263767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207801.1 protein_id gnl|my_center|LOCUS_08260 264176 265405 gene locus_tag LOCUS_08270 gene cmr 264176 265405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 protein_id gnl|my_center|LOCUS_08270 266026 265478 gene locus_tag LOCUS_08280 gene sodC 266026 265478 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF9 protein_id gnl|my_center|LOCUS_08280 267254 266136 gene locus_tag LOCUS_08290 267254 266136 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_08290 268026 267382 gene locus_tag LOCUS_08300 gene parA 268026 267382 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 protein_id gnl|my_center|LOCUS_08300 268150 268620 gene locus_tag LOCUS_08310 268150 268620 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116954.1 protein_id gnl|my_center|LOCUS_08310 268764 269324 gene locus_tag LOCUS_08320 268764 269324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 protein_id gnl|my_center|LOCUS_08320 270045 269464 gene locus_tag LOCUS_08330 270045 269464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067173.1 protein_id gnl|my_center|LOCUS_08330 270862 270080 gene locus_tag LOCUS_08340 270862 270080 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207793.1 protein_id gnl|my_center|LOCUS_08340 270988 272256 gene locus_tag LOCUS_08350 270988 272256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207792.1 protein_id gnl|my_center|LOCUS_08350 272458 272676 gene locus_tag LOCUS_08360 272458 272676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 272773 273726 gene locus_tag LOCUS_08370 gene hprA 272773 273726 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_08370 274361 273876 gene locus_tag LOCUS_08380 274361 273876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 274970 274581 gene locus_tag LOCUS_08390 274970 274581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207782.1 protein_id gnl|my_center|LOCUS_08390 275168 275971 gene locus_tag LOCUS_08400 275168 275971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948273.1 protein_id gnl|my_center|LOCUS_08400 278066 275997 gene locus_tag LOCUS_08410 gene glyS 278066 275997 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD5 protein_id gnl|my_center|LOCUS_08410 279055 278066 gene locus_tag LOCUS_08420 gene glyQ 279055 278066 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD4 protein_id gnl|my_center|LOCUS_08420 279775 279317 gene locus_tag LOCUS_08430 279775 279317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 279984 281090 gene locus_tag LOCUS_08440 279984 281090 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 protein_id gnl|my_center|LOCUS_08440 281441 281172 gene locus_tag LOCUS_08450 gene pspC 281441 281172 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207771.1 protein_id gnl|my_center|LOCUS_08450 281852 282454 gene locus_tag LOCUS_08460 281852 282454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207770.1 protein_id gnl|my_center|LOCUS_08460 284371 282548 gene locus_tag LOCUS_08470 gene mmgC 284371 282548 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_08470 284615 287005 gene locus_tag LOCUS_08480 284615 287005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207769.1 protein_id gnl|my_center|LOCUS_08480 287850 287059 gene locus_tag LOCUS_08490 gene aroE 287850 287059 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC4 protein_id gnl|my_center|LOCUS_08490 288180 287974 gene locus_tag LOCUS_08500 288180 287974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 289461 288520 gene locus_tag LOCUS_08510 gene hemF 289461 288520 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC3 protein_id gnl|my_center|LOCUS_08510 290198 289596 gene locus_tag LOCUS_08520 gene ribA 290198 289596 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC2 protein_id gnl|my_center|LOCUS_08520 290501 292414 gene locus_tag LOCUS_08530 gene dxs 290501 292414 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC1 protein_id gnl|my_center|LOCUS_08530 292532 293362 gene locus_tag LOCUS_08540 gene suhB 292532 293362 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207766.1 protein_id gnl|my_center|LOCUS_08540 293887 295755 gene locus_tag LOCUS_08550 gene deaD 293887 295755 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 protein_id gnl|my_center|LOCUS_08550 296103 296921 gene locus_tag LOCUS_08560 gene ttg2A 296103 296921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207763.1 protein_id gnl|my_center|LOCUS_08560 296918 297694 gene locus_tag LOCUS_08570 gene ttg2B 296918 297694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117010.1 protein_id gnl|my_center|LOCUS_08570 297694 298356 gene locus_tag LOCUS_08580 gene ttg2C 297694 298356 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207762.1 protein_id gnl|my_center|LOCUS_08580 298374 299012 gene locus_tag LOCUS_08590 gene ttg2D 298374 299012 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_08590 299036 299326 gene locus_tag LOCUS_08600 299036 299326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078357.1 protein_id gnl|my_center|LOCUS_08600 300374 299361 gene locus_tag LOCUS_08610 gene corA 300374 299361 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116978.1 protein_id gnl|my_center|LOCUS_08610 300509 301120 gene locus_tag LOCUS_08620 300509 301120 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFB1 protein_id gnl|my_center|LOCUS_08620 301130 301531 gene locus_tag LOCUS_08630 gene mutT 301130 301531 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207760.1 protein_id gnl|my_center|LOCUS_08630 302082 301528 gene locus_tag LOCUS_08640 gene comF 302082 301528 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207759.1 protein_id gnl|my_center|LOCUS_08640 304195 302150 gene locus_tag LOCUS_08650 gene recG 304195 302150 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA8 protein_id gnl|my_center|LOCUS_08650 304219 305028 gene locus_tag LOCUS_08660 304219 305028 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 protein_id gnl|my_center|LOCUS_08660 307635 305068 gene locus_tag LOCUS_08670 gene plsB 307635 305068 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA5 protein_id gnl|my_center|LOCUS_08670 307925 308797 gene locus_tag LOCUS_08680 gene tesB 307925 308797 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_08680 308941 310188 gene locus_tag LOCUS_08690 gene glt-4 308941 310188 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_08690 311122 310286 gene locus_tag LOCUS_08700 gene engB 311122 310286 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA1 protein_id gnl|my_center|LOCUS_08700 311672 311223 gene locus_tag LOCUS_08710 311672 311223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207752.1 protein_id gnl|my_center|LOCUS_08710 312536 311775 gene locus_tag LOCUS_08720 312536 311775 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207751.1 protein_id gnl|my_center|LOCUS_08720 313996 312803 gene locus_tag LOCUS_08730 gene metC 313996 312803 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207748.1 protein_id gnl|my_center|LOCUS_08730 314158 314886 gene locus_tag LOCUS_08740 gene yfeJ 314158 314886 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116949.1 protein_id gnl|my_center|LOCUS_08740 315144 315455 gene locus_tag LOCUS_08750 gene rpsJ 315144 315455 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF94 protein_id gnl|my_center|LOCUS_08750 315514 316152 gene locus_tag LOCUS_08760 gene rplC 315514 316152 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF93 protein_id gnl|my_center|LOCUS_08760 316164 316766 gene locus_tag LOCUS_08770 gene rplD 316164 316766 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 protein_id gnl|my_center|LOCUS_08770 316763 317083 gene locus_tag LOCUS_08780 gene rplW 316763 317083 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF91 protein_id gnl|my_center|LOCUS_08780 317095 317919 gene locus_tag LOCUS_08790 gene rplB 317095 317919 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF90 protein_id gnl|my_center|LOCUS_08790 317940 318215 gene locus_tag LOCUS_08800 gene rpsS 317940 318215 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF89 protein_id gnl|my_center|LOCUS_08800 318225 318554 gene locus_tag LOCUS_08810 gene rplV 318225 318554 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF88 protein_id gnl|my_center|LOCUS_08810 318556 319308 gene locus_tag LOCUS_08820 gene rpsC 318556 319308 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF87 protein_id gnl|my_center|LOCUS_08820 319312 319725 gene locus_tag LOCUS_08830 gene rplP 319312 319725 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF86 protein_id gnl|my_center|LOCUS_08830 319725 319922 gene locus_tag LOCUS_08840 gene rpmC 319725 319922 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF85 protein_id gnl|my_center|LOCUS_08840 319919 320176 gene locus_tag LOCUS_08850 gene rpsQ 319919 320176 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_08850 320269 320637 gene locus_tag LOCUS_08860 gene rplN 320269 320637 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ22 protein_id gnl|my_center|LOCUS_08860 320647 320967 gene locus_tag LOCUS_08870 gene rplX 320647 320967 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ21 protein_id gnl|my_center|LOCUS_08870 320983 321519 gene locus_tag LOCUS_08880 gene rplE 320983 321519 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ20 protein_id gnl|my_center|LOCUS_08880 321529 321834 gene locus_tag LOCUS_08890 gene rpsN 321529 321834 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ19 protein_id gnl|my_center|LOCUS_08890 321847 322242 gene locus_tag LOCUS_08900 gene rpsH 321847 322242 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ18 protein_id gnl|my_center|LOCUS_08900 322256 322789 gene locus_tag LOCUS_08910 gene rplF 322256 322789 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ17 protein_id gnl|my_center|LOCUS_08910 322804 323154 gene locus_tag LOCUS_08920 gene rplR 322804 323154 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_08920 323157 323654 gene locus_tag LOCUS_08930 gene rpsE 323157 323654 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ15 protein_id gnl|my_center|LOCUS_08930 323661 323837 gene locus_tag LOCUS_08940 gene rpmD 323661 323837 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ14 protein_id gnl|my_center|LOCUS_08940 323841 324281 gene locus_tag LOCUS_08950 gene rplO 323841 324281 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ13 protein_id gnl|my_center|LOCUS_08950 324288 325646 gene locus_tag LOCUS_08960 gene secY 324288 325646 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ12 protein_id gnl|my_center|LOCUS_08960 325890 326246 gene locus_tag LOCUS_08970 gene rpsM 325890 326246 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ10 protein_id gnl|my_center|LOCUS_08970 326266 326652 gene locus_tag LOCUS_08980 gene rpsK 326266 326652 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ09 protein_id gnl|my_center|LOCUS_08980 326665 327288 gene locus_tag LOCUS_08990 gene rpsD 326665 327288 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ08 protein_id gnl|my_center|LOCUS_08990 327306 328313 gene locus_tag LOCUS_09000 gene rpoA 327306 328313 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ07 protein_id gnl|my_center|LOCUS_09000 328332 328709 gene locus_tag LOCUS_09010 gene rplQ 328332 328709 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ06 protein_id gnl|my_center|LOCUS_09010 328890 330380 gene locus_tag LOCUS_09020 gene hapE 328890 330380 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_09020 331606 330434 gene locus_tag LOCUS_09030 gene fadE 331606 330434 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207741.1 protein_id gnl|my_center|LOCUS_09030 331790 332047 gene locus_tag LOCUS_09040 331790 332047 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_09040 332034 332426 gene locus_tag LOCUS_09050 332034 332426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 332905 334020 gene locus_tag LOCUS_09060 332905 334020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_09060 334098 334691 gene locus_tag LOCUS_09070 334098 334691 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207737.1 protein_id gnl|my_center|LOCUS_09070 334850 337129 gene locus_tag LOCUS_09080 334850 337129 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_09080 337627 337196 gene locus_tag LOCUS_09090 337627 337196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207735.1 protein_id gnl|my_center|LOCUS_09090 337852 337637 gene locus_tag LOCUS_09100 337852 337637 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117042.1 protein_id gnl|my_center|LOCUS_09100 339928 337889 gene locus_tag LOCUS_09110 gene prlC 339928 337889 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_09110 342583 340139 gene locus_tag LOCUS_09120 gene rnr 342583 340139 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPZ5 protein_id gnl|my_center|LOCUS_09120 342815 342904 gene locus_tag LOCUS_t00120 342815 342904 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 342919 342995 gene locus_tag LOCUS_t00130 342919 342995 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 343070 343146 gene locus_tag LOCUS_t00140 343070 343146 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 343381 343457 gene locus_tag LOCUS_t00150 343381 343457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 344842 343535 gene locus_tag LOCUS_09130 344842 343535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 344998 345495 gene locus_tag LOCUS_09140 344998 345495 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804627.1 protein_id gnl|my_center|LOCUS_09140 345533 346171 gene locus_tag LOCUS_09150 gene ycgM 345533 346171 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_09150 347487 346243 gene locus_tag LOCUS_09160 347487 346243 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_09160 347600 348193 gene locus_tag LOCUS_09170 347600 348193 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_09170 348807 348232 gene locus_tag LOCUS_09180 gene xpt 348807 348232 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPY5 protein_id gnl|my_center|LOCUS_09180 349613 348900 gene locus_tag LOCUS_09190 349613 348900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_09190 350461 349781 gene locus_tag LOCUS_09200 350461 349781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 protein_id gnl|my_center|LOCUS_09200 350705 351586 gene locus_tag LOCUS_09210 gene tonB 350705 351586 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 protein_id gnl|my_center|LOCUS_09210 352024 351602 gene locus_tag LOCUS_09220 352024 351602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078572.1 protein_id gnl|my_center|LOCUS_09220 352553 352074 gene locus_tag LOCUS_09230 gene ybeY 352553 352074 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPY1 protein_id gnl|my_center|LOCUS_09230 353659 352562 gene locus_tag LOCUS_09240 gene phoL 353659 352562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_09240 355155 353698 gene locus_tag LOCUS_09250 gene miaB 355155 353698 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX9 protein_id gnl|my_center|LOCUS_09250 355426 357411 gene locus_tag LOCUS_09260 gene slt 355426 357411 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_09260 357576 358115 gene locus_tag LOCUS_09270 357576 358115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_09270 358317 359303 gene locus_tag LOCUS_09280 gene mdh 358317 359303 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX6 protein_id gnl|my_center|LOCUS_09280 359466 359729 gene locus_tag LOCUS_09290 359466 359729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_09290 360294 359767 gene locus_tag LOCUS_09300 360294 359767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207718.1 protein_id gnl|my_center|LOCUS_09300 360971 360369 gene locus_tag LOCUS_09310 360971 360369 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207717.1 protein_id gnl|my_center|LOCUS_09310 361088 361945 gene locus_tag LOCUS_09320 gene rlmJ 361088 361945 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX2 protein_id gnl|my_center|LOCUS_09320 361995 362825 gene locus_tag LOCUS_09330 gene pssA 361995 362825 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_09330 362845 363918 gene locus_tag LOCUS_09340 362845 363918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207715.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence03 1110 190 gene locus_tag LOCUS_09350 1110 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2298 1168 gene locus_tag LOCUS_09360 2298 1168 CDS product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658325.1 protein_id gnl|my_center|LOCUS_09360 3104 2322 gene locus_tag LOCUS_09370 3104 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3714 3310 gene locus_tag LOCUS_09380 gene rnk 3714 3310 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_09380 4134 4493 gene locus_tag LOCUS_09390 4134 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206096.1 protein_id gnl|my_center|LOCUS_09390 4812 5237 gene locus_tag LOCUS_09400 4812 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6740 5487 gene locus_tag LOCUS_09410 gene glyA 6740 5487 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_09410 7789 8481 gene locus_tag LOCUS_09420 gene exoX 7789 8481 CDS product DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_09420 8565 9134 gene locus_tag LOCUS_09430 8565 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207238.1 protein_id gnl|my_center|LOCUS_09430 10047 9610 gene locus_tag LOCUS_09440 10047 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10911 10835 gene locus_tag LOCUS_t00160 10911 10835 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11090 12025 gene locus_tag LOCUS_09450 gene yadG 11090 12025 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 protein_id gnl|my_center|LOCUS_09450 12022 12795 gene locus_tag LOCUS_09460 gene yadH 12022 12795 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_09460 12792 13604 gene locus_tag LOCUS_09470 gene queF 12792 13604 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ66 protein_id gnl|my_center|LOCUS_09470 13630 14280 gene locus_tag LOCUS_09480 13630 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_09480 14461 15603 gene locus_tag LOCUS_09490 gene rodA 14461 15603 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_09490 15621 16622 gene locus_tag LOCUS_09500 gene mltB 15621 16622 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207240.1 protein_id gnl|my_center|LOCUS_09500 16909 17520 gene locus_tag LOCUS_09510 16909 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 protein_id gnl|my_center|LOCUS_09510 17791 18243 gene locus_tag LOCUS_09520 17791 18243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_09520 19277 18402 gene locus_tag LOCUS_09530 gene tsf 19277 18402 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ75 protein_id gnl|my_center|LOCUS_09530 20167 19421 gene locus_tag LOCUS_09540 gene rpsB 20167 19421 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ76 protein_id gnl|my_center|LOCUS_09540 20369 21202 gene locus_tag LOCUS_09550 gene map 20369 21202 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ77 protein_id gnl|my_center|LOCUS_09550 21484 22566 gene locus_tag LOCUS_09560 gene ompW 21484 22566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 protein_id gnl|my_center|LOCUS_09560 22754 23968 gene locus_tag LOCUS_09570 22754 23968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207248.1 protein_id gnl|my_center|LOCUS_09570 25663 24248 gene locus_tag LOCUS_09580 gene sthA 25663 24248 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_09580 25869 26882 gene locus_tag LOCUS_09590 gene lipA 25869 26882 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_09590 27113 26949 gene locus_tag LOCUS_09600 27113 26949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113596.1 protein_id gnl|my_center|LOCUS_09600 27626 30028 gene locus_tag LOCUS_09610 gene fadE 27626 30028 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_09610 30332 30075 gene locus_tag LOCUS_09620 30332 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 30635 31846 gene locus_tag LOCUS_09630 30635 31846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 protein_id gnl|my_center|LOCUS_09630 32410 31880 gene locus_tag LOCUS_09640 32410 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 33271 32465 gene locus_tag LOCUS_09650 33271 32465 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_09650 34600 33272 gene locus_tag LOCUS_09660 34600 33272 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_09660 34846 35907 gene locus_tag LOCUS_09670 34846 35907 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207349.1 protein_id gnl|my_center|LOCUS_09670 36938 35964 gene locus_tag LOCUS_09680 gene dusB 36938 35964 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKI7 protein_id gnl|my_center|LOCUS_09680 37680 37498 gene locus_tag LOCUS_09690 37680 37498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 38062 39636 gene locus_tag LOCUS_09700 38062 39636 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_09700 41308 39782 gene locus_tag LOCUS_09710 gene yoaE 41308 39782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 protein_id gnl|my_center|LOCUS_09710 41835 41653 gene locus_tag LOCUS_09720 41835 41653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 43365 42130 gene locus_tag LOCUS_09730 gene fdmA2 43365 42130 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_09730 43606 44790 gene locus_tag LOCUS_09740 43606 44790 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207351.1 protein_id gnl|my_center|LOCUS_09740 44757 45410 gene locus_tag LOCUS_09750 gene cicA 44757 45410 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067866.1 protein_id gnl|my_center|LOCUS_09750 46574 45438 gene locus_tag LOCUS_09760 gene proB 46574 45438 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ0 protein_id gnl|my_center|LOCUS_09760 47797 46589 gene locus_tag LOCUS_09770 gene yhbZ 47797 46589 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ1 protein_id gnl|my_center|LOCUS_09770 48711 48022 gene locus_tag LOCUS_09780 48711 48022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207352.1 protein_id gnl|my_center|LOCUS_09780 49449 48724 gene locus_tag LOCUS_09790 49449 48724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207353.1 protein_id gnl|my_center|LOCUS_09790 51040 49583 gene locus_tag LOCUS_09800 gene gap 51040 49583 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ4 protein_id gnl|my_center|LOCUS_09800 52239 51304 gene locus_tag LOCUS_09810 gene rarD 52239 51304 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207355.1 protein_id gnl|my_center|LOCUS_09810 52955 52371 gene locus_tag LOCUS_09820 gene blc 52955 52371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207356.1 protein_id gnl|my_center|LOCUS_09820 55100 53079 gene locus_tag LOCUS_09830 gene uvrB 55100 53079 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ7 protein_id gnl|my_center|LOCUS_09830 55294 56097 gene locus_tag LOCUS_09840 55294 56097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207357.1 protein_id gnl|my_center|LOCUS_09840 56319 57752 gene locus_tag LOCUS_09850 gene yedQ 56319 57752 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207358.1 protein_id gnl|my_center|LOCUS_09850 57969 57802 gene locus_tag LOCUS_09860 57969 57802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118942.1 protein_id gnl|my_center|LOCUS_09860 58182 59417 gene locus_tag LOCUS_09870 gene aspC 58182 59417 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_09870 59845 59477 gene locus_tag LOCUS_09880 59845 59477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 59954 60391 gene locus_tag LOCUS_09890 59954 60391 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 protein_id gnl|my_center|LOCUS_09890 61029 60571 gene locus_tag LOCUS_09900 61029 60571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207361.1 protein_id gnl|my_center|LOCUS_09900 61268 61343 gene locus_tag LOCUS_t00170 61268 61343 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 62117 61461 gene locus_tag LOCUS_09910 gene miaE 62117 61461 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_09910 62845 62120 gene locus_tag LOCUS_09920 gene pdxJ 62845 62120 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_09920 63569 62859 gene locus_tag LOCUS_09930 gene recO 63569 62859 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK9 protein_id gnl|my_center|LOCUS_09930 63764 63579 gene locus_tag LOCUS_09940 63764 63579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118955.1 protein_id gnl|my_center|LOCUS_09940 64821 63793 gene locus_tag LOCUS_09950 gene era 64821 63793 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL1 protein_id gnl|my_center|LOCUS_09950 65519 64827 gene locus_tag LOCUS_09960 gene rnc 65519 64827 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL2 protein_id gnl|my_center|LOCUS_09960 65865 65500 gene locus_tag LOCUS_09970 65865 65500 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_09970 66714 65887 gene locus_tag LOCUS_09980 gene lepB 66714 65887 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_09980 68553 66736 gene locus_tag LOCUS_09990 gene lepA 68553 66736 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL5 protein_id gnl|my_center|LOCUS_09990 69171 68728 gene locus_tag LOCUS_10000 69171 68728 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_10000 70677 69295 gene locus_tag LOCUS_10010 gene degP 70677 69295 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207372.1 protein_id gnl|my_center|LOCUS_10010 70904 72556 gene locus_tag LOCUS_10020 gene nadB 70904 72556 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL23 protein_id gnl|my_center|LOCUS_10020 73195 72587 gene locus_tag LOCUS_10030 gene tmk 73195 72587 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL25 protein_id gnl|my_center|LOCUS_10030 74248 73205 gene locus_tag LOCUS_10040 74248 73205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 protein_id gnl|my_center|LOCUS_10040 75064 74252 gene locus_tag LOCUS_10050 gene pabC 75064 74252 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 protein_id gnl|my_center|LOCUS_10050 75233 76246 gene locus_tag LOCUS_10060 gene cysP 75233 76246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207376.1 protein_id gnl|my_center|LOCUS_10060 76274 76885 gene locus_tag LOCUS_10070 76274 76885 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118423.1 protein_id gnl|my_center|LOCUS_10070 76972 77805 gene locus_tag LOCUS_10080 gene cysT 76972 77805 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207377.1 protein_id gnl|my_center|LOCUS_10080 77802 78695 gene locus_tag LOCUS_10090 gene cysW 77802 78695 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 protein_id gnl|my_center|LOCUS_10090 78707 79768 gene locus_tag LOCUS_10100 gene cysA 78707 79768 CDS product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL32 protein_id gnl|my_center|LOCUS_10100 79818 80741 gene locus_tag LOCUS_10110 gene gltC 79818 80741 CDS product cys regulon transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_10110 81552 80830 gene locus_tag LOCUS_10120 81552 80830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_10120 81845 82666 gene locus_tag LOCUS_10130 gene dapD 81845 82666 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL35 protein_id gnl|my_center|LOCUS_10130 82746 83456 gene locus_tag LOCUS_10140 gene queE 82746 83456 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL36 protein_id gnl|my_center|LOCUS_10140 83488 84156 gene locus_tag LOCUS_10150 gene queC 83488 84156 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL37 protein_id gnl|my_center|LOCUS_10150 84173 84583 gene locus_tag LOCUS_10160 84173 84583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073124.1 protein_id gnl|my_center|LOCUS_10160 84635 85102 gene locus_tag LOCUS_10170 gene bcp 84635 85102 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207381.1 protein_id gnl|my_center|LOCUS_10170 85855 85286 gene locus_tag LOCUS_10180 85855 85286 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119001.1 protein_id gnl|my_center|LOCUS_10180 85942 86802 gene locus_tag LOCUS_10190 gene paaG 85942 86802 CDS product enol-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_10190 86915 87697 gene locus_tag LOCUS_10200 86915 87697 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_10200 88239 87925 gene locus_tag LOCUS_10210 88239 87925 CDS product NIF3 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 protein_id gnl|my_center|LOCUS_10210 88358 89209 gene locus_tag LOCUS_10220 88358 89209 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112376.1 protein_id gnl|my_center|LOCUS_10220 93099 89266 gene locus_tag LOCUS_10230 gene purL 93099 89266 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL47 protein_id gnl|my_center|LOCUS_10230 93647 93483 gene locus_tag LOCUS_10240 93647 93483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 93650 94981 gene locus_tag LOCUS_10250 gene dgt 93650 94981 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_10250 95002 95604 gene locus_tag LOCUS_10260 gene ruvA 95002 95604 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL49 protein_id gnl|my_center|LOCUS_10260 95625 96629 gene locus_tag LOCUS_10270 gene ruvB 95625 96629 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL50 protein_id gnl|my_center|LOCUS_10270 98266 96719 gene locus_tag LOCUS_10280 gene hapE 98266 96719 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_10280 99113 98280 gene locus_tag LOCUS_10290 gene ephD 99113 98280 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_10290 100139 99144 gene locus_tag LOCUS_10300 100139 99144 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_10300 100659 101066 gene locus_tag LOCUS_10310 100659 101066 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699892.1 protein_id gnl|my_center|LOCUS_10310 101089 101787 gene locus_tag LOCUS_10320 gene tolQ 101089 101787 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207390.1 protein_id gnl|my_center|LOCUS_10320 101787 102236 gene locus_tag LOCUS_10330 gene tolR 101787 102236 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_10330 102241 103479 gene locus_tag LOCUS_10340 102241 103479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 103704 105044 gene locus_tag LOCUS_10350 gene tolB 103704 105044 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL57 protein_id gnl|my_center|LOCUS_10350 105082 105654 gene locus_tag LOCUS_10360 gene pal 105082 105654 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_10360 105896 105708 gene locus_tag LOCUS_10370 105896 105708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067763.1 protein_id gnl|my_center|LOCUS_10370 106070 107044 gene locus_tag LOCUS_10380 gene fbp 106070 107044 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL60 protein_id gnl|my_center|LOCUS_10380 107097 107873 gene locus_tag LOCUS_10390 107097 107873 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_10390 108016 108657 gene locus_tag LOCUS_10400 108016 108657 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118814.1 protein_id gnl|my_center|LOCUS_10400 108650 108970 gene locus_tag LOCUS_10410 108650 108970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118556.1 protein_id gnl|my_center|LOCUS_10410 108960 109367 gene locus_tag LOCUS_10420 108960 109367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118619.1 protein_id gnl|my_center|LOCUS_10420 111819 109414 gene locus_tag LOCUS_10430 111819 109414 CDS product CSLREA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207394.1 protein_id gnl|my_center|LOCUS_10430 113644 111833 gene locus_tag LOCUS_10440 113644 111833 CDS product rhombotarget A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207395.1 protein_id gnl|my_center|LOCUS_10440 114468 113761 gene locus_tag LOCUS_10450 gene dnaA 114468 113761 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_10450 115677 114490 gene locus_tag LOCUS_10460 gene rp630 115677 114490 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_10460 115815 116885 gene locus_tag LOCUS_10470 gene purM 115815 116885 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_10470 116892 117524 gene locus_tag LOCUS_10480 gene purN 116892 117524 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL71 protein_id gnl|my_center|LOCUS_10480 118381 117584 gene locus_tag LOCUS_10490 118381 117584 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_10490 119415 118399 gene locus_tag LOCUS_10500 gene nhaA 119415 118399 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_10500 119545 120495 gene locus_tag LOCUS_10510 gene htrB 119545 120495 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_10510 122929 120488 gene locus_tag LOCUS_10520 gene comEC 122929 120488 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207402.1 protein_id gnl|my_center|LOCUS_10520 123697 123014 gene locus_tag LOCUS_10530 gene lolD 123697 123014 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL76 protein_id gnl|my_center|LOCUS_10530 124835 123690 gene locus_tag LOCUS_10540 gene lolC 124835 123690 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_10540 124951 125523 gene locus_tag LOCUS_10550 124951 125523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 126459 125533 gene locus_tag LOCUS_10560 gene pagO 126459 125533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_10560 126926 126456 gene locus_tag LOCUS_10570 126926 126456 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL79 protein_id gnl|my_center|LOCUS_10570 127217 128161 gene locus_tag LOCUS_10580 127217 128161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 protein_id gnl|my_center|LOCUS_10580 128200 128349 gene locus_tag LOCUS_10590 128200 128349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 129496 128417 gene locus_tag LOCUS_10600 gene serC 129496 128417 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL81 protein_id gnl|my_center|LOCUS_10600 129943 131451 gene locus_tag LOCUS_10610 129943 131451 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207407.1 protein_id gnl|my_center|LOCUS_10610 131470 132600 gene locus_tag LOCUS_10620 131470 132600 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207408.1 protein_id gnl|my_center|LOCUS_10620 132600 133730 gene locus_tag LOCUS_10630 132600 133730 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118383.1 protein_id gnl|my_center|LOCUS_10630 133727 134815 gene locus_tag LOCUS_10640 gene ybhR 133727 134815 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_10640 137820 134863 gene locus_tag LOCUS_10650 gene gyrA 137820 134863 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL86 protein_id gnl|my_center|LOCUS_10650 139127 138195 gene locus_tag LOCUS_10660 gene etfA 139127 138195 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_10660 139898 139146 gene locus_tag LOCUS_10670 gene etfB 139898 139146 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_10670 141003 140398 gene locus_tag LOCUS_10680 141003 140398 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_10680 141119 141613 gene locus_tag LOCUS_10690 141119 141613 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530158.1 protein_id gnl|my_center|LOCUS_10690 142309 141938 gene locus_tag LOCUS_10700 142309 141938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 143408 142488 gene locus_tag LOCUS_10710 gene xerC 143408 142488 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL90 protein_id gnl|my_center|LOCUS_10710 144304 143459 gene locus_tag LOCUS_10720 gene dapF 144304 143459 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL93 protein_id gnl|my_center|LOCUS_10720 145564 144314 gene locus_tag LOCUS_10730 gene lysA 145564 144314 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL94 protein_id gnl|my_center|LOCUS_10730 145839 145588 gene locus_tag LOCUS_10740 145839 145588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118887.1 protein_id gnl|my_center|LOCUS_10740 147380 145977 gene locus_tag LOCUS_10750 gene cycA 147380 145977 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207418.1 protein_id gnl|my_center|LOCUS_10750 147880 149271 gene locus_tag LOCUS_10760 gene radA 147880 149271 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL98 protein_id gnl|my_center|LOCUS_10760 149378 150379 gene locus_tag LOCUS_10770 149378 150379 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118912.1 protein_id gnl|my_center|LOCUS_10770 151407 150433 gene locus_tag LOCUS_10780 gene poxA 151407 150433 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_10780 152474 151404 gene locus_tag LOCUS_10790 gene pdxB 152474 151404 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA1 protein_id gnl|my_center|LOCUS_10790 152851 154278 gene locus_tag LOCUS_10800 gene puuA 152851 154278 CDS product gamma-glutamylputrescine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207113.1 protein_id gnl|my_center|LOCUS_10800 155086 154391 gene locus_tag LOCUS_10810 gene kdpE 155086 154391 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207114.1 protein_id gnl|my_center|LOCUS_10810 157759 155099 gene locus_tag LOCUS_10820 gene kdpD 157759 155099 CDS product sensory kinase in two-component regulatory system wtih KdpE, regulates potassium transport system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207115.1 protein_id gnl|my_center|LOCUS_10820 158458 157853 gene locus_tag LOCUS_10830 gene kdpC 158458 157853 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR7 protein_id gnl|my_center|LOCUS_10830 160493 158469 gene locus_tag LOCUS_10840 gene kdpB 160493 158469 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR8 protein_id gnl|my_center|LOCUS_10840 162216 160504 gene locus_tag LOCUS_10850 gene kdpA 162216 160504 CDS product potassium-transporting ATPase potassium-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR9 protein_id gnl|my_center|LOCUS_10850 163419 162631 gene locus_tag LOCUS_10860 163419 162631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 protein_id gnl|my_center|LOCUS_10860 165287 163800 gene locus_tag LOCUS_10870 gene mmuP 165287 163800 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207791.1 protein_id gnl|my_center|LOCUS_10870 166437 165463 gene locus_tag LOCUS_10880 gene astE 166437 165463 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE5 protein_id gnl|my_center|LOCUS_10880 167810 166470 gene locus_tag LOCUS_10890 gene astB 167810 166470 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE6 protein_id gnl|my_center|LOCUS_10890 169312 167843 gene locus_tag LOCUS_10900 gene astD 169312 167843 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE7 protein_id gnl|my_center|LOCUS_10900 170355 169312 gene locus_tag LOCUS_10910 gene astA 170355 169312 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE8 protein_id gnl|my_center|LOCUS_10910 171582 170377 gene locus_tag LOCUS_10920 gene astC 171582 170377 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE9 protein_id gnl|my_center|LOCUS_10920 172906 171635 gene locus_tag LOCUS_10930 gene gdhA 172906 171635 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_10930 173139 173561 gene locus_tag LOCUS_10940 173139 173561 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 protein_id gnl|my_center|LOCUS_10940 173921 173832 gene locus_tag LOCUS_t00180 173921 173832 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 176039 174009 gene locus_tag LOCUS_10950 gene fadH 176039 174009 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 protein_id gnl|my_center|LOCUS_10950 177964 176273 gene locus_tag LOCUS_10960 gene dld 177964 176273 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 protein_id gnl|my_center|LOCUS_10960 179114 177969 gene locus_tag LOCUS_10970 gene lldD 179114 177969 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS9 protein_id gnl|my_center|LOCUS_10970 179859 179116 gene locus_tag LOCUS_10980 gene lldR 179859 179116 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208064.1 protein_id gnl|my_center|LOCUS_10980 181548 179881 gene locus_tag LOCUS_10990 gene lldP 181548 179881 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208063.1 protein_id gnl|my_center|LOCUS_10990 182132 183475 gene locus_tag LOCUS_11000 gene argG 182132 183475 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI5 protein_id gnl|my_center|LOCUS_11000 184808 183537 gene locus_tag LOCUS_11010 gene pleD 184808 183537 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070488.1 protein_id gnl|my_center|LOCUS_11010 185059 185979 gene locus_tag LOCUS_11020 gene pyrC 185059 185979 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI3 protein_id gnl|my_center|LOCUS_11020 185976 186623 gene locus_tag LOCUS_11030 gene rnt 185976 186623 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI2 protein_id gnl|my_center|LOCUS_11030 186644 186719 gene locus_tag LOCUS_t00190 186644 186719 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 186899 186974 gene locus_tag LOCUS_t00200 186899 186974 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 187073 188491 gene locus_tag LOCUS_11040 gene mmuP 187073 188491 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207841.1 protein_id gnl|my_center|LOCUS_11040 188693 188768 gene locus_tag LOCUS_t00210 188693 188768 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 188794 188869 gene locus_tag LOCUS_t00220 188794 188869 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 190413 189169 gene locus_tag LOCUS_11050 gene noxB 190413 189169 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206115.1 protein_id gnl|my_center|LOCUS_11050 192131 190536 gene locus_tag LOCUS_11060 gene yejF 192131 190536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_11060 193119 192106 gene locus_tag LOCUS_11070 gene yejE 193119 192106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_11070 194186 193119 gene locus_tag LOCUS_11080 gene yejB 194186 193119 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206112.1 protein_id gnl|my_center|LOCUS_11080 196068 194224 gene locus_tag LOCUS_11090 196068 194224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 protein_id gnl|my_center|LOCUS_11090 199147 196094 gene locus_tag LOCUS_11100 gene mltD 199147 196094 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 protein_id gnl|my_center|LOCUS_11100 199369 200736 gene locus_tag LOCUS_11110 gene dnaQ 199369 200736 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHH4 protein_id gnl|my_center|LOCUS_11110 200871 202514 gene locus_tag LOCUS_11120 200871 202514 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206108.1 protein_id gnl|my_center|LOCUS_11120 202515 203273 gene locus_tag LOCUS_11130 gene nudC 202515 203273 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 protein_id gnl|my_center|LOCUS_11130 204156 203284 gene locus_tag LOCUS_11140 gene afmiD 204156 203284 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206106.1 protein_id gnl|my_center|LOCUS_11140 204857 204162 gene locus_tag LOCUS_11150 204857 204162 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_11150 205343 204939 gene locus_tag LOCUS_11160 205343 204939 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH09 protein_id gnl|my_center|LOCUS_11160 206314 205364 gene locus_tag LOCUS_11170 206314 205364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 206327 207169 gene locus_tag LOCUS_11180 gene rsmI 206327 207169 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH08 protein_id gnl|my_center|LOCUS_11180 207504 207244 gene locus_tag LOCUS_11190 207504 207244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117665.1 protein_id gnl|my_center|LOCUS_11190 208893 207652 gene locus_tag LOCUS_11200 gene ubiF 208893 207652 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_11200 210098 208890 gene locus_tag LOCUS_11210 gene ubiH 210098 208890 CDS product ubiquinone biosynthesis protein UbiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_11210 211505 210123 gene locus_tag LOCUS_11220 gene pepP 211505 210123 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_11220 212161 211520 gene locus_tag LOCUS_11230 212161 211520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_11230 212214 212774 gene locus_tag LOCUS_11240 212214 212774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206098.1 protein_id gnl|my_center|LOCUS_11240 212771 213055 gene locus_tag LOCUS_11250 212771 213055 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ6 protein_id gnl|my_center|LOCUS_11250 213317 213117 gene locus_tag LOCUS_11260 213317 213117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 213853 213383 gene locus_tag LOCUS_11270 213853 213383 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 protein_id gnl|my_center|LOCUS_11270 214118 214624 gene locus_tag LOCUS_11280 214118 214624 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 protein_id gnl|my_center|LOCUS_11280 215875 215114 gene locus_tag LOCUS_11290 215875 215114 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX6 protein_id gnl|my_center|LOCUS_11290 216129 216488 gene locus_tag LOCUS_11300 216129 216488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206246.1 protein_id gnl|my_center|LOCUS_11300 216708 217916 gene locus_tag LOCUS_11310 gene alkM 216708 217916 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 protein_id gnl|my_center|LOCUS_11310 218031 219059 gene locus_tag LOCUS_11320 gene appY 218031 219059 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_11320 219331 219137 gene locus_tag LOCUS_11330 219331 219137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11330 219529 219374 gene locus_tag LOCUS_11340 219529 219374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11340 220065 219544 gene locus_tag LOCUS_11350 220065 219544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11350 220477 220112 gene locus_tag LOCUS_11360 220477 220112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 221430 221900 gene locus_tag LOCUS_11370 221430 221900 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ2 protein_id gnl|my_center|LOCUS_11370 222053 224479 gene locus_tag LOCUS_11380 gene lon 222053 224479 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ1 protein_id gnl|my_center|LOCUS_11380 225566 224739 gene locus_tag LOCUS_11390 gene yfbL 225566 224739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76482 protein_id gnl|my_center|LOCUS_11390 225844 226323 gene locus_tag LOCUS_11400 gene rlmH 225844 226323 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ0 protein_id gnl|my_center|LOCUS_11400 226441 227217 gene locus_tag LOCUS_11410 226441 227217 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_11410 227376 228479 gene locus_tag LOCUS_11420 gene hslJ 227376 228479 CDS product heat-shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206093.1 protein_id gnl|my_center|LOCUS_11420 229890 228547 gene locus_tag LOCUS_11430 gene gdhA 229890 228547 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY7 protein_id gnl|my_center|LOCUS_11430 230226 231026 gene locus_tag LOCUS_11440 gene rnfB 230226 231026 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 protein_id gnl|my_center|LOCUS_11440 231023 231739 gene locus_tag LOCUS_11450 gene nth 231023 231739 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY5 protein_id gnl|my_center|LOCUS_11450 231932 231747 gene locus_tag LOCUS_11460 231932 231747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 232683 232024 gene locus_tag LOCUS_11470 gene adk 232683 232024 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_11470 234103 232790 gene locus_tag LOCUS_11480 234103 232790 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_11480 234676 234164 gene locus_tag LOCUS_11490 234676 234164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117557.1 protein_id gnl|my_center|LOCUS_11490 234897 236927 gene locus_tag LOCUS_11500 gene pbpA 234897 236927 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_11500 236930 237481 gene locus_tag LOCUS_11510 gene rsmD 236930 237481 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX9 protein_id gnl|my_center|LOCUS_11510 237737 237501 gene locus_tag LOCUS_11520 237737 237501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 238058 238819 gene locus_tag LOCUS_11530 238058 238819 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 protein_id gnl|my_center|LOCUS_11530 238945 239286 gene locus_tag LOCUS_11540 238945 239286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117704.1 protein_id gnl|my_center|LOCUS_11540 240110 239529 gene locus_tag LOCUS_11550 240110 239529 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_11550 240394 240537 gene locus_tag LOCUS_11560 240394 240537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 240762 241259 gene locus_tag LOCUS_11570 gene cutF 240762 241259 CDS product lipoprotein involved with copper homeostasis and adhesion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206080.1 protein_id gnl|my_center|LOCUS_11570 242942 241338 gene locus_tag LOCUS_11580 gene aceA 242942 241338 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_11580 243521 244513 gene locus_tag LOCUS_11590 gene nahR 243521 244513 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_11590 244638 245960 gene locus_tag LOCUS_11600 gene ytfL 244638 245960 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 protein_id gnl|my_center|LOCUS_11600 246809 246303 gene locus_tag LOCUS_11610 246809 246303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206079.1 protein_id gnl|my_center|LOCUS_11610 247972 246977 gene locus_tag LOCUS_11620 247972 246977 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 protein_id gnl|my_center|LOCUS_11620 248278 250680 gene locus_tag LOCUS_11630 248278 250680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 252483 250870 gene locus_tag LOCUS_11640 gene cysNC 252483 250870 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW1 protein_id gnl|my_center|LOCUS_11640 253427 252504 gene locus_tag LOCUS_11650 gene cysD 253427 252504 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_11650 255139 253685 gene locus_tag LOCUS_11660 255139 253685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206075.1 protein_id gnl|my_center|LOCUS_11660 256822 255293 gene locus_tag LOCUS_11670 gene lysS 256822 255293 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV7 protein_id gnl|my_center|LOCUS_11670 257098 257577 gene locus_tag LOCUS_11680 257098 257577 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206073.1 protein_id gnl|my_center|LOCUS_11680 258146 257604 gene locus_tag LOCUS_11690 gene apt 258146 257604 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI44 protein_id gnl|my_center|LOCUS_11690 258745 258909 gene locus_tag LOCUS_11700 gene rubA 258745 258909 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_11700 258980 260158 gene locus_tag LOCUS_11710 gene rubB 258980 260158 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_11710 260219 261163 gene locus_tag LOCUS_11720 260219 261163 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_11720 261170 262078 gene locus_tag LOCUS_11730 gene estR 261170 262078 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_11730 264213 262135 gene locus_tag LOCUS_11740 gene ppk 264213 262135 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_11740 264997 264323 gene locus_tag LOCUS_11750 gene mtgA 264997 264323 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU7 protein_id gnl|my_center|LOCUS_11750 265076 265882 gene locus_tag LOCUS_11760 gene aarA 265076 265882 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206065.1 protein_id gnl|my_center|LOCUS_11760 268390 265910 gene locus_tag LOCUS_11770 268390 265910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206064.1 protein_id gnl|my_center|LOCUS_11770 269117 268371 gene locus_tag LOCUS_11780 gene ybbA 269117 268371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070633.1 protein_id gnl|my_center|LOCUS_11780 269130 269759 gene locus_tag LOCUS_11790 gene tesA 269130 269759 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 protein_id gnl|my_center|LOCUS_11790 270428 269814 gene locus_tag LOCUS_11800 gene cynT 270428 269814 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_11800 270765 271781 gene locus_tag LOCUS_11810 gene lip1 270765 271781 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_11810 271799 272800 gene locus_tag LOCUS_11820 271799 272800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 protein_id gnl|my_center|LOCUS_11820 275047 272840 gene locus_tag LOCUS_11830 gene pfeA 275047 272840 CDS product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206060.1 protein_id gnl|my_center|LOCUS_11830 275865 275227 gene locus_tag LOCUS_11840 gene nfuA 275865 275227 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_11840 276024 276644 gene locus_tag LOCUS_11850 276024 276644 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_11850 276811 278472 gene locus_tag LOCUS_11860 gene atsA 276811 278472 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206058.1 protein_id gnl|my_center|LOCUS_11860 278640 279452 gene locus_tag LOCUS_11870 gene sumF1 278640 279452 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206057.1 protein_id gnl|my_center|LOCUS_11870 279948 281504 gene locus_tag LOCUS_11880 279948 281504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_11880 283113 281581 gene locus_tag LOCUS_11890 gene pitA 283113 281581 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT0 protein_id gnl|my_center|LOCUS_11890 283674 287360 gene locus_tag LOCUS_11900 gene metH 283674 287360 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2Q2 protein_id gnl|my_center|LOCUS_11900 287734 287549 gene locus_tag LOCUS_11910 287734 287549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 289440 287731 gene locus_tag LOCUS_11920 289440 287731 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_11920 291466 290243 gene locus_tag LOCUS_11930 gene shiA 291466 290243 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229008.1 protein_id gnl|my_center|LOCUS_11930 293790 291514 gene locus_tag LOCUS_11940 gene rhf 293790 291514 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 protein_id gnl|my_center|LOCUS_11940 293950 294591 gene locus_tag LOCUS_11950 293950 294591 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730148.1 protein_id gnl|my_center|LOCUS_11950 294868 295167 gene locus_tag LOCUS_11960 294868 295167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11960 295180 296136 gene locus_tag LOCUS_11970 295180 296136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11970 296685 296188 gene locus_tag LOCUS_11980 296685 296188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 297117 296830 gene locus_tag LOCUS_11990 297117 296830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206029.1 protein_id gnl|my_center|LOCUS_11990 297276 297650 gene locus_tag LOCUS_12000 297276 297650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 298339 297767 gene locus_tag LOCUS_12010 gene pnuC 298339 297767 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 protein_id gnl|my_center|LOCUS_12010 298806 298465 gene locus_tag LOCUS_12020 gene fbp 298806 298465 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG87 protein_id gnl|my_center|LOCUS_12020 299553 298930 gene locus_tag LOCUS_12030 299553 298930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 300186 299656 gene locus_tag LOCUS_12040 gene yaeQ 300186 299656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075397.1 protein_id gnl|my_center|LOCUS_12040 301302 300280 gene locus_tag LOCUS_12050 gene cobW 301302 300280 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 protein_id gnl|my_center|LOCUS_12050 302212 302442 gene locus_tag LOCUS_12060 302212 302442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 303149 302625 gene locus_tag LOCUS_12070 gene vdlD 303149 302625 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_12070 305000 303345 gene locus_tag LOCUS_12080 gene betA 305000 303345 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG76 protein_id gnl|my_center|LOCUS_12080 306491 305016 gene locus_tag LOCUS_12090 gene betB 306491 305016 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG77 protein_id gnl|my_center|LOCUS_12090 307098 306517 gene locus_tag LOCUS_12100 gene betI 307098 306517 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGV8 protein_id gnl|my_center|LOCUS_12100 307334 309373 gene locus_tag LOCUS_12110 gene betT 307334 309373 CDS product high-affinity choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070759.1 protein_id gnl|my_center|LOCUS_12110 309394 310011 gene locus_tag LOCUS_12120 309394 310011 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG81 protein_id gnl|my_center|LOCUS_12120 310220 310906 gene locus_tag LOCUS_12130 310220 310906 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207293.1 protein_id gnl|my_center|LOCUS_12130 311821 310991 gene locus_tag LOCUS_12140 gene pcoB 311821 310991 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208440.1 protein_id gnl|my_center|LOCUS_12140 313358 311808 gene locus_tag LOCUS_12150 gene pcoA 313358 311808 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence04 351 962 gene locus_tag LOCUS_12160 351 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_12160 1008 1877 gene locus_tag LOCUS_12170 gene murI 1008 1877 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF8 protein_id gnl|my_center|LOCUS_12170 1997 3025 gene locus_tag LOCUS_12180 1997 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208258.1 protein_id gnl|my_center|LOCUS_12180 3099 4112 gene locus_tag LOCUS_12190 gene hemH 3099 4112 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_12190 4136 4780 gene locus_tag LOCUS_12200 gene ycbL 4136 4780 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_12200 4997 4809 gene locus_tag LOCUS_12210 4997 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6007 5822 gene locus_tag LOCUS_12220 gene yacG 6007 5822 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG2 protein_id gnl|my_center|LOCUS_12220 6103 6735 gene locus_tag LOCUS_12230 gene trmB 6103 6735 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_12230 6725 7939 gene locus_tag LOCUS_12240 6725 7939 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 protein_id gnl|my_center|LOCUS_12240 7977 8378 gene locus_tag LOCUS_12250 7977 8378 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_12250 8741 8409 gene locus_tag LOCUS_12260 8741 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_12260 8916 9296 gene locus_tag LOCUS_12270 gene crcB 8916 9296 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLF8 protein_id gnl|my_center|LOCUS_12270 9630 9376 gene locus_tag LOCUS_12280 gene rpmE2 9630 9376 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG9 protein_id gnl|my_center|LOCUS_12280 11058 9748 gene locus_tag LOCUS_12290 gene adcK4 11058 9748 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_12290 12666 11308 gene locus_tag LOCUS_12300 gene norM 12666 11308 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_12300 13098 12697 gene locus_tag LOCUS_12310 13098 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 protein_id gnl|my_center|LOCUS_12310 13286 14440 gene locus_tag LOCUS_12320 13286 14440 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_12320 14649 14446 gene locus_tag LOCUS_12330 14649 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 14621 15121 gene locus_tag LOCUS_12340 gene rhtC 14621 15121 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205974.1 protein_id gnl|my_center|LOCUS_12340 15468 15998 gene locus_tag LOCUS_12350 15468 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 16166 16091 gene locus_tag LOCUS_t00230 16166 16091 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16302 16227 gene locus_tag LOCUS_t00240 16302 16227 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16397 16322 gene locus_tag LOCUS_t00250 16397 16322 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18371 16530 gene locus_tag LOCUS_12360 18371 16530 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 protein_id gnl|my_center|LOCUS_12360 22098 18586 gene locus_tag LOCUS_12370 gene rne 22098 18586 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY4 protein_id gnl|my_center|LOCUS_12370 22478 22681 gene locus_tag LOCUS_12380 22478 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 22842 23780 gene locus_tag LOCUS_12390 22842 23780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 23920 24609 gene locus_tag LOCUS_12400 gene ppaX 23920 24609 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 protein_id gnl|my_center|LOCUS_12400 25018 25815 gene locus_tag LOCUS_12410 gene mhpD 25018 25815 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XEC1 protein_id gnl|my_center|LOCUS_12410 25840 26736 gene locus_tag LOCUS_12420 25840 26736 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTR4 protein_id gnl|my_center|LOCUS_12420 26749 27768 gene locus_tag LOCUS_12430 gene mhpE 26749 27768 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6H7 protein_id gnl|my_center|LOCUS_12430 27983 28330 gene locus_tag LOCUS_12440 27983 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 28718 30010 gene locus_tag LOCUS_12450 28718 30010 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206708.1 protein_id gnl|my_center|LOCUS_12450 30283 31140 gene locus_tag LOCUS_12460 30283 31140 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229072.1 protein_id gnl|my_center|LOCUS_12460 31882 31202 gene locus_tag LOCUS_12470 31882 31202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_12470 33065 32160 gene locus_tag LOCUS_12480 gene hcaR 33065 32160 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066014.1 protein_id gnl|my_center|LOCUS_12480 33335 34702 gene locus_tag LOCUS_12490 gene hcaE 33335 34702 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABR5 protein_id gnl|my_center|LOCUS_12490 34699 35217 gene locus_tag LOCUS_12500 gene hcaF 34699 35217 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83K38 protein_id gnl|my_center|LOCUS_12500 35217 35543 gene locus_tag LOCUS_12510 gene hcaC 35217 35543 CDS product 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XW23 protein_id gnl|my_center|LOCUS_12510 35546 36361 gene locus_tag LOCUS_12520 gene hcaB 35546 36361 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6C8 protein_id gnl|my_center|LOCUS_12520 36427 37386 gene locus_tag LOCUS_12530 gene mhpB 36427 37386 CDS product 2,3-dihydroxyphenylpropionate/2,3-dihydroxicinnamic acid 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABR9 protein_id gnl|my_center|LOCUS_12530 37399 38622 gene locus_tag LOCUS_12540 gene hcaD 37399 38622 CDS product 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N6C9 protein_id gnl|my_center|LOCUS_12540 38719 39645 gene locus_tag LOCUS_12550 gene pagO 38719 39645 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_12550 39846 40793 gene locus_tag LOCUS_12560 gene catA 39846 40793 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036504.1 protein_id gnl|my_center|LOCUS_12560 40856 41896 gene locus_tag LOCUS_12570 40856 41896 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208279.1 protein_id gnl|my_center|LOCUS_12570 42275 41886 gene locus_tag LOCUS_12580 42275 41886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 43975 42455 gene locus_tag LOCUS_12590 gene kat 43975 42455 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS5 protein_id gnl|my_center|LOCUS_12590 44923 44285 gene locus_tag LOCUS_12600 44923 44285 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195845.1 protein_id gnl|my_center|LOCUS_12600 44983 46632 gene locus_tag LOCUS_12610 44983 46632 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195844.1 protein_id gnl|my_center|LOCUS_12610 46814 46999 gene locus_tag LOCUS_12620 46814 46999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 49304 47013 gene locus_tag LOCUS_12630 gene ptsP 49304 47013 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208281.1 protein_id gnl|my_center|LOCUS_12630 49872 49390 gene locus_tag LOCUS_12640 gene rppH 49872 49390 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLZ5 protein_id gnl|my_center|LOCUS_12640 50057 50707 gene locus_tag LOCUS_12650 50057 50707 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_12650 51618 50746 gene locus_tag LOCUS_12660 gene gltC 51618 50746 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 protein_id gnl|my_center|LOCUS_12660 51840 53273 gene locus_tag LOCUS_12670 gene leuC 51840 53273 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_12670 53284 53934 gene locus_tag LOCUS_12680 gene leuD 53284 53934 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_12680 54034 54606 gene locus_tag LOCUS_12690 54034 54606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066026.1 protein_id gnl|my_center|LOCUS_12690 54645 55736 gene locus_tag LOCUS_12700 gene leuB 54645 55736 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM04 protein_id gnl|my_center|LOCUS_12700 56199 55798 gene locus_tag LOCUS_12710 56199 55798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208286.1 protein_id gnl|my_center|LOCUS_12710 56621 56400 gene locus_tag LOCUS_12720 gene infA 56621 56400 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_12720 56852 57859 gene locus_tag LOCUS_12730 gene rr07 56852 57859 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_12730 58685 57888 gene locus_tag LOCUS_12740 gene truA 58685 57888 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM09 protein_id gnl|my_center|LOCUS_12740 59666 58698 gene locus_tag LOCUS_12750 gene ansA 59666 58698 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208288.1 protein_id gnl|my_center|LOCUS_12750 61031 59712 gene locus_tag LOCUS_12760 61031 59712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208289.1 protein_id gnl|my_center|LOCUS_12760 62490 61105 gene locus_tag LOCUS_12770 62490 61105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208290.1 protein_id gnl|my_center|LOCUS_12770 63750 62632 gene locus_tag LOCUS_12780 gene asd 63750 62632 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM13 protein_id gnl|my_center|LOCUS_12780 63932 65071 gene locus_tag LOCUS_12790 63932 65071 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_12790 66545 65427 gene locus_tag LOCUS_12800 gene lpsB 66545 65427 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_12800 67540 66605 gene locus_tag LOCUS_12810 gene htrB 67540 66605 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_12810 67720 68280 gene locus_tag LOCUS_12820 67720 68280 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 protein_id gnl|my_center|LOCUS_12820 70209 68314 gene locus_tag LOCUS_12830 gene uup 70209 68314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_12830 70244 70489 gene locus_tag LOCUS_12840 70244 70489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 70563 71588 gene locus_tag LOCUS_12850 70563 71588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 71883 72332 gene locus_tag LOCUS_12860 71883 72332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004842579.1 protein_id gnl|my_center|LOCUS_12860 72367 75009 gene locus_tag LOCUS_12870 gene topA 72367 75009 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM24 protein_id gnl|my_center|LOCUS_12870 75107 75865 gene locus_tag LOCUS_12880 75107 75865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_12880 75988 76557 gene locus_tag LOCUS_12890 75988 76557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208303.1 protein_id gnl|my_center|LOCUS_12890 76627 77781 gene locus_tag LOCUS_12900 76627 77781 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_12900 77842 79821 gene locus_tag LOCUS_12910 gene pcrA 77842 79821 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM27 protein_id gnl|my_center|LOCUS_12910 79909 80160 gene locus_tag LOCUS_12920 gene rbpD 79909 80160 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_12920 80423 80926 gene locus_tag LOCUS_12930 80423 80926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_12930 81033 81311 gene locus_tag LOCUS_12940 81033 81311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114792.1 protein_id gnl|my_center|LOCUS_12940 83099 81381 gene locus_tag LOCUS_12950 gene ybaL 83099 81381 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079171.1 protein_id gnl|my_center|LOCUS_12950 83411 83256 gene locus_tag LOCUS_12960 gene rpmG 83411 83256 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_12960 83660 83424 gene locus_tag LOCUS_12970 gene rpmB 83660 83424 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM34 protein_id gnl|my_center|LOCUS_12970 85272 83824 gene locus_tag LOCUS_12980 gene calB 85272 83824 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM35 protein_id gnl|my_center|LOCUS_12980 85388 86074 gene locus_tag LOCUS_12990 85388 86074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 86170 87036 gene locus_tag LOCUS_13000 gene purU1 86170 87036 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM37 protein_id gnl|my_center|LOCUS_13000 87250 88050 gene locus_tag LOCUS_13010 gene tonB 87250 88050 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208308.1 protein_id gnl|my_center|LOCUS_13010 88070 88696 gene locus_tag LOCUS_13020 gene exbB 88070 88696 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_13020 88696 89100 gene locus_tag LOCUS_13030 gene exbD 88696 89100 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_13030 89678 89154 gene locus_tag LOCUS_13040 gene msrA 89678 89154 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_13040 90270 89800 gene locus_tag LOCUS_13050 90270 89800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 91427 90390 gene locus_tag LOCUS_13060 91427 90390 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_13060 91986 91474 gene locus_tag LOCUS_13070 gene folA 91986 91474 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM43 protein_id gnl|my_center|LOCUS_13070 92825 91983 gene locus_tag LOCUS_13080 gene thyA 92825 91983 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM44 protein_id gnl|my_center|LOCUS_13080 93193 94179 gene locus_tag LOCUS_13090 93193 94179 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206241.1 protein_id gnl|my_center|LOCUS_13090 94167 94946 gene locus_tag LOCUS_13100 94167 94946 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206243.1 protein_id gnl|my_center|LOCUS_13100 94939 95535 gene locus_tag LOCUS_13110 gene nodS 94939 95535 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206244.1 protein_id gnl|my_center|LOCUS_13110 95532 96203 gene locus_tag LOCUS_13120 95532 96203 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206245.1 protein_id gnl|my_center|LOCUS_13120 96623 96252 gene locus_tag LOCUS_13130 96623 96252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 97009 96623 gene locus_tag LOCUS_13140 97009 96623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115133.1 protein_id gnl|my_center|LOCUS_13140 97890 97081 gene locus_tag LOCUS_13150 gene lgt 97890 97081 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM47 protein_id gnl|my_center|LOCUS_13150 97985 98770 gene locus_tag LOCUS_13160 97985 98770 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 protein_id gnl|my_center|LOCUS_13160 101141 98811 gene locus_tag LOCUS_13170 101141 98811 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_13170 102081 101299 gene locus_tag LOCUS_13180 gene tatC 102081 101299 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_13180 102539 102078 gene locus_tag LOCUS_13190 102539 102078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 102774 102550 gene locus_tag LOCUS_13200 gene tatA 102774 102550 CDS product sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM53 protein_id gnl|my_center|LOCUS_13200 102927 103802 gene locus_tag LOCUS_13210 102927 103802 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208318.1 protein_id gnl|my_center|LOCUS_13210 104493 103861 gene locus_tag LOCUS_13220 104493 103861 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM55 protein_id gnl|my_center|LOCUS_13220 105194 104604 gene locus_tag LOCUS_13230 105194 104604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_13230 105784 105191 gene locus_tag LOCUS_13240 gene metW 105784 105191 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_13240 106944 105784 gene locus_tag LOCUS_13250 gene metX 106944 105784 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_13250 108725 107028 gene locus_tag LOCUS_13260 gene leuA 108725 107028 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM59 protein_id gnl|my_center|LOCUS_13260 109746 109063 gene locus_tag LOCUS_13270 gene piuC 109746 109063 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH49 protein_id gnl|my_center|LOCUS_13270 112134 109849 gene locus_tag LOCUS_13280 gene bfrD 112134 109849 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207070.1 protein_id gnl|my_center|LOCUS_13280 112559 113953 gene locus_tag LOCUS_13290 gene tig 112559 113953 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM1 protein_id gnl|my_center|LOCUS_13290 114150 114755 gene locus_tag LOCUS_13300 gene clpP 114150 114755 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM2 protein_id gnl|my_center|LOCUS_13300 114784 116100 gene locus_tag LOCUS_13310 gene clpX 114784 116100 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_13310 116252 116986 gene locus_tag LOCUS_13320 116252 116986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208323.1 protein_id gnl|my_center|LOCUS_13320 118633 117107 gene locus_tag LOCUS_13330 gene fumA 118633 117107 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM6 protein_id gnl|my_center|LOCUS_13330 119169 119777 gene locus_tag LOCUS_13340 119169 119777 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 protein_id gnl|my_center|LOCUS_13340 121989 119845 gene locus_tag LOCUS_13350 gene pta 121989 119845 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM7 protein_id gnl|my_center|LOCUS_13350 123258 122044 gene locus_tag LOCUS_13360 gene ackA 123258 122044 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM8 protein_id gnl|my_center|LOCUS_13360 123950 123537 gene locus_tag LOCUS_13370 123950 123537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 125344 124079 gene locus_tag LOCUS_13380 gene proA 125344 124079 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_13380 125653 126972 gene locus_tag LOCUS_13390 125653 126972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208332.1 protein_id gnl|my_center|LOCUS_13390 127850 126996 gene locus_tag LOCUS_13400 127850 126996 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208333.1 protein_id gnl|my_center|LOCUS_13400 128960 127935 gene locus_tag LOCUS_13410 gene nagZ 128960 127935 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_13410 129155 131344 gene locus_tag LOCUS_13420 gene prc 129155 131344 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 protein_id gnl|my_center|LOCUS_13420 131491 132768 gene locus_tag LOCUS_13430 131491 132768 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208336.1 protein_id gnl|my_center|LOCUS_13430 132797 133348 gene locus_tag LOCUS_13440 gene pgpB 132797 133348 CDS product phosphatidylglycerophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_13440 133418 133636 gene locus_tag LOCUS_13450 133418 133636 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_13450 133750 134181 gene locus_tag LOCUS_13460 gene ndk 133750 134181 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_13460 134304 135539 gene locus_tag LOCUS_13470 gene rlmN 134304 135539 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_13470 135564 136367 gene locus_tag LOCUS_13480 gene pilF 135564 136367 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_13480 136358 137161 gene locus_tag LOCUS_13490 136358 137161 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208339.1 protein_id gnl|my_center|LOCUS_13490 137184 138299 gene locus_tag LOCUS_13500 gene ispG 137184 138299 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP7 protein_id gnl|my_center|LOCUS_13500 138296 139591 gene locus_tag LOCUS_13510 gene hisS 138296 139591 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP9 protein_id gnl|my_center|LOCUS_13510 139623 140327 gene locus_tag LOCUS_13520 139623 140327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208343.1 protein_id gnl|my_center|LOCUS_13520 140327 141475 gene locus_tag LOCUS_13530 gene ire-1 140327 141475 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ1 protein_id gnl|my_center|LOCUS_13530 141644 143053 gene locus_tag LOCUS_13540 gene engA 141644 143053 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_13540 143160 143792 gene locus_tag LOCUS_13550 gene ffp 143160 143792 CDS product ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208363.1 protein_id gnl|my_center|LOCUS_13550 144804 143842 gene locus_tag LOCUS_13560 gene secF 144804 143842 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY7 protein_id gnl|my_center|LOCUS_13560 146717 144816 gene locus_tag LOCUS_13570 gene secD 146717 144816 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY6 protein_id gnl|my_center|LOCUS_13570 147101 146772 gene locus_tag LOCUS_13580 gene yajC 147101 146772 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_13580 148337 147207 gene locus_tag LOCUS_13590 gene tgt 148337 147207 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY4 protein_id gnl|my_center|LOCUS_13590 149058 148492 gene locus_tag LOCUS_13600 149058 148492 CDS product protein LemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_13600 150111 149080 gene locus_tag LOCUS_13610 150111 149080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 151170 150118 gene locus_tag LOCUS_13620 gene queA 151170 150118 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY3 protein_id gnl|my_center|LOCUS_13620 151332 151418 gene locus_tag LOCUS_t00260 151332 151418 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 151621 152898 gene locus_tag LOCUS_13630 gene bvgS 151621 152898 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207643.1 protein_id gnl|my_center|LOCUS_13630 152962 155712 gene locus_tag LOCUS_13640 gene glnE 152962 155712 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY1 protein_id gnl|my_center|LOCUS_13640 155739 156665 gene locus_tag LOCUS_13650 gene ilvE 155739 156665 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_13650 156729 157619 gene locus_tag LOCUS_13660 156729 157619 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_13660 157735 158442 gene locus_tag LOCUS_13670 157735 158442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 158445 159440 gene locus_tag LOCUS_13680 gene lpsE 158445 159440 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207636.1 protein_id gnl|my_center|LOCUS_13680 159430 160485 gene locus_tag LOCUS_13690 159430 160485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 161438 160476 gene locus_tag LOCUS_13700 161438 160476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140195.1 protein_id gnl|my_center|LOCUS_13700 161612 162574 gene locus_tag LOCUS_13710 161612 162574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 162810 162586 gene locus_tag LOCUS_13720 162810 162586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207632.1 protein_id gnl|my_center|LOCUS_13720 164708 162924 gene locus_tag LOCUS_13730 gene aspS 164708 162924 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 protein_id gnl|my_center|LOCUS_13730 165679 164915 gene locus_tag LOCUS_13740 165679 164915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207629.1 protein_id gnl|my_center|LOCUS_13740 165810 167909 gene locus_tag LOCUS_13750 165810 167909 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 protein_id gnl|my_center|LOCUS_13750 168012 169475 gene locus_tag LOCUS_13760 168012 169475 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_13760 169974 169528 gene locus_tag LOCUS_13770 169974 169528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_13770 170139 170570 gene locus_tag LOCUS_13780 170139 170570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 170782 171513 gene locus_tag LOCUS_13790 170782 171513 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_13790 171661 172464 gene locus_tag LOCUS_13800 gene fabI 171661 172464 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS9 protein_id gnl|my_center|LOCUS_13800 174152 172749 gene locus_tag LOCUS_13810 gene cmeC 174152 172749 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208366.1 protein_id gnl|my_center|LOCUS_13810 176151 174163 gene locus_tag LOCUS_13820 gene macB 176151 174163 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT1 protein_id gnl|my_center|LOCUS_13820 177494 176154 gene locus_tag LOCUS_13830 gene macA 177494 176154 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 protein_id gnl|my_center|LOCUS_13830 178601 177606 gene locus_tag LOCUS_13840 gene holA 178601 177606 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208369.1 protein_id gnl|my_center|LOCUS_13840 179136 178621 gene locus_tag LOCUS_13850 gene rlpB 179136 178621 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT4 protein_id gnl|my_center|LOCUS_13850 181785 179164 gene locus_tag LOCUS_13860 gene leuS 181785 179164 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT5 protein_id gnl|my_center|LOCUS_13860 182306 181902 gene locus_tag LOCUS_13870 182306 181902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 182948 184675 gene locus_tag LOCUS_13880 gene ilvI 182948 184675 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT6 protein_id gnl|my_center|LOCUS_13880 184672 185163 gene locus_tag LOCUS_13890 gene ilvH 184672 185163 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_13890 185198 186214 gene locus_tag LOCUS_13900 gene ilvC 185198 186214 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT8 protein_id gnl|my_center|LOCUS_13900 186852 188873 gene locus_tag LOCUS_13910 186852 188873 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066201.1 protein_id gnl|my_center|LOCUS_13910 189034 190623 gene locus_tag LOCUS_13920 gene prfC 189034 190623 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU2 protein_id gnl|my_center|LOCUS_13920 190696 191517 gene locus_tag LOCUS_13930 190696 191517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117238.1 protein_id gnl|my_center|LOCUS_13930 191609 192586 gene locus_tag LOCUS_13940 191609 192586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208372.1 protein_id gnl|my_center|LOCUS_13940 192590 193429 gene locus_tag LOCUS_13950 192590 193429 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_13950 193539 196295 gene locus_tag LOCUS_13960 gene acnA 193539 196295 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU6 protein_id gnl|my_center|LOCUS_13960 196425 197195 gene locus_tag LOCUS_13970 196425 197195 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_13970 198301 197261 gene locus_tag LOCUS_13980 gene dusA 198301 197261 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA5 protein_id gnl|my_center|LOCUS_13980 198405 199562 gene locus_tag LOCUS_13990 198405 199562 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693486.1 protein_id gnl|my_center|LOCUS_13990 199843 199559 gene locus_tag LOCUS_14000 199843 199559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 200053 201189 gene locus_tag LOCUS_14010 200053 201189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 201177 201566 gene locus_tag LOCUS_14020 201177 201566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 201827 202162 gene locus_tag LOCUS_14030 201827 202162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 202159 203721 gene locus_tag LOCUS_14040 202159 203721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 203731 203907 gene locus_tag LOCUS_14050 203731 203907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 205113 203926 gene locus_tag LOCUS_14060 205113 203926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 206037 205117 gene locus_tag LOCUS_14070 206037 205117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 208019 206034 gene locus_tag LOCUS_14080 208019 206034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 208958 208023 gene locus_tag LOCUS_14090 208958 208023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 209389 210039 gene locus_tag LOCUS_14100 209389 210039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 211251 210061 gene locus_tag LOCUS_14110 gene ygaY 211251 210061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208380.1 protein_id gnl|my_center|LOCUS_14110 212411 211467 gene locus_tag LOCUS_14120 212411 211467 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208382.1 protein_id gnl|my_center|LOCUS_14120 213309 214436 gene locus_tag LOCUS_14130 gene pntA1 213309 214436 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_14130 214448 214771 gene locus_tag LOCUS_14140 214448 214771 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921136.1 protein_id gnl|my_center|LOCUS_14140 214775 216232 gene locus_tag LOCUS_14150 gene pntB 214775 216232 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB1 protein_id gnl|my_center|LOCUS_14150 217207 216854 gene locus_tag LOCUS_14160 gene rsfS 217207 216854 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB4 protein_id gnl|my_center|LOCUS_14160 218133 217345 gene locus_tag LOCUS_14170 gene hyi 218133 217345 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB5 protein_id gnl|my_center|LOCUS_14170 219019 218153 gene locus_tag LOCUS_14180 gene glxR 219019 218153 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208388.1 protein_id gnl|my_center|LOCUS_14180 219823 219035 gene locus_tag LOCUS_14190 gene ech1 219823 219035 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_14190 222744 219940 gene locus_tag LOCUS_14200 gene barA 222744 219940 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 protein_id gnl|my_center|LOCUS_14200 222897 223823 gene locus_tag LOCUS_14210 gene cysM 222897 223823 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_14210 223841 224659 gene locus_tag LOCUS_14220 223841 224659 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 protein_id gnl|my_center|LOCUS_14220 224669 226060 gene locus_tag LOCUS_14230 gene rlmD 224669 226060 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC1 protein_id gnl|my_center|LOCUS_14230 226094 228400 gene locus_tag LOCUS_14240 gene relA 226094 228400 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_14240 229264 228488 gene locus_tag LOCUS_14250 229264 228488 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_14250 229380 230162 gene locus_tag LOCUS_14260 gene mazG 229380 230162 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_14260 230176 230595 gene locus_tag LOCUS_14270 230176 230595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 230731 232182 gene locus_tag LOCUS_14280 gene pcnB 230731 232182 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC6 protein_id gnl|my_center|LOCUS_14280 232179 232667 gene locus_tag LOCUS_14290 gene folK 232179 232667 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 protein_id gnl|my_center|LOCUS_14290 232705 233514 gene locus_tag LOCUS_14300 gene panB 232705 233514 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC8 protein_id gnl|my_center|LOCUS_14300 233518 234363 gene locus_tag LOCUS_14310 gene panC 233518 234363 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC9 protein_id gnl|my_center|LOCUS_14310 234396 235247 gene locus_tag LOCUS_14320 234396 235247 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND0 protein_id gnl|my_center|LOCUS_14320 235244 235513 gene locus_tag LOCUS_14330 gene ptsO 235244 235513 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984428.1 protein_id gnl|my_center|LOCUS_14330 235516 236052 gene locus_tag LOCUS_14340 235516 236052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208401.1 protein_id gnl|my_center|LOCUS_14340 236360 236109 gene locus_tag LOCUS_14350 236360 236109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 protein_id gnl|my_center|LOCUS_14350 236901 236479 gene locus_tag LOCUS_14360 236901 236479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409385.1 protein_id gnl|my_center|LOCUS_14360 238622 236979 gene locus_tag LOCUS_14370 gene alkK 238622 236979 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208402.1 protein_id gnl|my_center|LOCUS_14370 239014 240936 gene locus_tag LOCUS_14380 gene thrS 239014 240936 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND4 protein_id gnl|my_center|LOCUS_14380 241080 241493 gene locus_tag LOCUS_14390 gene infC 241080 241493 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117275.1 protein_id gnl|my_center|LOCUS_14390 242036 241560 gene locus_tag LOCUS_14400 gene ibpA 242036 241560 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_14400 242364 242981 gene locus_tag LOCUS_14410 gene yfcG 242364 242981 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_14410 243053 243475 gene locus_tag LOCUS_14420 243053 243475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_14420 244214 243516 gene locus_tag LOCUS_14430 244214 243516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 245644 244382 gene locus_tag LOCUS_14440 gene entS 245644 244382 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_14440 245882 246076 gene locus_tag LOCUS_14450 gene rpmI 245882 246076 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_14450 246088 246447 gene locus_tag LOCUS_14460 gene rplT 246088 246447 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE1 protein_id gnl|my_center|LOCUS_14460 246780 246550 gene locus_tag LOCUS_14470 246780 246550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 247863 246826 gene locus_tag LOCUS_14480 247863 246826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208406.1 protein_id gnl|my_center|LOCUS_14480 248020 249000 gene locus_tag LOCUS_14490 gene pheS 248020 249000 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE3 protein_id gnl|my_center|LOCUS_14490 249035 251416 gene locus_tag LOCUS_14500 gene pheT 249035 251416 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE4 protein_id gnl|my_center|LOCUS_14500 251413 251709 gene locus_tag LOCUS_14510 gene ihfA 251413 251709 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE5 protein_id gnl|my_center|LOCUS_14510 252270 251911 gene locus_tag LOCUS_14520 252270 251911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 253961 252699 gene locus_tag LOCUS_14530 gene rho 253961 252699 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE8 protein_id gnl|my_center|LOCUS_14530 254621 254295 gene locus_tag LOCUS_14540 gene trxA 254621 254295 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE9 protein_id gnl|my_center|LOCUS_14540 254886 256406 gene locus_tag LOCUS_14550 gene ppx 254886 256406 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_14550 256442 257266 gene locus_tag LOCUS_14560 gene accA 256442 257266 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF1 protein_id gnl|my_center|LOCUS_14560 257323 258567 gene locus_tag LOCUS_14570 gene mesJ 257323 258567 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF2 protein_id gnl|my_center|LOCUS_14570 258632 259414 gene locus_tag LOCUS_14580 gene proC 258632 259414 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_14580 259441 260010 gene locus_tag LOCUS_14590 259441 260010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_14590 262840 260081 gene locus_tag LOCUS_14600 gene polA 262840 260081 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_14600 263090 265843 gene locus_tag LOCUS_14610 263090 265843 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 protein_id gnl|my_center|LOCUS_14610 266756 265833 gene locus_tag LOCUS_14620 266756 265833 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066312.1 protein_id gnl|my_center|LOCUS_14620 267587 266766 gene locus_tag LOCUS_14630 267587 266766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804297.1 protein_id gnl|my_center|LOCUS_14630 267691 269178 gene locus_tag LOCUS_14640 gene xcpR 267691 269178 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_14640 269675 269250 gene locus_tag LOCUS_14650 gene ohr 269675 269250 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208414.1 protein_id gnl|my_center|LOCUS_14650 270597 269773 gene locus_tag LOCUS_14660 270597 269773 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 protein_id gnl|my_center|LOCUS_14660 271151 270621 gene locus_tag LOCUS_14670 271151 270621 CDS product anti-anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 protein_id gnl|my_center|LOCUS_14670 272263 271265 gene locus_tag LOCUS_14680 gene rsbP 272263 271265 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117221.1 protein_id gnl|my_center|LOCUS_14680 273263 272358 gene locus_tag LOCUS_14690 gene vacJ 273263 272358 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208418.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence05 246 97 gene locus_tag LOCUS_14700 246 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 389 1660 gene locus_tag LOCUS_14710 389 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1699 3801 gene locus_tag LOCUS_14720 gene paxB 1699 3801 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 protein_id gnl|my_center|LOCUS_14720 3798 4988 gene locus_tag LOCUS_14730 gene cyaD 3798 4988 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 protein_id gnl|my_center|LOCUS_14730 5083 5679 gene locus_tag LOCUS_14740 5083 5679 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206260.1 protein_id gnl|my_center|LOCUS_14740 5672 6289 gene locus_tag LOCUS_14750 5672 6289 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206261.1 protein_id gnl|my_center|LOCUS_14750 6442 7284 gene locus_tag LOCUS_14760 6442 7284 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115820.1 protein_id gnl|my_center|LOCUS_14760 8139 7471 gene locus_tag LOCUS_14770 8139 7471 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206262.1 protein_id gnl|my_center|LOCUS_14770 8978 8286 gene locus_tag LOCUS_14780 8978 8286 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115771.1 protein_id gnl|my_center|LOCUS_14780 9456 9133 gene locus_tag LOCUS_14790 gene fdxA 9456 9133 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_14790 12771 10120 gene locus_tag LOCUS_14800 gene mutS 12771 10120 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIZ0 protein_id gnl|my_center|LOCUS_14800 13873 13679 gene locus_tag LOCUS_14810 13873 13679 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206222.1 protein_id gnl|my_center|LOCUS_14810 14025 16502 gene locus_tag LOCUS_14820 gene actP 14025 16502 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206223.1 protein_id gnl|my_center|LOCUS_14820 16566 16958 gene locus_tag LOCUS_14830 gene zntR 16566 16958 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206224.1 protein_id gnl|my_center|LOCUS_14830 17505 19295 gene locus_tag LOCUS_14840 17505 19295 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904087.1 protein_id gnl|my_center|LOCUS_14840 19288 20697 gene locus_tag LOCUS_14850 gene rhbE 19288 20697 CDS product rhizobactin siderophore biosynthesis protein RhbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q8 protein_id gnl|my_center|LOCUS_14850 20711 22147 gene locus_tag LOCUS_14860 20711 22147 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267796.1 protein_id gnl|my_center|LOCUS_14860 22170 24011 gene locus_tag LOCUS_14870 22170 24011 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267797.1 protein_id gnl|my_center|LOCUS_14870 24023 25948 gene locus_tag LOCUS_14880 24023 25948 CDS product siderophore biosynthesis protein IucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267799.1 protein_id gnl|my_center|LOCUS_14880 25969 26754 gene locus_tag LOCUS_14890 25969 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 protein_id gnl|my_center|LOCUS_14890 26769 27419 gene locus_tag LOCUS_14900 26769 27419 CDS product S-adenosylmethionine--2-demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267804.1 protein_id gnl|my_center|LOCUS_14900 27419 28018 gene locus_tag LOCUS_14910 gene rhbD 27419 28018 CDS product rhizobactin siderophore biosynthesis protein RhbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3Q9 protein_id gnl|my_center|LOCUS_14910 28218 30416 gene locus_tag LOCUS_14920 gene iutA 28218 30416 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_14920 30500 30772 gene locus_tag LOCUS_14930 30500 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 30784 32301 gene locus_tag LOCUS_14940 30784 32301 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206646.1 protein_id gnl|my_center|LOCUS_14940 32298 32651 gene locus_tag LOCUS_14950 32298 32651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 33230 32748 gene locus_tag LOCUS_14960 33230 32748 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_14960 33734 34498 gene locus_tag LOCUS_14970 33734 34498 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_14970 34574 35356 gene locus_tag LOCUS_14980 gene menB 34574 35356 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 protein_id gnl|my_center|LOCUS_14980 35369 36526 gene locus_tag LOCUS_14990 35369 36526 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_14990 36581 38215 gene locus_tag LOCUS_15000 gene fadK 36581 38215 CDS product short-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38135 protein_id gnl|my_center|LOCUS_15000 40155 38974 gene locus_tag LOCUS_15010 40155 38974 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206489.1 protein_id gnl|my_center|LOCUS_15010 41010 40327 gene locus_tag LOCUS_15020 41010 40327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 protein_id gnl|my_center|LOCUS_15020 41303 42217 gene locus_tag LOCUS_15030 41303 42217 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931026.1 protein_id gnl|my_center|LOCUS_15030 42783 43277 gene locus_tag LOCUS_15040 42783 43277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 44474 43578 gene locus_tag LOCUS_15050 44474 43578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 45670 44639 gene locus_tag LOCUS_15060 45670 44639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 46293 45994 gene locus_tag LOCUS_15070 46293 45994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 46629 47141 gene locus_tag LOCUS_15080 46629 47141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 48857 47523 gene locus_tag LOCUS_15090 48857 47523 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206829.1 protein_id gnl|my_center|LOCUS_15090 49537 50523 gene locus_tag LOCUS_15100 49537 50523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 protein_id gnl|my_center|LOCUS_15100 50545 51588 gene locus_tag LOCUS_15110 gene metE 50545 51588 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_15110 51774 52265 gene locus_tag LOCUS_15120 gene rutF 51774 52265 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_15120 53046 52360 gene locus_tag LOCUS_15130 gene yrhP 53046 52360 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207414.1 protein_id gnl|my_center|LOCUS_15130 55069 53501 gene locus_tag LOCUS_15140 55069 53501 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_15140 55282 59270 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaaatcatctaggcgatgacgaac 60321 59368 gene locus_tag LOCUS_15150 gene cas1 60321 59368 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHN1 protein_id gnl|my_center|LOCUS_15150 60944 60333 gene locus_tag LOCUS_15160 60944 60333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 62005 60944 gene locus_tag LOCUS_15170 62005 60944 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_15170 62919 62035 gene locus_tag LOCUS_15180 62919 62035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 64082 62916 gene locus_tag LOCUS_15190 64082 62916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 64510 64193 gene locus_tag LOCUS_15200 64510 64193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 65081 68209 gene locus_tag LOCUS_15210 65081 68209 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101563.1 protein_id gnl|my_center|LOCUS_15210 69164 68274 gene locus_tag LOCUS_15220 gene oxyR 69164 68274 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206546.1 protein_id gnl|my_center|LOCUS_15220 69261 69692 gene locus_tag LOCUS_15230 69261 69692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090812.1 protein_id gnl|my_center|LOCUS_15230 70153 71832 gene locus_tag LOCUS_15240 70153 71832 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206490.1 protein_id gnl|my_center|LOCUS_15240 71835 72731 gene locus_tag LOCUS_15250 gene mdcB 71835 72731 CDS product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL22 protein_id gnl|my_center|LOCUS_15250 72719 73021 gene locus_tag LOCUS_15260 gene mdcC 72719 73021 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLH8 protein_id gnl|my_center|LOCUS_15260 73011 73862 gene locus_tag LOCUS_15270 gene mdcD 73011 73862 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206493.1 protein_id gnl|my_center|LOCUS_15270 73859 74686 gene locus_tag LOCUS_15280 gene mdcE 73859 74686 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206494.1 protein_id gnl|my_center|LOCUS_15280 74677 75297 gene locus_tag LOCUS_15290 gene mdcG 74677 75297 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206495.1 protein_id gnl|my_center|LOCUS_15290 75299 76225 gene locus_tag LOCUS_15300 gene mdcH 75299 76225 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLI2 protein_id gnl|my_center|LOCUS_15300 76280 76681 gene locus_tag LOCUS_15310 gene madL 76280 76681 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114391.1 protein_id gnl|my_center|LOCUS_15310 76718 77479 gene locus_tag LOCUS_15320 gene madM 76718 77479 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338775.1 protein_id gnl|my_center|LOCUS_15320 78452 77532 gene locus_tag LOCUS_15330 gene mdcR 78452 77532 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206497.1 protein_id gnl|my_center|LOCUS_15330 79457 78669 gene locus_tag LOCUS_15340 79457 78669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207105.1 protein_id gnl|my_center|LOCUS_15340 79823 80809 gene locus_tag LOCUS_15350 gene xylS 79823 80809 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113834.1 protein_id gnl|my_center|LOCUS_15350 82224 80881 gene locus_tag LOCUS_15360 gene pcaK 82224 80881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206707.1 protein_id gnl|my_center|LOCUS_15360 83616 82696 gene locus_tag LOCUS_15370 gene catA 83616 82696 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_15370 84752 83718 gene locus_tag LOCUS_15380 gene antC 84752 83718 CDS product anthranilate dioxygenase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206715.1 protein_id gnl|my_center|LOCUS_15380 85254 84763 gene locus_tag LOCUS_15390 gene antB 85254 84763 CDS product anthranilate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076809.1 protein_id gnl|my_center|LOCUS_15390 86672 85257 gene locus_tag LOCUS_15400 gene antA 86672 85257 CDS product anthranilate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206716.1 protein_id gnl|my_center|LOCUS_15400 87650 86838 gene locus_tag LOCUS_15410 gene kdgR 87650 86838 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206030.1 protein_id gnl|my_center|LOCUS_15410 87904 88209 gene locus_tag LOCUS_15420 gene ndoA 87904 88209 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 protein_id gnl|my_center|LOCUS_15420 88237 88536 gene locus_tag LOCUS_15430 88237 88536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070730.1 protein_id gnl|my_center|LOCUS_15430 88553 89620 gene locus_tag LOCUS_15440 gene vanA 88553 89620 CDS product 3-phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070727.1 protein_id gnl|my_center|LOCUS_15440 89613 90377 gene locus_tag LOCUS_15450 89613 90377 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206031.1 protein_id gnl|my_center|LOCUS_15450 90389 91318 gene locus_tag LOCUS_15460 gene mcpII 90389 91318 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206032.1 protein_id gnl|my_center|LOCUS_15460 91349 92560 gene locus_tag LOCUS_15470 gene thcD 91349 92560 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206033.1 protein_id gnl|my_center|LOCUS_15470 92603 93826 gene locus_tag LOCUS_15480 gene gudP 92603 93826 CDS product D-galactonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206034.1 protein_id gnl|my_center|LOCUS_15480 93849 94370 gene locus_tag LOCUS_15490 93849 94370 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206035.1 protein_id gnl|my_center|LOCUS_15490 94407 95231 gene locus_tag LOCUS_15500 gene catD 94407 95231 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 protein_id gnl|my_center|LOCUS_15500 95247 96041 gene locus_tag LOCUS_15510 gene pecR 95247 96041 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009973.1 protein_id gnl|my_center|LOCUS_15510 96057 96848 gene locus_tag LOCUS_15520 gene nadX 96057 96848 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGA5 protein_id gnl|my_center|LOCUS_15520 96862 98328 gene locus_tag LOCUS_15530 gene betB 96862 98328 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206038.1 protein_id gnl|my_center|LOCUS_15530 98367 100007 gene locus_tag LOCUS_15540 98367 100007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206039.1 protein_id gnl|my_center|LOCUS_15540 100163 101359 gene locus_tag LOCUS_15550 100163 101359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206040.1 protein_id gnl|my_center|LOCUS_15550 101664 101461 gene locus_tag LOCUS_15560 101664 101461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 101798 102277 gene locus_tag LOCUS_15570 gene def2 101798 102277 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGB1 protein_id gnl|my_center|LOCUS_15570 102635 103438 gene locus_tag LOCUS_15580 102635 103438 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206444.1 protein_id gnl|my_center|LOCUS_15580 105457 103496 gene locus_tag LOCUS_15590 105457 103496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206519.1 protein_id gnl|my_center|LOCUS_15590 106624 105650 gene locus_tag LOCUS_15600 106624 105650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206520.1 protein_id gnl|my_center|LOCUS_15600 107552 106734 gene locus_tag LOCUS_15610 gene cysE 107552 106734 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_15610 108387 107545 gene locus_tag LOCUS_15620 gene trmJ 108387 107545 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLL5 protein_id gnl|my_center|LOCUS_15620 111973 108407 gene locus_tag LOCUS_15630 gene dnaE 111973 108407 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLL6 protein_id gnl|my_center|LOCUS_15630 112736 112416 gene locus_tag LOCUS_15640 112736 112416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 113552 112857 gene locus_tag LOCUS_15650 gene metN 113552 112857 CDS product methionine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207148.1 protein_id gnl|my_center|LOCUS_15650 114574 113549 gene locus_tag LOCUS_15660 gene metN2 114574 113549 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW9 protein_id gnl|my_center|LOCUS_15660 115519 114650 gene locus_tag LOCUS_15670 gene yhcJ 115519 114650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207147.1 protein_id gnl|my_center|LOCUS_15670 117250 116015 gene locus_tag LOCUS_15680 117250 116015 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206525.1 protein_id gnl|my_center|LOCUS_15680 117406 117825 gene locus_tag LOCUS_15690 gene msrB 117406 117825 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM0 protein_id gnl|my_center|LOCUS_15690 117822 118304 gene locus_tag LOCUS_15700 gene gpo 117822 118304 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_15700 119528 118359 gene locus_tag LOCUS_15710 gene dapL 119528 118359 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 protein_id gnl|my_center|LOCUS_15710 122220 119554 gene locus_tag LOCUS_15720 gene glnD 122220 119554 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM5 protein_id gnl|my_center|LOCUS_15720 123451 122243 gene locus_tag LOCUS_15730 gene purT 123451 122243 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM6 protein_id gnl|my_center|LOCUS_15730 123917 123576 gene locus_tag LOCUS_15740 123917 123576 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002133404.1 protein_id gnl|my_center|LOCUS_15740 124660 123914 gene locus_tag LOCUS_15750 124660 123914 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206530.1 protein_id gnl|my_center|LOCUS_15750 124770 125252 gene locus_tag LOCUS_15760 124770 125252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483316.1 protein_id gnl|my_center|LOCUS_15760 126282 125320 gene locus_tag LOCUS_15770 gene mdcF 126282 125320 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_15770 127570 126479 gene locus_tag LOCUS_15780 gene ychF 127570 126479 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN4 protein_id gnl|my_center|LOCUS_15780 128335 127676 gene locus_tag LOCUS_15790 gene metI 128335 127676 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069679.1 protein_id gnl|my_center|LOCUS_15790 129386 128316 gene locus_tag LOCUS_15800 gene metN1 129386 128316 CDS product methionine import ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLN6 protein_id gnl|my_center|LOCUS_15800 130234 129398 gene locus_tag LOCUS_15810 gene metQ 130234 129398 CDS product methionine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206535.1 protein_id gnl|my_center|LOCUS_15810 131075 130245 gene locus_tag LOCUS_15820 131075 130245 CDS product methionine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206536.1 protein_id gnl|my_center|LOCUS_15820 132517 131105 gene locus_tag LOCUS_15830 gene soxA 132517 131105 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206537.1 protein_id gnl|my_center|LOCUS_15830 133737 132517 gene locus_tag LOCUS_15840 gene soxC 133737 132517 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206538.1 protein_id gnl|my_center|LOCUS_15840 134951 133749 gene locus_tag LOCUS_15850 gene soxC 134951 133749 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206539.1 protein_id gnl|my_center|LOCUS_15850 134969 135109 gene locus_tag LOCUS_15860 134969 135109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 135331 136095 gene locus_tag LOCUS_15870 135331 136095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 136577 137059 gene locus_tag LOCUS_15880 gene lrp 136577 137059 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050132.1 protein_id gnl|my_center|LOCUS_15880 137859 137110 gene locus_tag LOCUS_15890 137859 137110 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLP9 protein_id gnl|my_center|LOCUS_15890 138683 138450 gene locus_tag LOCUS_15900 138683 138450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 139061 139927 gene locus_tag LOCUS_15910 139061 139927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 140327 140251 gene locus_tag LOCUS_t00270 140327 140251 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 141033 141245 gene locus_tag LOCUS_15920 141033 141245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 142302 141301 gene locus_tag LOCUS_15930 gene bioB 142302 141301 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM71 protein_id gnl|my_center|LOCUS_15930 142628 142455 gene locus_tag LOCUS_15940 142628 142455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 143830 142739 gene locus_tag LOCUS_15950 gene queG 143830 142739 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM72 protein_id gnl|my_center|LOCUS_15950 143855 145318 gene locus_tag LOCUS_15960 gene yjeF 143855 145318 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM73 protein_id gnl|my_center|LOCUS_15960 145932 145315 gene locus_tag LOCUS_15970 gene leuE 145932 145315 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115157.1 protein_id gnl|my_center|LOCUS_15970 146500 145955 gene locus_tag LOCUS_15980 gene ruvC 146500 145955 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM75 protein_id gnl|my_center|LOCUS_15980 146621 147202 gene locus_tag LOCUS_15990 gene fxsA 146621 147202 CDS product FxsA cytoplasmic membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206565.1 protein_id gnl|my_center|LOCUS_15990 147456 147259 gene locus_tag LOCUS_16000 147456 147259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 149300 148134 gene locus_tag LOCUS_16010 gene metK 149300 148134 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Z0 protein_id gnl|my_center|LOCUS_16010 149691 151679 gene locus_tag LOCUS_16020 gene tktA 149691 151679 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM84 protein_id gnl|my_center|LOCUS_16020 151840 152391 gene locus_tag LOCUS_16030 151840 152391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 protein_id gnl|my_center|LOCUS_16030 152667 153266 gene locus_tag LOCUS_16040 gene yceI 152667 153266 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 protein_id gnl|my_center|LOCUS_16040 154084 153359 gene locus_tag LOCUS_16050 gene yfeJ 154084 153359 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 protein_id gnl|my_center|LOCUS_16050 154987 154181 gene locus_tag LOCUS_16060 gene eutC 154987 154181 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH73 protein_id gnl|my_center|LOCUS_16060 156382 154997 gene locus_tag LOCUS_16070 gene eutB 156382 154997 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207088.1 protein_id gnl|my_center|LOCUS_16070 157835 156399 gene locus_tag LOCUS_16080 gene eutP 157835 156399 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207087.1 protein_id gnl|my_center|LOCUS_16080 159557 158046 gene locus_tag LOCUS_16090 gene aldA 159557 158046 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207086.1 protein_id gnl|my_center|LOCUS_16090 159711 160901 gene locus_tag LOCUS_16100 159711 160901 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_16100 161835 160906 gene locus_tag LOCUS_16110 161835 160906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_16110 163206 162034 gene locus_tag LOCUS_16120 gene dhaT 163206 162034 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_16120 163416 165143 gene locus_tag LOCUS_16130 gene pif1 163416 165143 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_16130 166442 165612 gene locus_tag LOCUS_16140 gene thiM 166442 165612 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH64 protein_id gnl|my_center|LOCUS_16140 167647 166484 gene locus_tag LOCUS_16150 167647 166484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207082.1 protein_id gnl|my_center|LOCUS_16150 167955 170561 gene locus_tag LOCUS_16160 gene pepN 167955 170561 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207081.1 protein_id gnl|my_center|LOCUS_16160 171126 170683 gene locus_tag LOCUS_16170 171126 170683 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH28 protein_id gnl|my_center|LOCUS_16170 171822 172199 gene locus_tag LOCUS_16180 171822 172199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 172836 173279 gene locus_tag LOCUS_16190 172836 173279 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_16190 173304 173648 gene locus_tag LOCUS_16200 173304 173648 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087001.1 protein_id gnl|my_center|LOCUS_16200 174847 173645 gene locus_tag LOCUS_16210 gene benE2 174847 173645 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207052.1 protein_id gnl|my_center|LOCUS_16210 175632 174979 gene locus_tag LOCUS_16220 gene leuE 175632 174979 CDS product leucine export protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207051.1 protein_id gnl|my_center|LOCUS_16220 176700 175711 gene locus_tag LOCUS_16230 gene tal 176700 175711 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH21 protein_id gnl|my_center|LOCUS_16230 177680 176793 gene locus_tag LOCUS_16240 gene yahB 177680 176793 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207049.1 protein_id gnl|my_center|LOCUS_16240 177768 178193 gene locus_tag LOCUS_16250 177768 178193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207048.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16250 179912 178422 gene locus_tag LOCUS_16260 gene fadI 179912 178422 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 protein_id gnl|my_center|LOCUS_16260 180152 181543 gene locus_tag LOCUS_16270 180152 181543 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_16270 181680 182534 gene locus_tag LOCUS_16280 181680 182534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_16280 182619 183881 gene locus_tag LOCUS_16290 gene lipL 182619 183881 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_16290 183907 184866 gene locus_tag LOCUS_16300 183907 184866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113669.1 protein_id gnl|my_center|LOCUS_16300 185047 187212 gene locus_tag LOCUS_16310 gene dnaX 185047 187212 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207039.1 protein_id gnl|my_center|LOCUS_16310 187652 187218 gene locus_tag LOCUS_16320 187652 187218 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207037.1 protein_id gnl|my_center|LOCUS_16320 188809 187649 gene locus_tag LOCUS_16330 gene gbsB 188809 187649 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207036.1 protein_id gnl|my_center|LOCUS_16330 188926 189435 gene locus_tag LOCUS_16340 gene ptpA 188926 189435 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207034.1 protein_id gnl|my_center|LOCUS_16340 189407 190489 gene locus_tag LOCUS_16350 gene murB 189407 190489 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGJ6 protein_id gnl|my_center|LOCUS_16350 190497 191636 gene locus_tag LOCUS_16360 190497 191636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207032.1 protein_id gnl|my_center|LOCUS_16360 191636 192667 gene locus_tag LOCUS_16370 gene pldB 191636 192667 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115207.1 protein_id gnl|my_center|LOCUS_16370 193652 192783 gene locus_tag LOCUS_16380 gene tehB 193652 192783 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212046.1 protein_id gnl|my_center|LOCUS_16380 195399 193729 gene locus_tag LOCUS_16390 195399 193729 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207029.1 protein_id gnl|my_center|LOCUS_16390 196741 195569 gene locus_tag LOCUS_16400 gene xseA 196741 195569 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206583.1 protein_id gnl|my_center|LOCUS_16400 197365 196772 gene locus_tag LOCUS_16410 gene maf 197365 196772 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA6 protein_id gnl|my_center|LOCUS_16410 197748 197365 gene locus_tag LOCUS_16420 197748 197365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_16420 197888 199075 gene locus_tag LOCUS_16430 gene pgk 197888 199075 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA8 protein_id gnl|my_center|LOCUS_16430 199215 199514 gene locus_tag LOCUS_16440 199215 199514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 199636 200673 gene locus_tag LOCUS_16450 gene fba 199636 200673 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_16450 200762 201616 gene locus_tag LOCUS_16460 200762 201616 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_16460 202575 201922 gene locus_tag LOCUS_16470 gene nfnB 202575 201922 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 protein_id gnl|my_center|LOCUS_16470 203416 202697 gene locus_tag LOCUS_16480 gene lpxH 203416 202697 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH78 protein_id gnl|my_center|LOCUS_16480 203944 203435 gene locus_tag LOCUS_16490 gene ppiB 203944 203435 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH77 protein_id gnl|my_center|LOCUS_16490 204112 205836 gene locus_tag LOCUS_16500 gene glnS2 204112 205836 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH76 protein_id gnl|my_center|LOCUS_16500 205855 206670 gene locus_tag LOCUS_16510 205855 206670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200086.1 protein_id gnl|my_center|LOCUS_16510 207205 206672 gene locus_tag LOCUS_16520 207205 206672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206573.1 protein_id gnl|my_center|LOCUS_16520 207486 208268 gene locus_tag LOCUS_16530 gene rutD 207486 208268 CDS product putative aminoacrylate hydrolase RutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN76 protein_id gnl|my_center|LOCUS_16530 208289 208888 gene locus_tag LOCUS_16540 gene rutE 208289 208888 CDS product putative malonic semialdehyde reductase RutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU27 protein_id gnl|my_center|LOCUS_16540 209676 210788 gene locus_tag LOCUS_16550 gene rutA 209676 210788 CDS product pyrimidine monooxygenase RutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN78 protein_id gnl|my_center|LOCUS_16550 210785 211525 gene locus_tag LOCUS_16560 gene rutB 210785 211525 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN79 protein_id gnl|my_center|LOCUS_16560 211561 211944 gene locus_tag LOCUS_16570 gene rutC 211561 211944 CDS product putative aminoacrylate peracid reductase RutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN80 protein_id gnl|my_center|LOCUS_16570 212044 212628 gene locus_tag LOCUS_16580 gene rutF 212044 212628 CDS product FMN reductase (NADH) RutF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN81 protein_id gnl|my_center|LOCUS_16580 212670 214022 gene locus_tag LOCUS_16590 gene rutG 212670 214022 CDS product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207571.1 protein_id gnl|my_center|LOCUS_16590 214091 214984 gene locus_tag LOCUS_16600 214091 214984 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_16600 215305 215078 gene locus_tag LOCUS_16610 215305 215078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011679.1 protein_id gnl|my_center|LOCUS_16610 216631 215546 gene locus_tag LOCUS_16620 gene trmA 216631 215546 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_16620 218911 216746 gene locus_tag LOCUS_16630 gene yncD 218911 216746 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 protein_id gnl|my_center|LOCUS_16630 219686 219285 gene locus_tag LOCUS_16640 gene yedX 219686 219285 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIG6 protein_id gnl|my_center|LOCUS_16640 220200 219691 gene locus_tag LOCUS_16650 220200 219691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207181.1 protein_id gnl|my_center|LOCUS_16650 220309 220980 gene locus_tag LOCUS_16660 gene irlR 220309 220980 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207180.1 protein_id gnl|my_center|LOCUS_16660 220977 222386 gene locus_tag LOCUS_16670 gene czcS 220977 222386 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207179.1 protein_id gnl|my_center|LOCUS_16670 223096 222395 gene locus_tag LOCUS_16680 gene npdA 223096 222395 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM95 protein_id gnl|my_center|LOCUS_16680 224278 223181 gene locus_tag LOCUS_16690 224278 223181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889406.1 protein_id gnl|my_center|LOCUS_16690 224525 225286 gene locus_tag LOCUS_16700 224525 225286 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097562.1 protein_id gnl|my_center|LOCUS_16700 226657 225362 gene locus_tag LOCUS_16710 gene pcaT 226657 225362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206689.1 protein_id gnl|my_center|LOCUS_16710 228369 226957 gene locus_tag LOCUS_16720 228369 226957 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206708.1 protein_id gnl|my_center|LOCUS_16720 229746 228388 gene locus_tag LOCUS_16730 gene benK 229746 228388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_16730 230851 230075 gene locus_tag LOCUS_16740 gene catD 230851 230075 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206900.1 protein_id gnl|my_center|LOCUS_16740 232077 230872 gene locus_tag LOCUS_16750 gene catF 232077 230872 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206899.1 protein_id gnl|my_center|LOCUS_16750 232776 232123 gene locus_tag LOCUS_16760 gene pcaJ 232776 232123 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_16760 233481 232795 gene locus_tag LOCUS_16770 gene catI 233481 232795 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 protein_id gnl|my_center|LOCUS_16770 234732 233512 gene locus_tag LOCUS_16780 gene benE 234732 233512 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206210.1 protein_id gnl|my_center|LOCUS_16780 235580 234798 gene locus_tag LOCUS_16790 gene benD 235580 234798 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206211.1 protein_id gnl|my_center|LOCUS_16790 236614 235598 gene locus_tag LOCUS_16800 gene benC 236614 235598 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206212.1 protein_id gnl|my_center|LOCUS_16800 237197 236688 gene locus_tag LOCUS_16810 gene benB 237197 236688 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206213.1 protein_id gnl|my_center|LOCUS_16810 238576 237194 gene locus_tag LOCUS_16820 gene benA 238576 237194 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119889.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence06 879 310 gene locus_tag LOCUS_16830 gene ppiA 879 310 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPD9 protein_id gnl|my_center|LOCUS_16830 979 1644 gene locus_tag LOCUS_16840 979 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2790 1720 gene locus_tag LOCUS_16850 gene estA 2790 1720 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207659.1 protein_id gnl|my_center|LOCUS_16850 2996 3316 gene locus_tag LOCUS_16860 2996 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4050 3769 gene locus_tag LOCUS_16870 4050 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4666 5220 gene locus_tag LOCUS_16880 gene grpE 4666 5220 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE5 protein_id gnl|my_center|LOCUS_16880 5338 7284 gene locus_tag LOCUS_16890 gene dnaK 5338 7284 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE6 protein_id gnl|my_center|LOCUS_16890 7451 7846 gene locus_tag LOCUS_16900 7451 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207668.1 protein_id gnl|my_center|LOCUS_16900 9194 7911 gene locus_tag LOCUS_16910 gene mltB 9194 7911 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_16910 10992 9871 gene locus_tag LOCUS_16920 gene purK 10992 9871 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF3 protein_id gnl|my_center|LOCUS_16920 11520 11008 gene locus_tag LOCUS_16930 gene purE 11520 11008 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_16930 12001 11705 gene locus_tag LOCUS_16940 12001 11705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207671.1 protein_id gnl|my_center|LOCUS_16940 12328 13692 gene locus_tag LOCUS_16950 gene mpl 12328 13692 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF6 protein_id gnl|my_center|LOCUS_16950 15390 13732 gene locus_tag LOCUS_16960 gene fadD 15390 13732 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206871.1 protein_id gnl|my_center|LOCUS_16960 17370 15568 gene locus_tag LOCUS_16970 gene acdB 17370 15568 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206443.1 protein_id gnl|my_center|LOCUS_16970 19062 17689 gene locus_tag LOCUS_16980 gene fadL 19062 17689 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206872.1 protein_id gnl|my_center|LOCUS_16980 20486 19209 gene locus_tag LOCUS_16990 gene dcaK 20486 19209 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206439.1 protein_id gnl|my_center|LOCUS_16990 20945 21718 gene locus_tag LOCUS_17000 gene dcaE 20945 21718 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206438.1 protein_id gnl|my_center|LOCUS_17000 21734 23251 gene locus_tag LOCUS_17010 gene dcaH 21734 23251 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206436.1 protein_id gnl|my_center|LOCUS_17010 23590 23309 gene locus_tag LOCUS_17020 23590 23309 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017121.1 protein_id gnl|my_center|LOCUS_17020 23976 24932 gene locus_tag LOCUS_17030 gene terC 23976 24932 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207675.1 protein_id gnl|my_center|LOCUS_17030 25055 26380 gene locus_tag LOCUS_17040 gene guaD 25055 26380 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_17040 26597 27124 gene locus_tag LOCUS_17050 gene hpt 26597 27124 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115408.1 protein_id gnl|my_center|LOCUS_17050 27331 27600 gene locus_tag LOCUS_17060 27331 27600 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 protein_id gnl|my_center|LOCUS_17060 28357 27659 gene locus_tag LOCUS_17070 gene dsbC 28357 27659 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207679.1 protein_id gnl|my_center|LOCUS_17070 29460 28471 gene locus_tag LOCUS_17080 gene czcD 29460 28471 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039045.1 protein_id gnl|my_center|LOCUS_17080 29514 29777 gene locus_tag LOCUS_17090 29514 29777 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115414.1 protein_id gnl|my_center|LOCUS_17090 29953 31095 gene locus_tag LOCUS_17100 29953 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 32798 31443 gene locus_tag LOCUS_17110 gene mnmE 32798 31443 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPG9 protein_id gnl|my_center|LOCUS_17110 34655 32901 gene locus_tag LOCUS_17120 gene yidC 34655 32901 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH0 protein_id gnl|my_center|LOCUS_17120 34981 34661 gene locus_tag LOCUS_17130 34981 34661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 35391 34990 gene locus_tag LOCUS_17140 gene rnpA 35391 34990 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH1 protein_id gnl|my_center|LOCUS_17140 35548 35414 gene locus_tag LOCUS_17150 gene rpmH 35548 35414 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH2 protein_id gnl|my_center|LOCUS_17150 36211 37593 gene locus_tag LOCUS_17160 gene dnaA 36211 37593 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH3 protein_id gnl|my_center|LOCUS_17160 37689 38837 gene locus_tag LOCUS_17170 37689 38837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 38853 39935 gene locus_tag LOCUS_17180 gene recF 38853 39935 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH6 protein_id gnl|my_center|LOCUS_17180 39981 42449 gene locus_tag LOCUS_17190 gene gyrB 39981 42449 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH7 protein_id gnl|my_center|LOCUS_17190 43667 42504 gene locus_tag LOCUS_17200 gene ybdR 43667 42504 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206331.1 protein_id gnl|my_center|LOCUS_17200 44228 43983 gene locus_tag LOCUS_17210 44228 43983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206240.1 protein_id gnl|my_center|LOCUS_17210 46444 44510 gene locus_tag LOCUS_17220 gene yheS 46444 44510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_17220 46668 47675 gene locus_tag LOCUS_17230 46668 47675 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_17230 47873 48880 gene locus_tag LOCUS_17240 47873 48880 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_17240 49013 50017 gene locus_tag LOCUS_17250 49013 50017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_17250 50142 50477 gene locus_tag LOCUS_17260 gene erpA 50142 50477 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI5 protein_id gnl|my_center|LOCUS_17260 51375 50530 gene locus_tag LOCUS_17270 gene abhD7 51375 50530 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207692.1 protein_id gnl|my_center|LOCUS_17270 52619 51489 gene locus_tag LOCUS_17280 gene anmK 52619 51489 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI7 protein_id gnl|my_center|LOCUS_17280 52683 53915 gene locus_tag LOCUS_17290 gene tyrS 52683 53915 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI8 protein_id gnl|my_center|LOCUS_17290 54539 54000 gene locus_tag LOCUS_17300 54539 54000 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208020.1 protein_id gnl|my_center|LOCUS_17300 55115 54654 gene locus_tag LOCUS_17310 55115 54654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 55908 55426 gene locus_tag LOCUS_17320 gene yaaD 55908 55426 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM2 protein_id gnl|my_center|LOCUS_17320 56441 55905 gene locus_tag LOCUS_17330 gene lspA 56441 55905 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_17330 59274 56434 gene locus_tag LOCUS_17340 gene ileS 59274 56434 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM4 protein_id gnl|my_center|LOCUS_17340 60385 59339 gene locus_tag LOCUS_17350 gene ribF 60385 59339 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM5 protein_id gnl|my_center|LOCUS_17350 60551 61681 gene locus_tag LOCUS_17360 60551 61681 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208024.1 protein_id gnl|my_center|LOCUS_17360 61769 62350 gene locus_tag LOCUS_17370 gene mtnN 61769 62350 CDS product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 protein_id gnl|my_center|LOCUS_17370 63054 62389 gene locus_tag LOCUS_17380 gene rutR 63054 62389 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071782.1 protein_id gnl|my_center|LOCUS_17380 64262 63468 gene locus_tag LOCUS_17390 gene ssuB 64262 63468 CDS product aliphatic sulfonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208026.1 protein_id gnl|my_center|LOCUS_17390 65085 64279 gene locus_tag LOCUS_17400 gene ssuC 65085 64279 CDS product sulfonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_17400 66257 65082 gene locus_tag LOCUS_17410 gene ssuD 66257 65082 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN1 protein_id gnl|my_center|LOCUS_17410 67270 66281 gene locus_tag LOCUS_17420 67270 66281 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208028.1 protein_id gnl|my_center|LOCUS_17420 68254 67289 gene locus_tag LOCUS_17430 gene ssuA2 68254 67289 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208029.1 protein_id gnl|my_center|LOCUS_17430 69911 68565 gene locus_tag LOCUS_17440 gene argA 69911 68565 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN4 protein_id gnl|my_center|LOCUS_17440 70406 70038 gene locus_tag LOCUS_17450 70406 70038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120775.1 protein_id gnl|my_center|LOCUS_17450 71008 70631 gene locus_tag LOCUS_17460 71008 70631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120752.1 protein_id gnl|my_center|LOCUS_17460 72094 71348 gene locus_tag LOCUS_17470 gene yciK 72094 71348 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_17470 72819 72124 gene locus_tag LOCUS_17480 gene gph2 72819 72124 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_17480 73535 72816 gene locus_tag LOCUS_17490 gene ubiG 73535 72816 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_17490 73718 74335 gene locus_tag LOCUS_17500 gene dsbA 73718 74335 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_17500 75050 74415 gene locus_tag LOCUS_17510 75050 74415 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120773.1 protein_id gnl|my_center|LOCUS_17510 75825 75187 gene locus_tag LOCUS_17520 75825 75187 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 protein_id gnl|my_center|LOCUS_17520 75996 77015 gene locus_tag LOCUS_17530 gene hmp 75996 77015 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208031.1 protein_id gnl|my_center|LOCUS_17530 77048 78220 gene locus_tag LOCUS_17540 gene des6 77048 78220 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 protein_id gnl|my_center|LOCUS_17540 78290 79006 gene locus_tag LOCUS_17550 gene rph 78290 79006 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_17550 79291 81453 gene locus_tag LOCUS_17560 gene plcN 79291 81453 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208034.1 protein_id gnl|my_center|LOCUS_17560 82807 81962 gene locus_tag LOCUS_17570 gene nadC 82807 81962 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208036.1 protein_id gnl|my_center|LOCUS_17570 82953 83531 gene locus_tag LOCUS_17580 gene ampD 82953 83531 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_17580 83601 85142 gene locus_tag LOCUS_17590 gene mviN 83601 85142 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ1 protein_id gnl|my_center|LOCUS_17590 85698 85285 gene locus_tag LOCUS_17600 85698 85285 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_17600 85719 86813 gene locus_tag LOCUS_17610 85719 86813 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 protein_id gnl|my_center|LOCUS_17610 87494 86805 gene locus_tag LOCUS_17620 gene fklB 87494 86805 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_17620 88245 87541 gene locus_tag LOCUS_17630 gene fkpA 88245 87541 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ3 protein_id gnl|my_center|LOCUS_17630 90637 88454 gene locus_tag LOCUS_17640 gene ptk 90637 88454 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 protein_id gnl|my_center|LOCUS_17640 91083 90655 gene locus_tag LOCUS_17650 gene ptp 91083 90655 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_17650 92165 91086 gene locus_tag LOCUS_17660 gene wza 92165 91086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 protein_id gnl|my_center|LOCUS_17660 92528 93805 gene locus_tag LOCUS_17670 gene wbpO 92528 93805 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039034.1 protein_id gnl|my_center|LOCUS_17670 93824 94849 gene locus_tag LOCUS_17680 gene wbpP 93824 94849 CDS product UDP-GlkcNAc C4 epimerase WbpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_17680 94846 96024 gene locus_tag LOCUS_17690 94846 96024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 96018 96620 gene locus_tag LOCUS_17700 96018 96620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 96617 97150 gene locus_tag LOCUS_17710 96617 97150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 97134 98252 gene locus_tag LOCUS_17720 97134 98252 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203514.1 protein_id gnl|my_center|LOCUS_17720 98252 99397 gene locus_tag LOCUS_17730 98252 99397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 99402 100544 gene locus_tag LOCUS_17740 99402 100544 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057044.1 protein_id gnl|my_center|LOCUS_17740 100545 101159 gene locus_tag LOCUS_17750 100545 101159 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_17750 101149 101811 gene locus_tag LOCUS_17760 gene perB 101149 101811 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DBF7 protein_id gnl|my_center|LOCUS_17760 101854 103029 gene locus_tag LOCUS_17770 gene pglC 101854 103029 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_17770 103190 105064 gene locus_tag LOCUS_17780 gene wbfY 103190 105064 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_17780 105079 105957 gene locus_tag LOCUS_17790 gene galU 105079 105957 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS0 protein_id gnl|my_center|LOCUS_17790 105971 107236 gene locus_tag LOCUS_17800 gene udg 105971 107236 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 protein_id gnl|my_center|LOCUS_17800 107233 108909 gene locus_tag LOCUS_17810 gene pgi 107233 108909 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS2 protein_id gnl|my_center|LOCUS_17810 108902 109921 gene locus_tag LOCUS_17820 gene galE 108902 109921 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208059.1 protein_id gnl|my_center|LOCUS_17820 111341 109968 gene locus_tag LOCUS_17830 gene manB 111341 109968 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_17830 111909 111834 gene locus_tag LOCUS_t00280 111909 111834 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 112024 111949 gene locus_tag LOCUS_t00290 112024 111949 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 112296 112604 gene locus_tag LOCUS_17840 gene bolA 112296 112604 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_17840 112623 113012 gene locus_tag LOCUS_17850 112623 113012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208111.1 protein_id gnl|my_center|LOCUS_17850 113196 113606 gene locus_tag LOCUS_17860 113196 113606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114091.1 protein_id gnl|my_center|LOCUS_17860 114648 114013 gene locus_tag LOCUS_17870 gene dedA 114648 114013 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_17870 114956 116524 gene locus_tag LOCUS_17880 gene guaA 114956 116524 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJE6 protein_id gnl|my_center|LOCUS_17880 116715 117659 gene locus_tag LOCUS_17890 116715 117659 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 protein_id gnl|my_center|LOCUS_17890 117759 118412 gene locus_tag LOCUS_17900 gene gst3 117759 118412 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208119.1 protein_id gnl|my_center|LOCUS_17900 119104 118481 gene locus_tag LOCUS_17910 119104 118481 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208120.1 protein_id gnl|my_center|LOCUS_17910 120916 119126 gene locus_tag LOCUS_17920 gene argS 120916 119126 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF4 protein_id gnl|my_center|LOCUS_17920 121220 121396 gene locus_tag LOCUS_17930 121220 121396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 121436 121597 gene locus_tag LOCUS_17940 121436 121597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 122243 123937 gene locus_tag LOCUS_17950 gene sfcA 122243 123937 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF5 protein_id gnl|my_center|LOCUS_17950 124078 127395 gene locus_tag LOCUS_17960 124078 127395 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207953.1 protein_id gnl|my_center|LOCUS_17960 127406 129451 gene locus_tag LOCUS_17970 127406 129451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 129465 130166 gene locus_tag LOCUS_17980 129465 130166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 131158 131757 gene locus_tag LOCUS_17990 131158 131757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 131895 132803 gene locus_tag LOCUS_18000 131895 132803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 132894 133394 gene locus_tag LOCUS_18010 132894 133394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 133486 134415 gene locus_tag LOCUS_18020 133486 134415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 134639 135283 gene locus_tag LOCUS_18030 134639 135283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 135423 135806 gene locus_tag LOCUS_18040 135423 135806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18040 135873 136082 gene locus_tag LOCUS_18050 135873 136082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18050 136335 136949 gene locus_tag LOCUS_18060 136335 136949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 138040 137120 gene locus_tag LOCUS_18070 gene yfeX 138040 137120 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208122.1 protein_id gnl|my_center|LOCUS_18070 138880 138077 gene locus_tag LOCUS_18080 gene znuB 138880 138077 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208123.1 protein_id gnl|my_center|LOCUS_18080 139678 138884 gene locus_tag LOCUS_18090 gene znuC 139678 138884 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF9 protein_id gnl|my_center|LOCUS_18090 140148 139651 gene locus_tag LOCUS_18100 gene zur 140148 139651 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_18100 140270 141106 gene locus_tag LOCUS_18110 gene znuA 140270 141106 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 protein_id gnl|my_center|LOCUS_18110 141783 142658 gene locus_tag LOCUS_18120 gene atpB 141783 142658 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_18120 142743 142988 gene locus_tag LOCUS_18130 gene atpE 142743 142988 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG4 protein_id gnl|my_center|LOCUS_18130 143031 143501 gene locus_tag LOCUS_18140 gene atpF 143031 143501 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG5 protein_id gnl|my_center|LOCUS_18140 143513 144049 gene locus_tag LOCUS_18150 gene atpH 143513 144049 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG6 protein_id gnl|my_center|LOCUS_18150 144095 145639 gene locus_tag LOCUS_18160 gene atpA 144095 145639 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG7 protein_id gnl|my_center|LOCUS_18160 145712 146581 gene locus_tag LOCUS_18170 gene atpG 145712 146581 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG8 protein_id gnl|my_center|LOCUS_18170 146611 148005 gene locus_tag LOCUS_18180 gene atpD 146611 148005 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG9 protein_id gnl|my_center|LOCUS_18180 148033 148452 gene locus_tag LOCUS_18190 gene atpC 148033 148452 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_18190 149102 150478 gene locus_tag LOCUS_18200 149102 150478 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 protein_id gnl|my_center|LOCUS_18200 151130 150525 gene locus_tag LOCUS_18210 151130 150525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208127.1 protein_id gnl|my_center|LOCUS_18210 151605 151264 gene locus_tag LOCUS_18220 151605 151264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 152342 151800 gene locus_tag LOCUS_18230 gene btuE 152342 151800 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH2 protein_id gnl|my_center|LOCUS_18230 153119 152469 gene locus_tag LOCUS_18240 153119 152469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 154089 153334 gene locus_tag LOCUS_18250 gene yeaM 154089 153334 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208129.1 protein_id gnl|my_center|LOCUS_18250 154205 155098 gene locus_tag LOCUS_18260 154205 155098 CDS product multidrug DMT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208131.1 protein_id gnl|my_center|LOCUS_18260 156129 155560 gene locus_tag LOCUS_18270 gene yrdC 156129 155560 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_18270 157304 156174 gene locus_tag LOCUS_18280 gene smf 157304 156174 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 protein_id gnl|my_center|LOCUS_18280 158468 157320 gene locus_tag LOCUS_18290 158468 157320 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_18290 158593 159123 gene locus_tag LOCUS_18300 gene def 158593 159123 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY9 protein_id gnl|my_center|LOCUS_18300 159216 159638 gene locus_tag LOCUS_18310 159216 159638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114087.1 protein_id gnl|my_center|LOCUS_18310 159704 161767 gene locus_tag LOCUS_18320 gene oprC 159704 161767 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208134.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence07 3422 1923 gene locus_tag LOCUS_18330 gene nhx7 3422 1923 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207471.1 protein_id gnl|my_center|LOCUS_18330 3667 4224 gene locus_tag LOCUS_18340 3667 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5177 4278 gene locus_tag LOCUS_18350 5177 4278 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_18350 6155 5223 gene locus_tag LOCUS_18360 6155 5223 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_18360 6363 7376 gene locus_tag LOCUS_18370 gene trpS 6363 7376 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 protein_id gnl|my_center|LOCUS_18370 8779 7889 gene locus_tag LOCUS_18380 gene sucD 8779 7889 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZP3 protein_id gnl|my_center|LOCUS_18380 9958 8792 gene locus_tag LOCUS_18390 gene sucC 9958 8792 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX8 protein_id gnl|my_center|LOCUS_18390 11561 10128 gene locus_tag LOCUS_18400 gene lpdG 11561 10128 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX9 protein_id gnl|my_center|LOCUS_18400 12846 11623 gene locus_tag LOCUS_18410 gene sucB 12846 11623 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLY0 protein_id gnl|my_center|LOCUS_18410 15686 12846 gene locus_tag LOCUS_18420 gene sucA 15686 12846 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_18420 16960 16250 gene locus_tag LOCUS_18430 gene sdhB 16960 16250 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 protein_id gnl|my_center|LOCUS_18430 18810 16975 gene locus_tag LOCUS_18440 gene sdhA 18810 16975 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME4 protein_id gnl|my_center|LOCUS_18440 19203 18823 gene locus_tag LOCUS_18450 gene sdhD 19203 18823 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME5 protein_id gnl|my_center|LOCUS_18450 19547 19188 gene locus_tag LOCUS_18460 gene sdhC 19547 19188 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207477.1 protein_id gnl|my_center|LOCUS_18460 20598 21875 gene locus_tag LOCUS_18470 gene gltA 20598 21875 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME8 protein_id gnl|my_center|LOCUS_18470 22415 21927 gene locus_tag LOCUS_18480 22415 21927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 22663 24288 gene locus_tag LOCUS_18490 gene nadE2 22663 24288 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_18490 24266 25318 gene locus_tag LOCUS_18500 24266 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 25507 25431 gene locus_tag LOCUS_t00300 25507 25431 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25667 26071 gene locus_tag LOCUS_18510 25667 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 26228 26152 gene locus_tag LOCUS_t00310 26228 26152 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26862 26674 gene locus_tag LOCUS_18520 gene fdx 26862 26674 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205956.1 protein_id gnl|my_center|LOCUS_18520 27430 26939 gene locus_tag LOCUS_18530 gene coaD 27430 26939 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH8 protein_id gnl|my_center|LOCUS_18530 27567 28049 gene locus_tag LOCUS_18540 gene smpB 27567 28049 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_18540 28895 28149 gene locus_tag LOCUS_18550 28895 28149 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH5 protein_id gnl|my_center|LOCUS_18550 29971 28919 gene locus_tag LOCUS_18560 gene rluD 29971 28919 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH4 protein_id gnl|my_center|LOCUS_18560 30042 31073 gene locus_tag LOCUS_18570 gene comL 30042 31073 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH3 protein_id gnl|my_center|LOCUS_18570 31263 33146 gene locus_tag LOCUS_18580 gene dnaG 31263 33146 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH2 protein_id gnl|my_center|LOCUS_18580 34449 33166 gene locus_tag LOCUS_18590 gene hemA 34449 33166 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH0 protein_id gnl|my_center|LOCUS_18590 34558 36240 gene locus_tag LOCUS_18600 34558 36240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 protein_id gnl|my_center|LOCUS_18600 36247 36822 gene locus_tag LOCUS_18610 gene lolB 36247 36822 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG8 protein_id gnl|my_center|LOCUS_18610 36848 37678 gene locus_tag LOCUS_18620 gene ispE 36848 37678 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_18620 37680 37754 gene locus_tag LOCUS_t00320 37680 37754 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37782 37856 gene locus_tag LOCUS_t00330 37782 37856 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37877 37951 gene locus_tag LOCUS_t00340 37877 37951 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 38043 38117 gene locus_tag LOCUS_t00350 38043 38117 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 38154 39107 gene locus_tag LOCUS_18630 gene prs 38154 39107 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_18630 39207 39503 gene locus_tag LOCUS_18640 gene rplY 39207 39503 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG5 protein_id gnl|my_center|LOCUS_18640 39523 40104 gene locus_tag LOCUS_18650 gene pth 39523 40104 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF04 protein_id gnl|my_center|LOCUS_18650 40248 40628 gene locus_tag LOCUS_18660 gene panD 40248 40628 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_18660 41073 41732 gene locus_tag LOCUS_18670 gene ribB 41073 41732 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ9 protein_id gnl|my_center|LOCUS_18670 42254 41769 gene locus_tag LOCUS_18680 42254 41769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064555.1 protein_id gnl|my_center|LOCUS_18680 42369 43301 gene locus_tag LOCUS_18690 42369 43301 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF0 protein_id gnl|my_center|LOCUS_18690 43570 43836 gene locus_tag LOCUS_18700 43570 43836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 43931 44548 gene locus_tag LOCUS_18710 43931 44548 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_18710 45235 44711 gene locus_tag LOCUS_18720 45235 44711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_18720 45502 45299 gene locus_tag LOCUS_18730 45502 45299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116495.1 protein_id gnl|my_center|LOCUS_18730 45854 47743 gene locus_tag LOCUS_18740 gene rpoD 45854 47743 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF3 protein_id gnl|my_center|LOCUS_18740 47848 48135 gene locus_tag LOCUS_18750 47848 48135 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116017.1 protein_id gnl|my_center|LOCUS_18750 48194 48859 gene locus_tag LOCUS_18760 gene lipB 48194 48859 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF5 protein_id gnl|my_center|LOCUS_18760 48937 49470 gene locus_tag LOCUS_18770 48937 49470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_18770 49472 50656 gene locus_tag LOCUS_18780 gene dhaT 49472 50656 CDS product alcohol dehydrogenase EutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_18780 50914 52305 gene locus_tag LOCUS_18790 gene yeeF 50914 52305 CDS product putrescine/spermidine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207482.1 protein_id gnl|my_center|LOCUS_18790 52841 52365 gene locus_tag LOCUS_18800 gene trmL 52841 52365 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG5 protein_id gnl|my_center|LOCUS_18800 54249 52876 gene locus_tag LOCUS_18810 gene cysG 54249 52876 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG6 protein_id gnl|my_center|LOCUS_18810 54449 55699 gene locus_tag LOCUS_18820 gene tcbE 54449 55699 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206709.1 protein_id gnl|my_center|LOCUS_18820 56074 56265 gene locus_tag LOCUS_18830 56074 56265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 56296 57381 gene locus_tag LOCUS_18840 56296 57381 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527983.1 protein_id gnl|my_center|LOCUS_18840 57436 57693 gene locus_tag LOCUS_18850 57436 57693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 57743 58288 gene locus_tag LOCUS_18860 57743 58288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 58446 58667 gene locus_tag LOCUS_18870 58446 58667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 58913 59437 gene locus_tag LOCUS_18880 58913 59437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 60797 59526 gene locus_tag LOCUS_18890 gene serS 60797 59526 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG7 protein_id gnl|my_center|LOCUS_18890 61700 61005 gene locus_tag LOCUS_18900 gene lolA 61700 61005 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_18900 62166 61909 gene locus_tag LOCUS_18910 gene rpmA 62166 61909 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL7 protein_id gnl|my_center|LOCUS_18910 62496 62185 gene locus_tag LOCUS_18920 gene rplU 62496 62185 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH1 protein_id gnl|my_center|LOCUS_18920 62964 63941 gene locus_tag LOCUS_18930 gene ispB 62964 63941 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_18930 63991 66012 gene locus_tag LOCUS_18940 63991 66012 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_18940 66800 68041 gene locus_tag LOCUS_18950 gene acrA 66800 68041 CDS product AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_18950 68054 71233 gene locus_tag LOCUS_18960 gene acrB2 68054 71233 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_18960 71230 72705 gene locus_tag LOCUS_18970 gene oprM 71230 72705 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_18970 72800 73150 gene locus_tag LOCUS_18980 72800 73150 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_18980 73172 73609 gene locus_tag LOCUS_18990 73172 73609 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_18990 74483 73680 gene locus_tag LOCUS_19000 74483 73680 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_19000 75202 74525 gene locus_tag LOCUS_19010 75202 74525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 75402 78293 gene locus_tag LOCUS_19020 gene valS 75402 78293 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMI4 protein_id gnl|my_center|LOCUS_19020 78360 79517 gene locus_tag LOCUS_19030 78360 79517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945912.1 protein_id gnl|my_center|LOCUS_19030 79990 79784 gene locus_tag LOCUS_19040 79990 79784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19040 81271 80243 gene locus_tag LOCUS_19050 81271 80243 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207503.1 protein_id gnl|my_center|LOCUS_19050 82239 81334 gene locus_tag LOCUS_19060 82239 81334 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_19060 82742 83704 gene locus_tag LOCUS_19070 82742 83704 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_19070 83770 84513 gene locus_tag LOCUS_19080 83770 84513 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396522.1 protein_id gnl|my_center|LOCUS_19080 84515 85198 gene locus_tag LOCUS_19090 84515 85198 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_19090 85195 85938 gene locus_tag LOCUS_19100 85195 85938 CDS product glutamate/aspartate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631369.1 protein_id gnl|my_center|LOCUS_19100 86341 87528 gene locus_tag LOCUS_19110 86341 87528 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_19110 88270 87575 gene locus_tag LOCUS_19120 88270 87575 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_19120 88453 89025 gene locus_tag LOCUS_19130 88453 89025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 90245 89130 gene locus_tag LOCUS_19140 gene porB 90245 89130 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_19140 90592 91215 gene locus_tag LOCUS_19150 gene ydhM 90592 91215 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_19150 91219 92196 gene locus_tag LOCUS_19160 gene mecR 91219 92196 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207904.1 protein_id gnl|my_center|LOCUS_19160 92262 92615 gene locus_tag LOCUS_19170 92262 92615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_19170 94024 92777 gene locus_tag LOCUS_19180 gene ampG4 94024 92777 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_19180 94177 94812 gene locus_tag LOCUS_19190 gene plsC2 94177 94812 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_19190 94869 95786 gene locus_tag LOCUS_19200 gene ylbK 94869 95786 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_19200 95879 96334 gene locus_tag LOCUS_19210 95879 96334 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_19210 96374 97228 gene locus_tag LOCUS_19220 gene qmcA 96374 97228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_19220 98402 97494 gene locus_tag LOCUS_19230 gene ispA 98402 97494 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_19230 98770 98429 gene locus_tag LOCUS_19240 98770 98429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704081.1 protein_id gnl|my_center|LOCUS_19240 100150 98963 gene locus_tag LOCUS_19250 100150 98963 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_19250 100435 101835 gene locus_tag LOCUS_19260 gene aroP 100435 101835 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 protein_id gnl|my_center|LOCUS_19260 101908 101981 gene locus_tag LOCUS_t00360 101908 101981 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 102238 103788 gene locus_tag LOCUS_19270 gene yjdB 102238 103788 CDS product lipid A phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207511.1 protein_id gnl|my_center|LOCUS_19270 103792 104469 gene locus_tag LOCUS_19280 gene qseB 103792 104469 CDS product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 protein_id gnl|my_center|LOCUS_19280 104490 105806 gene locus_tag LOCUS_19290 gene qseC 104490 105806 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 protein_id gnl|my_center|LOCUS_19290 107024 108316 gene locus_tag LOCUS_19300 107024 108316 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_19300 108626 109846 gene locus_tag LOCUS_19310 108626 109846 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208459.1 protein_id gnl|my_center|LOCUS_19310 110533 109916 gene locus_tag LOCUS_19320 gene thrH 110533 109916 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_19320 110733 111467 gene locus_tag LOCUS_19330 gene cysH 110733 111467 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_19330 111667 113052 gene locus_tag LOCUS_19340 111667 113052 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_19340 113262 113089 gene locus_tag LOCUS_19350 113262 113089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116397.1 protein_id gnl|my_center|LOCUS_19350 114851 113397 gene locus_tag LOCUS_19360 gene cafA 114851 113397 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116044.1 protein_id gnl|my_center|LOCUS_19360 115489 114890 gene locus_tag LOCUS_19370 115489 114890 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN32 protein_id gnl|my_center|LOCUS_19370 115935 115444 gene locus_tag LOCUS_19380 115935 115444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 116683 115922 gene locus_tag LOCUS_19390 gene mreC 116683 115922 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN35 protein_id gnl|my_center|LOCUS_19390 117835 116795 gene locus_tag LOCUS_19400 gene mreB 117835 116795 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_19400 117966 118280 gene locus_tag LOCUS_19410 gene gatC 117966 118280 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN38 protein_id gnl|my_center|LOCUS_19410 118332 119810 gene locus_tag LOCUS_19420 gene gatA 118332 119810 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN39 protein_id gnl|my_center|LOCUS_19420 119810 121285 gene locus_tag LOCUS_19430 gene gatB 119810 121285 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN40 protein_id gnl|my_center|LOCUS_19430 121359 122156 gene locus_tag LOCUS_19440 121359 122156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_19440 123246 122302 gene locus_tag LOCUS_19450 123246 122302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 123788 124723 gene locus_tag LOCUS_19460 123788 124723 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206329.1 protein_id gnl|my_center|LOCUS_19460 125260 124766 gene locus_tag LOCUS_19470 125260 124766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207539.1 protein_id gnl|my_center|LOCUS_19470 126753 125554 gene locus_tag LOCUS_19480 gene bacA 126753 125554 CDS product microcin B17 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207542.1 protein_id gnl|my_center|LOCUS_19480 128664 126979 gene locus_tag LOCUS_19490 gene acsF2 128664 126979 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206452.1 protein_id gnl|my_center|LOCUS_19490 129425 128817 gene locus_tag LOCUS_19500 129425 128817 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206451.1 protein_id gnl|my_center|LOCUS_19500 129603 130775 gene locus_tag LOCUS_19510 gene ivd 129603 130775 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076583.1 protein_id gnl|my_center|LOCUS_19510 130809 132416 gene locus_tag LOCUS_19520 gene mccC2 130809 132416 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 protein_id gnl|my_center|LOCUS_19520 132426 133217 gene locus_tag LOCUS_19530 gene paaG5 132426 133217 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206449.1 protein_id gnl|my_center|LOCUS_19530 133259 135250 gene locus_tag LOCUS_19540 gene accC2 133259 135250 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206448.1 protein_id gnl|my_center|LOCUS_19540 135247 136152 gene locus_tag LOCUS_19550 gene mvaB 135247 136152 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206447.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence08 68 676 gene locus_tag LOCUS_19560 68 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 666 947 gene locus_tag LOCUS_19570 666 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1330 1605 gene locus_tag LOCUS_19580 1330 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 protein_id gnl|my_center|LOCUS_19580 1627 2739 gene locus_tag LOCUS_19590 gene adhC 1627 2739 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP63 protein_id gnl|my_center|LOCUS_19590 2967 3797 gene locus_tag LOCUS_19600 2967 3797 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 protein_id gnl|my_center|LOCUS_19600 4132 4434 gene locus_tag LOCUS_19610 4132 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5040 6197 gene locus_tag LOCUS_19620 5040 6197 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_19620 6273 6950 gene locus_tag LOCUS_19630 6273 6950 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_19630 7154 8281 gene locus_tag LOCUS_19640 7154 8281 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_19640 8595 8365 gene locus_tag LOCUS_19650 8595 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 9310 8702 gene locus_tag LOCUS_19660 gene ydhM 9310 8702 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207905.1 protein_id gnl|my_center|LOCUS_19660 9454 10473 gene locus_tag LOCUS_19670 9454 10473 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 protein_id gnl|my_center|LOCUS_19670 10490 11128 gene locus_tag LOCUS_19680 gene gst3 10490 11128 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206409.1 protein_id gnl|my_center|LOCUS_19680 11976 11545 gene locus_tag LOCUS_19690 11976 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695223.1 protein_id gnl|my_center|LOCUS_19690 12462 12256 gene locus_tag LOCUS_19700 12462 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19700 12894 12463 gene locus_tag LOCUS_19710 12894 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19710 13310 13005 gene locus_tag LOCUS_19720 13310 13005 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082849.1 protein_id gnl|my_center|LOCUS_19720 13639 16188 gene locus_tag LOCUS_19730 13639 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 16289 17848 gene locus_tag LOCUS_19740 16289 17848 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_19740 18266 18463 gene locus_tag LOCUS_19750 18266 18463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 18676 18948 gene locus_tag LOCUS_19760 18676 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 20908 20075 gene locus_tag LOCUS_19770 20908 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19770 21267 20890 gene locus_tag LOCUS_19780 21267 20890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19780 22282 21299 gene locus_tag LOCUS_19790 gene sumF1 22282 21299 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206164.1 protein_id gnl|my_center|LOCUS_19790 24127 22409 gene locus_tag LOCUS_19800 gene atsA 24127 22409 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51691 protein_id gnl|my_center|LOCUS_19800 25117 24197 gene locus_tag LOCUS_19810 gene catA 25117 24197 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113693.1 protein_id gnl|my_center|LOCUS_19810 26357 25296 gene locus_tag LOCUS_19820 gene mphP 26357 25296 CDS product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 protein_id gnl|my_center|LOCUS_19820 26735 26370 gene locus_tag LOCUS_19830 gene mphO 26735 26370 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 protein_id gnl|my_center|LOCUS_19830 28349 26811 gene locus_tag LOCUS_19840 gene mphN 28349 26811 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 protein_id gnl|my_center|LOCUS_19840 28677 28408 gene locus_tag LOCUS_19850 gene mphM 28677 28408 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049448.1 protein_id gnl|my_center|LOCUS_19850 29694 28690 gene locus_tag LOCUS_19860 gene mphL 29694 28690 CDS product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 protein_id gnl|my_center|LOCUS_19860 30003 29713 gene locus_tag LOCUS_19870 gene mphK 30003 29713 CDS product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 protein_id gnl|my_center|LOCUS_19870 30416 32101 gene locus_tag LOCUS_19880 gene mphR 30416 32101 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 protein_id gnl|my_center|LOCUS_19880 33096 32422 gene locus_tag LOCUS_19890 33096 32422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 33679 33074 gene locus_tag LOCUS_19900 33679 33074 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496801.1 protein_id gnl|my_center|LOCUS_19900 34884 33679 gene locus_tag LOCUS_19910 34884 33679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 35220 34921 gene locus_tag LOCUS_19920 35220 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 35979 35407 gene locus_tag LOCUS_19930 35979 35407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 37412 35976 gene locus_tag LOCUS_19940 gene dgt 37412 35976 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS31 protein_id gnl|my_center|LOCUS_19940 39448 38168 gene locus_tag LOCUS_19950 39448 38168 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_19950 39934 41112 gene locus_tag LOCUS_19960 39934 41112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207348.1 protein_id gnl|my_center|LOCUS_19960 41115 42263 gene locus_tag LOCUS_19970 gene wecB 41115 42263 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_19970 43135 42260 gene locus_tag LOCUS_19980 43135 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207347.1 protein_id gnl|my_center|LOCUS_19980 44958 43132 gene locus_tag LOCUS_19990 44958 43132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207346.1 protein_id gnl|my_center|LOCUS_19990 46229 44955 gene locus_tag LOCUS_20000 gene icaA 46229 44955 CDS product N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067892.1 protein_id gnl|my_center|LOCUS_20000 47101 46205 gene locus_tag LOCUS_20010 47101 46205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207345.1 protein_id gnl|my_center|LOCUS_20010 47856 47098 gene locus_tag LOCUS_20020 47856 47098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 49032 49769 gene locus_tag LOCUS_20030 49032 49769 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_20030 49781 50443 gene locus_tag LOCUS_20040 49781 50443 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206333.1 protein_id gnl|my_center|LOCUS_20040 50447 54052 gene locus_tag LOCUS_20050 50447 54052 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206334.1 protein_id gnl|my_center|LOCUS_20050 54159 55760 gene locus_tag LOCUS_20060 54159 55760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 56628 57071 gene locus_tag LOCUS_20070 gene copG 56628 57071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118705.1 protein_id gnl|my_center|LOCUS_20070 57083 58891 gene locus_tag LOCUS_20080 57083 58891 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_20080 58888 59910 gene locus_tag LOCUS_20090 58888 59910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_20090 60329 60000 gene locus_tag LOCUS_20100 gene qacF 60329 60000 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_20100 61219 60338 gene locus_tag LOCUS_20110 61219 60338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 62289 61216 gene locus_tag LOCUS_20120 62289 61216 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103268.1 protein_id gnl|my_center|LOCUS_20120 63182 62301 gene locus_tag LOCUS_20130 63182 62301 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_20130 64126 63182 gene locus_tag LOCUS_20140 64126 63182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 64754 66103 gene locus_tag LOCUS_20150 64754 66103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 protein_id gnl|my_center|LOCUS_20150 66189 67202 gene locus_tag LOCUS_20160 gene eutR 66189 67202 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_20160 67282 68388 gene locus_tag LOCUS_20170 67282 68388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088827.1 protein_id gnl|my_center|LOCUS_20170 68390 69409 gene locus_tag LOCUS_20180 68390 69409 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088828.1 protein_id gnl|my_center|LOCUS_20180 69869 69402 gene locus_tag LOCUS_20190 69869 69402 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121038.1 protein_id gnl|my_center|LOCUS_20190 70017 71129 gene locus_tag LOCUS_20200 gene gatA 70017 71129 CDS product Glu-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_20200 71148 72317 gene locus_tag LOCUS_20210 71148 72317 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206911.1 protein_id gnl|my_center|LOCUS_20210 72351 72710 gene locus_tag LOCUS_20220 72351 72710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387554.1 protein_id gnl|my_center|LOCUS_20220 72723 73250 gene locus_tag LOCUS_20230 72723 73250 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 protein_id gnl|my_center|LOCUS_20230 73281 74558 gene locus_tag LOCUS_20240 73281 74558 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 protein_id gnl|my_center|LOCUS_20240 74569 75054 gene locus_tag LOCUS_20250 74569 75054 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206909.1 protein_id gnl|my_center|LOCUS_20250 75065 75802 gene locus_tag LOCUS_20260 75065 75802 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206908.1 protein_id gnl|my_center|LOCUS_20260 75835 76788 gene locus_tag LOCUS_20270 gene vanB 75835 76788 CDS product vanillate monooxygenase oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206907.1 protein_id gnl|my_center|LOCUS_20270 76806 77309 gene locus_tag LOCUS_20280 gene rutF 76806 77309 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_20280 77524 77892 gene locus_tag LOCUS_20290 77524 77892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20290 78976 78017 gene locus_tag LOCUS_20300 78976 78017 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206371.1 protein_id gnl|my_center|LOCUS_20300 79599 78982 gene locus_tag LOCUS_20310 79599 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206370.1 protein_id gnl|my_center|LOCUS_20310 80418 79609 gene locus_tag LOCUS_20320 80418 79609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206369.1 protein_id gnl|my_center|LOCUS_20320 81794 80430 gene locus_tag LOCUS_20330 81794 80430 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206368.1 protein_id gnl|my_center|LOCUS_20330 82913 81810 gene locus_tag LOCUS_20340 82913 81810 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206367.1 protein_id gnl|my_center|LOCUS_20340 85623 82936 gene locus_tag LOCUS_20350 gene clpV1 85623 82936 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206366.1 protein_id gnl|my_center|LOCUS_20350 86004 86690 gene locus_tag LOCUS_20360 86004 86690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206355.1 protein_id gnl|my_center|LOCUS_20360 86711 87214 gene locus_tag LOCUS_20370 86711 87214 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005041656.1 protein_id gnl|my_center|LOCUS_20370 87207 88688 gene locus_tag LOCUS_20380 87207 88688 CDS product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206356.1 protein_id gnl|my_center|LOCUS_20380 88739 89242 gene locus_tag LOCUS_20390 88739 89242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653195.1 protein_id gnl|my_center|LOCUS_20390 89322 89798 gene locus_tag LOCUS_20400 89322 89798 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048404.1 protein_id gnl|my_center|LOCUS_20400 89811 91619 gene locus_tag LOCUS_20410 89811 91619 CDS product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206357.1 protein_id gnl|my_center|LOCUS_20410 91583 92584 gene locus_tag LOCUS_20420 91583 92584 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206358.1 protein_id gnl|my_center|LOCUS_20420 92578 93999 gene locus_tag LOCUS_20430 92578 93999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206359.1 protein_id gnl|my_center|LOCUS_20430 94029 97844 gene locus_tag LOCUS_20440 94029 97844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 97879 98838 gene locus_tag LOCUS_20450 97879 98838 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206363.1 protein_id gnl|my_center|LOCUS_20450 98841 99602 gene locus_tag LOCUS_20460 gene motB 98841 99602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206364.1 protein_id gnl|my_center|LOCUS_20460 99632 99898 gene locus_tag LOCUS_20470 99632 99898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 100130 101278 gene locus_tag LOCUS_20480 gene abhD3 100130 101278 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 protein_id gnl|my_center|LOCUS_20480 101639 101379 gene locus_tag LOCUS_20490 101639 101379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 103178 101922 gene locus_tag LOCUS_20500 103178 101922 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 protein_id gnl|my_center|LOCUS_20500 103395 104468 gene locus_tag LOCUS_20510 gene hemE 103395 104468 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS6 protein_id gnl|my_center|LOCUS_20510 104478 105287 gene locus_tag LOCUS_20520 104478 105287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207274.1 protein_id gnl|my_center|LOCUS_20520 105427 105897 gene locus_tag LOCUS_20530 105427 105897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_20530 105965 107851 gene locus_tag LOCUS_20540 105965 107851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_20540 107974 108861 gene locus_tag LOCUS_20550 107974 108861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20550 109104 109331 gene locus_tag LOCUS_20560 109104 109331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 109955 109401 gene locus_tag LOCUS_20570 gene folE 109955 109401 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS1 protein_id gnl|my_center|LOCUS_20570 110730 110041 gene locus_tag LOCUS_20580 110730 110041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_20580 111547 110723 gene locus_tag LOCUS_20590 gene trpC 111547 110723 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR6 protein_id gnl|my_center|LOCUS_20590 112613 111567 gene locus_tag LOCUS_20600 gene trpD 112613 111567 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR5 protein_id gnl|my_center|LOCUS_20600 113207 112623 gene locus_tag LOCUS_20610 gene trpG 113207 112623 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207264.1 protein_id gnl|my_center|LOCUS_20610 113938 115347 gene locus_tag LOCUS_20620 gene glnA 113938 115347 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ9 protein_id gnl|my_center|LOCUS_20620 115397 115708 gene locus_tag LOCUS_20630 115397 115708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 115701 116213 gene locus_tag LOCUS_20640 gene ubiC 115701 116213 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ8 protein_id gnl|my_center|LOCUS_20640 116231 117112 gene locus_tag LOCUS_20650 gene ubiA 116231 117112 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ7 protein_id gnl|my_center|LOCUS_20650 117219 118526 gene locus_tag LOCUS_20660 117219 118526 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207259.1 protein_id gnl|my_center|LOCUS_20660 118580 118828 gene locus_tag LOCUS_20670 118580 118828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 119309 118866 gene locus_tag LOCUS_20680 119309 118866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068176.1 protein_id gnl|my_center|LOCUS_20680 119442 119367 gene locus_tag LOCUS_t00370 119442 119367 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 892 338 gene locus_tag LOCUS_20690 892 338 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_20690 1201 944 gene locus_tag LOCUS_20700 gene sirA 1201 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053527.1 protein_id gnl|my_center|LOCUS_20700 1459 2580 gene locus_tag LOCUS_20710 1459 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_20710 2815 3654 gene locus_tag LOCUS_20720 gene corC 2815 3654 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_20720 3651 5210 gene locus_tag LOCUS_20730 gene lnt 3651 5210 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF2 protein_id gnl|my_center|LOCUS_20730 5623 5288 gene locus_tag LOCUS_20740 5623 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804170.1 protein_id gnl|my_center|LOCUS_20740 6397 5960 gene locus_tag LOCUS_20750 6397 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 7640 6435 gene locus_tag LOCUS_20760 gene xcpS 7640 6435 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_20760 7796 10021 gene locus_tag LOCUS_20770 gene priA 7796 10021 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE7 protein_id gnl|my_center|LOCUS_20770 10105 11937 gene locus_tag LOCUS_20780 gene kefB 10105 11937 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_20780 11987 12862 gene locus_tag LOCUS_20790 gene hslO 11987 12862 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE5 protein_id gnl|my_center|LOCUS_20790 13187 13648 gene locus_tag LOCUS_20800 13187 13648 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_20800 13804 14757 gene locus_tag LOCUS_20810 gene cbpA 13804 14757 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_20810 14770 15102 gene locus_tag LOCUS_20820 14770 15102 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 protein_id gnl|my_center|LOCUS_20820 16395 15157 gene locus_tag LOCUS_20830 gene corA 16395 15157 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_20830 18591 16492 gene locus_tag LOCUS_20840 gene pnp 18591 16492 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE0 protein_id gnl|my_center|LOCUS_20840 19102 18833 gene locus_tag LOCUS_20850 gene rpsO 19102 18833 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_20850 21765 19957 gene locus_tag LOCUS_20860 gene recD 21765 19957 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD7 protein_id gnl|my_center|LOCUS_20860 25509 21805 gene locus_tag LOCUS_20870 gene recB 25509 21805 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD6 protein_id gnl|my_center|LOCUS_20870 29198 25506 gene locus_tag LOCUS_20880 gene recC 29198 25506 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD4 protein_id gnl|my_center|LOCUS_20880 29385 29882 gene locus_tag LOCUS_20890 29385 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 protein_id gnl|my_center|LOCUS_20890 31345 29924 gene locus_tag LOCUS_20900 31345 29924 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_20900 31558 32265 gene locus_tag LOCUS_20910 31558 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208240.1 protein_id gnl|my_center|LOCUS_20910 32419 33363 gene locus_tag LOCUS_20920 gene ubiE 32419 33363 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD0 protein_id gnl|my_center|LOCUS_20920 33377 34051 gene locus_tag LOCUS_20930 33377 34051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208239.1 protein_id gnl|my_center|LOCUS_20930 34064 35683 gene locus_tag LOCUS_20940 gene ubiB 34064 35683 CDS product 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208238.1 protein_id gnl|my_center|LOCUS_20940 35910 35725 gene locus_tag LOCUS_20950 35910 35725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 35866 36648 gene locus_tag LOCUS_20960 gene hisI 35866 36648 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC5 protein_id gnl|my_center|LOCUS_20960 36657 38159 gene locus_tag LOCUS_20970 gene fbh1 36657 38159 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC4 protein_id gnl|my_center|LOCUS_20970 38176 39528 gene locus_tag LOCUS_20980 38176 39528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 39861 42698 gene locus_tag LOCUS_20990 gene phaAB 39861 42698 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208232.1 protein_id gnl|my_center|LOCUS_20990 42705 43073 gene locus_tag LOCUS_21000 gene phaC 42705 43073 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115033.1 protein_id gnl|my_center|LOCUS_21000 43073 44881 gene locus_tag LOCUS_21010 gene phaD 43073 44881 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208231.1 protein_id gnl|my_center|LOCUS_21010 44885 45424 gene locus_tag LOCUS_21020 gene phaE 44885 45424 CDS product pesticidal protein Cry1Ba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208230.1 protein_id gnl|my_center|LOCUS_21020 45421 45693 gene locus_tag LOCUS_21030 45421 45693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 45703 46122 gene locus_tag LOCUS_21040 gene phaG 45703 46122 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 protein_id gnl|my_center|LOCUS_21040 47018 46620 gene locus_tag LOCUS_21050 gene rbfA 47018 46620 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB5 protein_id gnl|my_center|LOCUS_21050 49744 47018 gene locus_tag LOCUS_21060 gene infB 49744 47018 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB4 protein_id gnl|my_center|LOCUS_21060 51239 49755 gene locus_tag LOCUS_21070 gene nusA 51239 49755 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB3 protein_id gnl|my_center|LOCUS_21070 51804 51280 gene locus_tag LOCUS_21080 gene rimP 51804 51280 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB2 protein_id gnl|my_center|LOCUS_21080 52088 52012 gene locus_tag LOCUS_t00380 52088 52012 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52251 52175 gene locus_tag LOCUS_t00390 52251 52175 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52378 52294 gene locus_tag LOCUS_t00400 52378 52294 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52760 52431 gene locus_tag LOCUS_21090 gene secG 52760 52431 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_21090 53565 52771 gene locus_tag LOCUS_21100 gene tpiA 53565 52771 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB0 protein_id gnl|my_center|LOCUS_21100 53854 55563 gene locus_tag LOCUS_21110 gene pilB 53854 55563 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_21110 55593 56819 gene locus_tag LOCUS_21120 gene pilC 55593 56819 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_21120 56819 57679 gene locus_tag LOCUS_21130 gene pilD 56819 57679 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA6 protein_id gnl|my_center|LOCUS_21130 57681 58292 gene locus_tag LOCUS_21140 gene coaE 57681 58292 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_21140 59224 58289 gene locus_tag LOCUS_21150 59224 58289 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_21150 60004 59249 gene locus_tag LOCUS_21160 gene rlmB 60004 59249 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA3 protein_id gnl|my_center|LOCUS_21160 60431 60108 gene locus_tag LOCUS_21170 60431 60108 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_21170 61039 62700 gene locus_tag LOCUS_21180 gene recN 61039 62700 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU0 protein_id gnl|my_center|LOCUS_21180 63029 63583 gene locus_tag LOCUS_21190 63029 63583 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT9 protein_id gnl|my_center|LOCUS_21190 63576 64019 gene locus_tag LOCUS_21200 63576 64019 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT8 protein_id gnl|my_center|LOCUS_21200 65098 64085 gene locus_tag LOCUS_21210 gene ydhJ 65098 64085 CDS product multidrug resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 protein_id gnl|my_center|LOCUS_21210 65331 65125 gene locus_tag LOCUS_21220 65331 65125 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115096.1 protein_id gnl|my_center|LOCUS_21220 67417 65333 gene locus_tag LOCUS_21230 67417 65333 CDS product fusaric acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208221.1 protein_id gnl|my_center|LOCUS_21230 67877 68647 gene locus_tag LOCUS_21240 gene pcaU 67877 68647 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114686.1 protein_id gnl|my_center|LOCUS_21240 69489 68875 gene locus_tag LOCUS_21250 69489 68875 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_21250 69701 71440 gene locus_tag LOCUS_21260 69701 71440 CDS product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 protein_id gnl|my_center|LOCUS_21260 72097 71510 gene locus_tag LOCUS_21270 gene pgsA 72097 71510 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_21270 73001 72204 gene locus_tag LOCUS_21280 73001 72204 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208217.1 protein_id gnl|my_center|LOCUS_21280 74908 73109 gene locus_tag LOCUS_21290 gene uvrC 74908 73109 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS7 protein_id gnl|my_center|LOCUS_21290 76323 75409 gene locus_tag LOCUS_21300 gene aspH 76323 75409 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000673.1 protein_id gnl|my_center|LOCUS_21300 76861 79011 gene locus_tag LOCUS_21310 gene fadB 76861 79011 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS1 protein_id gnl|my_center|LOCUS_21310 79024 80196 gene locus_tag LOCUS_21320 gene fadA 79024 80196 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_21320 80423 81214 gene locus_tag LOCUS_21330 80423 81214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 82056 81307 gene locus_tag LOCUS_21340 82056 81307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208207.1 protein_id gnl|my_center|LOCUS_21340 82259 82966 gene locus_tag LOCUS_21350 gene dsb 82259 82966 CDS product dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 protein_id gnl|my_center|LOCUS_21350 83385 83816 gene locus_tag LOCUS_21360 83385 83816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 84123 84452 gene locus_tag LOCUS_21370 84123 84452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 84672 85862 gene locus_tag LOCUS_21380 84672 85862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 protein_id gnl|my_center|LOCUS_21380 88137 86215 gene locus_tag LOCUS_21390 gene htpG 88137 86215 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKR1 protein_id gnl|my_center|LOCUS_21390 89346 88747 gene locus_tag LOCUS_21400 gene ompW 89346 88747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208202.1 protein_id gnl|my_center|LOCUS_21400 91141 89729 gene locus_tag LOCUS_21410 91141 89729 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 protein_id gnl|my_center|LOCUS_21410 91448 91948 gene locus_tag LOCUS_21420 91448 91948 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_21420 92355 91996 gene locus_tag LOCUS_21430 92355 91996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 96747 92557 gene locus_tag LOCUS_21440 gene rpoC 96747 92557 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKQ3 protein_id gnl|my_center|LOCUS_21440 100925 96837 gene locus_tag LOCUS_21450 gene rpoB 100925 96837 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_21450 101601 101230 gene locus_tag LOCUS_21460 gene rplL 101601 101230 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKQ0 protein_id gnl|my_center|LOCUS_21460 102156 101650 gene locus_tag LOCUS_21470 gene rplJ 102156 101650 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP9 protein_id gnl|my_center|LOCUS_21470 103123 102428 gene locus_tag LOCUS_21480 gene rplA 103123 102428 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP8 protein_id gnl|my_center|LOCUS_21480 103555 103127 gene locus_tag LOCUS_21490 gene rplK 103555 103127 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP7 protein_id gnl|my_center|LOCUS_21490 104200 103667 gene locus_tag LOCUS_21500 gene nusG 104200 103667 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP6 protein_id gnl|my_center|LOCUS_21500 104647 104207 gene locus_tag LOCUS_21510 gene secE 104647 104207 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP5 protein_id gnl|my_center|LOCUS_21510 104799 104724 gene locus_tag LOCUS_t00410 104799 104724 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 78 2 gene locus_tag LOCUS_t00420 78 2 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 200 124 gene locus_tag LOCUS_t00430 200 124 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 300 225 gene locus_tag LOCUS_t00440 300 225 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1039 530 gene locus_tag LOCUS_21520 1039 530 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_21520 1450 1043 gene locus_tag LOCUS_21530 1450 1043 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN58 protein_id gnl|my_center|LOCUS_21530 1550 2425 gene locus_tag LOCUS_21540 1550 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 protein_id gnl|my_center|LOCUS_21540 2563 2703 gene locus_tag LOCUS_21550 2563 2703 CDS product entericidin, EcnA/B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_21550 2937 3983 gene locus_tag LOCUS_21560 gene dapE 2937 3983 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_21560 4508 4044 gene locus_tag LOCUS_21570 4508 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207557.1 protein_id gnl|my_center|LOCUS_21570 8894 4524 gene locus_tag LOCUS_21580 gene chpA 8894 4524 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207558.1 protein_id gnl|my_center|LOCUS_21580 11141 9060 gene locus_tag LOCUS_21590 gene pilJ 11141 9060 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072794.1 protein_id gnl|my_center|LOCUS_21590 11723 11187 gene locus_tag LOCUS_21600 gene pilI 11723 11187 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_21600 12096 11728 gene locus_tag LOCUS_21610 gene pilH 12096 11728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_21610 12501 12118 gene locus_tag LOCUS_21620 gene pilG 12501 12118 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_21620 12840 13421 gene locus_tag LOCUS_21630 12840 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207559.1 protein_id gnl|my_center|LOCUS_21630 13483 14610 gene locus_tag LOCUS_21640 gene nolF 13483 14610 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207560.1 protein_id gnl|my_center|LOCUS_21640 14623 17727 gene locus_tag LOCUS_21650 gene nolG 14623 17727 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_21650 17818 19533 gene locus_tag LOCUS_21660 gene proS 17818 19533 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_21660 20634 19573 gene locus_tag LOCUS_21670 20634 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 protein_id gnl|my_center|LOCUS_21670 22940 20664 gene locus_tag LOCUS_21680 22940 20664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205923.1 protein_id gnl|my_center|LOCUS_21680 23630 22974 gene locus_tag LOCUS_21690 23630 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 25103 23640 gene locus_tag LOCUS_21700 25103 23640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 25916 25347 gene locus_tag LOCUS_21710 gene dcd 25916 25347 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 protein_id gnl|my_center|LOCUS_21710 26626 26033 gene locus_tag LOCUS_21720 26626 26033 CDS product multidrug transporter MatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071033.1 protein_id gnl|my_center|LOCUS_21720 27049 26873 gene locus_tag LOCUS_21730 27049 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 28499 27270 gene locus_tag LOCUS_21740 gene mrp 28499 27270 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV5 protein_id gnl|my_center|LOCUS_21740 28867 30927 gene locus_tag LOCUS_21750 gene metG 28867 30927 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV3 protein_id gnl|my_center|LOCUS_21750 31072 31428 gene locus_tag LOCUS_21760 31072 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 32118 31495 gene locus_tag LOCUS_21770 gene rhtC 32118 31495 CDS product threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_21770 32305 32760 gene locus_tag LOCUS_21780 32305 32760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888612.1 protein_id gnl|my_center|LOCUS_21780 33196 33029 gene locus_tag LOCUS_21790 33196 33029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 33660 35297 gene locus_tag LOCUS_21800 gene emrB 33660 35297 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_21800 35355 36500 gene locus_tag LOCUS_21810 gene hlyD 35355 36500 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205910.1 protein_id gnl|my_center|LOCUS_21810 36603 37499 gene locus_tag LOCUS_21820 gene dcyD 36603 37499 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_21820 37531 38730 gene locus_tag LOCUS_21830 37531 38730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205908.1 protein_id gnl|my_center|LOCUS_21830 39230 39024 gene locus_tag LOCUS_21840 39230 39024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 41270 39309 gene locus_tag LOCUS_21850 41270 39309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_21850 41866 41543 gene locus_tag LOCUS_21860 41866 41543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 42023 42445 gene locus_tag LOCUS_21870 42023 42445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205905.1 protein_id gnl|my_center|LOCUS_21870 43233 42472 gene locus_tag LOCUS_21880 gene fpr 43233 42472 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_21880 43319 44200 gene locus_tag LOCUS_21890 gene yeiE 43319 44200 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_21890 45120 44485 gene locus_tag LOCUS_21900 gene upp 45120 44485 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET7 protein_id gnl|my_center|LOCUS_21900 46734 45241 gene locus_tag LOCUS_21910 gene nuoN 46734 45241 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET6 protein_id gnl|my_center|LOCUS_21910 48345 46738 gene locus_tag LOCUS_21920 gene nuoM 48345 46738 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 protein_id gnl|my_center|LOCUS_21920 50239 48347 gene locus_tag LOCUS_21930 gene nuoL 50239 48347 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120008.1 protein_id gnl|my_center|LOCUS_21930 50544 50236 gene locus_tag LOCUS_21940 gene nuoK 50544 50236 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET3 protein_id gnl|my_center|LOCUS_21940 51064 50537 gene locus_tag LOCUS_21950 gene nuoJ 51064 50537 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205902.1 protein_id gnl|my_center|LOCUS_21950 51603 51061 gene locus_tag LOCUS_21960 gene nuoI 51603 51061 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XFD5 protein_id gnl|my_center|LOCUS_21960 52635 51622 gene locus_tag LOCUS_21970 gene nuoH 52635 51622 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET0 protein_id gnl|my_center|LOCUS_21970 55322 52638 gene locus_tag LOCUS_21980 gene nuoG 55322 52638 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES9 protein_id gnl|my_center|LOCUS_21980 56662 55334 gene locus_tag LOCUS_21990 gene nuoF 56662 55334 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_21990 57168 56659 gene locus_tag LOCUS_22000 gene nuoE 57168 56659 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_22000 58969 57182 gene locus_tag LOCUS_22010 gene nuoC 58969 57182 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES6 protein_id gnl|my_center|LOCUS_22010 59735 59058 gene locus_tag LOCUS_22020 gene nuoB 59735 59058 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES5 protein_id gnl|my_center|LOCUS_22020 60293 59742 gene locus_tag LOCUS_22030 gene nuoA 60293 59742 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPM2 protein_id gnl|my_center|LOCUS_22030 60792 62129 gene locus_tag LOCUS_22040 gene pleD 60792 62129 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 protein_id gnl|my_center|LOCUS_22040 62226 62582 gene locus_tag LOCUS_22050 62226 62582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205897.1 protein_id gnl|my_center|LOCUS_22050 64257 62605 gene locus_tag LOCUS_22060 gene rstB 64257 62605 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_22060 65029 64313 gene locus_tag LOCUS_22070 gene rstA 65029 64313 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_22070 65627 68455 gene locus_tag LOCUS_22080 gene nrdA 65627 68455 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071099.1 protein_id gnl|my_center|LOCUS_22080 68824 70107 gene locus_tag LOCUS_22090 gene nrdB 68824 70107 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPL5 protein_id gnl|my_center|LOCUS_22090 71310 70396 gene locus_tag LOCUS_22100 gene alsR 71310 70396 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208376.1 protein_id gnl|my_center|LOCUS_22100 71409 71540 gene locus_tag LOCUS_22110 71409 71540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 74157 71914 gene locus_tag LOCUS_22120 gene chuA 74157 71914 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206936.1 protein_id gnl|my_center|LOCUS_22120 75204 74578 gene locus_tag LOCUS_22130 75204 74578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 75330 75893 gene locus_tag LOCUS_22140 75330 75893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 76399 75911 gene locus_tag LOCUS_22150 gene ogt 76399 75911 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP06 protein_id gnl|my_center|LOCUS_22150 76736 76416 gene locus_tag LOCUS_22160 gene sugE 76736 76416 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 protein_id gnl|my_center|LOCUS_22160 77961 77275 gene locus_tag LOCUS_22170 gene rpe 77961 77275 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_22170 78134 78415 gene locus_tag LOCUS_22180 78134 78415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843456.1 protein_id gnl|my_center|LOCUS_22180 79279 78440 gene locus_tag LOCUS_22190 gene esd 79279 78440 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ7 protein_id gnl|my_center|LOCUS_22190 80720 79293 gene locus_tag LOCUS_22200 80720 79293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_22200 81649 80849 gene locus_tag LOCUS_22210 gene rsmJ 81649 80849 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ5 protein_id gnl|my_center|LOCUS_22210 82477 81653 gene locus_tag LOCUS_22220 gene uppP2 82477 81653 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_22220 83156 82491 gene locus_tag LOCUS_22230 gene yeaZ 83156 82491 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_22230 83822 83292 gene locus_tag LOCUS_22240 83822 83292 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_22240 84452 83847 gene locus_tag LOCUS_22250 gene nudL 84452 83847 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_22250 84556 85131 gene locus_tag LOCUS_22260 84556 85131 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_22260 87177 85228 gene locus_tag LOCUS_22270 87177 85228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208429.1 protein_id gnl|my_center|LOCUS_22270 88388 87201 gene locus_tag LOCUS_22280 88388 87201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 90091 88427 gene locus_tag LOCUS_22290 90091 88427 CDS product outer membrane protein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208426.1 protein_id gnl|my_center|LOCUS_22290 91213 90104 gene locus_tag LOCUS_22300 91213 90104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208425.1 protein_id gnl|my_center|LOCUS_22300 92096 91263 gene locus_tag LOCUS_22310 92096 91263 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208424.1 protein_id gnl|my_center|LOCUS_22310 93255 92290 gene locus_tag LOCUS_22320 93255 92290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208423.1 protein_id gnl|my_center|LOCUS_22320 93517 94875 gene locus_tag LOCUS_22330 gene pabB 93517 94875 CDS product p-aminobenzoate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 protein_id gnl|my_center|LOCUS_22330 95964 94876 gene locus_tag LOCUS_22340 gene hisC 95964 94876 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH3 protein_id gnl|my_center|LOCUS_22340 97323 96037 gene locus_tag LOCUS_22350 gene hisD 97323 96037 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH2 protein_id gnl|my_center|LOCUS_22350 98217 97519 gene locus_tag LOCUS_22360 gene hisG 98217 97519 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_22360 99473 98214 gene locus_tag LOCUS_22370 gene murA 99473 98214 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH0 protein_id gnl|my_center|LOCUS_22370 99732 99481 gene locus_tag LOCUS_22380 gene ligA 99732 99481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_22380 100200 99868 gene locus_tag LOCUS_22390 gene rpoX 100200 99868 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071251.1 protein_id gnl|my_center|LOCUS_22390 101815 100370 gene locus_tag LOCUS_22400 gene rpoN 101815 100370 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNG7 protein_id gnl|my_center|LOCUS_22400 >Feature sequence11 458 1822 gene locus_tag LOCUS_22410 458 1822 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802478.1 protein_id gnl|my_center|LOCUS_22410 2252 3502 gene locus_tag LOCUS_22420 2252 3502 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 protein_id gnl|my_center|LOCUS_22420 3597 4793 gene locus_tag LOCUS_22430 3597 4793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_22430 5006 7399 gene locus_tag LOCUS_22440 5006 7399 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK01 protein_id gnl|my_center|LOCUS_22440 7664 8188 gene locus_tag LOCUS_22450 7664 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208143.1 protein_id gnl|my_center|LOCUS_22450 8631 8278 gene locus_tag LOCUS_22460 8631 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 protein_id gnl|my_center|LOCUS_22460 10053 8998 gene locus_tag LOCUS_22470 gene dinP 10053 8998 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK09 protein_id gnl|my_center|LOCUS_22470 10805 10053 gene locus_tag LOCUS_22480 gene yegX 10805 10053 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 protein_id gnl|my_center|LOCUS_22480 12199 10871 gene locus_tag LOCUS_22490 gene farB 12199 10871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208151.1 protein_id gnl|my_center|LOCUS_22490 12538 13506 gene locus_tag LOCUS_22500 12538 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_22500 14173 13550 gene locus_tag LOCUS_22510 14173 13550 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK12 protein_id gnl|my_center|LOCUS_22510 14503 16104 gene locus_tag LOCUS_22520 gene yoaE 14503 16104 CDS product S-adenosylmethionine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208153.1 protein_id gnl|my_center|LOCUS_22520 16169 16648 gene locus_tag LOCUS_22530 16169 16648 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_22530 16686 17330 gene locus_tag LOCUS_22540 16686 17330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_22540 17368 18687 gene locus_tag LOCUS_22550 17368 18687 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121171.1 protein_id gnl|my_center|LOCUS_22550 18859 21078 gene locus_tag LOCUS_22560 gene parC 18859 21078 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK17 protein_id gnl|my_center|LOCUS_22560 21223 22902 gene locus_tag LOCUS_22570 gene fadD 21223 22902 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_22570 23322 22942 gene locus_tag LOCUS_22580 23322 22942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 protein_id gnl|my_center|LOCUS_22580 23479 23829 gene locus_tag LOCUS_22590 23479 23829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_22590 23948 24484 gene locus_tag LOCUS_22600 gene ppa 23948 24484 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK21 protein_id gnl|my_center|LOCUS_22600 25849 24581 gene locus_tag LOCUS_22610 gene oprD 25849 24581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 protein_id gnl|my_center|LOCUS_22610 26414 27181 gene locus_tag LOCUS_22620 26414 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_22620 28720 27236 gene locus_tag LOCUS_22630 gene yifB 28720 27236 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_22630 29011 28784 gene locus_tag LOCUS_22640 29011 28784 CDS product membrane fusogenic activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121136.1 protein_id gnl|my_center|LOCUS_22640 29281 29619 gene locus_tag LOCUS_22650 gene glnK 29281 29619 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_22650 29678 31060 gene locus_tag LOCUS_22660 gene amtB 29678 31060 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK32 protein_id gnl|my_center|LOCUS_22660 31182 31634 gene locus_tag LOCUS_22670 gene nrdR 31182 31634 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK33 protein_id gnl|my_center|LOCUS_22670 31653 32741 gene locus_tag LOCUS_22680 gene ribD 31653 32741 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK34 protein_id gnl|my_center|LOCUS_22680 32738 34030 gene locus_tag LOCUS_22690 32738 34030 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_22690 34052 34711 gene locus_tag LOCUS_22700 gene ribC 34052 34711 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_22700 35753 35121 gene locus_tag LOCUS_22710 35753 35121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121184.1 protein_id gnl|my_center|LOCUS_22710 36206 35799 gene locus_tag LOCUS_22720 gene holC 36206 35799 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121193.1 protein_id gnl|my_center|LOCUS_22720 37647 36199 gene locus_tag LOCUS_22730 gene pepA 37647 36199 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK40 protein_id gnl|my_center|LOCUS_22730 37802 38902 gene locus_tag LOCUS_22740 37802 38902 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_22740 38902 39972 gene locus_tag LOCUS_22750 38902 39972 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_22750 40091 41641 gene locus_tag LOCUS_22760 gene gpmI 40091 41641 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK43 protein_id gnl|my_center|LOCUS_22760 41661 42848 gene locus_tag LOCUS_22770 gene ctpA 41661 42848 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208171.1 protein_id gnl|my_center|LOCUS_22770 44264 42849 gene locus_tag LOCUS_22780 gene pilR 44264 42849 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208172.1 protein_id gnl|my_center|LOCUS_22780 45854 44289 gene locus_tag LOCUS_22790 gene pilS 45854 44289 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208173.1 protein_id gnl|my_center|LOCUS_22790 46504 45869 gene locus_tag LOCUS_22800 gene gacA 46504 45869 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_22800 46747 47754 gene locus_tag LOCUS_22810 gene pbpG 46747 47754 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121158.1 protein_id gnl|my_center|LOCUS_22810 48987 47842 gene locus_tag LOCUS_22820 gene thrC 48987 47842 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_22820 50349 49045 gene locus_tag LOCUS_22830 gene hom 50349 49045 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK50 protein_id gnl|my_center|LOCUS_22830 51288 50473 gene locus_tag LOCUS_22840 gene dsbC 51288 50473 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_22840 52311 51391 gene locus_tag LOCUS_22850 gene xerD 52311 51391 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK52 protein_id gnl|my_center|LOCUS_22850 52476 52739 gene locus_tag LOCUS_22860 gene feoA 52476 52739 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121198.1 protein_id gnl|my_center|LOCUS_22860 52736 54589 gene locus_tag LOCUS_22870 gene feoB 52736 54589 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 protein_id gnl|my_center|LOCUS_22870 54609 54866 gene locus_tag LOCUS_22880 54609 54866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208178.1 protein_id gnl|my_center|LOCUS_22880 55033 56379 gene locus_tag LOCUS_22890 gene murD 55033 56379 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_22890 56404 57600 gene locus_tag LOCUS_22900 gene ftsW 56404 57600 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK57 protein_id gnl|my_center|LOCUS_22900 57836 57606 gene locus_tag LOCUS_22910 57836 57606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 58759 57905 gene locus_tag LOCUS_22920 gene gluQ 58759 57905 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK58 protein_id gnl|my_center|LOCUS_22920 59360 58827 gene locus_tag LOCUS_22930 gene dksA 59360 58827 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL8 protein_id gnl|my_center|LOCUS_22930 60381 59572 gene locus_tag LOCUS_22940 gene icc 60381 59572 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL9 protein_id gnl|my_center|LOCUS_22940 61011 60391 gene locus_tag LOCUS_22950 gene aspP 61011 60391 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208182.1 protein_id gnl|my_center|LOCUS_22950 62980 61088 gene locus_tag LOCUS_22960 gene thiC 62980 61088 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM1 protein_id gnl|my_center|LOCUS_22960 64327 63263 gene locus_tag LOCUS_22970 64327 63263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208183.1 protein_id gnl|my_center|LOCUS_22970 64689 66041 gene locus_tag LOCUS_22980 64689 66041 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208186.1 protein_id gnl|my_center|LOCUS_22980 66141 66863 gene locus_tag LOCUS_22990 gene phoU 66141 66863 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM7 protein_id gnl|my_center|LOCUS_22990 67664 67392 gene locus_tag LOCUS_23000 67664 67392 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_23000 69127 67694 gene locus_tag LOCUS_23010 gene argH 69127 67694 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_23010 69613 70257 gene locus_tag LOCUS_23020 69613 70257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 70326 71063 gene locus_tag LOCUS_23030 gene algR 70326 71063 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_23030 71163 72086 gene locus_tag LOCUS_23040 gene hemC 71163 72086 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_23040 72092 72874 gene locus_tag LOCUS_23050 gene hemD 72092 72874 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_23050 72871 73719 gene locus_tag LOCUS_23060 72871 73719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208191.1 protein_id gnl|my_center|LOCUS_23060 73729 74922 gene locus_tag LOCUS_23070 73729 74922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208192.1 protein_id gnl|my_center|LOCUS_23070 74932 75369 gene locus_tag LOCUS_23080 gene ysmA 74932 75369 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208193.1 protein_id gnl|my_center|LOCUS_23080 75536 75862 gene locus_tag LOCUS_23090 gene hvrA 75536 75862 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_23090 76028 76771 gene locus_tag LOCUS_23100 76028 76771 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 protein_id gnl|my_center|LOCUS_23100 76771 77613 gene locus_tag LOCUS_23110 76771 77613 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079413.1 protein_id gnl|my_center|LOCUS_23110 77655 79910 gene locus_tag LOCUS_23120 gene xcpQ 77655 79910 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 protein_id gnl|my_center|LOCUS_23120 79976 80635 gene locus_tag LOCUS_23130 79976 80635 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208196.1 protein_id gnl|my_center|LOCUS_23130 80691 81362 gene locus_tag LOCUS_23140 gene gph 80691 81362 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_23140 81480 82973 gene locus_tag LOCUS_23150 gene trpE 81480 82973 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 protein_id gnl|my_center|LOCUS_23150 83072 83147 gene locus_tag LOCUS_t00450 83072 83147 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 83196 83279 gene locus_tag LOCUS_t00460 83196 83279 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 83317 83392 gene locus_tag LOCUS_t00470 83317 83392 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 83409 83483 gene locus_tag LOCUS_t00480 83409 83483 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 42 117 gene locus_tag LOCUS_t00490 42 117 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 161 237 gene locus_tag LOCUS_t00500 161 237 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 340 415 gene locus_tag LOCUS_t00510 340 415 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 492 953 gene locus_tag LOCUS_23160 492 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2187 1012 gene locus_tag LOCUS_23170 gene thlA 2187 1012 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_23170 2822 2298 gene locus_tag LOCUS_23180 gene fimT 2822 2298 CDS product type 4 fimbrial biogenesis protein FimT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207590.1 protein_id gnl|my_center|LOCUS_23180 3205 4251 gene locus_tag LOCUS_23190 gene ompA 3205 4251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207589.1 protein_id gnl|my_center|LOCUS_23190 6116 4653 gene locus_tag LOCUS_23200 gene lysP 6116 4653 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207587.1 protein_id gnl|my_center|LOCUS_23200 7151 6135 gene locus_tag LOCUS_23210 gene rsmC 7151 6135 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA0 protein_id gnl|my_center|LOCUS_23210 8581 7211 gene locus_tag LOCUS_23220 gene yicE 8581 7211 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207585.1 protein_id gnl|my_center|LOCUS_23220 8756 10591 gene locus_tag LOCUS_23230 gene typA 8756 10591 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_23230 10767 11213 gene locus_tag LOCUS_23240 gene mscL 10767 11213 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_23240 11592 11308 gene locus_tag LOCUS_23250 gene ppiC 11592 11308 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN94 protein_id gnl|my_center|LOCUS_23250 12437 11619 gene locus_tag LOCUS_23260 gene mutM 12437 11619 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN93 protein_id gnl|my_center|LOCUS_23260 12525 13091 gene locus_tag LOCUS_23270 12525 13091 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_23270 13259 14380 gene locus_tag LOCUS_23280 13259 14380 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116511.1 protein_id gnl|my_center|LOCUS_23280 15213 14425 gene locus_tag LOCUS_23290 gene ybeQ 15213 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207576.1 protein_id gnl|my_center|LOCUS_23290 16361 15642 gene locus_tag LOCUS_23300 16361 15642 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_23300 16622 19228 gene locus_tag LOCUS_23310 gene acnA 16622 19228 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208069.1 protein_id gnl|my_center|LOCUS_23310 19450 20328 gene locus_tag LOCUS_23320 19450 20328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 20725 21408 gene locus_tag LOCUS_23330 20725 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 21448 22155 gene locus_tag LOCUS_23340 21448 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_23340 22755 23420 gene locus_tag LOCUS_23350 gene rluA 22755 23420 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208085.1 protein_id gnl|my_center|LOCUS_23350 23652 24038 gene locus_tag LOCUS_23360 23652 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 protein_id gnl|my_center|LOCUS_23360 24138 24518 gene locus_tag LOCUS_23370 24138 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 24738 24986 gene locus_tag LOCUS_23380 24738 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 25115 25708 gene locus_tag LOCUS_23390 25115 25708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 25823 26866 gene locus_tag LOCUS_23400 25823 26866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207540.1 protein_id gnl|my_center|LOCUS_23400 27837 26896 gene locus_tag LOCUS_23410 gene dusC 27837 26896 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_23410 28054 28821 gene locus_tag LOCUS_23420 28054 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 protein_id gnl|my_center|LOCUS_23420 29674 28865 gene locus_tag LOCUS_23430 29674 28865 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_23430 29819 31234 gene locus_tag LOCUS_23440 gene ffh 29819 31234 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW9 protein_id gnl|my_center|LOCUS_23440 31391 31957 gene locus_tag LOCUS_23450 gene ydeN 31391 31957 CDS product putative hydrolase YdeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96671 protein_id gnl|my_center|LOCUS_23450 32673 31939 gene locus_tag LOCUS_23460 gene coaX 32673 31939 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX0 protein_id gnl|my_center|LOCUS_23460 33437 32691 gene locus_tag LOCUS_23470 gene birA 33437 32691 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205928.1 protein_id gnl|my_center|LOCUS_23470 33465 34277 gene locus_tag LOCUS_23480 33465 34277 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_23480 34428 35123 gene locus_tag LOCUS_23490 34428 35123 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_23490 35134 38583 gene locus_tag LOCUS_23500 gene smc 35134 38583 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX4 protein_id gnl|my_center|LOCUS_23500 38586 39596 gene locus_tag LOCUS_23510 gene zipA 38586 39596 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX5 protein_id gnl|my_center|LOCUS_23510 39672 41708 gene locus_tag LOCUS_23520 gene ligA 39672 41708 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX6 protein_id gnl|my_center|LOCUS_23520 41979 43178 gene locus_tag LOCUS_23530 41979 43178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205933.1 protein_id gnl|my_center|LOCUS_23530 44708 43272 gene locus_tag LOCUS_23540 gene otsA 44708 43272 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205934.1 protein_id gnl|my_center|LOCUS_23540 45544 44696 gene locus_tag LOCUS_23550 gene otsB 45544 44696 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY0 protein_id gnl|my_center|LOCUS_23550 46078 46542 gene locus_tag LOCUS_23560 gene bfrA 46078 46542 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX7 protein_id gnl|my_center|LOCUS_23560 46650 47366 gene locus_tag LOCUS_23570 gene bioH 46650 47366 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205936.1 protein_id gnl|my_center|LOCUS_23570 47472 48764 gene locus_tag LOCUS_23580 gene bioA 47472 48764 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY2 protein_id gnl|my_center|LOCUS_23580 48751 49908 gene locus_tag LOCUS_23590 gene bioF 48751 49908 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205938.1 protein_id gnl|my_center|LOCUS_23590 49905 50687 gene locus_tag LOCUS_23600 gene bioC 49905 50687 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY4 protein_id gnl|my_center|LOCUS_23600 50684 51328 gene locus_tag LOCUS_23610 gene bioD 50684 51328 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY5 protein_id gnl|my_center|LOCUS_23610 52282 51377 gene locus_tag LOCUS_23620 gene rluB 52282 51377 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_23620 52914 52324 gene locus_tag LOCUS_23630 52914 52324 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY7 protein_id gnl|my_center|LOCUS_23630 53702 52911 gene locus_tag LOCUS_23640 53702 52911 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_23640 54209 53940 gene locus_tag LOCUS_23650 54209 53940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 54901 54284 gene locus_tag LOCUS_23660 54901 54284 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205941.1 protein_id gnl|my_center|LOCUS_23660 55472 54996 gene locus_tag LOCUS_23670 55472 54996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205942.1 protein_id gnl|my_center|LOCUS_23670 55756 56313 gene locus_tag LOCUS_23680 55756 56313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_23680 56387 56572 gene locus_tag LOCUS_23690 gene rpmF 56387 56572 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ2 protein_id gnl|my_center|LOCUS_23690 56727 57713 gene locus_tag LOCUS_23700 gene fabD 56727 57713 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ3 protein_id gnl|my_center|LOCUS_23700 57710 58444 gene locus_tag LOCUS_23710 gene fabG 57710 58444 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120395.1 protein_id gnl|my_center|LOCUS_23710 58530 58769 gene locus_tag LOCUS_23720 gene acpP 58530 58769 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ5 protein_id gnl|my_center|LOCUS_23720 58989 59504 gene locus_tag LOCUS_23730 gene ygaU 58989 59504 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_23730 60356 59589 gene locus_tag LOCUS_23740 gene thiED 60356 59589 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_23740 60456 61112 gene locus_tag LOCUS_23750 60456 61112 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 protein_id gnl|my_center|LOCUS_23750 61685 61236 gene locus_tag LOCUS_23760 61685 61236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120291.1 protein_id gnl|my_center|LOCUS_23760 62914 61685 gene locus_tag LOCUS_23770 gene fabB 62914 61685 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205967.1 protein_id gnl|my_center|LOCUS_23770 63206 64675 gene locus_tag LOCUS_23780 63206 64675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205968.1 protein_id gnl|my_center|LOCUS_23780 64835 65209 gene locus_tag LOCUS_23790 gene rpsL 64835 65209 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ5 protein_id gnl|my_center|LOCUS_23790 65374 65844 gene locus_tag LOCUS_23800 gene rpsG 65374 65844 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ6 protein_id gnl|my_center|LOCUS_23800 65977 68115 gene locus_tag LOCUS_23810 gene fusA 65977 68115 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ7 protein_id gnl|my_center|LOCUS_23810 >Feature sequence13 458 117 gene locus_tag LOCUS_23820 458 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1834 467 gene locus_tag LOCUS_23830 1834 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2144 1959 gene locus_tag LOCUS_23840 2144 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2623 2393 gene locus_tag LOCUS_23850 2623 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 3623 2691 gene locus_tag LOCUS_23860 3623 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4789 3746 gene locus_tag LOCUS_23870 4789 3746 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_23870 5985 4942 gene locus_tag LOCUS_23880 5985 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_23880 6300 6052 gene locus_tag LOCUS_23890 6300 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 7021 7299 gene locus_tag LOCUS_23900 7021 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 7310 7459 gene locus_tag LOCUS_23910 7310 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 7509 7925 gene locus_tag LOCUS_23920 7509 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 7975 8547 gene locus_tag LOCUS_23930 7975 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8999 9400 gene locus_tag LOCUS_23940 8999 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 10849 9542 gene locus_tag LOCUS_23950 10849 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 10928 11149 gene locus_tag LOCUS_23960 10928 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 11596 12786 gene locus_tag LOCUS_23970 11596 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 12786 13775 gene locus_tag LOCUS_23980 12786 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 14100 14011 gene locus_tag LOCUS_t00520 14100 14011 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14604 15950 gene locus_tag LOCUS_23990 14604 15950 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477115.1 protein_id gnl|my_center|LOCUS_23990 15950 18712 gene locus_tag LOCUS_24000 15950 18712 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 protein_id gnl|my_center|LOCUS_24000 18702 19313 gene locus_tag LOCUS_24010 18702 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 19310 19780 gene locus_tag LOCUS_24020 gene greB 19310 19780 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z217 protein_id gnl|my_center|LOCUS_24020 21936 19771 gene locus_tag LOCUS_24030 21936 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816646.1 protein_id gnl|my_center|LOCUS_24030 23384 21936 gene locus_tag LOCUS_24040 23384 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816647.1 protein_id gnl|my_center|LOCUS_24040 24502 23381 gene locus_tag LOCUS_24050 24502 23381 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_24050 25921 24644 gene locus_tag LOCUS_24060 25921 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 26258 26112 gene locus_tag LOCUS_24070 26258 26112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 26745 27710 gene locus_tag LOCUS_24080 gene yfhD 26745 27710 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 protein_id gnl|my_center|LOCUS_24080 28196 27810 gene locus_tag LOCUS_24090 28196 27810 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_24090 29303 28401 gene locus_tag LOCUS_24100 gene ttcA 29303 28401 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLS9 protein_id gnl|my_center|LOCUS_24100 29800 30651 gene locus_tag LOCUS_24110 gene vII 29800 30651 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_24110 30783 31688 gene locus_tag LOCUS_24120 gene htpX 30783 31688 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT1 protein_id gnl|my_center|LOCUS_24120 32353 31778 gene locus_tag LOCUS_24130 32353 31778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207443.1 protein_id gnl|my_center|LOCUS_24130 33764 32424 gene locus_tag LOCUS_24140 33764 32424 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS2 protein_id gnl|my_center|LOCUS_24140 37070 33972 gene locus_tag LOCUS_24150 gene mexB 37070 33972 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207444.1 protein_id gnl|my_center|LOCUS_24150 36985 37233 gene locus_tag LOCUS_24160 36985 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 38423 37446 gene locus_tag LOCUS_24170 38423 37446 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207446.1 protein_id gnl|my_center|LOCUS_24170 38816 38625 gene locus_tag LOCUS_24180 38816 38625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 41083 39449 gene locus_tag LOCUS_24190 gene groL 41083 39449 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT7 protein_id gnl|my_center|LOCUS_24190 41432 41142 gene locus_tag LOCUS_24200 gene groS 41432 41142 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_24200 42390 41617 gene locus_tag LOCUS_24210 42390 41617 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207450.1 protein_id gnl|my_center|LOCUS_24210 43297 42371 gene locus_tag LOCUS_24220 43297 42371 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115559.1 protein_id gnl|my_center|LOCUS_24220 43707 45536 gene locus_tag LOCUS_24230 gene pckG 43707 45536 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU3 protein_id gnl|my_center|LOCUS_24230 45770 46198 gene locus_tag LOCUS_24240 45770 46198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115580.1 protein_id gnl|my_center|LOCUS_24240 46903 46235 gene locus_tag LOCUS_24250 46903 46235 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_24250 48074 47226 gene locus_tag LOCUS_24260 gene folD 48074 47226 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_24260 48227 48300 gene locus_tag LOCUS_t00530 48227 48300 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 48313 48398 gene locus_tag LOCUS_t00540 48313 48398 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49179 48865 gene locus_tag LOCUS_24270 49179 48865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115563.1 protein_id gnl|my_center|LOCUS_24270 50095 49244 gene locus_tag LOCUS_24280 50095 49244 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV3 protein_id gnl|my_center|LOCUS_24280 52026 50230 gene locus_tag LOCUS_24290 gene ftsH 52026 50230 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV4 protein_id gnl|my_center|LOCUS_24290 52860 52261 gene locus_tag LOCUS_24300 gene rlmE 52860 52261 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_24300 53106 53429 gene locus_tag LOCUS_24310 53106 53429 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_24310 53442 53978 gene locus_tag LOCUS_24320 53442 53978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 protein_id gnl|my_center|LOCUS_24320 54431 54039 gene locus_tag LOCUS_24330 54431 54039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 54762 55901 gene locus_tag LOCUS_24340 gene carA 54762 55901 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW0 protein_id gnl|my_center|LOCUS_24340 55917 59147 gene locus_tag LOCUS_24350 gene carB 55917 59147 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW1 protein_id gnl|my_center|LOCUS_24350 59239 59715 gene locus_tag LOCUS_24360 gene greA 59239 59715 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW2 protein_id gnl|my_center|LOCUS_24360 59841 60461 gene locus_tag LOCUS_24370 gene catB2 59841 60461 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207463.1 protein_id gnl|my_center|LOCUS_24370 60965 60549 gene locus_tag LOCUS_24380 gene atl1 60965 60549 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_24380 <64788 61004 gene locus_tag LOCUS_24390 <64788 61004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147473.1:Ig-like domain repeat protein >Feature sequence14 447 1322 gene locus_tag LOCUS_24400 447 1322 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121736.1 protein_id gnl|my_center|LOCUS_24400 1428 1886 gene locus_tag LOCUS_24410 gene rimI 1428 1886 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK1 protein_id gnl|my_center|LOCUS_24410 2713 1898 gene locus_tag LOCUS_24420 gene ate 2713 1898 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK2 protein_id gnl|my_center|LOCUS_24420 3464 2733 gene locus_tag LOCUS_24430 gene aat 3464 2733 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK3 protein_id gnl|my_center|LOCUS_24430 4551 3592 gene locus_tag LOCUS_24440 gene trxB 4551 3592 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK4 protein_id gnl|my_center|LOCUS_24440 4803 7934 gene locus_tag LOCUS_24450 gene ftsK 4803 7934 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205973.1 protein_id gnl|my_center|LOCUS_24450 8286 7999 gene locus_tag LOCUS_24460 8286 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_24460 8687 8415 gene locus_tag LOCUS_24470 gene minE 8687 8415 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK9 protein_id gnl|my_center|LOCUS_24470 9502 8690 gene locus_tag LOCUS_24480 gene minD 9502 8690 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL0 protein_id gnl|my_center|LOCUS_24480 10264 9563 gene locus_tag LOCUS_24490 gene minC 10264 9563 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL1 protein_id gnl|my_center|LOCUS_24490 11434 10385 gene locus_tag LOCUS_24500 11434 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_24500 12384 11470 gene locus_tag LOCUS_24510 gene yihG 12384 11470 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_24510 12625 13254 gene locus_tag LOCUS_24520 gene yiaD 12625 13254 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 protein_id gnl|my_center|LOCUS_24520 13380 15419 gene locus_tag LOCUS_24530 gene rep 13380 15419 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL5 protein_id gnl|my_center|LOCUS_24530 15459 15911 gene locus_tag LOCUS_24540 gene dut 15459 15911 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL6 protein_id gnl|my_center|LOCUS_24540 16131 17555 gene locus_tag LOCUS_24550 gene algC 16131 17555 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 protein_id gnl|my_center|LOCUS_24550 17566 18486 gene locus_tag LOCUS_24560 gene argB 17566 18486 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_24560 18630 19478 gene locus_tag LOCUS_24570 18630 19478 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_24570 19769 20209 gene locus_tag LOCUS_24580 19769 20209 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 protein_id gnl|my_center|LOCUS_24580 20360 21442 gene locus_tag LOCUS_24590 20360 21442 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205981.1 protein_id gnl|my_center|LOCUS_24590 21442 21765 gene locus_tag LOCUS_24600 21442 21765 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM3 protein_id gnl|my_center|LOCUS_24600 22209 21811 gene locus_tag LOCUS_24610 gene bamE 22209 21811 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_24610 22321 22758 gene locus_tag LOCUS_24620 gene fur 22321 22758 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_24620 23941 22823 gene locus_tag LOCUS_24630 gene pilU 23941 22823 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 protein_id gnl|my_center|LOCUS_24630 25007 23970 gene locus_tag LOCUS_24640 gene pilT 25007 23970 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_24640 25131 25826 gene locus_tag LOCUS_24650 gene yggS 25131 25826 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_24650 29488 25886 gene locus_tag LOCUS_24660 gene sbcC 29488 25886 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM9 protein_id gnl|my_center|LOCUS_24660 30747 29485 gene locus_tag LOCUS_24670 gene sbcD 30747 29485 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN0 protein_id gnl|my_center|LOCUS_24670 31263 31658 gene locus_tag LOCUS_24680 31263 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 31677 32591 gene locus_tag LOCUS_24690 gene yfcH 31677 32591 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205990.1 protein_id gnl|my_center|LOCUS_24690 33735 32602 gene locus_tag LOCUS_24700 33735 32602 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205991.1 protein_id gnl|my_center|LOCUS_24700 34764 33751 gene locus_tag LOCUS_24710 gene hemB 34764 33751 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN7 protein_id gnl|my_center|LOCUS_24710 34870 35370 gene locus_tag LOCUS_24720 34870 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205992.1 protein_id gnl|my_center|LOCUS_24720 35668 36816 gene locus_tag LOCUS_24730 gene emrA 35668 36816 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_24730 36823 38352 gene locus_tag LOCUS_24740 gene emrB 36823 38352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_24740 39888 38401 gene locus_tag LOCUS_24750 gene glpK 39888 38401 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT38 protein_id gnl|my_center|LOCUS_24750 40018 40376 gene locus_tag LOCUS_tm00010 40018 40376 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 40529 41950 gene locus_tag LOCUS_24760 gene int 40529 41950 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_24760 41950 42768 gene locus_tag LOCUS_24770 41950 42768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 42901 43101 gene locus_tag LOCUS_24780 42901 43101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 43115 43288 gene locus_tag LOCUS_24790 43115 43288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 43299 43544 gene locus_tag LOCUS_24800 43299 43544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 43528 43797 gene locus_tag LOCUS_24810 43528 43797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 43938 45149 gene locus_tag LOCUS_24820 43938 45149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 45839 50770 gene locus_tag LOCUS_24830 45839 50770 CDS product DNA damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_24830 50828 52666 gene locus_tag LOCUS_24840 50828 52666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 52699 53088 gene locus_tag LOCUS_24850 52699 53088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 53442 53882 gene locus_tag LOCUS_24860 53442 53882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24860 53932 54231 gene locus_tag LOCUS_24870 53932 54231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 54238 54942 gene locus_tag LOCUS_24880 54238 54942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 54929 55831 gene locus_tag LOCUS_24890 54929 55831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 56703 56002 gene locus_tag LOCUS_24900 56703 56002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118524.1 protein_id gnl|my_center|LOCUS_24900 57575 58462 gene locus_tag LOCUS_24910 gene trxB 57575 58462 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207182.1 protein_id gnl|my_center|LOCUS_24910 58550 59014 gene locus_tag LOCUS_24920 58550 59014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_24920 60106 59666 gene locus_tag LOCUS_24930 gene uspA 60106 59666 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFV2 protein_id gnl|my_center|LOCUS_24930 60759 60376 gene locus_tag LOCUS_24940 gene pcaC 60759 60376 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_24940 62018 60840 gene locus_tag LOCUS_24950 gene thlA 62018 60840 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_24950 63519 62110 gene locus_tag LOCUS_24960 gene atoE 63519 62110 CDS product short-chain fatty acid transporter scFAT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206695.1 protein_id gnl|my_center|LOCUS_24960 64304 63654 gene locus_tag LOCUS_24970 gene atoA 64304 63654 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence15 140 64 gene locus_tag LOCUS_t00550 140 64 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1364 294 gene locus_tag LOCUS_24980 gene nadA 1364 294 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_24980 2719 1499 gene locus_tag LOCUS_24990 gene argJ 2719 1499 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP07 protein_id gnl|my_center|LOCUS_24990 3315 2884 gene locus_tag LOCUS_25000 3315 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 6108 3379 gene locus_tag LOCUS_25010 gene secA 6108 3379 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNT4 protein_id gnl|my_center|LOCUS_25010 6448 7089 gene locus_tag LOCUS_25020 6448 7089 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_25020 7240 7770 gene locus_tag LOCUS_25030 7240 7770 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 protein_id gnl|my_center|LOCUS_25030 8786 7779 gene locus_tag LOCUS_25040 gene iga 8786 7779 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 protein_id gnl|my_center|LOCUS_25040 10060 8777 gene locus_tag LOCUS_25050 gene folC 10060 8777 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 protein_id gnl|my_center|LOCUS_25050 10953 10057 gene locus_tag LOCUS_25060 gene accD 10953 10057 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU0 protein_id gnl|my_center|LOCUS_25060 11753 10950 gene locus_tag LOCUS_25070 gene trpA 11753 10950 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU1 protein_id gnl|my_center|LOCUS_25070 12143 13438 gene locus_tag LOCUS_25080 12143 13438 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496298.1 protein_id gnl|my_center|LOCUS_25080 14502 13477 gene locus_tag LOCUS_25090 14502 13477 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207612.1 protein_id gnl|my_center|LOCUS_25090 14629 15507 gene locus_tag LOCUS_25100 14629 15507 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_25100 16577 15582 gene locus_tag LOCUS_25110 16577 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207614.1 protein_id gnl|my_center|LOCUS_25110 17366 16857 gene locus_tag LOCUS_25120 17366 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139542.1 protein_id gnl|my_center|LOCUS_25120 18860 17631 gene locus_tag LOCUS_25130 gene trpB 18860 17631 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU6 protein_id gnl|my_center|LOCUS_25130 19485 18844 gene locus_tag LOCUS_25140 gene trpF 19485 18844 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU7 protein_id gnl|my_center|LOCUS_25140 19875 21707 gene locus_tag LOCUS_25150 gene btuB 19875 21707 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 protein_id gnl|my_center|LOCUS_25150 21807 22385 gene locus_tag LOCUS_25160 21807 22385 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 protein_id gnl|my_center|LOCUS_25160 22430 23143 gene locus_tag LOCUS_25170 gene ugpQ 22430 23143 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_25170 23608 23153 gene locus_tag LOCUS_25180 23608 23153 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207619.1 protein_id gnl|my_center|LOCUS_25180 23883 25046 gene locus_tag LOCUS_25190 gene olE1 23883 25046 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_25190 25220 26662 gene locus_tag LOCUS_25200 25220 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 protein_id gnl|my_center|LOCUS_25200 27684 26998 gene locus_tag LOCUS_25210 gene baeR 27684 26998 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116101.1 protein_id gnl|my_center|LOCUS_25210 29364 27697 gene locus_tag LOCUS_25220 gene baeS 29364 27697 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207622.1 protein_id gnl|my_center|LOCUS_25220 29495 29902 gene locus_tag LOCUS_25230 29495 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207623.1 protein_id gnl|my_center|LOCUS_25230 30213 32015 gene locus_tag LOCUS_25240 gene acdB 30213 32015 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_25240 32186 33967 gene locus_tag LOCUS_25250 gene acdA 32186 33967 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_25250 34619 34056 gene locus_tag LOCUS_25260 gene orn 34619 34056 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_25260 34746 35804 gene locus_tag LOCUS_25270 gene engC 34746 35804 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS6 protein_id gnl|my_center|LOCUS_25270 35907 36329 gene locus_tag LOCUS_25280 gene yibN 35907 36329 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_25280 36341 36598 gene locus_tag LOCUS_25290 gene grx 36341 36598 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_25290 36626 37078 gene locus_tag LOCUS_25300 gene secB 36626 37078 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_25300 38406 37141 gene locus_tag LOCUS_25310 gene dfp 38406 37141 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_25310 38518 39243 gene locus_tag LOCUS_25320 gene radC 38518 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207648.1 protein_id gnl|my_center|LOCUS_25320 39286 40197 gene locus_tag LOCUS_25330 39286 40197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064169.1 protein_id gnl|my_center|LOCUS_25330 41070 40204 gene locus_tag LOCUS_25340 gene trpH 41070 40204 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_25340 41115 41729 gene locus_tag LOCUS_25350 gene ispZ 41115 41729 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ2 protein_id gnl|my_center|LOCUS_25350 41756 42058 gene locus_tag LOCUS_25360 41756 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 protein_id gnl|my_center|LOCUS_25360 42063 42551 gene locus_tag LOCUS_25370 42063 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064163.1 protein_id gnl|my_center|LOCUS_25370 42591 44498 gene locus_tag LOCUS_25380 gene mnmC 42591 44498 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC7 protein_id gnl|my_center|LOCUS_25380 44890 44576 gene locus_tag LOCUS_25390 gene glpE 44890 44576 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 protein_id gnl|my_center|LOCUS_25390 44982 45470 gene locus_tag LOCUS_25400 44982 45470 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC9 protein_id gnl|my_center|LOCUS_25400 45498 46001 gene locus_tag LOCUS_25410 45498 46001 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 protein_id gnl|my_center|LOCUS_25410 46467 46045 gene locus_tag LOCUS_25420 46467 46045 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116010.1 protein_id gnl|my_center|LOCUS_25420 46900 46469 gene locus_tag LOCUS_25430 gene thi3 46900 46469 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_25430 47163 47498 gene locus_tag LOCUS_25440 gene blh 47163 47498 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_25440 47491 47925 gene locus_tag LOCUS_25450 gene blh 47491 47925 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_25450 50081 48081 gene locus_tag LOCUS_25460 50081 48081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 50289 51671 gene locus_tag LOCUS_25470 gene pdhD 50289 51671 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207656.1 protein_id gnl|my_center|LOCUS_25470 52998 51721 gene locus_tag LOCUS_25480 52998 51721 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086530.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence16 1107 430 gene locus_tag LOCUS_25490 1107 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065252.1 protein_id gnl|my_center|LOCUS_25490 1555 1127 gene locus_tag LOCUS_25500 gene sspB 1555 1127 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_25500 2218 1565 gene locus_tag LOCUS_25510 gene sspA 2218 1565 CDS product starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065247.1 protein_id gnl|my_center|LOCUS_25510 2941 2555 gene locus_tag LOCUS_25520 gene rpsI 2941 2555 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK4 protein_id gnl|my_center|LOCUS_25520 3382 2954 gene locus_tag LOCUS_25530 gene rplM 3382 2954 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK3 protein_id gnl|my_center|LOCUS_25530 3698 3916 gene locus_tag LOCUS_25540 3698 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3936 4901 gene locus_tag LOCUS_25550 gene pdxA 3936 4901 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK2 protein_id gnl|my_center|LOCUS_25550 4922 5734 gene locus_tag LOCUS_25560 gene rsmA 4922 5734 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS2 protein_id gnl|my_center|LOCUS_25560 5738 6580 gene locus_tag LOCUS_25570 gene apaH 5738 6580 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ9 protein_id gnl|my_center|LOCUS_25570 7144 6695 gene locus_tag LOCUS_25580 7144 6695 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 protein_id gnl|my_center|LOCUS_25580 7905 7237 gene locus_tag LOCUS_25590 gene lrgB 7905 7237 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 protein_id gnl|my_center|LOCUS_25590 8289 7918 gene locus_tag LOCUS_25600 8289 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 protein_id gnl|my_center|LOCUS_25600 9668 8328 gene locus_tag LOCUS_25610 gene hflX 9668 8328 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ5 protein_id gnl|my_center|LOCUS_25610 9895 9758 gene locus_tag LOCUS_25620 9895 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 10052 10888 gene locus_tag LOCUS_25630 gene plsC 10052 10888 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_25630 12455 10956 gene locus_tag LOCUS_25640 gene plD 12455 10956 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117884.1 protein_id gnl|my_center|LOCUS_25640 12691 13701 gene locus_tag LOCUS_25650 12691 13701 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_25650 15078 13765 gene locus_tag LOCUS_25660 gene yhjE 15078 13765 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207605.1 protein_id gnl|my_center|LOCUS_25660 15859 15218 gene locus_tag LOCUS_25670 gene yqfA 15859 15218 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207604.1 protein_id gnl|my_center|LOCUS_25670 15962 17182 gene locus_tag LOCUS_25680 gene gstcD 15962 17182 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_25680 18145 17276 gene locus_tag LOCUS_25690 gene yjjU 18145 17276 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207601.1 protein_id gnl|my_center|LOCUS_25690 18491 18165 gene locus_tag LOCUS_25700 18491 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 20837 18699 gene locus_tag LOCUS_25710 20837 18699 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_25710 22053 20848 gene locus_tag LOCUS_25720 gene fadA 22053 20848 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_25720 23252 22242 gene locus_tag LOCUS_25730 gene oruR 23252 22242 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 protein_id gnl|my_center|LOCUS_25730 23431 24591 gene locus_tag LOCUS_25740 gene amacR 23431 24591 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207596.1 protein_id gnl|my_center|LOCUS_25740 24741 26384 gene locus_tag LOCUS_25750 gene cysI 24741 26384 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207593.1 protein_id gnl|my_center|LOCUS_25750 26377 26868 gene locus_tag LOCUS_25760 26377 26868 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207592.1 protein_id gnl|my_center|LOCUS_25760 29539 26930 gene locus_tag LOCUS_25770 gene cysJ 29539 26930 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207550.1 protein_id gnl|my_center|LOCUS_25770 30268 29708 gene locus_tag LOCUS_25780 30268 29708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 protein_id gnl|my_center|LOCUS_25780 32460 30355 gene locus_tag LOCUS_25790 32460 30355 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207548.1 protein_id gnl|my_center|LOCUS_25790 32716 33873 gene locus_tag LOCUS_25800 gene bcr 32716 33873 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 protein_id gnl|my_center|LOCUS_25800 34622 33918 gene locus_tag LOCUS_25810 34622 33918 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 protein_id gnl|my_center|LOCUS_25810 35010 36365 gene locus_tag LOCUS_25820 35010 36365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207512.1 protein_id gnl|my_center|LOCUS_25820 36978 38213 gene locus_tag LOCUS_25830 gene gltS 36978 38213 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 protein_id gnl|my_center|LOCUS_25830 38306 39781 gene locus_tag LOCUS_25840 38306 39781 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207544.1 protein_id gnl|my_center|LOCUS_25840 41028 39820 gene locus_tag LOCUS_25850 41028 39820 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_25850 41165 42169 gene locus_tag LOCUS_25860 gene ylbK 41165 42169 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207543.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence17 754 218 gene locus_tag LOCUS_25870 gene ureJ 754 218 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 protein_id gnl|my_center|LOCUS_25870 1412 798 gene locus_tag LOCUS_25880 gene ureG 1412 798 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 protein_id gnl|my_center|LOCUS_25880 2140 1469 gene locus_tag LOCUS_25890 gene ureF 2140 1469 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX6 protein_id gnl|my_center|LOCUS_25890 2606 2121 gene locus_tag LOCUS_25900 gene ureE 2606 2121 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX5 protein_id gnl|my_center|LOCUS_25900 3118 2732 gene locus_tag LOCUS_25910 3118 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3476 3063 gene locus_tag LOCUS_25920 3476 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 5597 3897 gene locus_tag LOCUS_25930 gene ureC 5597 3897 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX4 protein_id gnl|my_center|LOCUS_25930 5920 5594 gene locus_tag LOCUS_25940 gene ureB 5920 5594 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX2 protein_id gnl|my_center|LOCUS_25940 6232 5930 gene locus_tag LOCUS_25950 gene ureA 6232 5930 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX1 protein_id gnl|my_center|LOCUS_25950 7191 6319 gene locus_tag LOCUS_25960 gene ureD 7191 6319 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX0 protein_id gnl|my_center|LOCUS_25960 8784 7423 gene locus_tag LOCUS_25970 8784 7423 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 protein_id gnl|my_center|LOCUS_25970 11021 9615 gene locus_tag LOCUS_25980 11021 9615 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_25980 12302 11367 gene locus_tag LOCUS_25990 12302 11367 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_25990 13891 12443 gene locus_tag LOCUS_26000 gene davD 13891 12443 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_26000 15098 14226 gene locus_tag LOCUS_26010 15098 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_26010 15525 15112 gene locus_tag LOCUS_26020 15525 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 protein_id gnl|my_center|LOCUS_26020 15944 15522 gene locus_tag LOCUS_26030 15944 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069081.1 protein_id gnl|my_center|LOCUS_26030 16258 18108 gene locus_tag LOCUS_26040 gene dsbD 16258 18108 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 protein_id gnl|my_center|LOCUS_26040 19529 18258 gene locus_tag LOCUS_26050 gene gdhA 19529 18258 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF0 protein_id gnl|my_center|LOCUS_26050 21130 19682 gene locus_tag LOCUS_26060 gene gabD 21130 19682 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207896.1 protein_id gnl|my_center|LOCUS_26060 22407 21127 gene locus_tag LOCUS_26070 gene gabT 22407 21127 CDS product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207897.1 protein_id gnl|my_center|LOCUS_26070 22792 24222 gene locus_tag LOCUS_26080 22792 24222 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206135.1 protein_id gnl|my_center|LOCUS_26080 24240 25010 gene locus_tag LOCUS_26090 24240 25010 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_26090 25067 25786 gene locus_tag LOCUS_26100 gene rmpR 25067 25786 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206133.1 protein_id gnl|my_center|LOCUS_26100 25860 26567 gene locus_tag LOCUS_26110 25860 26567 CDS product cache protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206132.1 protein_id gnl|my_center|LOCUS_26110 26763 28094 gene locus_tag LOCUS_26120 gene puuP 26763 28094 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206131.1 protein_id gnl|my_center|LOCUS_26120 28114 29529 gene locus_tag LOCUS_26130 gene puuB 28114 29529 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206130.1 protein_id gnl|my_center|LOCUS_26130 30893 29646 gene locus_tag LOCUS_26140 30893 29646 CDS product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105913.1 protein_id gnl|my_center|LOCUS_26140 31144 32631 gene locus_tag LOCUS_26150 gene mocR 31144 32631 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_26150 33835 32726 gene locus_tag LOCUS_26160 gene fabH 33835 32726 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 protein_id gnl|my_center|LOCUS_26160 37723 33866 gene locus_tag LOCUS_26170 gene hrpA 37723 33866 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206207.1 protein_id gnl|my_center|LOCUS_26170 38064 38627 gene locus_tag LOCUS_26180 gene ahpC 38064 38627 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 protein_id gnl|my_center|LOCUS_26180 38811 39017 gene locus_tag LOCUS_26190 38811 39017 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 protein_id gnl|my_center|LOCUS_26190 39636 39052 gene locus_tag LOCUS_26200 gene mdmC 39636 39052 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_26200 39930 39682 gene locus_tag LOCUS_26210 39930 39682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence18 743 453 gene locus_tag LOCUS_26220 gene catC 743 453 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF42 protein_id gnl|my_center|LOCUS_26220 1874 768 gene locus_tag LOCUS_26230 gene catB 1874 768 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 protein_id gnl|my_center|LOCUS_26230 1984 2898 gene locus_tag LOCUS_26240 gene benM 1984 2898 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206214.1 protein_id gnl|my_center|LOCUS_26240 3831 2917 gene locus_tag LOCUS_26250 gene bioH 3831 2917 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_26250 4381 3848 gene locus_tag LOCUS_26260 4381 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206944.1 protein_id gnl|my_center|LOCUS_26260 4512 6536 gene locus_tag LOCUS_26270 gene fadH 4512 6536 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 protein_id gnl|my_center|LOCUS_26270 6621 7034 gene locus_tag LOCUS_26280 6621 7034 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_26280 7089 8189 gene locus_tag LOCUS_26290 gene abhD3 7089 8189 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 protein_id gnl|my_center|LOCUS_26290 8304 8585 gene locus_tag LOCUS_26300 8304 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 9238 8807 gene locus_tag LOCUS_26310 9238 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 9465 11105 gene locus_tag LOCUS_26320 gene pyrG 9465 11105 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFQ0 protein_id gnl|my_center|LOCUS_26320 11137 11994 gene locus_tag LOCUS_26330 gene kdsA 11137 11994 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP9 protein_id gnl|my_center|LOCUS_26330 12040 13329 gene locus_tag LOCUS_26340 gene eno 12040 13329 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP8 protein_id gnl|my_center|LOCUS_26340 13336 13737 gene locus_tag LOCUS_26350 gene ftsB 13336 13737 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP4 protein_id gnl|my_center|LOCUS_26350 13700 14431 gene locus_tag LOCUS_26360 gene ispD 13700 14431 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP3 protein_id gnl|my_center|LOCUS_26360 14613 14984 gene locus_tag LOCUS_26370 14613 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206225.1 protein_id gnl|my_center|LOCUS_26370 15639 15061 gene locus_tag LOCUS_26380 15639 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206996.1 protein_id gnl|my_center|LOCUS_26380 15813 16307 gene locus_tag LOCUS_26390 gene ispF 15813 16307 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE4 protein_id gnl|my_center|LOCUS_26390 16819 16295 gene locus_tag LOCUS_26400 16819 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_26400 17972 16872 gene locus_tag LOCUS_26410 gene aroF 17972 16872 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_26410 18968 18090 gene locus_tag LOCUS_26420 18968 18090 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN08 protein_id gnl|my_center|LOCUS_26420 20961 19405 gene locus_tag LOCUS_26430 20961 19405 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206646.1 protein_id gnl|my_center|LOCUS_26430 23454 21322 gene locus_tag LOCUS_26440 gene fpvA1 23454 21322 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_26440 23677 24852 gene locus_tag LOCUS_26450 gene lpxB 23677 24852 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN14 protein_id gnl|my_center|LOCUS_26450 25806 24937 gene locus_tag LOCUS_26460 25806 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 protein_id gnl|my_center|LOCUS_26460 25840 26316 gene locus_tag LOCUS_26470 25840 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206651.1 protein_id gnl|my_center|LOCUS_26470 26425 27108 gene locus_tag LOCUS_26480 26425 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 protein_id gnl|my_center|LOCUS_26480 28253 27150 gene locus_tag LOCUS_26490 gene porB 28253 27150 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_26490 28930 28517 gene locus_tag LOCUS_26500 28930 28517 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_26500 29218 28949 gene locus_tag LOCUS_26510 29218 28949 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206654.1 protein_id gnl|my_center|LOCUS_26510 29959 30204 gene locus_tag LOCUS_26520 29959 30204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 30905 31735 gene locus_tag LOCUS_26530 gene htrB 30905 31735 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_26530 32000 31791 gene locus_tag LOCUS_26540 gene cspA 32000 31791 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 protein_id gnl|my_center|LOCUS_26540 32707 33093 gene locus_tag LOCUS_26550 32707 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206458.1 protein_id gnl|my_center|LOCUS_26550 33429 33112 gene locus_tag LOCUS_26560 33429 33112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 33762 34175 gene locus_tag LOCUS_26570 33762 34175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 34462 34860 gene locus_tag LOCUS_26580 34462 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113876.1 protein_id gnl|my_center|LOCUS_26580 35182 35003 gene locus_tag LOCUS_26590 35182 35003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 35436 35759 gene locus_tag LOCUS_26600 35436 35759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence19 615 352 gene locus_tag LOCUS_26610 615 352 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207228.1 protein_id gnl|my_center|LOCUS_26610 2011 617 gene locus_tag LOCUS_26620 2011 617 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207227.1 protein_id gnl|my_center|LOCUS_26620 3002 2223 gene locus_tag LOCUS_26630 gene fpr 3002 2223 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118187.1 protein_id gnl|my_center|LOCUS_26630 3104 3805 gene locus_tag LOCUS_26640 3104 3805 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_26640 4752 3808 gene locus_tag LOCUS_26650 4752 3808 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324795.1 protein_id gnl|my_center|LOCUS_26650 5058 6815 gene locus_tag LOCUS_26660 gene xcpR 5058 6815 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_26660 6902 7267 gene locus_tag LOCUS_26670 6902 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207222.1 protein_id gnl|my_center|LOCUS_26670 7422 8081 gene locus_tag LOCUS_26680 gene qseB 7422 8081 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 protein_id gnl|my_center|LOCUS_26680 8082 9428 gene locus_tag LOCUS_26690 gene qseC 8082 9428 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207220.1 protein_id gnl|my_center|LOCUS_26690 9664 9494 gene locus_tag LOCUS_26700 9664 9494 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118129.1 protein_id gnl|my_center|LOCUS_26700 9802 10701 gene locus_tag LOCUS_26710 9802 10701 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207219.1 protein_id gnl|my_center|LOCUS_26710 11287 10733 gene locus_tag LOCUS_26720 11287 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207218.1 protein_id gnl|my_center|LOCUS_26720 13708 11306 gene locus_tag LOCUS_26730 gene mrcB 13708 11306 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ35 protein_id gnl|my_center|LOCUS_26730 13900 14805 gene locus_tag LOCUS_26740 gene nadK 13900 14805 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ34 protein_id gnl|my_center|LOCUS_26740 14808 15080 gene locus_tag LOCUS_26750 14808 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_26750 15519 15178 gene locus_tag LOCUS_26760 15519 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 16620 15619 gene locus_tag LOCUS_26770 16620 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_26770 17051 18394 gene locus_tag LOCUS_26780 gene dctA 17051 18394 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207216.1 protein_id gnl|my_center|LOCUS_26780 18545 19684 gene locus_tag LOCUS_26790 gene acadL 18545 19684 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_26790 21457 19739 gene locus_tag LOCUS_26800 gene rpfB 21457 19739 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_26800 22006 23115 gene locus_tag LOCUS_26810 gene pheA 22006 23115 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 protein_id gnl|my_center|LOCUS_26810 23308 25554 gene locus_tag LOCUS_26820 gene aroA 23308 25554 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ26 protein_id gnl|my_center|LOCUS_26820 25679 26059 gene locus_tag LOCUS_26830 25679 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207212.1 protein_id gnl|my_center|LOCUS_26830 26750 26118 gene locus_tag LOCUS_26840 gene rp471 26750 26118 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207209.1 protein_id gnl|my_center|LOCUS_26840 26875 27654 gene locus_tag LOCUS_26850 26875 27654 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ21 protein_id gnl|my_center|LOCUS_26850 27777 28406 gene locus_tag LOCUS_26860 27777 28406 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_26860 28828 28445 gene locus_tag LOCUS_26870 28828 28445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 29370 29011 gene locus_tag LOCUS_26880 29370 29011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence20 546 737 gene locus_tag LOCUS_26890 546 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 737 2344 gene locus_tag LOCUS_26900 gene cydA 737 2344 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 protein_id gnl|my_center|LOCUS_26900 2341 3486 gene locus_tag LOCUS_26910 gene cydB 2341 3486 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_26910 3613 3909 gene locus_tag LOCUS_26920 3613 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 protein_id gnl|my_center|LOCUS_26920 4606 3950 gene locus_tag LOCUS_26930 4606 3950 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_26930 5403 4810 gene locus_tag LOCUS_26940 5403 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121011.1 protein_id gnl|my_center|LOCUS_26940 6746 5646 gene locus_tag LOCUS_26950 gene ftsY 6746 5646 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT1 protein_id gnl|my_center|LOCUS_26950 6918 8321 gene locus_tag LOCUS_26960 6918 8321 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_26960 8335 9912 gene locus_tag LOCUS_26970 8335 9912 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_26970 10159 9833 gene locus_tag LOCUS_26980 10159 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 10682 10278 gene locus_tag LOCUS_26990 10682 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120892.1 protein_id gnl|my_center|LOCUS_26990 10904 11137 gene locus_tag LOCUS_27000 10904 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121063.1 protein_id gnl|my_center|LOCUS_27000 11271 11651 gene locus_tag LOCUS_27010 11271 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121078.1 protein_id gnl|my_center|LOCUS_27010 11804 12235 gene locus_tag LOCUS_27020 11804 12235 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_27020 13517 12312 gene locus_tag LOCUS_27030 gene trpB2 13517 12312 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ0 protein_id gnl|my_center|LOCUS_27030 14743 13556 gene locus_tag LOCUS_27040 14743 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_27040 15607 14756 gene locus_tag LOCUS_27050 15607 14756 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_27050 15974 15630 gene locus_tag LOCUS_27060 15974 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113949.1 protein_id gnl|my_center|LOCUS_27060 16320 16009 gene locus_tag LOCUS_27070 16320 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113722.1 protein_id gnl|my_center|LOCUS_27070 17591 16449 gene locus_tag LOCUS_27080 gene rnd 17591 16449 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence21 2087 480 gene locus_tag LOCUS_27090 2087 480 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206466.1 protein_id gnl|my_center|LOCUS_27090 2774 5341 gene locus_tag LOCUS_27100 2774 5341 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_27100 5951 7084 gene locus_tag LOCUS_27110 5951 7084 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 protein_id gnl|my_center|LOCUS_27110 7434 8297 gene locus_tag LOCUS_27120 7434 8297 CDS product CAU/MBL1b family subclass B3 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920000.1 protein_id gnl|my_center|LOCUS_27120 9194 8409 gene locus_tag LOCUS_27130 9194 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 9999 9208 gene locus_tag LOCUS_27140 9999 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 10428 10892 gene locus_tag LOCUS_27150 gene ybbK 10428 10892 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207987.1 protein_id gnl|my_center|LOCUS_27150 11063 10988 gene locus_tag LOCUS_t00560 11063 10988 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12654 11233 gene locus_tag LOCUS_27160 gene cysS 12654 11233 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX2 protein_id gnl|my_center|LOCUS_27160 12844 13842 gene locus_tag LOCUS_27170 gene kdsD 12844 13842 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX3 protein_id gnl|my_center|LOCUS_27170 13847 14386 gene locus_tag LOCUS_27180 gene kdsC 13847 14386 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_27180 14426 14974 gene locus_tag LOCUS_27190 14426 14974 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070181.1 protein_id gnl|my_center|LOCUS_27190 14958 15524 gene locus_tag LOCUS_27200 gene lptA 14958 15524 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX6 protein_id gnl|my_center|LOCUS_27200 15524 16270 gene locus_tag LOCUS_27210 15524 16270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence22 1981 1433 gene locus_tag LOCUS_27220 gene yceJ 1981 1433 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206183.1 protein_id gnl|my_center|LOCUS_27220 2814 3500 gene locus_tag LOCUS_27230 2814 3500 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_27230 4412 3678 gene locus_tag LOCUS_27240 4412 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_27240 4675 4415 gene locus_tag LOCUS_27250 4675 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 5673 4774 gene locus_tag LOCUS_27260 gene gltC 5673 4774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206484.1 protein_id gnl|my_center|LOCUS_27260 5788 6210 gene locus_tag LOCUS_27270 gene cidA 5788 6210 CDS product holin-like protein CidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFD1 protein_id gnl|my_center|LOCUS_27270 6207 6908 gene locus_tag LOCUS_27280 gene ywbG 6207 6908 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206486.1 protein_id gnl|my_center|LOCUS_27280 7657 6905 gene locus_tag LOCUS_27290 gene cobS 7657 6905 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN06 protein_id gnl|my_center|LOCUS_27290 8262 7654 gene locus_tag LOCUS_27300 gene cobC 8262 7654 CDS product fructose 2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206641.1 protein_id gnl|my_center|LOCUS_27300 9315 8263 gene locus_tag LOCUS_27310 gene cobT 9315 8263 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN03 protein_id gnl|my_center|LOCUS_27310 9833 9315 gene locus_tag LOCUS_27320 gene cobU 9833 9315 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_27320 10462 9815 gene locus_tag LOCUS_27330 10462 9815 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206638.1 protein_id gnl|my_center|LOCUS_27330 10702 10926 gene locus_tag LOCUS_27340 10702 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10923 11222 gene locus_tag LOCUS_27350 10923 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 11312 11545 gene locus_tag LOCUS_27360 11312 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 12674 12345 gene locus_tag LOCUS_27370 12674 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 13505 13320 gene locus_tag LOCUS_27380 13505 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 13946 14215 gene locus_tag LOCUS_27390 13946 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 14779 14312 gene locus_tag LOCUS_27400 gene ybaK 14779 14312 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ8 protein_id gnl|my_center|LOCUS_27400 15071 15535 gene locus_tag LOCUS_27410 15071 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence23 181 417 gene locus_tag LOCUS_27420 181 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 572 892 gene locus_tag LOCUS_27430 572 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_27430 885 1157 gene locus_tag LOCUS_27440 885 1157 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_27440 1777 1986 gene locus_tag LOCUS_27450 1777 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2235 3689 gene locus_tag LOCUS_27460 gene ybaR 2235 3689 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 protein_id gnl|my_center|LOCUS_27460 4508 3972 gene locus_tag LOCUS_27470 4508 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 5499 4576 gene locus_tag LOCUS_27480 5499 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 5879 5658 gene locus_tag LOCUS_27490 5879 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 7417 5981 gene locus_tag LOCUS_27500 7417 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 7588 7893 gene locus_tag LOCUS_27510 7588 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 8014 7883 gene locus_tag LOCUS_27520 8014 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 8579 9631 gene locus_tag LOCUS_27530 8579 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 9618 9884 gene locus_tag LOCUS_27540 9618 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence24 748 969 gene locus_tag LOCUS_27550 748 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1468 1040 gene locus_tag LOCUS_27560 gene arsC 1468 1040 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLK5 protein_id gnl|my_center|LOCUS_27560 1554 1868 gene locus_tag LOCUS_27570 gene arsR 1554 1868 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206514.1 protein_id gnl|my_center|LOCUS_27570 1873 2910 gene locus_tag LOCUS_27580 gene arsB 1873 2910 CDS product arsenite transporter ACR3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206515.1 protein_id gnl|my_center|LOCUS_27580 4058 3186 gene locus_tag LOCUS_27590 4058 3186 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 protein_id gnl|my_center|LOCUS_27590 5161 4055 gene locus_tag LOCUS_27600 gene phaC1 5161 4055 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206656.1 protein_id gnl|my_center|LOCUS_27600 5293 6480 gene locus_tag LOCUS_27610 gene metZ 5293 6480 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN23 protein_id gnl|my_center|LOCUS_27610 6508 6837 gene locus_tag LOCUS_27620 6508 6837 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_27620 6851 7447 gene locus_tag LOCUS_27630 gene recR 6851 7447 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN26 protein_id gnl|my_center|LOCUS_27630 >Feature sequence25 376 125 gene locus_tag LOCUS_27640 376 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1182 2498 gene locus_tag LOCUS_27650 gene hmgB 1182 2498 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_27650 2485 3123 gene locus_tag LOCUS_27660 gene hmgA 2485 3123 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_27660 3143 3700 gene locus_tag LOCUS_27670 3143 3700 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence26 58 678 gene locus_tag LOCUS_27680 58 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1416 706 gene locus_tag LOCUS_27690 1416 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207508.1 protein_id gnl|my_center|LOCUS_27690 1842 1456 gene locus_tag LOCUS_27700 gene dgkA 1842 1456 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY23 protein_id gnl|my_center|LOCUS_27700