>Feature sequence001 563 943 gene locus_tag LOCUS_00010 563 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1783 1493 gene locus_tag LOCUS_00020 1783 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2997 1798 gene locus_tag LOCUS_00030 2997 1798 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705921.1 protein_id gnl|my_center|LOCUS_00030 3223 3008 gene locus_tag LOCUS_00040 3223 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3340 3558 gene locus_tag LOCUS_00050 3340 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3950 4948 gene locus_tag LOCUS_00060 3950 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7851 5083 gene locus_tag LOCUS_00070 7851 5083 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_00070 9758 7848 gene locus_tag LOCUS_00080 9758 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12580 9779 gene locus_tag LOCUS_00090 12580 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035774.1 protein_id gnl|my_center|LOCUS_00090 >Feature sequence002 2 1156 gene locus_tag LOCUS_00100 2 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 1606 2076 gene locus_tag LOCUS_00110 1606 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 2390 4633 gene locus_tag LOCUS_00120 2390 4633 CDS product type II restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_00120 4642 5715 gene locus_tag LOCUS_00130 4642 5715 CDS product type II restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476615.1 protein_id gnl|my_center|LOCUS_00130 6267 5764 gene locus_tag LOCUS_00140 6267 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933904.1 protein_id gnl|my_center|LOCUS_00140 7422 6271 gene locus_tag LOCUS_00150 7422 6271 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_00150 7872 7582 gene locus_tag LOCUS_00160 7872 7582 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 protein_id gnl|my_center|LOCUS_00160 8225 7977 gene locus_tag LOCUS_00170 gene alpA 8225 7977 CDS product Mu phage lytic protein AlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071638.1 protein_id gnl|my_center|LOCUS_00170 9228 8305 gene locus_tag LOCUS_00180 9228 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 10432 9371 gene locus_tag LOCUS_00190 10432 9371 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_00190 11521 10529 gene locus_tag LOCUS_00200 11521 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_00200 11898 11560 gene locus_tag LOCUS_00210 11898 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 12949 12044 gene locus_tag LOCUS_00220 12949 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence003 171 2360 gene locus_tag LOCUS_00230 gene fimX 171 2360 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_00230 2403 2843 gene locus_tag LOCUS_00240 2403 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 2928 3887 gene locus_tag LOCUS_00250 2928 3887 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_00250 3984 5000 gene locus_tag LOCUS_00260 3984 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 4997 7063 gene locus_tag LOCUS_00270 gene tgpA 4997 7063 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_00270 7123 7905 gene locus_tag LOCUS_00280 7123 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 9115 7913 gene locus_tag LOCUS_00290 9115 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 <12305 9125 gene locus_tag LOCUS_00300 <12305 9125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267702.1:methionine synthase >Feature sequence004 620 1867 gene locus_tag LOCUS_00310 620 1867 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527919.1 protein_id gnl|my_center|LOCUS_00310 1947 5129 gene locus_tag LOCUS_00320 gene nolG 1947 5129 CDS product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_00320 5432 6169 gene locus_tag LOCUS_00330 5432 6169 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709525.1 protein_id gnl|my_center|LOCUS_00330 6339 8000 gene locus_tag LOCUS_00340 6339 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 8170 8907 gene locus_tag LOCUS_00350 8170 8907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 protein_id gnl|my_center|LOCUS_00350 8985 9674 gene locus_tag LOCUS_00360 8985 9674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225834.1 protein_id gnl|my_center|LOCUS_00360 9837 10814 gene locus_tag LOCUS_00370 9837 10814 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F501 protein_id gnl|my_center|LOCUS_00370 10789 10974 gene locus_tag LOCUS_00380 10789 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 11289 10960 gene locus_tag LOCUS_00390 gene ihfA 11289 10960 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMM4 protein_id gnl|my_center|LOCUS_00390 >Feature sequence005 960 37 gene locus_tag LOCUS_00400 gene ddl 960 37 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6M0 protein_id gnl|my_center|LOCUS_00400 2690 1176 gene locus_tag LOCUS_00410 gene murC 2690 1176 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_00410 3852 2734 gene locus_tag LOCUS_00420 gene murG 3852 2734 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC8 protein_id gnl|my_center|LOCUS_00420 4199 6172 gene locus_tag LOCUS_00430 4199 6172 CDS product exported alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550684.1 protein_id gnl|my_center|LOCUS_00430 7206 6244 gene locus_tag LOCUS_00440 gene gshB 7206 6244 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_00440 7842 7261 gene locus_tag LOCUS_00450 7842 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 8691 7969 gene locus_tag LOCUS_00460 gene pyrE 8691 7969 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_00460 9741 8728 gene locus_tag LOCUS_00470 9741 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 10659 9748 gene locus_tag LOCUS_00480 10659 9748 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 protein_id gnl|my_center|LOCUS_00480 <11501 10718 gene locus_tag LOCUS_00490 <11501 10718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P30819:nicotinate-nucleotide pyrophosphorylase [carboxylating] >Feature sequence006 <1 1700 gene locus_tag LOCUS_00500 <1 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256139.1:sodium-independent anion transporter 1776 2108 gene locus_tag LOCUS_00510 gene blh 1776 2108 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_00510 2127 2588 gene locus_tag LOCUS_00520 gene yaiI 2127 2588 CDS product UPF0178 protein YaiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83M67 protein_id gnl|my_center|LOCUS_00520 2595 3269 gene locus_tag LOCUS_00530 2595 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3762 3283 gene locus_tag LOCUS_00540 3762 3283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812126.1 protein_id gnl|my_center|LOCUS_00540 4758 3793 gene locus_tag LOCUS_00550 gene poxA 4758 3793 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_00550 5969 4866 gene locus_tag LOCUS_00560 gene pdxB 5969 4866 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA1 protein_id gnl|my_center|LOCUS_00560 9045 6088 gene locus_tag LOCUS_00570 9045 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 10141 9239 gene locus_tag LOCUS_00580 10141 9239 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889403.1 protein_id gnl|my_center|LOCUS_00580 <11225 10321 gene locus_tag LOCUS_00590 <11225 10321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705620.1:alkyl hydroperoxide reductase subunit F >Feature sequence007 2658 748 gene locus_tag LOCUS_00600 gene ftsH 2658 748 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV4 protein_id gnl|my_center|LOCUS_00600 3526 2894 gene locus_tag LOCUS_00610 gene rlmE 3526 2894 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_00610 3854 4171 gene locus_tag LOCUS_00620 3854 4171 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_00620 4179 4949 gene locus_tag LOCUS_00630 4179 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5731 5036 gene locus_tag LOCUS_00640 gene yebA 5731 5036 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121983.1 protein_id gnl|my_center|LOCUS_00640 5922 6410 gene locus_tag LOCUS_00650 5922 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 7623 6748 gene locus_tag LOCUS_00660 gene lpxC 7623 6748 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q2 protein_id gnl|my_center|LOCUS_00660 9042 7822 gene locus_tag LOCUS_00670 gene ftsZ 9042 7822 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC3 protein_id gnl|my_center|LOCUS_00670 10472 9192 gene locus_tag LOCUS_00680 gene ftsA 10472 9192 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC4 protein_id gnl|my_center|LOCUS_00680 <11096 10494 gene locus_tag LOCUS_00690 <11096 10494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHC5:cell division protein FtsQ >Feature sequence008 2078 105 gene locus_tag LOCUS_00700 gene yheS 2078 105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_00700 2188 2544 gene locus_tag LOCUS_00710 gene erpA 2188 2544 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI5 protein_id gnl|my_center|LOCUS_00710 2943 3299 gene locus_tag LOCUS_00720 2943 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 protein_id gnl|my_center|LOCUS_00720 3523 5088 gene locus_tag LOCUS_00730 gene gshA 3523 5088 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG2 protein_id gnl|my_center|LOCUS_00730 5209 5733 gene locus_tag LOCUS_00740 gene dsbB 5209 5733 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_00740 7401 5818 gene locus_tag LOCUS_00750 gene guaA 7401 5818 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJE6 protein_id gnl|my_center|LOCUS_00750 7891 9225 gene locus_tag LOCUS_00760 7891 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9914 9324 gene locus_tag LOCUS_00770 gene mntP2 9914 9324 CDS product putative manganese efflux pump MntP 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1C7 protein_id gnl|my_center|LOCUS_00770 10939 10010 gene locus_tag LOCUS_00780 10939 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence009 1652 2734 gene locus_tag LOCUS_00790 1652 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 protein_id gnl|my_center|LOCUS_00790 2762 3949 gene locus_tag LOCUS_00800 2762 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209072.1 protein_id gnl|my_center|LOCUS_00800 4053 4883 gene locus_tag LOCUS_00810 4053 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040056.1 protein_id gnl|my_center|LOCUS_00810 4886 6022 gene locus_tag LOCUS_00820 4886 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266642.1 protein_id gnl|my_center|LOCUS_00820 6100 7071 gene locus_tag LOCUS_00830 6100 7071 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797369.1 protein_id gnl|my_center|LOCUS_00830 7330 8406 gene locus_tag LOCUS_00840 7330 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 9231 8482 gene locus_tag LOCUS_00850 9231 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497656.1 protein_id gnl|my_center|LOCUS_00850 >Feature sequence010 <1 1092 gene locus_tag LOCUS_00860 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNE8:transcription termination factor Rho 2099 1215 gene locus_tag LOCUS_00870 2099 1215 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207472.1 protein_id gnl|my_center|LOCUS_00870 2688 3017 gene locus_tag LOCUS_00880 2688 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 3722 3237 gene locus_tag LOCUS_00890 gene ccmE 3722 3237 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_00890 4016 3807 gene locus_tag LOCUS_00900 4016 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 4924 4133 gene locus_tag LOCUS_00910 gene ccmC 4924 4133 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_00910 5709 5041 gene locus_tag LOCUS_00920 5709 5041 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FLA8 protein_id gnl|my_center|LOCUS_00920 6359 5721 gene locus_tag LOCUS_00930 gene ccmA 6359 5721 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE3 protein_id gnl|my_center|LOCUS_00930 6668 7450 gene locus_tag LOCUS_00940 6668 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9624 7519 gene locus_tag LOCUS_00950 gene fadH 9624 7519 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence011 19 792 gene locus_tag LOCUS_00960 gene ompR 19 792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_00960 895 1935 gene locus_tag LOCUS_00970 gene cobW 895 1935 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 protein_id gnl|my_center|LOCUS_00970 2816 2004 gene locus_tag LOCUS_00980 2816 2004 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 protein_id gnl|my_center|LOCUS_00980 3002 3736 gene locus_tag LOCUS_00990 3002 3736 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261993.1 protein_id gnl|my_center|LOCUS_00990 4610 3789 gene locus_tag LOCUS_01000 gene phaB 4610 3789 CDS product putative enoyl CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269778.1 protein_id gnl|my_center|LOCUS_01000 4849 5367 gene locus_tag LOCUS_01010 4849 5367 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_01010 5380 5619 gene locus_tag LOCUS_01020 5380 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5668 6615 gene locus_tag LOCUS_01030 5668 6615 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474264.1 protein_id gnl|my_center|LOCUS_01030 6634 7038 gene locus_tag LOCUS_01040 6634 7038 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_01040 7529 7849 gene locus_tag LOCUS_01050 7529 7849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209030.1 protein_id gnl|my_center|LOCUS_01050 7950 9689 gene locus_tag LOCUS_01060 gene actP 7950 9689 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402531.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence012 406 1992 gene locus_tag LOCUS_01070 gene mviN 406 1992 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ1 protein_id gnl|my_center|LOCUS_01070 2569 2132 gene locus_tag LOCUS_01080 gene fur 2569 2132 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_01080 2892 3275 gene locus_tag LOCUS_01090 gene bamE 2892 3275 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_01090 3636 3361 gene locus_tag LOCUS_01100 3636 3361 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C31 protein_id gnl|my_center|LOCUS_01100 4724 3633 gene locus_tag LOCUS_01110 4724 3633 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205981.1 protein_id gnl|my_center|LOCUS_01110 5628 5014 gene locus_tag LOCUS_01120 5628 5014 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388648.1 protein_id gnl|my_center|LOCUS_01120 6460 5708 gene locus_tag LOCUS_01130 6460 5708 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230282.1 protein_id gnl|my_center|LOCUS_01130 7194 6619 gene locus_tag LOCUS_01140 7194 6619 CDS product tellurium resistance protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888851.1 protein_id gnl|my_center|LOCUS_01140 8632 7559 gene locus_tag LOCUS_01150 8632 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence013 <1 986 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcaccgccacacaggcggcttagaaa 1314 1238 gene locus_tag LOCUS_t00010 1314 1238 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1538 1813 gene locus_tag LOCUS_01160 1538 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767847.1 protein_id gnl|my_center|LOCUS_01160 1926 2465 gene locus_tag LOCUS_01170 1926 2465 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704514.1 protein_id gnl|my_center|LOCUS_01170 2509 3186 gene locus_tag LOCUS_01180 2509 3186 CDS product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 protein_id gnl|my_center|LOCUS_01180 3221 4663 gene locus_tag LOCUS_01190 gene qseC 3221 4663 CDS product sensor protein QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45336 protein_id gnl|my_center|LOCUS_01190 5768 4755 gene locus_tag LOCUS_01200 5768 4755 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524222.1 protein_id gnl|my_center|LOCUS_01200 6037 8709 gene locus_tag LOCUS_01210 6037 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968588.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence014 137 1120 gene locus_tag LOCUS_01220 137 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_01220 1156 4530 gene locus_tag LOCUS_01230 1156 4530 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_01230 4720 6099 gene locus_tag LOCUS_01240 4720 6099 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_01240 6096 7052 gene locus_tag LOCUS_01250 6096 7052 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_01250 7065 8084 gene locus_tag LOCUS_01260 7065 8084 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_01260 8088 8690 gene locus_tag LOCUS_01270 8088 8690 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769530.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence015 597 1475 gene locus_tag LOCUS_01280 gene tsf 597 1475 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ75 protein_id gnl|my_center|LOCUS_01280 1601 2395 gene locus_tag LOCUS_01290 1601 2395 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_01290 2923 2573 gene locus_tag LOCUS_01300 2923 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01300 4278 2992 gene locus_tag LOCUS_01310 gene metY 4278 2992 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_01310 5877 4510 gene locus_tag LOCUS_01320 5877 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 8384 6282 gene locus_tag LOCUS_01330 gene glyS 8384 6282 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD5 protein_id gnl|my_center|LOCUS_01330 >Feature sequence016 1559 267 gene locus_tag LOCUS_01340 1559 267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_01340 1681 1971 gene locus_tag LOCUS_01350 1681 1971 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268096.1 protein_id gnl|my_center|LOCUS_01350 2404 2024 gene locus_tag LOCUS_01360 2404 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2751 4271 gene locus_tag LOCUS_01370 2751 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5749 4604 gene locus_tag LOCUS_01380 5749 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 6519 7445 gene locus_tag LOCUS_01390 6519 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 7495 7875 gene locus_tag LOCUS_01400 7495 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7908 8408 gene locus_tag LOCUS_01410 7908 8408 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141610.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence017 1520 1089 gene locus_tag LOCUS_01420 gene ptp 1520 1089 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 protein_id gnl|my_center|LOCUS_01420 2652 1537 gene locus_tag LOCUS_01430 gene wza 2652 1537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 protein_id gnl|my_center|LOCUS_01430 3057 2971 gene locus_tag LOCUS_t00020 3057 2971 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3314 3081 gene locus_tag LOCUS_01440 3314 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3339 4241 gene locus_tag LOCUS_01450 3339 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 4701 4282 gene locus_tag LOCUS_01460 4701 4282 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_01460 6105 4759 gene locus_tag LOCUS_01470 gene lipL 6105 4759 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 protein_id gnl|my_center|LOCUS_01470 7099 6203 gene locus_tag LOCUS_01480 7099 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_01480 <8370 7357 gene locus_tag LOCUS_01490 <8370 7357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207046.1:3-oxoacyl-ACP reductase >Feature sequence018 <1 591 gene locus_tag LOCUS_01500 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPH0:membrane protein insertase YidC 752 2143 gene locus_tag LOCUS_01510 gene mnmE 752 2143 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPG9 protein_id gnl|my_center|LOCUS_01510 2176 2700 gene locus_tag LOCUS_01520 gene nrdR 2176 2700 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK33 protein_id gnl|my_center|LOCUS_01520 2709 3788 gene locus_tag LOCUS_01530 gene ribD 2709 3788 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK34 protein_id gnl|my_center|LOCUS_01530 4253 4921 gene locus_tag LOCUS_01540 gene ribC 4253 4921 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_01540 5263 6390 gene locus_tag LOCUS_01550 5263 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 <8332 6447 gene locus_tag LOCUS_01560 <8332 6447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477868.1:two-component system sensor histidine kinase/response regulator >Feature sequence019 2984 2055 gene locus_tag LOCUS_01570 gene fhuD 2984 2055 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263057.1 protein_id gnl|my_center|LOCUS_01570 3772 2999 gene locus_tag LOCUS_01580 gene fhuC 3772 2999 CDS product iron-hydroxamate transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167185.1 protein_id gnl|my_center|LOCUS_01580 3944 5059 gene locus_tag LOCUS_01590 3944 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 5845 5210 gene locus_tag LOCUS_01600 5845 5210 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_01600 6499 6050 gene locus_tag LOCUS_01610 gene osmC 6499 6050 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 protein_id gnl|my_center|LOCUS_01610 7210 6746 gene locus_tag LOCUS_01620 7210 6746 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 protein_id gnl|my_center|LOCUS_01620 7434 7892 gene locus_tag LOCUS_01630 7434 7892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence020 1013 1282 gene locus_tag LOCUS_01640 1013 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 1293 1559 gene locus_tag LOCUS_01650 1293 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 1556 1885 gene locus_tag LOCUS_01660 1556 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2417 2794 gene locus_tag LOCUS_01670 2417 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 2787 3173 gene locus_tag LOCUS_01680 2787 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3323 3709 gene locus_tag LOCUS_01690 3323 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3836 5917 gene locus_tag LOCUS_01700 3836 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6189 6455 gene locus_tag LOCUS_01710 6189 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence021 306 1067 gene locus_tag LOCUS_01720 306 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 1118 3208 gene locus_tag LOCUS_01730 gene accC2 1118 3208 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206448.1 protein_id gnl|my_center|LOCUS_01730 3210 3899 gene locus_tag LOCUS_01740 3210 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3916 4836 gene locus_tag LOCUS_01750 gene hmgcL 3916 4836 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_01750 4850 5485 gene locus_tag LOCUS_01760 4850 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5525 6700 gene locus_tag LOCUS_01770 gene ivd 5525 6700 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_01770 7810 6797 gene locus_tag LOCUS_01780 7810 6797 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence022 4305 2632 gene locus_tag LOCUS_01790 4305 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_01790 6259 4343 gene locus_tag LOCUS_01800 gene ilvD-2 6259 4343 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_274214.1 protein_id gnl|my_center|LOCUS_01800 6463 7050 gene locus_tag LOCUS_01810 6463 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence023 1272 268 gene locus_tag LOCUS_01820 gene moaA 1272 268 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 protein_id gnl|my_center|LOCUS_01820 2564 1275 gene locus_tag LOCUS_01830 gene moeA 2564 1275 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45210 protein_id gnl|my_center|LOCUS_01830 3258 2569 gene locus_tag LOCUS_01840 3258 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4336 3242 gene locus_tag LOCUS_01850 gene pucA 4336 3242 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_01850 6781 4358 gene locus_tag LOCUS_01860 6781 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 <7678 6778 gene locus_tag LOCUS_01870 <7678 6778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037858.1:oxidoreductase >Feature sequence024 655 236 gene locus_tag LOCUS_01880 655 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 647 820 gene locus_tag LOCUS_01890 647 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 1270 962 gene locus_tag LOCUS_01900 1270 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 2181 2429 gene locus_tag LOCUS_01910 2181 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2827 2751 gene locus_tag LOCUS_t00030 2827 2751 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2939 2864 gene locus_tag LOCUS_t00040 2939 2864 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3694 3203 gene locus_tag LOCUS_01920 gene gpo 3694 3203 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFV1 protein_id gnl|my_center|LOCUS_01920 3868 5541 gene locus_tag LOCUS_01930 3868 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6969 5632 gene locus_tag LOCUS_01940 6969 5632 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP0 protein_id gnl|my_center|LOCUS_01940 >Feature sequence025 749 81 gene locus_tag LOCUS_01950 749 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 894 2102 gene locus_tag LOCUS_01960 gene y1062 894 2102 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 protein_id gnl|my_center|LOCUS_01960 2362 2099 gene locus_tag LOCUS_01970 2362 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2719 2372 gene locus_tag LOCUS_01980 2719 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3772 2720 gene locus_tag LOCUS_01990 3772 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3966 4283 gene locus_tag LOCUS_02000 3966 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4324 6216 gene locus_tag LOCUS_02010 4324 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 6690 6911 gene locus_tag LOCUS_02020 6690 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence026 <1 822 gene locus_tag LOCUS_02030 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005071966.1:chromosome partitioning protein ParA 1082 1339 gene locus_tag LOCUS_02040 1082 1339 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811953.1 protein_id gnl|my_center|LOCUS_02040 1619 2365 gene locus_tag LOCUS_02050 1619 2365 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090678.1 protein_id gnl|my_center|LOCUS_02050 3876 2461 gene locus_tag LOCUS_02060 gene thrC 3876 2461 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 protein_id gnl|my_center|LOCUS_02060 5297 3945 gene locus_tag LOCUS_02070 gene sun 5297 3945 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL5 protein_id gnl|my_center|LOCUS_02070 6329 5313 gene locus_tag LOCUS_02080 gene fmt 6329 5313 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL4 protein_id gnl|my_center|LOCUS_02080 >Feature sequence027 1353 1153 gene locus_tag LOCUS_02090 1353 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 1974 1369 gene locus_tag LOCUS_02100 1974 1369 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ2 protein_id gnl|my_center|LOCUS_02100 2474 3457 gene locus_tag LOCUS_02110 gene araC 2474 3457 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_02110 3676 4572 gene locus_tag LOCUS_02120 3676 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4600 5805 gene locus_tag LOCUS_02130 gene xcpS 4600 5805 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_02130 5945 6394 gene locus_tag LOCUS_02140 5945 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence028 1013 1717 gene locus_tag LOCUS_02150 1013 1717 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA6 protein_id gnl|my_center|LOCUS_02150 1770 2477 gene locus_tag LOCUS_02160 1770 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_02160 2644 3144 gene locus_tag LOCUS_02170 2644 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 protein_id gnl|my_center|LOCUS_02170 3930 3280 gene locus_tag LOCUS_02180 3930 3280 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017026.1 protein_id gnl|my_center|LOCUS_02180 4485 5453 gene locus_tag LOCUS_02190 gene yihG 4485 5453 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_02190 5602 6663 gene locus_tag LOCUS_02200 5602 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence029 <1 2182 gene locus_tag LOCUS_02210 <1 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205570.1:nitrite reductase large subunit 2251 2571 gene locus_tag LOCUS_02220 gene nirD 2251 2571 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 protein_id gnl|my_center|LOCUS_02220 3678 2818 gene locus_tag LOCUS_02230 3678 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4436 3825 gene locus_tag LOCUS_02240 4436 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4959 4426 gene locus_tag LOCUS_02250 4959 4426 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT80 protein_id gnl|my_center|LOCUS_02250 6791 5163 gene locus_tag LOCUS_02260 6791 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence030 109 1176 gene locus_tag LOCUS_02270 109 1176 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_02270 1185 1949 gene locus_tag LOCUS_02280 1185 1949 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762577.1 protein_id gnl|my_center|LOCUS_02280 2008 2853 gene locus_tag LOCUS_02290 2008 2853 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_02290 3154 4113 gene locus_tag LOCUS_02300 3154 4113 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_02300 6054 4243 gene locus_tag LOCUS_02310 6054 4243 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951394.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence031 1187 15 gene locus_tag LOCUS_02320 gene recF 1187 15 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH6 protein_id gnl|my_center|LOCUS_02320 2415 1240 gene locus_tag LOCUS_02330 gene dnaN 2415 1240 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVX5 protein_id gnl|my_center|LOCUS_02330 3860 2520 gene locus_tag LOCUS_02340 gene dnaA 3860 2520 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH3 protein_id gnl|my_center|LOCUS_02340 4757 5194 gene locus_tag LOCUS_02350 4757 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence032 199 840 gene locus_tag LOCUS_02360 gene tmk 199 840 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL25 protein_id gnl|my_center|LOCUS_02360 2634 937 gene locus_tag LOCUS_02370 gene nadB 2634 937 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL23 protein_id gnl|my_center|LOCUS_02370 3101 4279 gene locus_tag LOCUS_02380 3101 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 4505 5398 gene locus_tag LOCUS_02390 gene dapA 4505 5398 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_02390 5395 5694 gene locus_tag LOCUS_02400 5395 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5836 6564 gene locus_tag LOCUS_02410 gene purC 5836 6564 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_02410 >Feature sequence033 1031 378 gene locus_tag LOCUS_02420 1031 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1710 1006 gene locus_tag LOCUS_02430 1710 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2403 1759 gene locus_tag LOCUS_02440 2403 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3887 2643 gene locus_tag LOCUS_02450 3887 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4797 3940 gene locus_tag LOCUS_02460 4797 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5632 4790 gene locus_tag LOCUS_02470 5632 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence034 742 1617 gene locus_tag LOCUS_02480 742 1617 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44579 protein_id gnl|my_center|LOCUS_02480 1718 2296 gene locus_tag LOCUS_02490 1718 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 2921 2355 gene locus_tag LOCUS_02500 2921 2355 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438953.1 protein_id gnl|my_center|LOCUS_02500 4381 3035 gene locus_tag LOCUS_02510 4381 3035 CDS product putative metabolite transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44610 protein_id gnl|my_center|LOCUS_02510 4593 4907 gene locus_tag LOCUS_02520 gene glpE 4593 4907 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 protein_id gnl|my_center|LOCUS_02520 4904 6181 gene locus_tag LOCUS_02530 4904 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence035 704 282 gene locus_tag LOCUS_02540 704 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1292 720 gene locus_tag LOCUS_02550 1292 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2230 1289 gene locus_tag LOCUS_02560 gene gpJ 2230 1289 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 protein_id gnl|my_center|LOCUS_02560 2610 2227 gene locus_tag LOCUS_02570 2610 2227 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177408.1 protein_id gnl|my_center|LOCUS_02570 3155 2607 gene locus_tag LOCUS_02580 gene gpV 3155 2607 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816098.1 protein_id gnl|my_center|LOCUS_02580 3518 3261 gene locus_tag LOCUS_02590 3518 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4504 3665 gene locus_tag LOCUS_02600 4504 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44243 protein_id gnl|my_center|LOCUS_02600 5137 4685 gene locus_tag LOCUS_02610 5137 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5529 5134 gene locus_tag LOCUS_02620 5529 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 6131 5526 gene locus_tag LOCUS_02630 6131 5526 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203507.1 protein_id gnl|my_center|LOCUS_02630 6457 6128 gene locus_tag LOCUS_02640 6457 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence036 2177 4291 gene locus_tag LOCUS_02650 2177 4291 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence037 432 1238 gene locus_tag LOCUS_02660 432 1238 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_02660 1315 2121 gene locus_tag LOCUS_02670 1315 2121 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_02670 2213 3133 gene locus_tag LOCUS_02680 2213 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3364 4083 gene locus_tag LOCUS_02690 3364 4083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105543.1 protein_id gnl|my_center|LOCUS_02690 4095 4820 gene locus_tag LOCUS_02700 4095 4820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 protein_id gnl|my_center|LOCUS_02700 4878 5450 gene locus_tag LOCUS_02710 4878 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence038 2508 616 gene locus_tag LOCUS_02720 2508 616 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 protein_id gnl|my_center|LOCUS_02720 2664 2882 gene locus_tag LOCUS_02730 2664 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3151 4602 gene locus_tag LOCUS_02740 3151 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4634 5854 gene locus_tag LOCUS_02750 4634 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence039 1453 524 gene locus_tag LOCUS_02760 1453 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1563 2375 gene locus_tag LOCUS_02770 1563 2375 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_02770 3058 2417 gene locus_tag LOCUS_02780 gene ribA 3058 2417 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC2 protein_id gnl|my_center|LOCUS_02780 3535 5706 gene locus_tag LOCUS_02790 gene dxs 3535 5706 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67036 protein_id gnl|my_center|LOCUS_02790 >Feature sequence040 <1 1533 gene locus_tag LOCUS_02800 <1 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MB15:nuclease SbcCD subunit C 1767 2681 gene locus_tag LOCUS_02810 1767 2681 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809454.1 protein_id gnl|my_center|LOCUS_02810 2722 3951 gene locus_tag LOCUS_02820 2722 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4263 4853 gene locus_tag LOCUS_02830 4263 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence041 <1 1731 gene locus_tag LOCUS_02840 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMI4:valine--tRNA ligase 1798 2535 gene locus_tag LOCUS_02850 1798 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2668 3195 gene locus_tag LOCUS_02860 2668 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3225 3479 gene locus_tag LOCUS_02870 3225 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3634 4455 gene locus_tag LOCUS_02880 gene pheC 3634 4455 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525749.1 protein_id gnl|my_center|LOCUS_02880 <6383 4516 gene locus_tag LOCUS_02890 <6383 4516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208411.1:DNA polymerase I >Feature sequence042 508 185 gene locus_tag LOCUS_02900 gene nuoK 508 185 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET3 protein_id gnl|my_center|LOCUS_02900 1152 508 gene locus_tag LOCUS_02910 gene nuoJ 1152 508 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205902.1 protein_id gnl|my_center|LOCUS_02910 1700 1149 gene locus_tag LOCUS_02920 gene nuoI 1700 1149 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0J4 protein_id gnl|my_center|LOCUS_02920 2771 1716 gene locus_tag LOCUS_02930 gene nuoH 2771 1716 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET0 protein_id gnl|my_center|LOCUS_02930 5767 2771 gene locus_tag LOCUS_02940 gene nuoG 5767 2771 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES9 protein_id gnl|my_center|LOCUS_02940 <6319 5777 gene locus_tag LOCUS_02950 <6319 5777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002120030.1:NADH-quinone oxidoreductase subunit F >Feature sequence043 389 1411 gene locus_tag LOCUS_02960 gene yejE 389 1411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_02960 1823 1413 gene locus_tag LOCUS_02970 gene vapC 1823 1413 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D058 protein_id gnl|my_center|LOCUS_02970 2023 1820 gene locus_tag LOCUS_02980 2023 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2165 3817 gene locus_tag LOCUS_02990 gene yejF 2165 3817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_02990 4018 5487 gene locus_tag LOCUS_03000 4018 5487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244170.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence044 1555 539 gene locus_tag LOCUS_03010 1555 539 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_03010 2313 1888 gene locus_tag LOCUS_03020 2313 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2389 2601 gene locus_tag LOCUS_03030 2389 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3305 2640 gene locus_tag LOCUS_03040 3305 2640 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705819.1 protein_id gnl|my_center|LOCUS_03040 3425 4342 gene locus_tag LOCUS_03050 3425 4342 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057776.1 protein_id gnl|my_center|LOCUS_03050 5435 5734 gene locus_tag LOCUS_03060 5435 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence045 1499 555 gene locus_tag LOCUS_03070 gene xerD 1499 555 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK52 protein_id gnl|my_center|LOCUS_03070 1807 1535 gene locus_tag LOCUS_03080 gene sirA 1807 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053527.1 protein_id gnl|my_center|LOCUS_03080 2252 1800 gene locus_tag LOCUS_03090 2252 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 2734 2249 gene locus_tag LOCUS_03100 2734 2249 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT8 protein_id gnl|my_center|LOCUS_03100 3293 2727 gene locus_tag LOCUS_03110 3293 2727 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT9 protein_id gnl|my_center|LOCUS_03110 5083 3377 gene locus_tag LOCUS_03120 gene recN 5083 3377 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU0 protein_id gnl|my_center|LOCUS_03120 5662 6000 gene locus_tag LOCUS_03130 5662 6000 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_03130 >Feature sequence046 821 99 gene locus_tag LOCUS_03140 821 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 1328 1008 gene locus_tag LOCUS_03150 1328 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 1754 1446 gene locus_tag LOCUS_03160 1754 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2548 1790 gene locus_tag LOCUS_03170 gene rpe 2548 1790 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_03170 4171 3059 gene locus_tag LOCUS_03180 4171 3059 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_03180 4489 5631 gene locus_tag LOCUS_03190 gene asd 4489 5631 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM13 protein_id gnl|my_center|LOCUS_03190 >Feature sequence047 427 3561 gene locus_tag LOCUS_03200 427 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 4097 5785 gene locus_tag LOCUS_03210 4097 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence048 626 1276 gene locus_tag LOCUS_03220 626 1276 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK12 protein_id gnl|my_center|LOCUS_03220 2806 1379 gene locus_tag LOCUS_03230 2806 1379 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_03230 3008 4240 gene locus_tag LOCUS_03240 gene serA 3008 4240 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 protein_id gnl|my_center|LOCUS_03240 <5924 4521 gene locus_tag LOCUS_03250 <5924 4521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207852.1:energy-dependent translational throttle protein EttA >Feature sequence049 1857 853 gene locus_tag LOCUS_03260 gene pstS 1857 853 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ63 protein_id gnl|my_center|LOCUS_03260 2204 2974 gene locus_tag LOCUS_03270 gene phoU 2204 2974 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM7 protein_id gnl|my_center|LOCUS_03270 3116 3850 gene locus_tag LOCUS_03280 gene gph 3116 3850 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44755 protein_id gnl|my_center|LOCUS_03280 3837 4397 gene locus_tag LOCUS_03290 3837 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 protein_id gnl|my_center|LOCUS_03290 <5920 4437 gene locus_tag LOCUS_03300 <5920 4437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208165.1:ATP-dependent protease >Feature sequence050 >Feature sequence051 1272 691 gene locus_tag LOCUS_03310 gene grpE 1272 691 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE5 protein_id gnl|my_center|LOCUS_03310 2090 1485 gene locus_tag LOCUS_03320 gene yrdC 2090 1485 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_03320 3053 2139 gene locus_tag LOCUS_03330 3053 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 3372 2971 gene locus_tag LOCUS_03340 3372 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4642 3539 gene locus_tag LOCUS_03350 4642 3539 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_03350 4804 4667 gene locus_tag LOCUS_03360 4804 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5015 5545 gene locus_tag LOCUS_03370 gene def 5015 5545 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY9 protein_id gnl|my_center|LOCUS_03370 >Feature sequence052 <1 969 gene locus_tag LOCUS_03380 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMS6:putative ribosome biogenesis GTPase RsgA 1089 1529 gene locus_tag LOCUS_03390 gene yibN 1089 1529 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_03390 1664 1924 gene locus_tag LOCUS_03400 gene grx 1664 1924 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_03400 2083 2514 gene locus_tag LOCUS_03410 gene secB 2083 2514 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_03410 3552 2605 gene locus_tag LOCUS_03420 3552 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3663 4463 gene locus_tag LOCUS_03430 3663 4463 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_03430 <5825 4558 gene locus_tag LOCUS_03440 <5825 4558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005068179.1:2-alkenal reductase >Feature sequence053 862 3249 gene locus_tag LOCUS_03450 862 3249 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_03450 3316 4092 gene locus_tag LOCUS_03460 3316 4092 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ93 protein_id gnl|my_center|LOCUS_03460 4236 4054 gene locus_tag LOCUS_03470 4236 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence054 <1 544 gene locus_tag LOCUS_03480 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121158.1:D-alanyl-D-alanine endopeptidase 981 655 gene locus_tag LOCUS_03490 981 655 CDS product dimethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707324.1 protein_id gnl|my_center|LOCUS_03490 1270 2460 gene locus_tag LOCUS_03500 gene pgk 1270 2460 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA8 protein_id gnl|my_center|LOCUS_03500 2636 3040 gene locus_tag LOCUS_03510 2636 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3263 4300 gene locus_tag LOCUS_03520 gene fba 3263 4300 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_03520 4425 5045 gene locus_tag LOCUS_03530 gene ruvA 4425 5045 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL49 protein_id gnl|my_center|LOCUS_03530 <5730 5098 gene locus_tag LOCUS_03540 <5730 5098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115704.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence055 680 934 gene locus_tag LOCUS_03550 680 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 1254 961 gene locus_tag LOCUS_03560 1254 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1722 1318 gene locus_tag LOCUS_03570 1722 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1959 2699 gene locus_tag LOCUS_03580 1959 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_03580 2778 3971 gene locus_tag LOCUS_03590 2778 3971 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML86 protein_id gnl|my_center|LOCUS_03590 3989 5338 gene locus_tag LOCUS_03600 gene pepP 3989 5338 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence056 1475 555 gene locus_tag LOCUS_03610 1475 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1632 3449 gene locus_tag LOCUS_03620 1632 3449 CDS product terminase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458709.1 protein_id gnl|my_center|LOCUS_03620 3458 4453 gene locus_tag LOCUS_03630 3458 4453 CDS product capsid portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458710.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence057 2553 598 gene locus_tag LOCUS_03640 2553 598 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_03640 4158 2686 gene locus_tag LOCUS_03650 4158 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence058 1905 1222 gene locus_tag LOCUS_03660 1905 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020083.1 protein_id gnl|my_center|LOCUS_03660 3001 1907 gene locus_tag LOCUS_03670 gene prfA 3001 1907 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT1 protein_id gnl|my_center|LOCUS_03670 4301 3144 gene locus_tag LOCUS_03680 gene fabH 4301 3144 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 protein_id gnl|my_center|LOCUS_03680 5382 4570 gene locus_tag LOCUS_03690 5382 4570 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence059 4660 326 gene locus_tag LOCUS_03700 4660 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence060 357 1922 gene locus_tag LOCUS_03710 gene algC 357 1922 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 protein_id gnl|my_center|LOCUS_03710 2070 2879 gene locus_tag LOCUS_03720 gene argB 2070 2879 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_03720 3147 3653 gene locus_tag LOCUS_03730 3147 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3728 4345 gene locus_tag LOCUS_03740 3728 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5219 4806 gene locus_tag LOCUS_03750 5219 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_03750 5549 5286 gene locus_tag LOCUS_03760 5549 5286 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence061 1820 2002 gene locus_tag LOCUS_03770 1820 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1984 2304 gene locus_tag LOCUS_03780 1984 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2312 3208 gene locus_tag LOCUS_03790 gene ylbK 2312 3208 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_03790 3854 3321 gene locus_tag LOCUS_03800 3854 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence062 114 773 gene locus_tag LOCUS_03810 114 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1474 770 gene locus_tag LOCUS_03820 1474 770 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM54 protein_id gnl|my_center|LOCUS_03820 1524 2120 gene locus_tag LOCUS_03830 1524 2120 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 protein_id gnl|my_center|LOCUS_03830 2282 3265 gene locus_tag LOCUS_03840 2282 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224842.1 protein_id gnl|my_center|LOCUS_03840 4691 3357 gene locus_tag LOCUS_03850 gene gdhA 4691 3357 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY7 protein_id gnl|my_center|LOCUS_03850 >Feature sequence063 2505 838 gene locus_tag LOCUS_03860 2505 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3345 2551 gene locus_tag LOCUS_03870 3345 2551 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_03870 4274 3360 gene locus_tag LOCUS_03880 4274 3360 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_03880 5115 4276 gene locus_tag LOCUS_03890 5115 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5348 5175 gene locus_tag LOCUS_03900 5348 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence064 2901 553 gene locus_tag LOCUS_03910 2901 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3452 2919 gene locus_tag LOCUS_03920 gene pilP 3452 2919 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_03920 4200 3439 gene locus_tag LOCUS_03930 gene pilO 4200 3439 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_03930 4874 4203 gene locus_tag LOCUS_03940 gene pilN 4874 4203 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_03940 <5512 4874 gene locus_tag LOCUS_03950 <5512 4874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804529.1:pilus assembly protein PilM >Feature sequence065 <1 1101 gene locus_tag LOCUS_03960 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103359.1:tellurium resistance protein 1569 2147 gene locus_tag LOCUS_03970 1569 2147 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266647.1 protein_id gnl|my_center|LOCUS_03970 2215 2409 gene locus_tag LOCUS_03980 2215 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2754 2939 gene locus_tag LOCUS_03990 2754 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4424 3123 gene locus_tag LOCUS_04000 4424 3123 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_04000 4795 5094 gene locus_tag LOCUS_04010 4795 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence066 1125 1802 gene locus_tag LOCUS_04020 1125 1802 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_04020 2368 1799 gene locus_tag LOCUS_04030 2368 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_04030 3174 2422 gene locus_tag LOCUS_04040 3174 2422 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46490 protein_id gnl|my_center|LOCUS_04040 3623 3264 gene locus_tag LOCUS_04050 gene rplQ 3623 3264 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ06 protein_id gnl|my_center|LOCUS_04050 4651 3644 gene locus_tag LOCUS_04060 gene rpoA 4651 3644 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ07 protein_id gnl|my_center|LOCUS_04060 <5261 4681 gene locus_tag LOCUS_04070 <5261 4681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KQ08:30S ribosomal protein S4 >Feature sequence067 913 590 gene locus_tag LOCUS_04080 gene trxA 913 590 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBF6 protein_id gnl|my_center|LOCUS_04080 1379 2914 gene locus_tag LOCUS_04090 gene ppx 1379 2914 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_04090 3021 3830 gene locus_tag LOCUS_04100 gene accA 3021 3830 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence068 1301 2320 gene locus_tag LOCUS_04110 gene hemH 1301 2320 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_04110 2741 2487 gene locus_tag LOCUS_04120 2741 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2915 3538 gene locus_tag LOCUS_04130 gene yvbH 2915 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32245 protein_id gnl|my_center|LOCUS_04130 3551 4279 gene locus_tag LOCUS_04140 3551 4279 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_04140 4763 4344 gene locus_tag LOCUS_04150 4763 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence069 1667 288 gene locus_tag LOCUS_04160 gene soxA 1667 288 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206537.1 protein_id gnl|my_center|LOCUS_04160 2905 1667 gene locus_tag LOCUS_04170 gene soxC 2905 1667 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206538.1 protein_id gnl|my_center|LOCUS_04170 4140 2923 gene locus_tag LOCUS_04180 gene soxC 4140 2923 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206539.1 protein_id gnl|my_center|LOCUS_04180 <5182 4591 gene locus_tag LOCUS_04190 <5182 4591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462139.1:membrane protein >Feature sequence070 1240 1701 gene locus_tag LOCUS_04200 1240 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 protein_id gnl|my_center|LOCUS_04200 1795 2778 gene locus_tag LOCUS_04210 gene ruvB 1795 2778 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL50 protein_id gnl|my_center|LOCUS_04210 5162 2850 gene locus_tag LOCUS_04220 5162 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence071 1769 255 gene locus_tag LOCUS_04230 gene pepA 1769 255 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK40 protein_id gnl|my_center|LOCUS_04230 2138 3244 gene locus_tag LOCUS_04240 2138 3244 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_04240 3241 4314 gene locus_tag LOCUS_04250 3241 4314 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_04250 4316 4981 gene locus_tag LOCUS_04260 4316 4981 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence072 397 131 gene locus_tag LOCUS_04270 gene rpsO 397 131 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_04270 794 609 gene locus_tag LOCUS_04280 794 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1360 836 gene locus_tag LOCUS_04290 1360 836 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372548.1 protein_id gnl|my_center|LOCUS_04290 2714 1764 gene locus_tag LOCUS_04300 gene truB 2714 1764 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX7 protein_id gnl|my_center|LOCUS_04300 3751 2735 gene locus_tag LOCUS_04310 3751 2735 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_04310 4209 3820 gene locus_tag LOCUS_04320 gene rbfA 4209 3820 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB5 protein_id gnl|my_center|LOCUS_04320 <5131 4315 gene locus_tag LOCUS_04330 <5131 4315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLB4:translation initiation factor IF-2 >Feature sequence073 2149 446 gene locus_tag LOCUS_04340 gene dld 2149 446 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIT0 protein_id gnl|my_center|LOCUS_04340 2514 2200 gene locus_tag LOCUS_04350 2514 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3819 2647 gene locus_tag LOCUS_04360 gene dhaT 3819 2647 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence074 3 707 gene locus_tag LOCUS_04370 3 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1049 2263 gene locus_tag LOCUS_04380 gene ytfL 1049 2263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 protein_id gnl|my_center|LOCUS_04380 2401 3318 gene locus_tag LOCUS_04390 gene metR 2401 3318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 protein_id gnl|my_center|LOCUS_04390 3968 3405 gene locus_tag LOCUS_04400 3968 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4962 4129 gene locus_tag LOCUS_04410 4962 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUR8 protein_id gnl|my_center|LOCUS_04410 >Feature sequence075 <1 541 gene locus_tag LOCUS_04420 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFL1:putative septum site-determining protein MinC 797 1609 gene locus_tag LOCUS_04430 gene minD 797 1609 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL0 protein_id gnl|my_center|LOCUS_04430 1613 1888 gene locus_tag LOCUS_04440 gene minE 1613 1888 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK9 protein_id gnl|my_center|LOCUS_04440 2550 1993 gene locus_tag LOCUS_04450 2550 1993 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_04450 3218 2655 gene locus_tag LOCUS_04460 3218 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 4232 3279 gene locus_tag LOCUS_04470 gene chpB 4232 3279 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_04470 <5019 4261 gene locus_tag LOCUS_04480 <5019 4261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotactic signal transduction system protein >Feature sequence076 90 4775 gene locus_tag LOCUS_04490 90 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence077 <1 984 gene locus_tag LOCUS_04500 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WGB9:aldehyde dehydrogenase 2318 1074 gene locus_tag LOCUS_04510 2318 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2673 4325 gene locus_tag LOCUS_04520 gene emrB 2673 4325 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence078 499 1257 gene locus_tag LOCUS_04530 499 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1402 1803 gene locus_tag LOCUS_04540 gene rsfS 1402 1803 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB4 protein_id gnl|my_center|LOCUS_04540 3742 1946 gene locus_tag LOCUS_04550 3742 1946 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252107.1 protein_id gnl|my_center|LOCUS_04550 <4979 3807 gene locus_tag LOCUS_04560 <4979 3807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836940.1:peroxidase >Feature sequence079 616 1500 gene locus_tag LOCUS_04570 616 1500 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257914.1 protein_id gnl|my_center|LOCUS_04570 1502 2119 gene locus_tag LOCUS_04580 1502 2119 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_04580 2897 2148 gene locus_tag LOCUS_04590 gene hisA 2897 2148 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_04590 3044 4507 gene locus_tag LOCUS_04600 3044 4507 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence080 2186 1338 gene locus_tag LOCUS_04610 2186 1338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221945.1 protein_id gnl|my_center|LOCUS_04610 2406 2771 gene locus_tag LOCUS_04620 2406 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311710.1 protein_id gnl|my_center|LOCUS_04620 2841 3647 gene locus_tag LOCUS_04630 2841 3647 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766795.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence081 1406 2062 gene locus_tag LOCUS_04640 gene adk 1406 2062 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_04640 2485 2216 gene locus_tag LOCUS_04650 gene rpsT 2485 2216 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX2 protein_id gnl|my_center|LOCUS_04650 2837 3550 gene locus_tag LOCUS_04660 2837 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3586 4110 gene locus_tag LOCUS_04670 gene menG 3586 4110 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_04670 >Feature sequence082 <1 2069 gene locus_tag LOCUS_04680 <1 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFH2:DNA primase 3395 2082 gene locus_tag LOCUS_04690 3395 2082 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_04690 4203 3409 gene locus_tag LOCUS_04700 gene moeB 4203 3409 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 protein_id gnl|my_center|LOCUS_04700 <4876 4259 gene locus_tag LOCUS_04710 <4876 4259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RN3:release factor glutamine methyltransferase >Feature sequence083 1485 598 gene locus_tag LOCUS_04720 1485 598 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 protein_id gnl|my_center|LOCUS_04720 2942 1482 gene locus_tag LOCUS_04730 2942 1482 CDS product putative cationic amino acid transport integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704570.1 protein_id gnl|my_center|LOCUS_04730 4039 3053 gene locus_tag LOCUS_04740 gene astE 4039 3053 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFE5 protein_id gnl|my_center|LOCUS_04740 <4841 4074 gene locus_tag LOCUS_04750 <4841 4074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFE6:N-succinylarginine dihydrolase >Feature sequence084 2902 1886 gene locus_tag LOCUS_04760 2902 1886 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940530.1 protein_id gnl|my_center|LOCUS_04760 3043 3615 gene locus_tag LOCUS_04770 gene efp 3043 3615 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJV8 protein_id gnl|my_center|LOCUS_04770 >Feature sequence085 1465 1390 gene locus_tag LOCUS_t00050 1465 1390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1756 2349 gene locus_tag LOCUS_04780 1756 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2509 3468 gene locus_tag LOCUS_04790 2509 3468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_04790 3470 4243 gene locus_tag LOCUS_04800 gene yadH 3470 4243 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_04800 >Feature sequence086 <1 1874 gene locus_tag LOCUS_04810 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224931.1:Fe/S-dependent 2-methylisocitrate dehydratase AcnD 2031 3257 gene locus_tag LOCUS_04820 2031 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3974 4240 gene locus_tag LOCUS_04830 3974 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence087 571 362 gene locus_tag LOCUS_04840 gene yjbJ 571 362 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296638.1 protein_id gnl|my_center|LOCUS_04840 1368 880 gene locus_tag LOCUS_04850 gene slyD 1368 880 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_04850 2873 1716 gene locus_tag LOCUS_04860 2873 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204814.1 protein_id gnl|my_center|LOCUS_04860 3086 4666 gene locus_tag LOCUS_04870 gene prfC 3086 4666 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU2 protein_id gnl|my_center|LOCUS_04870 >Feature sequence088 <1 1192 gene locus_tag LOCUS_04880 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118952.1:peptidase 1590 1378 gene locus_tag LOCUS_04890 1590 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2015 2479 gene locus_tag LOCUS_04900 2015 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206184.1 protein_id gnl|my_center|LOCUS_04900 2625 3053 gene locus_tag LOCUS_04910 gene rpsF 2625 3053 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV0 protein_id gnl|my_center|LOCUS_04910 3069 3296 gene locus_tag LOCUS_04920 gene rpsR 3069 3296 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV1 protein_id gnl|my_center|LOCUS_04920 3312 3770 gene locus_tag LOCUS_04930 gene rplI 3312 3770 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_04930 >Feature sequence089 <1 2977 gene locus_tag LOCUS_04940 <1 2977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208390.1:hybrid sensor histidine kinase/response regulator 3170 4075 gene locus_tag LOCUS_04950 gene ech1 3170 4075 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence090 1225 77 gene locus_tag LOCUS_04960 1225 77 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_04960 1423 2508 gene locus_tag LOCUS_04970 1423 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2719 4089 gene locus_tag LOCUS_04980 gene norM 2719 4089 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence091 191 1276 gene locus_tag LOCUS_04990 191 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2925 1411 gene locus_tag LOCUS_05000 2925 1411 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_05000 3392 3171 gene locus_tag LOCUS_05010 gene infA 3392 3171 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_05010 4326 3520 gene locus_tag LOCUS_05020 gene truA 4326 3520 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM09 protein_id gnl|my_center|LOCUS_05020 >Feature sequence092 84 1562 gene locus_tag LOCUS_05030 gene hemN 84 1562 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_05030 1580 2038 gene locus_tag LOCUS_05040 1580 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2059 2667 gene locus_tag LOCUS_05050 gene yogG 2059 2667 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130463.1 protein_id gnl|my_center|LOCUS_05050 3241 2678 gene locus_tag LOCUS_05060 3241 2678 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_05060 3350 3733 gene locus_tag LOCUS_05070 3350 3733 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889108.1 protein_id gnl|my_center|LOCUS_05070 4239 3730 gene locus_tag LOCUS_05080 4239 3730 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence093 575 1210 gene locus_tag LOCUS_05090 gene fxsA 575 1210 CDS product FxsA cytoplasmic membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206565.1 protein_id gnl|my_center|LOCUS_05090 1471 2178 gene locus_tag LOCUS_05100 1471 2178 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040206.1 protein_id gnl|my_center|LOCUS_05100 2196 2825 gene locus_tag LOCUS_05110 gene atoA 2196 2825 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 protein_id gnl|my_center|LOCUS_05110 2989 4218 gene locus_tag LOCUS_05120 2989 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence094 1827 1123 gene locus_tag LOCUS_05130 1827 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2128 3900 gene locus_tag LOCUS_05140 gene proS 2128 3900 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_05140 >Feature sequence095 415 2811 gene locus_tag LOCUS_05150 gene rnr 415 2811 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPZ5 protein_id gnl|my_center|LOCUS_05150 3269 2997 gene locus_tag LOCUS_05160 3269 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4281 3451 gene locus_tag LOCUS_05170 4281 3451 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence096 <1 574 gene locus_tag LOCUS_05180 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLT7:60 kDa chaperonin 1609 803 gene locus_tag LOCUS_05190 1609 803 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZU5 protein_id gnl|my_center|LOCUS_05190 2627 1707 gene locus_tag LOCUS_05200 gene argF 2627 1707 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_05200 3662 2754 gene locus_tag LOCUS_05210 gene alr 3662 2754 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV4 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05210 <4585 3867 gene locus_tag LOCUS_05220 <4585 3867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHV3:replicative DNA helicase >Feature sequence097 151 2397 gene locus_tag LOCUS_05230 151 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence098 1318 3051 gene locus_tag LOCUS_05240 1318 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3311 3991 gene locus_tag LOCUS_05250 gene lolB 3311 3991 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG8 protein_id gnl|my_center|LOCUS_05250 >Feature sequence099 1291 2280 gene locus_tag LOCUS_05260 gene terC 1291 2280 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207675.1 protein_id gnl|my_center|LOCUS_05260 2392 2871 gene locus_tag LOCUS_05270 2392 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4199 3012 gene locus_tag LOCUS_05280 gene argD 4199 3012 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_05280 4505 4293 gene locus_tag LOCUS_05290 4505 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence100 1550 447 gene locus_tag LOCUS_05300 1550 447 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_05300 1835 2452 gene locus_tag LOCUS_05310 gene nfuA 1835 2452 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_05310 3872 2586 gene locus_tag LOCUS_05320 gene gltA 3872 2586 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME8 protein_id gnl|my_center|LOCUS_05320 >Feature sequence101 266 1351 gene locus_tag LOCUS_05330 266 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1404 2468 gene locus_tag LOCUS_05340 1404 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence102 2135 1437 gene locus_tag LOCUS_05350 gene mpg1 2135 1437 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_05350 3299 2142 gene locus_tag LOCUS_05360 3299 2142 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence103 547 1938 gene locus_tag LOCUS_05370 547 1938 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_05370 3198 1987 gene locus_tag LOCUS_05380 gene rnd 3198 1987 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_05380 3889 3281 gene locus_tag LOCUS_05390 gene recR 3889 3281 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN26 protein_id gnl|my_center|LOCUS_05390 4386 4057 gene locus_tag LOCUS_05400 4386 4057 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_05400 >Feature sequence104 756 418 gene locus_tag LOCUS_05410 756 418 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR0 protein_id gnl|my_center|LOCUS_05410 945 784 gene locus_tag LOCUS_05420 945 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2848 959 gene locus_tag LOCUS_05430 gene parE 2848 959 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF2 protein_id gnl|my_center|LOCUS_05430 3526 2897 gene locus_tag LOCUS_05440 gene yqiA 3526 2897 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 protein_id gnl|my_center|LOCUS_05440 3788 4072 gene locus_tag LOCUS_05450 3788 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence105 278 676 gene locus_tag LOCUS_05460 gene rpsH 278 676 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ18 protein_id gnl|my_center|LOCUS_05460 750 1283 gene locus_tag LOCUS_05470 gene rplF 750 1283 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ17 protein_id gnl|my_center|LOCUS_05470 1295 1645 gene locus_tag LOCUS_05480 gene rplR 1295 1645 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_05480 1648 2145 gene locus_tag LOCUS_05490 gene rpsE 1648 2145 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ15 protein_id gnl|my_center|LOCUS_05490 2162 2341 gene locus_tag LOCUS_05500 gene rpmD 2162 2341 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ14 protein_id gnl|my_center|LOCUS_05500 2341 2781 gene locus_tag LOCUS_05510 gene rplO 2341 2781 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ13 protein_id gnl|my_center|LOCUS_05510 2788 4125 gene locus_tag LOCUS_05520 gene secY 2788 4125 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ12 protein_id gnl|my_center|LOCUS_05520 >Feature sequence106 611 1468 gene locus_tag LOCUS_05530 gene ugpQ 611 1468 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_05530 1504 1959 gene locus_tag LOCUS_05540 1504 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888612.1 protein_id gnl|my_center|LOCUS_05540 2898 2173 gene locus_tag LOCUS_05550 gene rnhB 2898 2173 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52021 protein_id gnl|my_center|LOCUS_05550 >Feature sequence107 241 1662 gene locus_tag LOCUS_05560 gene gltD 241 1662 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_05560 1812 2360 gene locus_tag LOCUS_05570 1812 2360 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 protein_id gnl|my_center|LOCUS_05570 2394 3836 gene locus_tag LOCUS_05580 2394 3836 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence108 596 766 gene locus_tag LOCUS_05590 596 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 787 1386 gene locus_tag LOCUS_05600 gene nudL 787 1386 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 protein_id gnl|my_center|LOCUS_05600 3220 1406 gene locus_tag LOCUS_05610 gene dacB 3220 1406 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201777.1 protein_id gnl|my_center|LOCUS_05610 3846 3562 gene locus_tag LOCUS_05620 3846 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3734 4333 gene locus_tag LOCUS_05630 3734 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence109 952 437 gene locus_tag LOCUS_05640 gene fabZ 952 437 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC6 protein_id gnl|my_center|LOCUS_05640 2134 1082 gene locus_tag LOCUS_05650 gene lpxD 2134 1082 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_05650 2747 2244 gene locus_tag LOCUS_05660 2747 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 <4424 2770 gene locus_tag LOCUS_05670 <4424 2770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGC9:outer membrane protein assembly factor BamA >Feature sequence110 1346 1062 gene locus_tag LOCUS_05680 1346 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2450 1521 gene locus_tag LOCUS_05690 2450 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2751 3695 gene locus_tag LOCUS_05700 2751 3695 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119677.1 protein_id gnl|my_center|LOCUS_05700 4330 3692 gene locus_tag LOCUS_05710 gene trmB 4330 3692 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence111 1040 2404 gene locus_tag LOCUS_05720 gene dat 1040 2404 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 protein_id gnl|my_center|LOCUS_05720 2488 3057 gene locus_tag LOCUS_05730 2488 3057 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687630.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence112 163 912 gene locus_tag LOCUS_05740 gene gpmA 163 912 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_05740 2171 1005 gene locus_tag LOCUS_05750 gene olE1 2171 1005 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_05750 4019 2376 gene locus_tag LOCUS_05760 4019 2376 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence113 133 1788 gene locus_tag LOCUS_05770 133 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2745 1846 gene locus_tag LOCUS_05780 2745 1846 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH7 protein_id gnl|my_center|LOCUS_05780 3979 2798 gene locus_tag LOCUS_05790 3979 2798 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_05790 4304 4122 gene locus_tag LOCUS_05800 4304 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence114 1317 661 gene locus_tag LOCUS_05810 gene ureJ 1317 661 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931339.1 protein_id gnl|my_center|LOCUS_05810 2046 1345 gene locus_tag LOCUS_05820 gene ureG 2046 1345 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 protein_id gnl|my_center|LOCUS_05820 2933 2097 gene locus_tag LOCUS_05830 gene ureF 2933 2097 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX6 protein_id gnl|my_center|LOCUS_05830 3490 2930 gene locus_tag LOCUS_05840 3490 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 <4296 3727 gene locus_tag LOCUS_05850 <4296 3727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGX4:urease subunit alpha >Feature sequence115 85 615 gene locus_tag LOCUS_05860 gene msrA 85 615 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_05860 860 2245 gene locus_tag LOCUS_05870 gene mltB 860 2245 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_05870 2695 2435 gene locus_tag LOCUS_05880 2695 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3903 2896 gene locus_tag LOCUS_05890 3903 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208258.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence116 1308 277 gene locus_tag LOCUS_05900 gene mreB 1308 277 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946547.1 protein_id gnl|my_center|LOCUS_05900 1929 2231 gene locus_tag LOCUS_05910 gene gatC 1929 2231 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN38 protein_id gnl|my_center|LOCUS_05910 2289 3785 gene locus_tag LOCUS_05920 gene gatA 2289 3785 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN39 protein_id gnl|my_center|LOCUS_05920 >Feature sequence117 <1 1023 gene locus_tag LOCUS_05930 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLC4:DNA helicase 1016 2029 gene locus_tag LOCUS_05940 gene dusC 1016 2029 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW6 protein_id gnl|my_center|LOCUS_05940 2456 2034 gene locus_tag LOCUS_05950 2456 2034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_05950 2914 2468 gene locus_tag LOCUS_05960 2914 2468 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_05960 3260 3778 gene locus_tag LOCUS_05970 gene rppH 3260 3778 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLZ5 protein_id gnl|my_center|LOCUS_05970 4199 3921 gene locus_tag LOCUS_05980 gene rpmE2 4199 3921 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG9 protein_id gnl|my_center|LOCUS_05980 >Feature sequence118 1254 2105 gene locus_tag LOCUS_05990 1254 2105 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_05990 2166 2903 gene locus_tag LOCUS_06000 2166 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_06000 3196 3852 gene locus_tag LOCUS_06010 3196 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522307.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence119 <1 630 gene locus_tag LOCUS_06020 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546330.1:transcriptional regulator 1065 637 gene locus_tag LOCUS_06030 1065 637 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_06030 1523 1086 gene locus_tag LOCUS_06040 1523 1086 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_06040 1738 2049 gene locus_tag LOCUS_06050 1738 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_06050 2275 3558 gene locus_tag LOCUS_06060 2275 3558 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence120 1716 706 gene locus_tag LOCUS_06070 gene porB 1716 706 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_06070 4135 1958 gene locus_tag LOCUS_06080 gene glcB 4135 1958 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV4 protein_id gnl|my_center|LOCUS_06080 >Feature sequence121 <1 984 gene locus_tag LOCUS_06090 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000421580.1:ABC transporter ATP-binding protein 1122 3254 gene locus_tag LOCUS_06100 1122 3254 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705823.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence122 42 485 gene locus_tag LOCUS_06110 42 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207704.1 protein_id gnl|my_center|LOCUS_06110 984 3320 gene locus_tag LOCUS_06120 984 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence123 1185 277 gene locus_tag LOCUS_06130 gene mutM 1185 277 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN93 protein_id gnl|my_center|LOCUS_06130 3629 1212 gene locus_tag LOCUS_06140 gene relA 3629 1212 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence124 640 819 gene locus_tag LOCUS_06150 640 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1070 2596 gene locus_tag LOCUS_06160 gene phoD 1070 2596 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06160 2612 2887 gene locus_tag LOCUS_06170 2612 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 <4195 2949 gene locus_tag LOCUS_06180 <4195 2949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065953.1:electron transfer flavoprotein-ubiquinone oxidoreductase >Feature sequence125 1816 974 gene locus_tag LOCUS_06190 1816 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1909 2289 gene locus_tag LOCUS_06200 1909 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2310 2828 gene locus_tag LOCUS_06210 2310 2828 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141610.1 protein_id gnl|my_center|LOCUS_06210 3074 2946 gene locus_tag LOCUS_06220 3074 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence126 1284 37 gene locus_tag LOCUS_06230 gene ubiF 1284 37 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_06230 2552 1281 gene locus_tag LOCUS_06240 gene ubiH 2552 1281 CDS product ubiquinone biosynthesis protein UbiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_06240 2687 2920 gene locus_tag LOCUS_06250 2687 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence127 1 132 gene locus_tag LOCUS_06260 1 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 336 671 gene locus_tag LOCUS_06270 gene bolA 336 671 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_06270 758 1123 gene locus_tag LOCUS_06280 758 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 1153 1548 gene locus_tag LOCUS_06290 1153 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1991 3727 gene locus_tag LOCUS_06300 1991 3727 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence128 3269 1788 gene locus_tag LOCUS_06310 gene nusA 3269 1788 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB3 protein_id gnl|my_center|LOCUS_06310 3896 3387 gene locus_tag LOCUS_06320 gene rimP 3896 3387 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB2 protein_id gnl|my_center|LOCUS_06320 >Feature sequence129 1361 2305 gene locus_tag LOCUS_06330 gene nahR 1361 2305 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206878.1 protein_id gnl|my_center|LOCUS_06330 2975 2358 gene locus_tag LOCUS_06340 gene gmk 2975 2358 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ2 protein_id gnl|my_center|LOCUS_06340 3172 4140 gene locus_tag LOCUS_06350 gene ispH 3172 4140 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence130 836 1477 gene locus_tag LOCUS_06360 gene cynT 836 1477 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_06360 1710 2204 gene locus_tag LOCUS_06370 gene gloA 1710 2204 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880P8 protein_id gnl|my_center|LOCUS_06370 3305 2304 gene locus_tag LOCUS_06380 gene hemF 3305 2304 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC3 protein_id gnl|my_center|LOCUS_06380 3629 3808 gene locus_tag LOCUS_06390 3629 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence131 721 1455 gene locus_tag LOCUS_06400 gene ubiG 721 1455 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_06400 1496 2206 gene locus_tag LOCUS_06410 gene gph2 1496 2206 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_06410 2319 3089 gene locus_tag LOCUS_06420 gene yciK 2319 3089 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_06420 3182 3448 gene locus_tag LOCUS_06430 3182 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_06430 <4111 3487 gene locus_tag LOCUS_06440 <4111 3487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808335.1:phospholipase D family protein >Feature sequence132 >Feature sequence133 667 104 gene locus_tag LOCUS_06450 667 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1315 833 gene locus_tag LOCUS_06460 1315 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2104 1388 gene locus_tag LOCUS_06470 gene rph 2104 1388 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_06470 3973 2237 gene locus_tag LOCUS_06480 gene fadD 3973 2237 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence134 <1 518 gene locus_tag LOCUS_06490 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87H47:3-hydroxyisobutyrate dehydrogenase 639 1454 gene locus_tag LOCUS_06500 639 1454 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208376.1 protein_id gnl|my_center|LOCUS_06500 2313 1558 gene locus_tag LOCUS_06510 2313 1558 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_06510 2589 3401 gene locus_tag LOCUS_06520 2589 3401 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097033.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence135 394 540 gene locus_tag LOCUS_06530 394 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2019 559 gene locus_tag LOCUS_06540 gene murD 2019 559 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_06540 2693 3031 gene locus_tag LOCUS_06550 gene glnK 2693 3031 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence136 616 185 gene locus_tag LOCUS_06560 gene mscL 616 185 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_06560 2648 810 gene locus_tag LOCUS_06570 gene typA 2648 810 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_06570 3972 2815 gene locus_tag LOCUS_06580 gene ompA 3972 2815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207589.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence137 506 54 gene locus_tag LOCUS_06590 506 54 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_06590 1748 540 gene locus_tag LOCUS_06600 gene gpsA 1748 540 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_06600 2409 1837 gene locus_tag LOCUS_06610 2409 1837 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_06610 3065 2406 gene locus_tag LOCUS_06620 3065 2406 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105536.1 protein_id gnl|my_center|LOCUS_06620 <4048 3110 gene locus_tag LOCUS_06630 <4048 3110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMV3:cell division protein ZapE >Feature sequence138 896 222 gene locus_tag LOCUS_06640 gene clpP 896 222 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHI5 protein_id gnl|my_center|LOCUS_06640 2430 1048 gene locus_tag LOCUS_06650 gene tig 2430 1048 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM1 protein_id gnl|my_center|LOCUS_06650 3389 2739 gene locus_tag LOCUS_06660 3389 2739 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM55 protein_id gnl|my_center|LOCUS_06660 >Feature sequence139 <1 1172 gene locus_tag LOCUS_06670 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002119349.1:transcriptional regulator 1567 2934 gene locus_tag LOCUS_06680 gene bioA 1567 2934 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V66 protein_id gnl|my_center|LOCUS_06680 >Feature sequence140 144 317 gene locus_tag LOCUS_06690 144 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1567 320 gene locus_tag LOCUS_06700 1567 320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_06700 2388 1807 gene locus_tag LOCUS_06710 2388 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_06710 3356 2748 gene locus_tag LOCUS_06720 gene metW 3356 2748 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_06720 <3965 3402 gene locus_tag LOCUS_06730 <3965 3402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM58:homoserine O-acetyltransferase >Feature sequence141 9 902 gene locus_tag LOCUS_06740 9 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 903 2423 gene locus_tag LOCUS_06750 gene nuoN 903 2423 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET6 protein_id gnl|my_center|LOCUS_06750 2519 3358 gene locus_tag LOCUS_06760 gene fpr 2519 3358 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence142 1294 1590 gene locus_tag LOCUS_06770 1294 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 1826 3238 gene locus_tag LOCUS_06780 1826 3238 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence143 1 867 gene locus_tag LOCUS_06790 1 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1050 1958 gene locus_tag LOCUS_06800 gene prmA 1050 1958 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW3 protein_id gnl|my_center|LOCUS_06800 2194 3387 gene locus_tag LOCUS_06810 2194 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence144 627 1559 gene locus_tag LOCUS_06820 gene dapF 627 1559 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V327 protein_id gnl|my_center|LOCUS_06820 1584 2618 gene locus_tag LOCUS_06830 gene xerC 1584 2618 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL90 protein_id gnl|my_center|LOCUS_06830 3152 2694 gene locus_tag LOCUS_06840 3152 2694 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267105.1 protein_id gnl|my_center|LOCUS_06840 <3881 3170 gene locus_tag LOCUS_06850 <3881 3170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208417.1:carbon-nitrogen hydrolase >Feature sequence145 569 721 gene locus_tag LOCUS_06860 569 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 750 1361 gene locus_tag LOCUS_06870 750 1361 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_06870 1459 1968 gene locus_tag LOCUS_06880 1459 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2598 1999 gene locus_tag LOCUS_06890 2598 1999 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_06890 <3869 2697 gene locus_tag LOCUS_06900 <3869 2697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMN5:gamma-glutamyl phosphate reductase >Feature sequence146 811 1587 gene locus_tag LOCUS_06910 811 1587 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477336.1 protein_id gnl|my_center|LOCUS_06910 2397 1708 gene locus_tag LOCUS_06920 gene rpiA 2397 1708 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR7 protein_id gnl|my_center|LOCUS_06920 >Feature sequence147 85 2574 gene locus_tag LOCUS_06930 gene gcd 85 2574 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207594.1 protein_id gnl|my_center|LOCUS_06930 <3806 2702 gene locus_tag LOCUS_06940 <3806 2702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114697.1:deoxyribodipyrimidine photo-lyase >Feature sequence148 233 454 gene locus_tag LOCUS_06950 233 454 CDS product stress-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 protein_id gnl|my_center|LOCUS_06950 2204 663 gene locus_tag LOCUS_06960 gene fumB 2204 663 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYE9 protein_id gnl|my_center|LOCUS_06960 3227 2355 gene locus_tag LOCUS_06970 3227 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence149 901 488 gene locus_tag LOCUS_06980 gene arsC 901 488 CDS product putative arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269090.1 protein_id gnl|my_center|LOCUS_06980 1684 923 gene locus_tag LOCUS_06990 gene arsH 1684 923 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926640.1 protein_id gnl|my_center|LOCUS_06990 2185 1688 gene locus_tag LOCUS_07000 gene arsC2 2185 1688 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 protein_id gnl|my_center|LOCUS_07000 3583 2291 gene locus_tag LOCUS_07010 gene arsB2 3583 2291 CDS product arsenical pump membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPZ5 protein_id gnl|my_center|LOCUS_07010 >Feature sequence150 1552 743 gene locus_tag LOCUS_07020 1552 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2443 1661 gene locus_tag LOCUS_07030 2443 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_07030 3406 2462 gene locus_tag LOCUS_07040 gene htrB 3406 2462 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence151 422 2650 gene locus_tag LOCUS_07050 gene spoT 422 2650 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_07050 2678 3058 gene locus_tag LOCUS_07060 2678 3058 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence152 917 1405 gene locus_tag LOCUS_07070 917 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1523 2239 gene locus_tag LOCUS_07080 gene ung 1523 2239 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_07080 2257 2790 gene locus_tag LOCUS_07090 gene yfhC 2257 2790 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_07090 3312 2953 gene locus_tag LOCUS_07100 3312 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence153 <1 1235 gene locus_tag LOCUS_07110 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KG21:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1457 2575 gene locus_tag LOCUS_07120 gene mraY 1457 2575 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG20 protein_id gnl|my_center|LOCUS_07120 2759 3337 gene locus_tag LOCUS_07130 2759 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence154 1702 3102 gene locus_tag LOCUS_07140 gene sahH 1702 3102 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ86 protein_id gnl|my_center|LOCUS_07140 >Feature sequence155 329 1027 gene locus_tag LOCUS_07150 gene phoB 329 1027 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_07150 1097 2425 gene locus_tag LOCUS_07160 gene phoR 1097 2425 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121907.1 protein_id gnl|my_center|LOCUS_07160 <3669 2400 gene locus_tag LOCUS_07170 <3669 2400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063961.1:D-amino acid dehydrogenase small subunit >Feature sequence156 1404 1844 gene locus_tag LOCUS_07180 gene tusD 1404 1844 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 protein_id gnl|my_center|LOCUS_07180 1875 2207 gene locus_tag LOCUS_07190 1875 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2218 2538 gene locus_tag LOCUS_07200 gene tusE 2218 2538 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF7 protein_id gnl|my_center|LOCUS_07200 3072 2548 gene locus_tag LOCUS_07210 gene trmL 3072 2548 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG5 protein_id gnl|my_center|LOCUS_07210 3362 3502 gene locus_tag LOCUS_07220 3362 3502 CDS product entericidin, EcnA/B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence157 <1 759 gene locus_tag LOCUS_07230 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM47:prolipoprotein diacylglyceryl transferase 791 1651 gene locus_tag LOCUS_07240 gene thyA 791 1651 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM44 protein_id gnl|my_center|LOCUS_07240 1695 2228 gene locus_tag LOCUS_07250 gene folA 1695 2228 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM43 protein_id gnl|my_center|LOCUS_07250 2309 2539 gene locus_tag LOCUS_07260 2309 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3187 2699 gene locus_tag LOCUS_07270 3187 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence158 <1 547 gene locus_tag LOCUS_07280 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266205.1:short-chain dehydrogenase 1026 610 gene locus_tag LOCUS_07290 1026 610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 protein_id gnl|my_center|LOCUS_07290 2557 1085 gene locus_tag LOCUS_07300 2557 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3513 2587 gene locus_tag LOCUS_07310 3513 2587 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145047.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence159 <1 1505 gene locus_tag LOCUS_07320 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFA5:glycerol-3-phosphate acyltransferase 2291 1566 gene locus_tag LOCUS_07330 2291 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 <3592 2354 gene locus_tag LOCUS_07340 <3592 2354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJF4:arginine--tRNA ligase >Feature sequence160 <1 576 gene locus_tag LOCUS_07350 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKM1:phosphomethylpyrimidine synthase 875 1462 gene locus_tag LOCUS_07360 875 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2339 1533 gene locus_tag LOCUS_07370 gene dapB 2339 1533 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_07370 <3589 2562 gene locus_tag LOCUS_07380 <3589 2562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI50:chaperone protein DnaJ >Feature sequence161 1305 400 gene locus_tag LOCUS_07390 gene accD 1305 400 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU0 protein_id gnl|my_center|LOCUS_07390 2262 1441 gene locus_tag LOCUS_07400 gene trpA 2262 1441 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM0 protein_id gnl|my_center|LOCUS_07400 2526 2275 gene locus_tag LOCUS_07410 2526 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 <3583 2537 gene locus_tag LOCUS_07420 <3583 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNU6:tryptophan synthase beta chain >Feature sequence162 804 2636 gene locus_tag LOCUS_07430 804 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 3268 2732 gene locus_tag LOCUS_07440 3268 2732 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence163 3001 263 gene locus_tag LOCUS_07450 3001 263 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951108.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence164 330 1949 gene locus_tag LOCUS_07460 330 1949 CDS product histidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206642.1 protein_id gnl|my_center|LOCUS_07460 <3538 2660 gene locus_tag LOCUS_07470 <3538 2660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762895.1:membrane protein >Feature sequence165 381 1214 gene locus_tag LOCUS_07480 gene otsB 381 1214 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY0 protein_id gnl|my_center|LOCUS_07480 1202 2617 gene locus_tag LOCUS_07490 gene otsA 1202 2617 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205934.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence166 2254 1031 gene locus_tag LOCUS_07500 2254 1031 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_07500 2582 3406 gene locus_tag LOCUS_07510 gene mazG 2582 3406 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence167 1233 517 gene locus_tag LOCUS_07520 1233 517 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA4 protein_id gnl|my_center|LOCUS_07520 1385 1296 gene locus_tag LOCUS_t00060 1385 1296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1853 3190 gene locus_tag LOCUS_07530 gene dctA 1853 3190 CDS product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHX3 protein_id gnl|my_center|LOCUS_07530 >Feature sequence168 2680 947 gene locus_tag LOCUS_07540 2680 947 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_07540 <3523 2913 gene locus_tag LOCUS_07550 <3523 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096636.1:urea ABC transporter substrate-binding protein >Feature sequence169 1605 1315 gene locus_tag LOCUS_07560 gene groS 1605 1315 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_07560 2011 2706 gene locus_tag LOCUS_07570 2011 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence170 1052 468 gene locus_tag LOCUS_07580 1052 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 protein_id gnl|my_center|LOCUS_07580 2612 1467 gene locus_tag LOCUS_07590 gene rodA 2612 1467 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence171 2027 597 gene locus_tag LOCUS_07600 gene rubB 2027 597 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 protein_id gnl|my_center|LOCUS_07600 2213 2049 gene locus_tag LOCUS_07610 gene rubA 2213 2049 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_07610 2580 3116 gene locus_tag LOCUS_07620 2580 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence172 329 1369 gene locus_tag LOCUS_07630 gene nagZ 329 1369 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_07630 1832 1497 gene locus_tag LOCUS_07640 1832 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2376 2301 gene locus_tag LOCUS_t00070 2376 2301 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2481 2407 gene locus_tag LOCUS_t00080 2481 2407 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2620 2544 gene locus_tag LOCUS_t00090 2620 2544 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <3503 2773 gene locus_tag LOCUS_07650 <3503 2773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KP08:quinolinate synthase A >Feature sequence173 420 1205 gene locus_tag LOCUS_07660 gene dnaA 420 1205 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_07660 1283 1963 gene locus_tag LOCUS_07670 1283 1963 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_07670 2539 2048 gene locus_tag LOCUS_07680 2539 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 <3497 2561 gene locus_tag LOCUS_07690 <3497 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIJ8:type II secretion system protein L >Feature sequence174 <1 689 gene locus_tag LOCUS_07700 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205896.1:two-component sensor histidine kinase 787 996 gene locus_tag LOCUS_07710 787 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2483 1107 gene locus_tag LOCUS_07720 gene envZ 2483 1107 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence175 66 734 gene locus_tag LOCUS_07730 66 734 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_07730 1867 1262 gene locus_tag LOCUS_07740 1867 1262 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence176 <1 1583 gene locus_tag LOCUS_07750 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGZ1:Lon protease 2260 1712 gene locus_tag LOCUS_07760 2260 1712 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVR1 protein_id gnl|my_center|LOCUS_07760 <3462 2557 gene locus_tag LOCUS_07770 <3462 2557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461355.1:MFS transporter >Feature sequence177 1785 559 gene locus_tag LOCUS_07780 gene mrp 1785 559 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV5 protein_id gnl|my_center|LOCUS_07780 >Feature sequence178 1177 635 gene locus_tag LOCUS_07790 1177 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1566 1309 gene locus_tag LOCUS_07800 1566 1309 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_07800 2024 1605 gene locus_tag LOCUS_07810 2024 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 <3456 2071 gene locus_tag LOCUS_07820 <3456 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704950.1:U32 family peptidase >Feature sequence179 2626 773 gene locus_tag LOCUS_07830 gene sdhA 2626 773 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME4 protein_id gnl|my_center|LOCUS_07830 3067 2732 gene locus_tag LOCUS_07840 gene sdhD 3067 2732 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME5 protein_id gnl|my_center|LOCUS_07840 >Feature sequence180 476 264 gene locus_tag LOCUS_07850 gene cspG 476 264 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 protein_id gnl|my_center|LOCUS_07850 1375 749 gene locus_tag LOCUS_07860 1375 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2192 1440 gene locus_tag LOCUS_07870 2192 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 <3440 2337 gene locus_tag LOCUS_07880 <3440 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJQ9:glutamine synthetase >Feature sequence181 2692 3159 gene locus_tag LOCUS_07890 2692 3159 CDS product magnesium transporter MgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 protein_id gnl|my_center|LOCUS_07890 3408 3253 gene locus_tag LOCUS_07900 3408 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence182 858 613 gene locus_tag LOCUS_07910 858 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1484 855 gene locus_tag LOCUS_07920 1484 855 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633911.1 protein_id gnl|my_center|LOCUS_07920 1807 2622 gene locus_tag LOCUS_07930 1807 2622 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence183 801 2597 gene locus_tag LOCUS_07940 801 2597 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184654.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence184 1387 2022 gene locus_tag LOCUS_07950 gene gst 1387 2022 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44521 protein_id gnl|my_center|LOCUS_07950 >Feature sequence185 812 1825 gene locus_tag LOCUS_07960 gene porB 812 1825 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence186 3073 947 gene locus_tag LOCUS_07970 gene pcrA 3073 947 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM27 protein_id gnl|my_center|LOCUS_07970 >Feature sequence187 1718 624 gene locus_tag LOCUS_07980 gene lpxK 1718 624 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC1 protein_id gnl|my_center|LOCUS_07980 <3382 1718 gene locus_tag LOCUS_07990 <3382 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMC0:lipid A export ATP-binding/permease protein MsbA >Feature sequence188 903 619 gene locus_tag LOCUS_08000 903 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1249 1977 gene locus_tag LOCUS_08010 1249 1977 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence189 1033 203 gene locus_tag LOCUS_08020 1033 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_08020 1251 1706 gene locus_tag LOCUS_08030 gene dgkA 1251 1706 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216810.1 protein_id gnl|my_center|LOCUS_08030 1749 2561 gene locus_tag LOCUS_08040 1749 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence190 1532 897 gene locus_tag LOCUS_08050 1532 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2724 1570 gene locus_tag LOCUS_08060 2724 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227457.1 protein_id gnl|my_center|LOCUS_08060 <3356 2813 gene locus_tag LOCUS_08070 <3356 2813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227456.1:peroxidase >Feature sequence191 755 243 gene locus_tag LOCUS_08080 755 243 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_08080 875 1906 gene locus_tag LOCUS_08090 gene ribF 875 1906 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM5 protein_id gnl|my_center|LOCUS_08090 >Feature sequence192 1033 398 gene locus_tag LOCUS_08100 gene hisH 1033 398 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_08100 1206 2210 gene locus_tag LOCUS_08110 gene cbpA 1206 2210 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_08110 2323 2649 gene locus_tag LOCUS_08120 2323 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence193 390 175 gene locus_tag LOCUS_08130 gene rpsU 390 175 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII8 protein_id gnl|my_center|LOCUS_08130 929 1429 gene locus_tag LOCUS_08140 929 1429 CDS product cytochrome c-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_08140 1636 2106 gene locus_tag LOCUS_08150 gene ybaK 1636 2106 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ8 protein_id gnl|my_center|LOCUS_08150 2118 2498 gene locus_tag LOCUS_08160 2118 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2966 2526 gene locus_tag LOCUS_08170 2966 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence194 752 468 gene locus_tag LOCUS_08180 gene rpsQ 752 468 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_08180 961 755 gene locus_tag LOCUS_08190 gene rpmC 961 755 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF85 protein_id gnl|my_center|LOCUS_08190 1374 961 gene locus_tag LOCUS_08200 gene rplP 1374 961 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE2 protein_id gnl|my_center|LOCUS_08200 2132 1380 gene locus_tag LOCUS_08210 gene rpsC 2132 1380 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF87 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08210 2463 2134 gene locus_tag LOCUS_08220 gene rplV 2463 2134 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF88 protein_id gnl|my_center|LOCUS_08220 2749 2474 gene locus_tag LOCUS_08230 gene rpsS 2749 2474 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF89 protein_id gnl|my_center|LOCUS_08230 <3306 2761 gene locus_tag LOCUS_08240 <3306 2761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KF90:50S ribosomal protein L2 >Feature sequence195 981 1832 gene locus_tag LOCUS_08250 gene thiG 981 1832 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL0 protein_id gnl|my_center|LOCUS_08250 1861 3219 gene locus_tag LOCUS_08260 1861 3219 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence196 984 313 gene locus_tag LOCUS_08270 984 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1608 1318 gene locus_tag LOCUS_08280 1608 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3275 1977 gene locus_tag LOCUS_08290 3275 1977 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence197 2785 1274 gene locus_tag LOCUS_08300 2785 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3268 2792 gene locus_tag LOCUS_08310 3268 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence198 374 1153 gene locus_tag LOCUS_08320 gene aroE 374 1153 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC4 protein_id gnl|my_center|LOCUS_08320 2020 1289 gene locus_tag LOCUS_08330 2020 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2708 2187 gene locus_tag LOCUS_08340 2708 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2984 2718 gene locus_tag LOCUS_08350 2984 2718 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence199 <1 598 gene locus_tag LOCUS_08360 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM24:DNA topoisomerase 1 877 656 gene locus_tag LOCUS_08370 877 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_08370 2165 1230 gene locus_tag LOCUS_08380 gene hslO 2165 1230 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE5 protein_id gnl|my_center|LOCUS_08380 >Feature sequence200 3 521 gene locus_tag LOCUS_08390 3 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 566 2503 gene locus_tag LOCUS_08400 566 2503 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494952.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence201 167 922 gene locus_tag LOCUS_08410 167 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_08410 941 2800 gene locus_tag LOCUS_08420 gene kefB 941 2800 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence202 779 429 gene locus_tag LOCUS_08430 gene ftsB 779 429 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP4 protein_id gnl|my_center|LOCUS_08430 2294 954 gene locus_tag LOCUS_08440 gene eno 2294 954 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP8 protein_id gnl|my_center|LOCUS_08440 <3220 2474 gene locus_tag LOCUS_08450 <3220 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P77868:putative cation-transporting ATPase >Feature sequence203 1034 645 gene locus_tag LOCUS_08460 1034 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08460 1276 1037 gene locus_tag LOCUS_08470 1276 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1840 1286 gene locus_tag LOCUS_08480 gene purE 1840 1286 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_08480 2875 1961 gene locus_tag LOCUS_08490 2875 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence204 1415 2497 gene locus_tag LOCUS_08500 gene nhaA 1415 2497 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence205 280 981 gene locus_tag LOCUS_08510 280 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1814 1014 gene locus_tag LOCUS_08520 1814 1014 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173233.1 protein_id gnl|my_center|LOCUS_08520 <3191 1885 gene locus_tag LOCUS_08530 <3191 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207482.1:putrescine/spermidine ABC transporter >Feature sequence206 1397 15 gene locus_tag LOCUS_08540 1397 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1479 2474 gene locus_tag LOCUS_08550 1479 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 <3175 2580 gene locus_tag LOCUS_08560 <3175 2580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864506.1:FUSC family protein >Feature sequence207 2994 316 gene locus_tag LOCUS_08570 gene glnD 2994 316 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM5 protein_id gnl|my_center|LOCUS_08570 >Feature sequence208 48 1406 gene locus_tag LOCUS_08580 gene glmU 48 1406 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_08580 >Feature sequence209 <3167 1206 gene locus_tag LOCUS_08590 <3167 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267302.1:helicase >Feature sequence210 2360 1017 gene locus_tag LOCUS_08600 gene proP 2360 1017 CDS product proline/betaine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067910.1 protein_id gnl|my_center|LOCUS_08600 <3166 2402 gene locus_tag LOCUS_08610 <3166 2402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336960.1:creatinase >Feature sequence211 <3149 703 gene locus_tag LOCUS_08620 <3149 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLW1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence212 1004 171 gene locus_tag LOCUS_08630 gene efeU 1004 171 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602752.1 protein_id gnl|my_center|LOCUS_08630 2728 1217 gene locus_tag LOCUS_08640 2728 1217 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018494.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence213 <1 1042 gene locus_tag LOCUS_08650 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPI7:anhydro-N-acetylmuramic acid kinase 1192 2499 gene locus_tag LOCUS_08660 1192 2499 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH6 protein_id gnl|my_center|LOCUS_08660 >Feature sequence214 1545 1021 gene locus_tag LOCUS_08670 1545 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2696 1971 gene locus_tag LOCUS_08680 gene yggS 2696 1971 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence215 >Feature sequence216 1087 338 gene locus_tag LOCUS_08690 1087 338 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLP9 protein_id gnl|my_center|LOCUS_08690 2575 1232 gene locus_tag LOCUS_08700 gene adcK4 2575 1232 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence217 3003 757 gene locus_tag LOCUS_08710 gene brfB 3003 757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810200.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence218 629 1060 gene locus_tag LOCUS_08720 gene ndk 629 1060 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP3 protein_id gnl|my_center|LOCUS_08720 1819 2319 gene locus_tag LOCUS_08730 gene ispF 1819 2319 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE4 protein_id gnl|my_center|LOCUS_08730 2493 2831 gene locus_tag LOCUS_08740 gene grxD 2493 2831 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_08740 >Feature sequence219 24 1034 gene locus_tag LOCUS_08750 24 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1338 1096 gene locus_tag LOCUS_08760 1338 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2114 1539 gene locus_tag LOCUS_08770 gene dcd 2114 1539 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW0 protein_id gnl|my_center|LOCUS_08770 <3040 2221 gene locus_tag LOCUS_08780 <3040 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI86:chaperone protein ClpB >Feature sequence220 55 828 gene locus_tag LOCUS_08790 gene cmoA 55 828 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIF6 protein_id gnl|my_center|LOCUS_08790 877 1929 gene locus_tag LOCUS_08800 gene cmoB 877 1929 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIF5 protein_id gnl|my_center|LOCUS_08800 2228 2010 gene locus_tag LOCUS_08810 2228 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence221 473 1543 gene locus_tag LOCUS_08820 gene leuB 473 1543 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZI9 protein_id gnl|my_center|LOCUS_08820 >Feature sequence222 931 656 gene locus_tag LOCUS_08830 931 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1036 2991 gene locus_tag LOCUS_08840 gene uup 1036 2991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence223 >Feature sequence224 1644 178 gene locus_tag LOCUS_08850 1644 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence225 <1 829 gene locus_tag LOCUS_08860 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL86:DNA gyrase subunit A 1002 1697 gene locus_tag LOCUS_08870 1002 1697 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence226 <1 558 gene locus_tag LOCUS_08880 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL71:phosphoribosylglycinamide formyltransferase 1539 628 gene locus_tag LOCUS_08890 gene ubiA 1539 628 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ7 protein_id gnl|my_center|LOCUS_08890 2462 1638 gene locus_tag LOCUS_08900 gene bioC 2462 1638 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC6 protein_id gnl|my_center|LOCUS_08900 <3000 2479 gene locus_tag LOCUS_08910 <3000 2479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207926.1:CDP-abequose synthase >Feature sequence227 1296 667 gene locus_tag LOCUS_08920 1296 667 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence228 1202 366 gene locus_tag LOCUS_08930 gene trmJ 1202 366 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLL5 protein_id gnl|my_center|LOCUS_08930 1571 1227 gene locus_tag LOCUS_08940 1571 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 <2991 1744 gene locus_tag LOCUS_08950 <2991 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLL6:DNA-directed DNA polymerase >Feature sequence229 304 1203 gene locus_tag LOCUS_08960 304 1203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 protein_id gnl|my_center|LOCUS_08960 2045 1314 gene locus_tag LOCUS_08970 gene rluA 2045 1314 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_08970 <2979 2193 gene locus_tag LOCUS_08980 <2979 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKF5:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence230 <1 581 gene locus_tag LOCUS_08990 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116044.1:ribonuclease G 916 1227 gene locus_tag LOCUS_09000 gene rpsJ 916 1227 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF94 protein_id gnl|my_center|LOCUS_09000 1282 1920 gene locus_tag LOCUS_09010 gene rplC 1282 1920 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF93 protein_id gnl|my_center|LOCUS_09010 1935 2537 gene locus_tag LOCUS_09020 gene rplD 1935 2537 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 protein_id gnl|my_center|LOCUS_09020 2534 2857 gene locus_tag LOCUS_09030 gene rplW 2534 2857 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF91 protein_id gnl|my_center|LOCUS_09030 >Feature sequence231 3 1082 gene locus_tag LOCUS_09040 gene tauA 3 1082 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206506.1 protein_id gnl|my_center|LOCUS_09040 1112 1891 gene locus_tag LOCUS_09050 gene tauB 1112 1891 CDS product taurine import ATP-binding protein TauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8S0 protein_id gnl|my_center|LOCUS_09050 1945 2850 gene locus_tag LOCUS_09060 gene tauC 1945 2850 CDS product taurine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206507.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence232 332 1207 gene locus_tag LOCUS_09070 gene pilD 332 1207 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA6 protein_id gnl|my_center|LOCUS_09070 1252 1860 gene locus_tag LOCUS_09080 gene coaE 1252 1860 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_09080 <2950 1918 gene locus_tag LOCUS_09090 <2950 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886939.1:nicotinate phosphoribosyltransferase >Feature sequence233 418 1638 gene locus_tag LOCUS_09100 gene yhbZ 418 1638 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ1 protein_id gnl|my_center|LOCUS_09100 2594 1713 gene locus_tag LOCUS_09110 2594 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence234 1936 1448 gene locus_tag LOCUS_09120 1936 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2118 2516 gene locus_tag LOCUS_09130 2118 2516 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116928.1 protein_id gnl|my_center|LOCUS_09130 2629 2704 gene locus_tag LOCUS_t00100 2629 2704 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence235 2935 1136 gene locus_tag LOCUS_09140 gene maeB 2935 1136 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence236 837 556 gene locus_tag LOCUS_09150 837 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1283 846 gene locus_tag LOCUS_09160 1283 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 <2932 1283 gene locus_tag LOCUS_09170 <2932 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205534.1:bacteriophage membrane protein >Feature sequence237 <1 808 gene locus_tag LOCUS_09180 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980995.1:class II glutamine amidotransferase 810 1712 gene locus_tag LOCUS_09190 810 1712 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_09190 <2908 1820 gene locus_tag LOCUS_09200 <2908 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889090.1:class V aminotransferase >Feature sequence238 911 354 gene locus_tag LOCUS_09210 911 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 981 1826 gene locus_tag LOCUS_09220 gene rsmI 981 1826 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH08 protein_id gnl|my_center|LOCUS_09220 2611 1823 gene locus_tag LOCUS_09230 2611 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212540.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence239 909 442 gene locus_tag LOCUS_09240 gene nuoA 909 442 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPM2 protein_id gnl|my_center|LOCUS_09240 2193 1504 gene locus_tag LOCUS_09250 gene lolA 2193 1504 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_09250 2812 2549 gene locus_tag LOCUS_09260 gene rpmA 2812 2549 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F2 protein_id gnl|my_center|LOCUS_09260 >Feature sequence240 <1 1362 gene locus_tag LOCUS_09270 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206111.1:ABC transporter substrate-binding protein 1377 2177 gene locus_tag LOCUS_09280 gene gloB 1377 2177 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7J0 protein_id gnl|my_center|LOCUS_09280 >Feature sequence241 1954 881 gene locus_tag LOCUS_09290 gene lipA 1954 881 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_09290 >Feature sequence242 <1 1149 gene locus_tag LOCUS_09300 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262036.1:oleate hydratase 1305 1943 gene locus_tag LOCUS_09310 1305 1943 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 protein_id gnl|my_center|LOCUS_09310 <2882 2073 gene locus_tag LOCUS_09320 <2882 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812829.1:2-dehydropantoate 2-reductase >Feature sequence243 1832 483 gene locus_tag LOCUS_09330 1832 483 CDS product putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYD0 protein_id gnl|my_center|LOCUS_09330 2739 1834 gene locus_tag LOCUS_09340 2739 1834 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence244 <1 574 gene locus_tag LOCUS_09350 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5Z0:S-adenosylmethionine synthase 663 977 gene locus_tag LOCUS_09360 663 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 protein_id gnl|my_center|LOCUS_09360 1062 1652 gene locus_tag LOCUS_09370 1062 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2120 1764 gene locus_tag LOCUS_09380 2120 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence245 <1 1149 gene locus_tag LOCUS_09390 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705934.1:sodium:alanine symporter 2378 1239 gene locus_tag LOCUS_09400 2378 1239 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence246 463 633 gene locus_tag LOCUS_09410 463 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2318 630 gene locus_tag LOCUS_09420 2318 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence247 204 737 gene locus_tag LOCUS_09430 204 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1117 2217 gene locus_tag LOCUS_09440 1117 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2513 2226 gene locus_tag LOCUS_09450 2513 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence248 132 548 gene locus_tag LOCUS_09460 gene atpC 132 548 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_09460 932 1639 gene locus_tag LOCUS_09470 gene rstA 932 1639 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence249 465 638 gene locus_tag LOCUS_09480 465 638 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396487.1 protein_id gnl|my_center|LOCUS_09480 635 1813 gene locus_tag LOCUS_09490 635 1813 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS22 protein_id gnl|my_center|LOCUS_09490 2251 1898 gene locus_tag LOCUS_09500 gene yffB 2251 1898 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence250 1839 736 gene locus_tag LOCUS_09510 1839 736 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198339.1 protein_id gnl|my_center|LOCUS_09510 2840 1926 gene locus_tag LOCUS_09520 2840 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence251 <1 520 gene locus_tag LOCUS_09530 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206205.1:O-methyltransferase 528 1154 gene locus_tag LOCUS_09540 528 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1151 1345 gene locus_tag LOCUS_09550 1151 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 1321 1938 gene locus_tag LOCUS_09560 1321 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 1923 2480 gene locus_tag LOCUS_09570 1923 2480 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY7 protein_id gnl|my_center|LOCUS_09570 >Feature sequence252 1339 455 gene locus_tag LOCUS_09580 gene gluQ 1339 455 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK58 protein_id gnl|my_center|LOCUS_09580 1847 1410 gene locus_tag LOCUS_09590 1847 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 <2824 2074 gene locus_tag LOCUS_09600 <2824 2074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KPD7:3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA >Feature sequence253 1183 125 gene locus_tag LOCUS_09610 1183 125 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_09610 2052 1438 gene locus_tag LOCUS_09620 gene folE 2052 1438 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence254 151 1311 gene locus_tag LOCUS_09630 151 1311 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483354.1 protein_id gnl|my_center|LOCUS_09630 1353 2129 gene locus_tag LOCUS_09640 1353 2129 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477237.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence255 <1 1645 gene locus_tag LOCUS_09650 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116875.1:RNA-binding transcriptional accessory protein 1730 2662 gene locus_tag LOCUS_09660 gene menA 1730 2662 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44739 protein_id gnl|my_center|LOCUS_09660 >Feature sequence256 3 986 gene locus_tag LOCUS_09670 gene rhlB 3 986 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK3 protein_id gnl|my_center|LOCUS_09670 1407 1069 gene locus_tag LOCUS_09680 1407 1069 CDS product RplA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706218.1 protein_id gnl|my_center|LOCUS_09680 2109 1749 gene locus_tag LOCUS_tm00010 2109 1749 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence257 2476 989 gene locus_tag LOCUS_09690 2476 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence258 1535 276 gene locus_tag LOCUS_09700 gene glyA 1535 276 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_09700 2389 1784 gene locus_tag LOCUS_09710 gene ubiC 2389 1784 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ8 protein_id gnl|my_center|LOCUS_09710 >Feature sequence259 <1 803 gene locus_tag LOCUS_09720 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207409.1:multidrug ABC transporter permease 1016 2461 gene locus_tag LOCUS_09730 gene sdaA 1016 2461 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223712.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence260 1 165 gene locus_tag LOCUS_09740 1 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 627 175 gene locus_tag LOCUS_09750 627 175 CDS product putative heavy metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44617 protein_id gnl|my_center|LOCUS_09750 735 1478 gene locus_tag LOCUS_09760 735 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1557 1769 gene locus_tag LOCUS_09770 1557 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207685.2 protein_id gnl|my_center|LOCUS_09770 >Feature sequence261 <1 1157 gene locus_tag LOCUS_09780 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNY7:protein-export membrane protein SecF 1227 1934 gene locus_tag LOCUS_09790 1227 1934 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_09790 1979 2362 gene locus_tag LOCUS_09800 1979 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence262 1113 505 gene locus_tag LOCUS_09810 1113 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 protein_id gnl|my_center|LOCUS_09810 1800 1303 gene locus_tag LOCUS_09820 1800 1303 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_09820 2115 1900 gene locus_tag LOCUS_09830 2115 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2428 2352 gene locus_tag LOCUS_t00110 2428 2352 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence263 412 1137 gene locus_tag LOCUS_09840 gene rplY 412 1137 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX3 protein_id gnl|my_center|LOCUS_09840 1175 1762 gene locus_tag LOCUS_09850 gene pth 1175 1762 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF04 protein_id gnl|my_center|LOCUS_09850 1977 2357 gene locus_tag LOCUS_09860 gene panD 1977 2357 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_09860 >Feature sequence264 1148 357 gene locus_tag LOCUS_09870 1148 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2196 1246 gene locus_tag LOCUS_09880 gene cas6_1 2196 1246 CDS product CRISPR-associated protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence265 <1 1669 gene locus_tag LOCUS_09890 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208238.1:2-octaprenylphenol hydroxylase 1676 2296 gene locus_tag LOCUS_09900 1676 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence266 1607 1792 gene locus_tag LOCUS_09910 1607 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2041 2116 gene locus_tag LOCUS_t00120 2041 2116 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 580 281 gene locus_tag LOCUS_09920 580 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1267 584 gene locus_tag LOCUS_09930 1267 584 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_09930 2265 1963 gene locus_tag LOCUS_09940 2265 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence268 1039 374 gene locus_tag LOCUS_09950 gene exbB 1039 374 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_09950 <2767 1548 gene locus_tag LOCUS_09960 <2767 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001882427.1:TonB-dependent receptor >Feature sequence269 2196 1150 gene locus_tag LOCUS_09970 gene ispB 2196 1150 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence270 265 396 gene locus_tag LOCUS_09980 265 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1550 489 gene locus_tag LOCUS_09990 1550 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence271 1081 1851 gene locus_tag LOCUS_10000 1081 1851 CDS product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097055.1 protein_id gnl|my_center|LOCUS_10000 2200 1931 gene locus_tag LOCUS_10010 2200 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence272 <1 651 gene locus_tag LOCUS_10020 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P26876:lactonizing lipase 789 631 gene locus_tag LOCUS_10030 789 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 827 1762 gene locus_tag LOCUS_10040 gene lifO 827 1762 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_10040 <2721 1860 gene locus_tag LOCUS_10050 <2721 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNH2:histidinol dehydrogenase >Feature sequence273 456 2024 gene locus_tag LOCUS_10060 gene yoaE 456 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170491.1 protein_id gnl|my_center|LOCUS_10060 2566 2093 gene locus_tag LOCUS_10070 2566 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence274 1601 1137 gene locus_tag LOCUS_10080 1601 1137 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_10080 2246 1653 gene locus_tag LOCUS_10090 2246 1653 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence275 1535 813 gene locus_tag LOCUS_10100 gene queE 1535 813 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL36 protein_id gnl|my_center|LOCUS_10100 2012 1608 gene locus_tag LOCUS_10110 gene pcaC 2012 1608 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_10110 <2701 2131 gene locus_tag LOCUS_10120 <2701 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL35:2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase >Feature sequence276 1308 46 gene locus_tag LOCUS_10130 1308 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 <2694 1337 gene locus_tag LOCUS_10140 <2694 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIS2:glucose-6-phosphate isomerase >Feature sequence277 526 984 gene locus_tag LOCUS_10150 526 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1073 1930 gene locus_tag LOCUS_10160 gene hisI 1073 1930 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC5 protein_id gnl|my_center|LOCUS_10160 2119 2349 gene locus_tag LOCUS_10170 gene tatA 2119 2349 CDS product sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA49 protein_id gnl|my_center|LOCUS_10170 >Feature sequence278 907 131 gene locus_tag LOCUS_10180 gene fpr 907 131 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_10180 1085 1816 gene locus_tag LOCUS_10190 1085 1816 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_10190 1990 2382 gene locus_tag LOCUS_10200 1990 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118406.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence279 2 538 gene locus_tag LOCUS_10210 2 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 535 957 gene locus_tag LOCUS_10220 535 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 954 1763 gene locus_tag LOCUS_10230 gene xcpW 954 1763 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence280 754 197 gene locus_tag LOCUS_10240 754 197 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_10240 1506 835 gene locus_tag LOCUS_10250 1506 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 <2653 1519 gene locus_tag LOCUS_10260 <2653 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44683:putative ribosomal oxygenase >Feature sequence281 735 926 gene locus_tag LOCUS_10270 735 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1054 1404 gene locus_tag LOCUS_10280 1054 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1480 1734 gene locus_tag LOCUS_10290 1480 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2557 1826 gene locus_tag LOCUS_10300 gene miaE 2557 1826 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence282 <1 918 gene locus_tag LOCUS_10310 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118558.1:D-alanyl-D-alanine carboxypeptidase <2646 985 gene locus_tag LOCUS_10320 <2646 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000202845.1:hybrid sensor histidine kinase/response regulator >Feature sequence283 472 1224 gene locus_tag LOCUS_10330 472 1224 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082767.1 protein_id gnl|my_center|LOCUS_10330 1221 1892 gene locus_tag LOCUS_10340 1221 1892 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence284 1724 843 gene locus_tag LOCUS_10350 gene panB 1724 843 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC8 protein_id gnl|my_center|LOCUS_10350 2425 1931 gene locus_tag LOCUS_10360 gene folK 2425 1931 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence285 495 1157 gene locus_tag LOCUS_10370 gene coq7 495 1157 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_10370 1389 2432 gene locus_tag LOCUS_10380 1389 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence286 587 1441 gene locus_tag LOCUS_10390 gene fkpA 587 1441 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ3 protein_id gnl|my_center|LOCUS_10390 1542 2336 gene locus_tag LOCUS_10400 gene fklB 1542 2336 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_10400 2620 2432 gene locus_tag LOCUS_10410 2620 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence287 1886 93 gene locus_tag LOCUS_10420 gene acdB 1886 93 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_10420 <2616 2037 gene locus_tag LOCUS_10430 <2616 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34311:signaling protein YkoW >Feature sequence288 >Feature sequence289 610 80 gene locus_tag LOCUS_10440 610 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1195 854 gene locus_tag LOCUS_10450 1195 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1487 1197 gene locus_tag LOCUS_10460 1487 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2610 1474 gene locus_tag LOCUS_10470 2610 1474 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008479712.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence290 848 456 gene locus_tag LOCUS_10480 848 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1861 956 gene locus_tag LOCUS_10490 gene lepB 1861 956 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_10490 <2604 1870 gene locus_tag LOCUS_10500 <2604 1870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKL5:elongation factor 4 >Feature sequence291 497 2446 gene locus_tag LOCUS_10510 gene acsA2 497 2446 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207919.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence292 394 726 gene locus_tag LOCUS_10520 394 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2182 785 gene locus_tag LOCUS_10530 gene radA 2182 785 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL98 protein_id gnl|my_center|LOCUS_10530 >Feature sequence293 2487 1894 gene locus_tag LOCUS_10540 2487 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207822.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence294 1167 376 gene locus_tag LOCUS_10550 gene cmoM 1167 376 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYR1 protein_id gnl|my_center|LOCUS_10550 1634 1164 gene locus_tag LOCUS_10560 gene smpB 1634 1164 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_10560 >Feature sequence295 1401 58 gene locus_tag LOCUS_10570 gene MltB 1401 58 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_10570 1656 1943 gene locus_tag LOCUS_10580 1656 1943 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVE4 protein_id gnl|my_center|LOCUS_10580 2586 2011 gene locus_tag LOCUS_10590 2586 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence296 1436 246 gene locus_tag LOCUS_10600 1436 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2042 1587 gene locus_tag LOCUS_10610 2042 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence297 2362 953 gene locus_tag LOCUS_10620 2362 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence298 1290 2387 gene locus_tag LOCUS_10630 gene aroF 1290 2387 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN07 protein_id gnl|my_center|LOCUS_10630 >Feature sequence299 1779 1498 gene locus_tag LOCUS_10640 1779 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1938 1798 gene locus_tag LOCUS_10650 1938 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence300 363 1247 gene locus_tag LOCUS_10660 363 1247 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU2 protein_id gnl|my_center|LOCUS_10660 >Feature sequence301 >Feature sequence302 <1 2098 gene locus_tag LOCUS_10670 <1 2098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKS1:fatty acid oxidation complex subunit alpha >Feature sequence303 994 164 gene locus_tag LOCUS_10680 gene apaH 994 164 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ9 protein_id gnl|my_center|LOCUS_10680 1927 1043 gene locus_tag LOCUS_10690 gene rsmA 1927 1043 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_10690 >Feature sequence304 61 765 gene locus_tag LOCUS_10700 61 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089781.1 protein_id gnl|my_center|LOCUS_10700 <2534 847 gene locus_tag LOCUS_10710 <2534 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206955.1:peptidase M16 >Feature sequence305 797 366 gene locus_tag LOCUS_10720 797 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1122 1940 gene locus_tag LOCUS_10730 1122 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence306 2247 1348 gene locus_tag LOCUS_10740 gene corC 2247 1348 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence307 <1 1565 gene locus_tag LOCUS_10750 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975944.1:nitrate reductase >Feature sequence308 762 25 gene locus_tag LOCUS_10760 gene algR 762 25 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_10760 2211 1033 gene locus_tag LOCUS_10770 2211 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence309 1615 293 gene locus_tag LOCUS_10780 1615 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence310 <1 1761 gene locus_tag LOCUS_10790 <1 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KK17:DNA topoisomerase 4 subunit A 1984 2349 gene locus_tag LOCUS_10800 1984 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence311 733 368 gene locus_tag LOCUS_10810 733 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1488 835 gene locus_tag LOCUS_10820 gene tpm 1488 835 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_10820 2326 1511 gene locus_tag LOCUS_10830 2326 1511 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206444.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence312 <1 943 gene locus_tag LOCUS_10840 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CK15:pseudouridine synthase 1455 1012 gene locus_tag LOCUS_10850 1455 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 <2487 1479 gene locus_tag LOCUS_10860 <2487 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087057.1:acetylhydrolase >Feature sequence313 1075 188 gene locus_tag LOCUS_10870 gene galU 1075 188 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGG5 protein_id gnl|my_center|LOCUS_10870 2191 1289 gene locus_tag LOCUS_10880 gene sucD 2191 1289 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHF4 protein_id gnl|my_center|LOCUS_10880 >Feature sequence314 1802 180 gene locus_tag LOCUS_10890 gene gpmI 1802 180 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK43 protein_id gnl|my_center|LOCUS_10890 >Feature sequence315 1165 1554 gene locus_tag LOCUS_10900 1165 1554 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_10900 1835 1590 gene locus_tag LOCUS_10910 1835 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence316 128 619 gene locus_tag LOCUS_10920 128 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1158 751 gene locus_tag LOCUS_10930 1158 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 protein_id gnl|my_center|LOCUS_10930 1427 2125 gene locus_tag LOCUS_10940 1427 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112747.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence317 277 202 gene locus_tag LOCUS_t00130 277 202 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 388 313 gene locus_tag LOCUS_t00140 388 313 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 593 1219 gene locus_tag LOCUS_10950 593 1219 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence318 >Feature sequence319 805 257 gene locus_tag LOCUS_10960 805 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1373 846 gene locus_tag LOCUS_10970 1373 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2353 1385 gene locus_tag LOCUS_10980 gene rarD-1 2353 1385 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763735.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence320 <1 878 gene locus_tag LOCUS_10990 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950993.1:two-component sensor histidine kinase >Feature sequence321 983 1702 gene locus_tag LOCUS_11000 983 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence322 1893 427 gene locus_tag LOCUS_11010 gene miaB 1893 427 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX9 protein_id gnl|my_center|LOCUS_11010 >Feature sequence323 1344 544 gene locus_tag LOCUS_11020 gene soj 1344 544 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_11020 2096 1449 gene locus_tag LOCUS_11030 gene gidB 2096 1449 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB5 protein_id gnl|my_center|LOCUS_11030 >Feature sequence324 1249 815 gene locus_tag LOCUS_11040 1249 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence325 >Feature sequence326 2424 286 gene locus_tag LOCUS_11050 gene clpA 2424 286 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679937.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence327 1209 418 gene locus_tag LOCUS_11060 1209 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 <2418 1533 gene locus_tag LOCUS_11070 <2418 1533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207719.1:lytic transglycosylase >Feature sequence328 2040 442 gene locus_tag LOCUS_11080 gene glpK 2040 442 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MA83 protein_id gnl|my_center|LOCUS_11080 >Feature sequence329 <1 549 gene locus_tag LOCUS_11090 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGF2:fumarate hydratase class II 1379 681 gene locus_tag LOCUS_11100 1379 681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 protein_id gnl|my_center|LOCUS_11100 2207 1389 gene locus_tag LOCUS_11110 2207 1389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence330 <1 569 gene locus_tag LOCUS_11120 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPK2:4-hydroxythreonine-4-phosphate dehydrogenase 1448 636 gene locus_tag LOCUS_11130 gene nlpD 1448 636 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_11130 <2401 1724 gene locus_tag LOCUS_11140 <2401 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207111.1:MFS transporter >Feature sequence331 1270 671 gene locus_tag LOCUS_11150 1270 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2231 1254 gene locus_tag LOCUS_11160 gene fbp 2231 1254 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL60 protein_id gnl|my_center|LOCUS_11160 >Feature sequence332 3 872 gene locus_tag LOCUS_11170 3 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1090 1413 gene locus_tag LOCUS_11180 1090 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1480 1935 gene locus_tag LOCUS_11190 1480 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence333 75 824 gene locus_tag LOCUS_11200 gene etfB 75 824 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_11200 908 1840 gene locus_tag LOCUS_11210 gene etfA 908 1840 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_11210 >Feature sequence334 <2382 1605 gene locus_tag LOCUS_11220 <2382 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JMI5:cytidylate kinase >Feature sequence335 >Feature sequence336 1523 153 gene locus_tag LOCUS_11230 gene gor 1523 153 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43783 protein_id gnl|my_center|LOCUS_11230 >Feature sequence337 <1 650 gene locus_tag LOCUS_11240 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207313.1:protease SohB 744 1406 gene locus_tag LOCUS_11250 744 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020320.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence338 <1 570 gene locus_tag LOCUS_11260 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFW5:protein RecA 676 1308 gene locus_tag LOCUS_11270 gene recX 676 1308 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW6 protein_id gnl|my_center|LOCUS_11270 <2353 1317 gene locus_tag LOCUS_11280 <2353 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225284.1:sulfate ABC transporter substrate-binding protein >Feature sequence339 1896 1114 gene locus_tag LOCUS_11290 gene mtgA 1896 1114 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU7 protein_id gnl|my_center|LOCUS_11290 1990 2277 gene locus_tag LOCUS_11300 1990 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence340 >Feature sequence341 1242 454 gene locus_tag LOCUS_11310 gene hemD 1242 454 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_11310 2247 1264 gene locus_tag LOCUS_11320 gene hemC 2247 1264 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_11320 >Feature sequence342 782 54 gene locus_tag LOCUS_11330 gene pyrH 782 54 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD6 protein_id gnl|my_center|LOCUS_11330 1348 1004 gene locus_tag LOCUS_11340 1348 1004 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720718.1 protein_id gnl|my_center|LOCUS_11340 <2343 1363 gene locus_tag LOCUS_11350 <2343 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGD7:ribosomal protein S12 methylthiotransferase RimO >Feature sequence343 <1 730 gene locus_tag LOCUS_11360 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207471.1:sodium:proton antiporter 1968 790 gene locus_tag LOCUS_11370 gene yqhD 1968 790 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074098.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence344 1520 234 gene locus_tag LOCUS_11380 gene rarA 1520 234 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence345 1035 823 gene locus_tag LOCUS_11390 1035 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1353 1772 gene locus_tag LOCUS_11400 1353 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 <2336 1773 gene locus_tag LOCUS_11410 <2336 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KK01:UPF0313 protein >Feature sequence346 822 58 gene locus_tag LOCUS_11420 gene vII 822 58 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_11420 <2326 1586 gene locus_tag LOCUS_11430 <2326 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPJ5:GTPase HflX >Feature sequence347 1867 218 gene locus_tag LOCUS_11440 gene oprM 1867 218 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence348 962 887 gene locus_tag LOCUS_t00150 962 887 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1161 1086 gene locus_tag LOCUS_t00160 1161 1086 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2166 1261 gene locus_tag LOCUS_11450 gene ispE 2166 1261 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_11450 >Feature sequence349 128 688 gene locus_tag LOCUS_11460 128 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 842 1708 gene locus_tag LOCUS_11470 gene thiL 842 1708 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_11470 1723 2301 gene locus_tag LOCUS_11480 gene pgpA 1723 2301 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX8 protein_id gnl|my_center|LOCUS_11480 >Feature sequence350 467 763 gene locus_tag LOCUS_11490 gene himD 467 763 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_11490 926 1285 gene locus_tag LOCUS_11500 926 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1327 2064 gene locus_tag LOCUS_11510 gene pyrF 1327 2064 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_11510 >Feature sequence351 49 714 gene locus_tag LOCUS_11520 49 714 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence352 798 43 gene locus_tag LOCUS_11530 gene lgtE 798 43 CDS product lacto-N-neotetraose biosynthesis glycosyltransferase LgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51117 protein_id gnl|my_center|LOCUS_11530 1914 817 gene locus_tag LOCUS_11540 1914 817 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence353 >Feature sequence354 1619 468 gene locus_tag LOCUS_11550 1619 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence355 975 1952 gene locus_tag LOCUS_11560 gene tesB 975 1952 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence356 <1 1422 gene locus_tag LOCUS_11570 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895504.1:zinc protease >Feature sequence357 <1 1807 gene locus_tag LOCUS_11580 <1 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KEX4:chromosome partition protein Smc >Feature sequence358 2273 753 gene locus_tag LOCUS_11590 gene emrB 2273 753 CDS product multidrug efflux MFS transporter subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208746.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence359 <1 1695 gene locus_tag LOCUS_11600 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207039.1:DNA polymerase III subunit gamma/tau >Feature sequence360 550 1758 gene locus_tag LOCUS_11610 gene ssuD 550 1758 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence361 291 67 gene locus_tag LOCUS_11620 291 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1530 295 gene locus_tag LOCUS_11630 gene rtcB 1530 295 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA2 protein_id gnl|my_center|LOCUS_11630 >Feature sequence362 111 374 gene locus_tag LOCUS_11640 gene moaD 111 374 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_11640 412 903 gene locus_tag LOCUS_11650 gene moaE 412 903 CDS product molybdopterin-converting factor chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_11650 944 1681 gene locus_tag LOCUS_11660 944 1681 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Z3 protein_id gnl|my_center|LOCUS_11660 >Feature sequence363 2196 1588 gene locus_tag LOCUS_11670 2196 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence364 786 91 gene locus_tag LOCUS_11680 786 91 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217107.1 protein_id gnl|my_center|LOCUS_11680 <2236 1062 gene locus_tag LOCUS_11690 <2236 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL47:phosphoribosylformylglycinamidine synthase >Feature sequence365 1110 553 gene locus_tag LOCUS_11700 1110 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2227 1178 gene locus_tag LOCUS_11710 2227 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence366 <1 982 gene locus_tag LOCUS_11720 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMT8:ketol-acid reductoisomerase (NADP(+)) 1131 1670 gene locus_tag LOCUS_11730 1131 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1882 2094 gene locus_tag LOCUS_11740 gene cspA 1882 2094 CDS product cold shock-like protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KN00 protein_id gnl|my_center|LOCUS_11740 >Feature sequence367 1051 2097 gene locus_tag LOCUS_11750 gene purM 1051 2097 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_11750 >Feature sequence368 1468 728 gene locus_tag LOCUS_11760 1468 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 <2198 1575 gene locus_tag LOCUS_11770 <2198 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZZ6:ammonium transporter >Feature sequence369 974 627 gene locus_tag LOCUS_11780 974 627 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_11780 1653 991 gene locus_tag LOCUS_11790 gene hisG 1653 991 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_11790 2197 1667 gene locus_tag LOCUS_11800 2197 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence370 <1 1515 gene locus_tag LOCUS_11810 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038080.1:lipase >Feature sequence371 <1 624 gene locus_tag LOCUS_11820 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088608.1:membrane protein 899 744 gene locus_tag LOCUS_11830 899 744 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI32 protein_id gnl|my_center|LOCUS_11830 1531 2022 gene locus_tag LOCUS_11840 1531 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence372 <1 748 gene locus_tag LOCUS_11850 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205973.1:DNA translocase FtsK 1187 822 gene locus_tag LOCUS_11860 1187 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208092.1 protein_id gnl|my_center|LOCUS_11860 <2178 1261 gene locus_tag LOCUS_11870 <2178 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJB3:D-amino acid dehydrogenase >Feature sequence373 >Feature sequence374 <1 1136 gene locus_tag LOCUS_11880 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207110.1:outer membrane protein assembly factor >Feature sequence375 996 694 gene locus_tag LOCUS_11890 996 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1638 1069 gene locus_tag LOCUS_11900 1638 1069 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104935.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence376 >Feature sequence377 <1 950 gene locus_tag LOCUS_11910 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113994.1:aminodeoxychorismate lyase >Feature sequence378 1331 222 gene locus_tag LOCUS_11920 gene murB 1331 222 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9J9 protein_id gnl|my_center|LOCUS_11920 1885 1457 gene locus_tag LOCUS_11930 gene hslR 1885 1457 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW4 protein_id gnl|my_center|LOCUS_11930 >Feature sequence379 21 449 gene locus_tag LOCUS_11940 21 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 505 1785 gene locus_tag LOCUS_11950 505 1785 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence380 >Feature sequence381 <1 830 gene locus_tag LOCUS_11960 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224963.1:membrane protein 1053 1643 gene locus_tag LOCUS_11970 gene blc 1053 1643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770558.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence382 1422 682 gene locus_tag LOCUS_11980 1422 682 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence383 <1 1139 gene locus_tag LOCUS_11990 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706825.1:thiol reductant ABC exporter subunit CydD >Feature sequence384 1 1158 gene locus_tag LOCUS_12000 1 1158 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215509.1 protein_id gnl|my_center|LOCUS_12000 1754 1296 gene locus_tag LOCUS_12010 1754 1296 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence385 535 1440 gene locus_tag LOCUS_12020 535 1440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195284.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence386 362 1090 gene locus_tag LOCUS_12030 gene fabG 362 1090 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_12030 1274 1516 gene locus_tag LOCUS_12040 gene acpP 1274 1516 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ5 protein_id gnl|my_center|LOCUS_12040 2082 1588 gene locus_tag LOCUS_12050 2082 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence387 120 1361 gene locus_tag LOCUS_12060 120 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1391 1891 gene locus_tag LOCUS_12070 1391 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence388 138 1136 gene locus_tag LOCUS_12080 138 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence389 1292 699 gene locus_tag LOCUS_12090 1292 699 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_12090 2074 1565 gene locus_tag LOCUS_12100 2074 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence390 920 1702 gene locus_tag LOCUS_12110 920 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12110 >Feature sequence391 <1 1103 gene locus_tag LOCUS_12120 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705186.1:c-type cytochrome biogenesis protein CcmI 1090 1665 gene locus_tag LOCUS_12130 gene dsbE 1090 1665 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence392 1819 941 gene locus_tag LOCUS_12140 gene atpG 1819 941 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG8 protein_id gnl|my_center|LOCUS_12140 >Feature sequence393 927 52 gene locus_tag LOCUS_12150 gene atpB 927 52 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_12150 1796 1395 gene locus_tag LOCUS_12160 1796 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence394 <1 574 gene locus_tag LOCUS_12170 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z314:vitamin B12 transporter BtuB >Feature sequence395 525 749 gene locus_tag LOCUS_12180 525 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 protein_id gnl|my_center|LOCUS_12180 <2053 897 gene locus_tag LOCUS_12190 <2053 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225706.1:hydrogenase expression protein >Feature sequence396 309 175 gene locus_tag LOCUS_12200 309 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 <2044 329 gene locus_tag LOCUS_12210 <2044 329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037005.1:ferrous iron transporter B >Feature sequence397 219 776 gene locus_tag LOCUS_12220 gene rimM 219 776 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_12220 903 1673 gene locus_tag LOCUS_12230 gene trmD 903 1673 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence398 812 303 gene locus_tag LOCUS_12240 gene rplJ 812 303 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44350 protein_id gnl|my_center|LOCUS_12240 1800 1102 gene locus_tag LOCUS_12250 gene rplA 1800 1102 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP8 protein_id gnl|my_center|LOCUS_12250 >Feature sequence399 >Feature sequence400 512 1930 gene locus_tag LOCUS_12260 gene leuC 512 1930 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_12260 >Feature sequence401 <2018 709 gene locus_tag LOCUS_12270 <2018 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNY1:glutamate-ammonia-ligase adenylyltransferase >Feature sequence402 <1 1014 gene locus_tag LOCUS_12280 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208227.1:type IV-A pilus assembly ATPase PilB >Feature sequence403 1485 403 gene locus_tag LOCUS_12290 gene pyrC 1485 403 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI3 protein_id gnl|my_center|LOCUS_12290 >Feature sequence404 1446 1766 gene locus_tag LOCUS_12300 1446 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence405 386 1513 gene locus_tag LOCUS_12310 gene queG 386 1513 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM72 protein_id gnl|my_center|LOCUS_12310 >Feature sequence406 243 1067 gene locus_tag LOCUS_12320 243 1067 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence407 <1 545 gene locus_tag LOCUS_12330 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN35:cell shape-determining protein MreC 557 1042 gene locus_tag LOCUS_12340 557 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1061 1690 gene locus_tag LOCUS_12350 1061 1690 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT2 protein_id gnl|my_center|LOCUS_12350 >Feature sequence408 3 554 gene locus_tag LOCUS_12360 3 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 603 1901 gene locus_tag LOCUS_12370 gene hisS 603 1901 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP9 protein_id gnl|my_center|LOCUS_12370 >Feature sequence409 1296 364 gene locus_tag LOCUS_12380 gene potB 1296 364 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261915.1 protein_id gnl|my_center|LOCUS_12380 <1975 1289 gene locus_tag LOCUS_12390 <1975 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FRF6:spermidine/putrescine import ATP-binding protein PotA >Feature sequence410 <1 1220 gene locus_tag LOCUS_12400 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KES6:NADH-quinone oxidoreductase subunit C/D 1234 1743 gene locus_tag LOCUS_12410 gene nuoE 1234 1743 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence411 1139 405 gene locus_tag LOCUS_12420 1139 405 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_12420 1653 1273 gene locus_tag LOCUS_12430 gene gcvH 1653 1273 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0L7 protein_id gnl|my_center|LOCUS_12430 >Feature sequence412 <1 1623 gene locus_tag LOCUS_12440 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNG7:RNA polymerase sigma-54 factor >Feature sequence413 945 484 gene locus_tag LOCUS_12450 945 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1860 1000 gene locus_tag LOCUS_12460 1860 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence414 <1 1029 gene locus_tag LOCUS_12470 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN23:O-succinylhomoserine sulfhydrylase 1905 1129 gene locus_tag LOCUS_12480 1905 1129 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence415 631 419 gene locus_tag LOCUS_12490 631 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence416 <1939 390 gene locus_tag LOCUS_12500 <1939 390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPC7:tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC >Feature sequence417 1798 875 gene locus_tag LOCUS_12510 gene cysM 1798 875 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_12510 >Feature sequence418 >Feature sequence419 1123 56 gene locus_tag LOCUS_12520 gene argC 1123 56 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR4 protein_id gnl|my_center|LOCUS_12520 1927 1145 gene locus_tag LOCUS_12530 1927 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence420 652 338 gene locus_tag LOCUS_12540 652 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1470 760 gene locus_tag LOCUS_12550 gene queC 1470 760 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL37 protein_id gnl|my_center|LOCUS_12550 >Feature sequence421 671 1594 gene locus_tag LOCUS_12560 gene trpH 671 1594 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence422 >Feature sequence423 1704 841 gene locus_tag LOCUS_12570 1704 841 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence424 994 1890 gene locus_tag LOCUS_12580 994 1890 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980864.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence425 982 488 gene locus_tag LOCUS_12590 982 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1448 1086 gene locus_tag LOCUS_12600 1448 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence426 >Feature sequence427 1112 768 gene locus_tag LOCUS_12610 1112 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 >Feature sequence428 <1880 1042 gene locus_tag LOCUS_12620 <1880 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000884372.1:cytochrome bd-I ubiquinol oxidase subunit I >Feature sequence429 >Feature sequence430 <1 1474 gene locus_tag LOCUS_12630 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMT1:macrolide export ATP-binding/permease protein MacB 1736 1811 gene locus_tag LOCUS_t00170 1736 1811 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence431 252 1304 gene locus_tag LOCUS_12640 gene miaA 252 1304 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH83 protein_id gnl|my_center|LOCUS_12640 >Feature sequence432 >Feature sequence433 >Feature sequence434 65 1036 gene locus_tag LOCUS_12650 65 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence435 988 203 gene locus_tag LOCUS_12660 gene map 988 203 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ77 protein_id gnl|my_center|LOCUS_12660 1149 1619 gene locus_tag LOCUS_12670 1149 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence436 570 1085 gene locus_tag LOCUS_12680 570 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence437 382 110 gene locus_tag LOCUS_12690 gene hup 382 110 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_12690 831 1493 gene locus_tag LOCUS_12700 831 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence438 223 1488 gene locus_tag LOCUS_12710 223 1488 CDS product putative phospholipase A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0U7 protein_id gnl|my_center|LOCUS_12710 >Feature sequence439 <1822 930 gene locus_tag LOCUS_12720 <1822 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207473.1:membrane protein >Feature sequence440 >Feature sequence441 71 790 gene locus_tag LOCUS_12730 71 790 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_12730 1507 848 gene locus_tag LOCUS_12740 gene pdxH 1507 848 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX20 protein_id gnl|my_center|LOCUS_12740 >Feature sequence442 <1 568 gene locus_tag LOCUS_12750 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084137.1:long-chain-fatty-acid--CoA ligase <1811 823 gene locus_tag LOCUS_12760 <1811 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207424.1:oxidoreductase molybdopterin >Feature sequence443 >Feature sequence444 377 90 gene locus_tag LOCUS_12770 377 90 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU36 protein_id gnl|my_center|LOCUS_12770 743 399 gene locus_tag LOCUS_12780 743 399 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021110.1 protein_id gnl|my_center|LOCUS_12780 <1809 745 gene locus_tag LOCUS_12790 <1809 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKM9:argininosuccinate lyase >Feature sequence445 <1 1626 gene locus_tag LOCUS_12800 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196309.1:bifunctional metallophosphatase/5'-nucleotidase >Feature sequence446 >Feature sequence447 <1 642 gene locus_tag LOCUS_12810 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMT5:leucine--tRNA ligase 774 1340 gene locus_tag LOCUS_12820 gene rlpB 774 1340 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT4 protein_id gnl|my_center|LOCUS_12820 >Feature sequence448 256 813 gene locus_tag LOCUS_12830 256 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 925 1212 gene locus_tag LOCUS_12840 925 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence449 828 565 gene locus_tag LOCUS_12850 828 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <1794 1064 gene locus_tag LOCUS_12860 <1794 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RXI8:malate dehydrogenase >Feature sequence450 1017 1583 gene locus_tag LOCUS_12870 1017 1583 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence451 58 837 gene locus_tag LOCUS_12880 gene ssuB1 58 837 CDS product aliphatic sulfonates import ATP-binding protein SsuB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYG4 protein_id gnl|my_center|LOCUS_12880 >Feature sequence452 1237 728 gene locus_tag LOCUS_12890 1237 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence453 372 1358 gene locus_tag LOCUS_12900 gene thrB 372 1358 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_12900 >Feature sequence454 <1 835 gene locus_tag LOCUS_12910 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207047.1:acetyl-CoA acetyltransferase 1200 910 gene locus_tag LOCUS_12920 1200 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence455 1334 222 gene locus_tag LOCUS_12930 1334 222 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence456 688 416 gene locus_tag LOCUS_12940 688 416 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335188.1 protein_id gnl|my_center|LOCUS_12940 <1745 840 gene locus_tag LOCUS_12950 <1745 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKS7:UvrABC system protein C >Feature sequence457 <1739 585 gene locus_tag LOCUS_12960 <1739 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMM8:acetate kinase >Feature sequence458 >Feature sequence459 9 1268 gene locus_tag LOCUS_12970 9 1268 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence460 1091 141 gene locus_tag LOCUS_12980 1091 141 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198247.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence461 1424 564 gene locus_tag LOCUS_12990 gene purU1 1424 564 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM37 protein_id gnl|my_center|LOCUS_12990 >Feature sequence462 >Feature sequence463 1149 523 gene locus_tag LOCUS_13000 gene trpG 1149 523 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207264.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence464 <1 655 gene locus_tag LOCUS_13010 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI77:adenylosuccinate synthetase 712 1440 gene locus_tag LOCUS_13020 712 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence465 >Feature sequence466 <1 525 gene locus_tag LOCUS_13030 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y7L8:S-formylglutathione hydrolase >Feature sequence467 >Feature sequence468 <1 1503 gene locus_tag LOCUS_13040 <1 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002120008.1:NADH-quinone oxidoreductase subunit L >Feature sequence469 311 1012 gene locus_tag LOCUS_13050 gene bioD 311 1012 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CU9 protein_id gnl|my_center|LOCUS_13050 1314 1550 gene locus_tag LOCUS_13060 gene rpmB 1314 1550 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44364 protein_id gnl|my_center|LOCUS_13060 >Feature sequence470 1197 373 gene locus_tag LOCUS_13070 1197 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_13070 1565 1640 gene locus_tag LOCUS_t00180 1565 1640 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence471 >Feature sequence472 3 1475 gene locus_tag LOCUS_13080 3 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence473 <1693 745 gene locus_tag LOCUS_13090 <1693 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFT1:signal recognition particle receptor FtsY >Feature sequence474 1150 518 gene locus_tag LOCUS_13100 gene hscB 1150 518 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDW4 protein_id gnl|my_center|LOCUS_13100 1549 1208 gene locus_tag LOCUS_13110 1549 1208 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_13110 >Feature sequence475 <1 1032 gene locus_tag LOCUS_13120 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHI5:argininosuccinate synthase 1625 1086 gene locus_tag LOCUS_13130 1625 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence476 >Feature sequence477 <1 802 gene locus_tag LOCUS_13140 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807247.1:MBL fold metallo-hydrolase 821 1243 gene locus_tag LOCUS_13150 821 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence478 348 1451 gene locus_tag LOCUS_13160 gene serC 348 1451 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ94 protein_id gnl|my_center|LOCUS_13160 >Feature sequence479 339 428 gene locus_tag LOCUS_t00190 339 428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 532 608 gene locus_tag LOCUS_t00200 532 608 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 932 1558 gene locus_tag LOCUS_13170 932 1558 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence480 >Feature sequence481 697 95 gene locus_tag LOCUS_13180 gene nodS 697 95 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206244.1 protein_id gnl|my_center|LOCUS_13180 1511 690 gene locus_tag LOCUS_13190 1511 690 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206243.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence482 <1 540 gene locus_tag LOCUS_13200 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KLG5:alanine racemase >Feature sequence483 >Feature sequence484 <1641 498 gene locus_tag LOCUS_13210 <1641 498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206207.1:ATP-dependent helicase >Feature sequence485 >Feature sequence486 111 1112 gene locus_tag LOCUS_13220 gene lst 111 1112 CDS product CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q48211 protein_id gnl|my_center|LOCUS_13220 >Feature sequence487 1 384 gene locus_tag LOCUS_13230 gene rpsG 1 384 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ6 protein_id gnl|my_center|LOCUS_13230 >Feature sequence488 1251 619 gene locus_tag LOCUS_13240 1251 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence489 <1 1096 gene locus_tag LOCUS_13250 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKJ0:glutamate 5-kinase >Feature sequence490 <1 1015 gene locus_tag LOCUS_13260 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005067989.1:ATP-dependent protease 1571 1035 gene locus_tag LOCUS_13270 1571 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence491 444 1184 gene locus_tag LOCUS_13280 gene ispU 444 1184 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD4 protein_id gnl|my_center|LOCUS_13280 >Feature sequence492 688 1050 gene locus_tag LOCUS_13290 688 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence493 >Feature sequence494 <1 835 gene locus_tag LOCUS_13300 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206089.1:membrane protein >Feature sequence495 <1 1146 gene locus_tag LOCUS_13310 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464702.1:membrane protein >Feature sequence496 908 156 gene locus_tag LOCUS_13320 908 156 CDS product putative NADP-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45200 protein_id gnl|my_center|LOCUS_13320 1389 1009 gene locus_tag LOCUS_13330 1389 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence497 >Feature sequence498 441 1145 gene locus_tag LOCUS_13340 441 1145 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence499 586 1119 gene locus_tag LOCUS_13350 gene ppa 586 1119 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G4 protein_id gnl|my_center|LOCUS_13350 >Feature sequence500 132 48 gene locus_tag LOCUS_t00210 132 48 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1242 244 gene locus_tag LOCUS_13360 1242 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence501 4 1548 gene locus_tag LOCUS_13370 4 1548 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence502 337 621 gene locus_tag LOCUS_13380 337 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980869.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence503 >Feature sequence504 1493 654 gene locus_tag LOCUS_13390 gene proC 1493 654 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_13390 >Feature sequence505 1017 463 gene locus_tag LOCUS_13400 1017 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence506 >Feature sequence507 69 233 gene locus_tag LOCUS_13410 69 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1132 368 gene locus_tag LOCUS_13420 1132 368 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence508 <1 743 gene locus_tag LOCUS_13430 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886857.1:mechanosensitive ion channel protein MscS >Feature sequence509 737 432 gene locus_tag LOCUS_13440 737 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1566 1075 gene locus_tag LOCUS_13450 1566 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence510 <1 555 gene locus_tag LOCUS_13460 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118253.1:DNA exonuclease 1057 614 gene locus_tag LOCUS_13470 1057 614 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence511 <1 526 gene locus_tag LOCUS_13480 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZUM5:leucyl/phenylalanyl-tRNA--protein transferase 550 1368 gene locus_tag LOCUS_13490 gene ate 550 1368 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK2 protein_id gnl|my_center|LOCUS_13490 1564 1361 gene locus_tag LOCUS_13500 1564 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence512 <1 1261 gene locus_tag LOCUS_13510 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005073697.1:helicase >Feature sequence513 1116 307 gene locus_tag LOCUS_13520 gene rnfB 1116 307 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence514 33 857 gene locus_tag LOCUS_13530 gene sanA 33 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207551.1 protein_id gnl|my_center|LOCUS_13530 1531 854 gene locus_tag LOCUS_13540 gene lolD 1531 854 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL76 protein_id gnl|my_center|LOCUS_13540 >Feature sequence515 >Feature sequence516 231 1175 gene locus_tag LOCUS_13550 gene ureD 231 1175 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX0 protein_id gnl|my_center|LOCUS_13550 1226 1528 gene locus_tag LOCUS_13560 gene ureA 1226 1528 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence517 <1 660 gene locus_tag LOCUS_13570 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121001.1:ATP-binding protein >Feature sequence518 <1 669 gene locus_tag LOCUS_13580 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNZ5:ribosomal RNA small subunit methyltransferase J 1164 739 gene locus_tag LOCUS_13590 1164 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence519 220 861 gene locus_tag LOCUS_13600 220 861 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_13600 932 1411 gene locus_tag LOCUS_13610 932 1411 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence520 <1535 231 gene locus_tag LOCUS_13620 <1535 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMQ2:GTPase Der >Feature sequence521 736 1245 gene locus_tag LOCUS_13630 gene ppiB-2 736 1245 CDS product peptidyl-prolyl cis-trans isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_011090.2 protein_id gnl|my_center|LOCUS_13630 >Feature sequence522 1067 492 gene locus_tag LOCUS_13640 1067 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence523 <1527 753 gene locus_tag LOCUS_13650 <1527 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNJ2:chorismate synthase >Feature sequence524 <1 1277 gene locus_tag LOCUS_13660 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI76:ATP phosphoribosyltransferase regulatory subunit >Feature sequence525 1366 407 gene locus_tag LOCUS_13670 gene ispA 1366 407 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence526 77 439 gene locus_tag LOCUS_13680 77 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence527 >Feature sequence528 >Feature sequence529 >Feature sequence530 <1513 440 gene locus_tag LOCUS_13690 <1513 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804387.1:multidrug resistance protein, MATE family >Feature sequence531 <1510 280 gene locus_tag LOCUS_13700 <1510 280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003702612.1:phospholipase D family protein >Feature sequence532 <1 604 gene locus_tag LOCUS_13710 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJX6:tRNA-specific 2-thiouridylase MnmA <1509 674 gene locus_tag LOCUS_13720 <1509 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230418.1:helicase >Feature sequence533 <1 569 gene locus_tag LOCUS_13730 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206521.1:serine acetyltransferase 1508 630 gene locus_tag LOCUS_13740 1508 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence534 <1508 385 gene locus_tag LOCUS_13750 <1508 385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLY0:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence535 665 87 gene locus_tag LOCUS_13760 665 87 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963525.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence536 359 1261 gene locus_tag LOCUS_13770 359 1261 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732985.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence537 504 1424 gene locus_tag LOCUS_13780 gene pssA 504 1424 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence538 705 157 gene locus_tag LOCUS_13790 gene lspA 705 157 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_13790 <1494 698 gene locus_tag LOCUS_13800 <1494 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIM4:isoleucine--tRNA ligase >Feature sequence539 1403 333 gene locus_tag LOCUS_13810 gene nadR 1403 333 CDS product bifunctional NAD biosynthesis protein NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44308 protein_id gnl|my_center|LOCUS_13810 >Feature sequence540 181 762 gene locus_tag LOCUS_13820 181 762 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence541 1075 233 gene locus_tag LOCUS_13830 gene dsbC 1075 233 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence542 950 57 gene locus_tag LOCUS_13840 950 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence543 >Feature sequence544 >Feature sequence545 >Feature sequence546 <1 828 gene locus_tag LOCUS_13850 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMX8:transcription-repair-coupling factor 898 1077 gene locus_tag LOCUS_13860 898 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence547 <1 1430 gene locus_tag LOCUS_13870 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207339.1:serine protease >Feature sequence548 <1 1030 gene locus_tag LOCUS_13880 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207388.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence549 >Feature sequence550 1296 34 gene locus_tag LOCUS_13890 gene nhaP 1296 34 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_13890 >Feature sequence551 >Feature sequence552 <1 1095 gene locus_tag LOCUS_13900 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963142.1:3-hydroxybutyryl-CoA dehydrogenase 1452 1135 gene locus_tag LOCUS_13910 1452 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence553 2 172 gene locus_tag LOCUS_13920 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 296 1159 gene locus_tag LOCUS_13930 gene kdsA 296 1159 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP9 protein_id gnl|my_center|LOCUS_13930 >Feature sequence554 >Feature sequence555 >Feature sequence556 >Feature sequence557 322 1026 gene locus_tag LOCUS_13940 322 1026 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence558 <1 1129 gene locus_tag LOCUS_13950 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206527.1:succinyldiaminopimelate transaminase >Feature sequence559 529 20 gene locus_tag LOCUS_13960 529 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364101.1 protein_id gnl|my_center|LOCUS_13960 <1433 581 gene locus_tag LOCUS_13970 <1433 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KND0:nucleotide-binding protein >Feature sequence560 <1431 213 gene locus_tag LOCUS_13980 <1431 213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207351.1:membrane protein >Feature sequence561 >Feature sequence562 30 815 gene locus_tag LOCUS_13990 30 815 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731935.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence563 553 629 gene locus_tag LOCUS_t00220 553 629 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence564 >Feature sequence565 >Feature sequence566 1316 246 gene locus_tag LOCUS_14000 gene tnpA 1316 246 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213218.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence567 >Feature sequence568 390 1214 gene locus_tag LOCUS_14010 390 1214 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence569 542 1054 gene locus_tag LOCUS_14020 542 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence570 200 847 gene locus_tag LOCUS_14030 gene metI 200 847 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069679.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence571 <1 519 gene locus_tag LOCUS_14040 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206536.1:methionine transporter >Feature sequence572 <1381 546 gene locus_tag LOCUS_14050 <1381 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116482.1:AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence573 769 1266 gene locus_tag LOCUS_14060 769 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence574 1150 644 gene locus_tag LOCUS_14070 gene rutF 1150 644 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence575 1 987 gene locus_tag LOCUS_14080 1 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence576 <1 592 gene locus_tag LOCUS_14090 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002113662.1:MoxR-like ATPase >Feature sequence577 442 1011 gene locus_tag LOCUS_14100 442 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence578 782 222 gene locus_tag LOCUS_14110 gene regR 782 222 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036952.1 protein_id gnl|my_center|LOCUS_14110 <1361 792 gene locus_tag LOCUS_14120 <1361 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545659.1:sensor histidine kinase >Feature sequence579 >Feature sequence580 <1 718 gene locus_tag LOCUS_14130 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPF3:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence581 >Feature sequence582 127 1137 gene locus_tag LOCUS_14140 gene add 127 1137 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_14140 >Feature sequence583 >Feature sequence584 1185 487 gene locus_tag LOCUS_14150 1185 487 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence585 >Feature sequence586 >Feature sequence587 >Feature sequence588 419 1252 gene locus_tag LOCUS_14160 gene psd 419 1252 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_14160 >Feature sequence589 <1 551 gene locus_tag LOCUS_14170 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KG25:ribosomal RNA small subunit methyltransferase H 735 1241 gene locus_tag LOCUS_14180 735 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence590 >Feature sequence591 >Feature sequence592 475 77 gene locus_tag LOCUS_14190 475 77 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTZ2 protein_id gnl|my_center|LOCUS_14190 <1305 478 gene locus_tag LOCUS_14200 <1305 478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000056892.1:lactate dehydrogenase >Feature sequence593 167 92 gene locus_tag LOCUS_t00230 167 92 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1185 319 gene locus_tag LOCUS_14210 1185 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence594 >Feature sequence595 >Feature sequence596 >Feature sequence597 >Feature sequence598 129 884 gene locus_tag LOCUS_14220 gene recO 129 884 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH79 protein_id gnl|my_center|LOCUS_14220 >Feature sequence599 786 139 gene locus_tag LOCUS_14230 786 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence600 >Feature sequence601 1183 449 gene locus_tag LOCUS_14240 1183 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence602 >Feature sequence603 >Feature sequence604 >Feature sequence605 <1 1075 gene locus_tag LOCUS_14250 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974400.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence606 81 1049 gene locus_tag LOCUS_14260 gene kdsD 81 1049 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX3 protein_id gnl|my_center|LOCUS_14260 >Feature sequence607 1181 312 gene locus_tag LOCUS_14270 gene pstA 1181 312 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCM6 protein_id gnl|my_center|LOCUS_14270 >Feature sequence608 >Feature sequence609 196 663 gene locus_tag LOCUS_14280 gene tolR 196 663 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence610 >Feature sequence611 <1265 580 gene locus_tag LOCUS_14290 <1265 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKQ3:DNA-directed RNA polymerase subunit beta' >Feature sequence612 <1 859 gene locus_tag LOCUS_14300 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHB8:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence613 >Feature sequence614 713 39 gene locus_tag LOCUS_14310 713 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 <1249 722 gene locus_tag LOCUS_14320 <1249 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005070756.1:acyl-CoA thioesterase >Feature sequence615 >Feature sequence616 >Feature sequence617 <1246 541 gene locus_tag LOCUS_14330 <1246 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001156530.1:UDP-glucose 4-epimerase >Feature sequence618 654 271 gene locus_tag LOCUS_14340 654 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1096 797 gene locus_tag LOCUS_14350 1096 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence619 >Feature sequence620 464 1207 gene locus_tag LOCUS_14360 464 1207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence621 460 1032 gene locus_tag LOCUS_14370 460 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence622 26 1174 gene locus_tag LOCUS_14380 gene lldD 26 1174 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS9 protein_id gnl|my_center|LOCUS_14380 >Feature sequence623 >Feature sequence624 <1221 603 gene locus_tag LOCUS_14390 <1221 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208413.1:type II secretion system protein GspE >Feature sequence625 >Feature sequence626 >Feature sequence627 1152 502 gene locus_tag LOCUS_14400 1152 502 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691360.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence628 >Feature sequence629 >Feature sequence630 >Feature sequence631 <1209 253 gene locus_tag LOCUS_14410 <1209 253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208422.1:p-aminobenzoate synthetase >Feature sequence632 1 1044 gene locus_tag LOCUS_14420 gene sat 1 1044 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_14420 >Feature sequence633 230 871 gene locus_tag LOCUS_14430 230 871 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence634 >Feature sequence635 <1198 322 gene locus_tag LOCUS_14440 <1198 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957353.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence636 1085 714 gene locus_tag LOCUS_14450 1085 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602867.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence637 >Feature sequence638 >Feature sequence639 >Feature sequence640 633 121 gene locus_tag LOCUS_14460 633 121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence641 >Feature sequence642 1065 64 gene locus_tag LOCUS_14470 1065 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637056.2 protein_id gnl|my_center|LOCUS_14470 >Feature sequence643 >Feature sequence644 322 1053 gene locus_tag LOCUS_14480 322 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14480 >Feature sequence645 >Feature sequence646 >Feature sequence647 >Feature sequence648 539 913 gene locus_tag LOCUS_14490 gene rpsL 539 913 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFJ5 protein_id gnl|my_center|LOCUS_14490 >Feature sequence649 >Feature sequence650 <1161 625 gene locus_tag LOCUS_14500 <1161 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VU03:protein TolB >Feature sequence651 >Feature sequence652 <1 671 gene locus_tag LOCUS_14510 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM17:lipid A biosynthesis lauroyltransferase >Feature sequence653 >Feature sequence654 171 1007 gene locus_tag LOCUS_14520 gene uppP2 171 1007 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_14520 >Feature sequence655 <1153 508 gene locus_tag LOCUS_14530 <1153 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224746.1:oligopeptide transporter, OPT family protein >Feature sequence656 >Feature sequence657 >Feature sequence658 >Feature sequence659 >Feature sequence660 1147 80 gene locus_tag LOCUS_14540 1147 80 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence661 >Feature sequence662 >Feature sequence663 <1 901 gene locus_tag LOCUS_14550 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHQ6:aconitate hydratase B >Feature sequence664 <1136 308 gene locus_tag LOCUS_14560 <1136 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205943.1:hydroxymethylpyrimidine/phosphomethylpyrimidine kinase >Feature sequence665 610 1011 gene locus_tag LOCUS_14570 610 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence666 >Feature sequence667 509 162 gene locus_tag LOCUS_14580 gene pilZ 509 162 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_14580 <1133 603 gene locus_tag LOCUS_14590 <1133 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206594.1:DNA polymerase III subunit delta' >Feature sequence668 <1130 87 gene locus_tag LOCUS_14600 <1130 87 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389104.1:cation transporter >Feature sequence669 1116 436 gene locus_tag LOCUS_14610 gene lipB 1116 436 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF5 protein_id gnl|my_center|LOCUS_14610 >Feature sequence670 >Feature sequence671 810 406 gene locus_tag LOCUS_14620 810 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence672 >Feature sequence673 <1 973 gene locus_tag LOCUS_14630 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIJ6:dihydroorotate dehydrogenase (quinone) >Feature sequence674 >Feature sequence675 <1 1072 gene locus_tag LOCUS_14640 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000597238.1:SAV1866 family putative multidrug efflux ABC transporter >Feature sequence676 <1 578 gene locus_tag LOCUS_14650 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459714.1:GGDEF domain-containing protein <1106 587 gene locus_tag LOCUS_14660 <1106 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KGH7:tRNA pseudouridine synthase D >Feature sequence677 >Feature sequence678 <1104 485 gene locus_tag LOCUS_14670 <1104 485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJR5:anthranilate phosphoribosyltransferase >Feature sequence679 16 327 gene locus_tag LOCUS_14680 16 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence680 >Feature sequence681 >Feature sequence682 1030 92 gene locus_tag LOCUS_14690 gene comB 1030 92 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence683 >Feature sequence684 936 223 gene locus_tag LOCUS_14700 gene petC 936 223 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence685 <1 676 gene locus_tag LOCUS_14710 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706176.1:ribonucleotide-diphosphate reductase subunit beta 717 977 gene locus_tag LOCUS_14720 717 977 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence686 <1092 337 gene locus_tag LOCUS_14730 <1092 337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207571.1:pyrimidine utilization transport protein G >Feature sequence687 <1 990 gene locus_tag LOCUS_14740 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005172553.1:transporter >Feature sequence688 >Feature sequence689 >Feature sequence690 <1 966 gene locus_tag LOCUS_14750 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207223.1:type II secretion system protein E >Feature sequence691 >Feature sequence692 <1078 523 gene locus_tag LOCUS_14760 <1078 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM02:3-isopropylmalate dehydratase small subunit >Feature sequence693 <1 628 gene locus_tag LOCUS_14770 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P6E6:putative potassium transport system protein kup 894 700 gene locus_tag LOCUS_14780 894 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence694 1 678 gene locus_tag LOCUS_14790 1 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence695 >Feature sequence696 >Feature sequence697 >Feature sequence698 >Feature sequence699 >Feature sequence700 112 187 gene locus_tag LOCUS_t00240 112 187 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 261 728 gene locus_tag LOCUS_14800 gene secE 261 728 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKP5 protein_id gnl|my_center|LOCUS_14800 >Feature sequence701 >Feature sequence702 294 806 gene locus_tag LOCUS_14810 294 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence703 >Feature sequence704 772 302 gene locus_tag LOCUS_14820 gene atpF 772 302 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG5 protein_id gnl|my_center|LOCUS_14820 >Feature sequence705 >Feature sequence706 <1 514 gene locus_tag LOCUS_14830 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIK7:RNA polymerase sigma factor RpoH 520 888 gene locus_tag LOCUS_14840 520 888 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence707 <1038 495 gene locus_tag LOCUS_14850 <1038 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C7J2:phosphohexose mutases >Feature sequence708 >Feature sequence709 <1037 326 gene locus_tag LOCUS_14860 <1037 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092223.1:FMN-binding glutamate synthase family protein >Feature sequence710 <1 936 gene locus_tag LOCUS_14870 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O07084:cadmium, cobalt and zinc/H(+)-K(+) antiporter >Feature sequence711 <1 752 gene locus_tag LOCUS_14880 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLE7:primosomal protein N' >Feature sequence712 >Feature sequence713 >Feature sequence714 >Feature sequence715 >Feature sequence716 >Feature sequence717 >Feature sequence718 1017 364 gene locus_tag LOCUS_14890 1017 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence719 >Feature sequence720 <1 603 gene locus_tag LOCUS_14900 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLA3:23S rRNA (guanosine-2'-O-)-methyltransferase RlmB >Feature sequence721 >Feature sequence722 526 5 gene locus_tag LOCUS_14910 526 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence723