>Feature sequence001 2099 312 gene locus_tag LOCUS_00010 gene msbA 2099 312 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC0 protein_id gnl|my_center|LOCUS_00010 2602 2171 gene locus_tag LOCUS_00020 gene exbD 2602 2171 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_00020 3386 2673 gene locus_tag LOCUS_00030 3386 2673 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_00030 4630 3488 gene locus_tag LOCUS_00040 4630 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5514 4735 gene locus_tag LOCUS_00050 gene soj 5514 4735 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_00050 6502 5786 gene locus_tag LOCUS_00060 gene gidB 6502 5786 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB5 protein_id gnl|my_center|LOCUS_00060 6907 9642 gene locus_tag LOCUS_00070 gene ycbZ 6907 9642 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067989.1 protein_id gnl|my_center|LOCUS_00070 9785 10921 gene locus_tag LOCUS_00080 9785 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10959 11606 gene locus_tag LOCUS_00090 10959 11606 CDS product tellurium resistance protein TerZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888853.1 protein_id gnl|my_center|LOCUS_00090 12739 11756 gene locus_tag LOCUS_00100 gene kcnb2 12739 11756 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_00100 13170 12943 gene locus_tag LOCUS_00110 13170 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13552 14178 gene locus_tag LOCUS_00120 gene ompW 13552 14178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_00120 16049 14331 gene locus_tag LOCUS_00130 gene aceF 16049 14331 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB8 protein_id gnl|my_center|LOCUS_00130 18888 16078 gene locus_tag LOCUS_00140 gene aceE 18888 16078 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB9 protein_id gnl|my_center|LOCUS_00140 19893 22562 gene locus_tag LOCUS_00150 19893 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22856 25852 gene locus_tag LOCUS_00160 22856 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 26113 28185 gene locus_tag LOCUS_00170 26113 28185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 28702 29166 gene locus_tag LOCUS_00180 28702 29166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 29212 31227 gene locus_tag LOCUS_00190 29212 31227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 >Feature sequence002 1126 200 gene locus_tag LOCUS_00200 1126 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 1596 1892 gene locus_tag LOCUS_00210 1596 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 1919 2224 gene locus_tag LOCUS_00220 1919 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 2121 2321 gene locus_tag LOCUS_00230 2121 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2353 2895 gene locus_tag LOCUS_00240 2353 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 2987 3964 gene locus_tag LOCUS_00250 2987 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4281 5819 gene locus_tag LOCUS_00260 4281 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 5901 6965 gene locus_tag LOCUS_00270 5901 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 8113 7208 gene locus_tag LOCUS_00280 8113 7208 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_00280 8368 10074 gene locus_tag LOCUS_00290 8368 10074 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_00290 10071 11879 gene locus_tag LOCUS_00300 10071 11879 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HG0 protein_id gnl|my_center|LOCUS_00300 12206 13888 gene locus_tag LOCUS_00310 gene maeA 12206 13888 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHR8 protein_id gnl|my_center|LOCUS_00310 14591 15556 gene locus_tag LOCUS_00320 14591 15556 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974801.1 protein_id gnl|my_center|LOCUS_00320 15568 18084 gene locus_tag LOCUS_00330 15568 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_00330 18298 18107 gene locus_tag LOCUS_00340 18298 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 18815 18402 gene locus_tag LOCUS_00350 18815 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 19624 18956 gene locus_tag LOCUS_00360 19624 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 19899 19720 gene locus_tag LOCUS_00370 19899 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 20661 22937 gene locus_tag LOCUS_00380 20661 22937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 23766 23056 gene locus_tag LOCUS_00390 23766 23056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 24868 23750 gene locus_tag LOCUS_00400 24868 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 25826 24855 gene locus_tag LOCUS_00410 25826 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 26317 25919 gene locus_tag LOCUS_00420 26317 25919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 26583 26290 gene locus_tag LOCUS_00430 26583 26290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 27129 26611 gene locus_tag LOCUS_00440 27129 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 27932 27252 gene locus_tag LOCUS_00450 27932 27252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 28086 28328 gene locus_tag LOCUS_00460 28086 28328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 28394 28876 gene locus_tag LOCUS_00470 28394 28876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 28935 29603 gene locus_tag LOCUS_00480 28935 29603 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378807.1 protein_id gnl|my_center|LOCUS_00480 29603 30958 gene locus_tag LOCUS_00490 29603 30958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 30955 31356 gene locus_tag LOCUS_00500 30955 31356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 31397 31873 gene locus_tag LOCUS_00510 31397 31873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 32058 32756 gene locus_tag LOCUS_00520 32058 32756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 >Feature sequence003 <1 754 gene locus_tag LOCUS_00530 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFL0:site-determining protein 757 1047 gene locus_tag LOCUS_00540 gene minE 757 1047 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK9 protein_id gnl|my_center|LOCUS_00540 1790 1269 gene locus_tag LOCUS_00550 1790 1269 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_00550 2429 1932 gene locus_tag LOCUS_00560 2429 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 3448 2447 gene locus_tag LOCUS_00570 gene chpB 3448 2447 CDS product protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD63 protein_id gnl|my_center|LOCUS_00570 10274 3438 gene locus_tag LOCUS_00580 10274 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 11240 10305 gene locus_tag LOCUS_00590 gene pilK 11240 10305 CDS product methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_00590 12773 11358 gene locus_tag LOCUS_00600 12773 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13478 12948 gene locus_tag LOCUS_00610 gene pilI 13478 12948 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_00610 13844 13482 gene locus_tag LOCUS_00620 gene pilH 13844 13482 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_00620 14392 14015 gene locus_tag LOCUS_00630 gene pilG 14392 14015 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_00630 14892 16340 gene locus_tag LOCUS_00640 14892 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 16610 17332 gene locus_tag LOCUS_00650 16610 17332 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_00650 17417 19573 gene locus_tag LOCUS_00660 17417 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 19827 20597 gene locus_tag LOCUS_00670 19827 20597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 protein_id gnl|my_center|LOCUS_00670 20616 21302 gene locus_tag LOCUS_00680 20616 21302 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 protein_id gnl|my_center|LOCUS_00680 21472 22452 gene locus_tag LOCUS_00690 21472 22452 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F501 protein_id gnl|my_center|LOCUS_00690 22818 23666 gene locus_tag LOCUS_00700 22818 23666 CDS product 2,5-didehydrogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388041.1 protein_id gnl|my_center|LOCUS_00700 24249 23749 gene locus_tag LOCUS_00710 gene ccmE 24249 23749 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_00710 24702 24481 gene locus_tag LOCUS_00720 24702 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 25507 24719 gene locus_tag LOCUS_00730 gene ccmC 25507 24719 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_00730 26438 25731 gene locus_tag LOCUS_00740 26438 25731 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQZ8 protein_id gnl|my_center|LOCUS_00740 27162 26533 gene locus_tag LOCUS_00750 gene ccmA 27162 26533 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XE58 protein_id gnl|my_center|LOCUS_00750 27326 28420 gene locus_tag LOCUS_00760 27326 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 28553 29221 gene locus_tag LOCUS_00770 28553 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 29309 30226 gene locus_tag LOCUS_00780 29309 30226 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_00780 30298 30504 gene locus_tag LOCUS_00790 30298 30504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence004 110 34 gene locus_tag LOCUS_t00010 110 34 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 318 234 gene locus_tag LOCUS_t00020 318 234 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 767 459 gene locus_tag LOCUS_00800 gene secG 767 459 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_00800 1806 976 gene locus_tag LOCUS_00810 gene tpiA 1806 976 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB0 protein_id gnl|my_center|LOCUS_00810 2218 3933 gene locus_tag LOCUS_00820 gene pilB 2218 3933 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_00820 4159 5382 gene locus_tag LOCUS_00830 gene pilC 4159 5382 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_00830 5387 6292 gene locus_tag LOCUS_00840 5387 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 6401 7087 gene locus_tag LOCUS_00850 gene coaE 6401 7087 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA5 protein_id gnl|my_center|LOCUS_00850 7820 7050 gene locus_tag LOCUS_00860 gene rlmB 7820 7050 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA3 protein_id gnl|my_center|LOCUS_00860 8421 8086 gene locus_tag LOCUS_00870 8421 8086 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU2 protein_id gnl|my_center|LOCUS_00870 9131 10810 gene locus_tag LOCUS_00880 gene recN 9131 10810 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKU0 protein_id gnl|my_center|LOCUS_00880 10930 11532 gene locus_tag LOCUS_00890 10930 11532 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKT9 protein_id gnl|my_center|LOCUS_00890 11578 12159 gene locus_tag LOCUS_00900 11578 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 12246 12749 gene locus_tag LOCUS_00910 12246 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12882 13130 gene locus_tag LOCUS_00920 12882 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 13160 14098 gene locus_tag LOCUS_00930 gene xerD 13160 14098 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK52 protein_id gnl|my_center|LOCUS_00930 14146 14484 gene locus_tag LOCUS_00940 gene ydzA 14146 14484 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_00940 15325 14624 gene locus_tag LOCUS_00950 15325 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 15554 16162 gene locus_tag LOCUS_00960 15554 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 17459 16251 gene locus_tag LOCUS_00970 17459 16251 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 protein_id gnl|my_center|LOCUS_00970 18763 17459 gene locus_tag LOCUS_00980 18763 17459 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_00980 19239 19856 gene locus_tag LOCUS_00990 19239 19856 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088377.1 protein_id gnl|my_center|LOCUS_00990 20040 21680 gene locus_tag LOCUS_01000 gene pepA 20040 21680 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK40 protein_id gnl|my_center|LOCUS_01000 21742 22209 gene locus_tag LOCUS_01010 21742 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 22550 23752 gene locus_tag LOCUS_01020 gene sstT 22550 23752 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5G9 protein_id gnl|my_center|LOCUS_01020 24152 23829 gene locus_tag LOCUS_01030 24152 23829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 25281 24253 gene locus_tag LOCUS_01040 gene cbpA 25281 24253 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208249.1 protein_id gnl|my_center|LOCUS_01040 25905 25612 gene locus_tag LOCUS_01050 25905 25612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_01050 26217 25918 gene locus_tag LOCUS_01060 26217 25918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738422.1 protein_id gnl|my_center|LOCUS_01060 26997 27359 gene locus_tag LOCUS_01070 26997 27359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 29485 27452 gene locus_tag LOCUS_01080 gene yheS 29485 27452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_01080 >Feature sequence005 51 2786 gene locus_tag LOCUS_01090 gene infB 51 2786 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB4 protein_id gnl|my_center|LOCUS_01090 2984 3373 gene locus_tag LOCUS_01100 gene rbfA 2984 3373 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB5 protein_id gnl|my_center|LOCUS_01100 3383 4489 gene locus_tag LOCUS_01110 3383 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 4852 5376 gene locus_tag LOCUS_01120 gene pfpI 4852 5376 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228555.1 protein_id gnl|my_center|LOCUS_01120 5451 5612 gene locus_tag LOCUS_01130 5451 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5722 5898 gene locus_tag LOCUS_01140 5722 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 6274 6540 gene locus_tag LOCUS_01150 gene rpsO 6274 6540 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_01150 7238 9340 gene locus_tag LOCUS_01160 gene pnp 7238 9340 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE0 protein_id gnl|my_center|LOCUS_01160 10003 9440 gene locus_tag LOCUS_01170 10003 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 10460 10032 gene locus_tag LOCUS_01180 10460 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 10991 10734 gene locus_tag LOCUS_01190 10991 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 13190 10992 gene locus_tag LOCUS_01200 gene prlC 13190 10992 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 protein_id gnl|my_center|LOCUS_01200 13626 14738 gene locus_tag LOCUS_01210 13626 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674011.1 protein_id gnl|my_center|LOCUS_01210 14984 15754 gene locus_tag LOCUS_01220 14984 15754 CDS product EEP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 protein_id gnl|my_center|LOCUS_01220 15939 16964 gene locus_tag LOCUS_01230 15939 16964 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480898.1 protein_id gnl|my_center|LOCUS_01230 17129 18013 gene locus_tag LOCUS_01240 17129 18013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 18663 18046 gene locus_tag LOCUS_01250 18663 18046 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_01250 19574 18681 gene locus_tag LOCUS_01260 19574 18681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257914.1 protein_id gnl|my_center|LOCUS_01260 21464 19641 gene locus_tag LOCUS_01270 21464 19641 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57180 protein_id gnl|my_center|LOCUS_01270 21916 22764 gene locus_tag LOCUS_01280 21916 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689009.1 protein_id gnl|my_center|LOCUS_01280 22942 23832 gene locus_tag LOCUS_01290 22942 23832 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_01290 24545 23892 gene locus_tag LOCUS_01300 24545 23892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_01300 25630 24542 gene locus_tag LOCUS_01310 25630 24542 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257745.1 protein_id gnl|my_center|LOCUS_01310 <27353 25696 gene locus_tag LOCUS_01320 <27353 25696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKM1:phosphomethylpyrimidine synthase >Feature sequence006 1123 725 gene locus_tag LOCUS_01330 1123 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 2296 1406 gene locus_tag LOCUS_01340 gene znuA 2296 1406 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 protein_id gnl|my_center|LOCUS_01340 2571 3137 gene locus_tag LOCUS_01350 gene zur 2571 3137 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 protein_id gnl|my_center|LOCUS_01350 3227 3991 gene locus_tag LOCUS_01360 gene znuC 3227 3991 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJF9 protein_id gnl|my_center|LOCUS_01360 4093 4911 gene locus_tag LOCUS_01370 gene znuB 4093 4911 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208123.1 protein_id gnl|my_center|LOCUS_01370 5171 6019 gene locus_tag LOCUS_01380 gene cpdA 5171 6019 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQJ3 protein_id gnl|my_center|LOCUS_01380 6507 6944 gene locus_tag LOCUS_01390 gene dksA 6507 6944 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL8 protein_id gnl|my_center|LOCUS_01390 7253 8149 gene locus_tag LOCUS_01400 gene gluQ 7253 8149 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK58 protein_id gnl|my_center|LOCUS_01400 9338 8256 gene locus_tag LOCUS_01410 gene ftsW 9338 8256 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK57 protein_id gnl|my_center|LOCUS_01410 11191 9755 gene locus_tag LOCUS_01420 gene murD 11191 9755 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_01420 11859 13358 gene locus_tag LOCUS_01430 11859 13358 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268206.1 protein_id gnl|my_center|LOCUS_01430 13527 14387 gene locus_tag LOCUS_01440 13527 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 14842 15180 gene locus_tag LOCUS_01450 gene glnK 14842 15180 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_01450 15287 16549 gene locus_tag LOCUS_01460 15287 16549 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_01460 17123 16740 gene locus_tag LOCUS_01470 17123 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 protein_id gnl|my_center|LOCUS_01470 17646 17383 gene locus_tag LOCUS_01480 17646 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 18562 17711 gene locus_tag LOCUS_01490 18562 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 18734 18824 gene locus_tag LOCUS_t00030 18734 18824 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20653 19430 gene locus_tag LOCUS_01500 gene yjcL 20653 19430 CDS product putative membrane protein YjcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31634 protein_id gnl|my_center|LOCUS_01500 21405 20704 gene locus_tag LOCUS_01510 gene ddpX 21405 20704 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSR8 protein_id gnl|my_center|LOCUS_01510 22302 21538 gene locus_tag LOCUS_01520 22302 21538 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_01520 25638 22309 gene locus_tag LOCUS_01530 25638 22309 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_01530 26552 25629 gene locus_tag LOCUS_01540 26552 25629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence007 <1 773 gene locus_tag LOCUS_01550 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGF2:fumarate hydratase class II 1521 919 gene locus_tag LOCUS_01560 1521 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2507 1698 gene locus_tag LOCUS_01570 2507 1698 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_01570 3746 2643 gene locus_tag LOCUS_01580 3746 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5133 3946 gene locus_tag LOCUS_01590 gene lldD 5133 3946 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_01590 5486 5172 gene locus_tag LOCUS_01600 5486 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5693 6379 gene locus_tag LOCUS_01610 gene mtgA 5693 6379 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU7 protein_id gnl|my_center|LOCUS_01610 6682 6422 gene locus_tag LOCUS_01620 6682 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6587 8827 gene locus_tag LOCUS_01630 gene ppk 6587 8827 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU8 protein_id gnl|my_center|LOCUS_01630 9260 9430 gene locus_tag LOCUS_01640 9260 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 9500 9745 gene locus_tag LOCUS_01650 9500 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 9804 10163 gene locus_tag LOCUS_01660 9804 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 10298 10498 gene locus_tag LOCUS_01670 10298 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 11420 10653 gene locus_tag LOCUS_01680 gene miaE 11420 10653 CDS product tRNA hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_01680 11586 11359 gene locus_tag LOCUS_01690 11586 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12078 14276 gene locus_tag LOCUS_01700 gene glcB 12078 14276 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV4 protein_id gnl|my_center|LOCUS_01700 14888 15946 gene locus_tag LOCUS_01710 14888 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 16091 17230 gene locus_tag LOCUS_01720 16091 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 17442 19073 gene locus_tag LOCUS_01730 gene pyrG 17442 19073 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFQ0 protein_id gnl|my_center|LOCUS_01730 19297 20172 gene locus_tag LOCUS_01740 gene kdsA 19297 20172 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP9 protein_id gnl|my_center|LOCUS_01740 20200 20454 gene locus_tag LOCUS_01750 20200 20454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 20691 20915 gene locus_tag LOCUS_01760 20691 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 21264 23630 gene locus_tag LOCUS_01770 21264 23630 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222365.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence008 484 852 gene locus_tag LOCUS_01780 484 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 1097 2629 gene locus_tag LOCUS_01790 1097 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 2688 2933 gene locus_tag LOCUS_01800 2688 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 4331 3105 gene locus_tag LOCUS_01810 gene pncB 4331 3105 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYM9 protein_id gnl|my_center|LOCUS_01810 6414 4627 gene locus_tag LOCUS_01820 6414 4627 CDS product methionine sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951394.1 protein_id gnl|my_center|LOCUS_01820 7551 6688 gene locus_tag LOCUS_01830 7551 6688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115525.1 protein_id gnl|my_center|LOCUS_01830 9551 7623 gene locus_tag LOCUS_01840 9551 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10987 9881 gene locus_tag LOCUS_01850 gene calB 10987 9881 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YG5 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01850 11365 10991 gene locus_tag LOCUS_01860 11365 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01860 11718 11587 gene locus_tag LOCUS_01870 11718 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11760 12614 gene locus_tag LOCUS_01880 11760 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 12755 12591 gene locus_tag LOCUS_01890 12755 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12795 13325 gene locus_tag LOCUS_01900 gene ppa 12795 13325 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0G4 protein_id gnl|my_center|LOCUS_01900 13511 13978 gene locus_tag LOCUS_01910 13511 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14489 14713 gene locus_tag LOCUS_01920 14489 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 15897 15010 gene locus_tag LOCUS_01930 15897 15010 CDS product fatty acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_01930 16097 16504 gene locus_tag LOCUS_01940 16097 16504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087586.1 protein_id gnl|my_center|LOCUS_01940 17612 16581 gene locus_tag LOCUS_01950 gene dusB 17612 16581 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKI7 protein_id gnl|my_center|LOCUS_01950 19778 17733 gene locus_tag LOCUS_01960 19778 17733 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 protein_id gnl|my_center|LOCUS_01960 20578 20135 gene locus_tag LOCUS_01970 20578 20135 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_01970 20786 21604 gene locus_tag LOCUS_01980 20786 21604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence009 4 79 gene locus_tag LOCUS_t00040 4 79 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 539 180 gene locus_tag LOCUS_01990 539 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 664 1173 gene locus_tag LOCUS_02000 664 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888890.1 protein_id gnl|my_center|LOCUS_02000 1216 1923 gene locus_tag LOCUS_02010 gene gph 1216 1923 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK13 protein_id gnl|my_center|LOCUS_02010 3543 1969 gene locus_tag LOCUS_02020 gene yifB 3543 1969 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_02020 3904 6339 gene locus_tag LOCUS_02030 3904 6339 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_02030 6575 8146 gene locus_tag LOCUS_02040 gene hemN 6575 8146 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77915 protein_id gnl|my_center|LOCUS_02040 9105 8224 gene locus_tag LOCUS_02050 gene qmcA 9105 8224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_02050 9811 9197 gene locus_tag LOCUS_02060 9811 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 10566 10003 gene locus_tag LOCUS_02070 10566 10003 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074102.1 protein_id gnl|my_center|LOCUS_02070 11324 10785 gene locus_tag LOCUS_02080 11324 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 11613 12845 gene locus_tag LOCUS_02090 gene bioF 11613 12845 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44422 protein_id gnl|my_center|LOCUS_02090 12845 13705 gene locus_tag LOCUS_02100 gene bioC 12845 13705 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6R8 protein_id gnl|my_center|LOCUS_02100 15757 13814 gene locus_tag LOCUS_02110 gene dnaK 15757 13814 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPE6 protein_id gnl|my_center|LOCUS_02110 16540 15941 gene locus_tag LOCUS_02120 gene grpE 16540 15941 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX5 protein_id gnl|my_center|LOCUS_02120 16991 18385 gene locus_tag LOCUS_02130 16991 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 19585 18437 gene locus_tag LOCUS_02140 19585 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 20510 19779 gene locus_tag LOCUS_02150 20510 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 21509 20538 gene locus_tag LOCUS_02160 21509 20538 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_02160 22451 21822 gene locus_tag LOCUS_02170 gene yrdC 22451 21822 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJY6 protein_id gnl|my_center|LOCUS_02170 <23178 22587 gene locus_tag LOCUS_02180 <23178 22587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P43862:DNA-processing protein A >Feature sequence010 557 1198 gene locus_tag LOCUS_02190 557 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 2419 1274 gene locus_tag LOCUS_02200 2419 1274 CDS product type I site-specific deoxyribonuclease specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058063.1 protein_id gnl|my_center|LOCUS_02200 3959 2409 gene locus_tag LOCUS_02210 gene hsdM 3959 2409 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_02210 4241 5164 gene locus_tag LOCUS_02220 4241 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 6057 5341 gene locus_tag LOCUS_02230 gene pdhR 6057 5341 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009388335.1 protein_id gnl|my_center|LOCUS_02230 7892 6159 gene locus_tag LOCUS_02240 gene ilvD 7892 6159 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206894.1 protein_id gnl|my_center|LOCUS_02240 8109 9416 gene locus_tag LOCUS_02250 gene ttuB 8109 9416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206893.1 protein_id gnl|my_center|LOCUS_02250 9428 10426 gene locus_tag LOCUS_02260 9428 10426 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113632.1 protein_id gnl|my_center|LOCUS_02260 10437 12011 gene locus_tag LOCUS_02270 gene aldH 10437 12011 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_02270 12678 12118 gene locus_tag LOCUS_02280 12678 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 13055 13837 gene locus_tag LOCUS_02290 gene sanA 13055 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207551.1 protein_id gnl|my_center|LOCUS_02290 14856 13870 gene locus_tag LOCUS_02300 gene rrmA 14856 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_02300 16075 14957 gene locus_tag LOCUS_02310 gene mraY 16075 14957 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG20 protein_id gnl|my_center|LOCUS_02310 17527 16079 gene locus_tag LOCUS_02320 gene murF 17527 16079 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG21 protein_id gnl|my_center|LOCUS_02320 19311 17611 gene locus_tag LOCUS_02330 gene murE 19311 17611 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG22 protein_id gnl|my_center|LOCUS_02330 21454 19379 gene locus_tag LOCUS_02340 gene ftsI 21454 19379 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_02340 21933 21451 gene locus_tag LOCUS_02350 21933 21451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 <23100 22324 gene locus_tag LOCUS_02360 <23100 22324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KG25:ribosomal RNA small subunit methyltransferase H >Feature sequence011 68 143 gene locus_tag LOCUS_t00050 68 143 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 609 1544 gene locus_tag LOCUS_02370 gene araC 609 1544 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_02370 1831 2892 gene locus_tag LOCUS_02380 1831 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 2959 4161 gene locus_tag LOCUS_02390 gene xcpS 2959 4161 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_02390 4574 5089 gene locus_tag LOCUS_02400 4574 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5347 5910 gene locus_tag LOCUS_02410 5347 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5958 8117 gene locus_tag LOCUS_02420 5958 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 8486 9937 gene locus_tag LOCUS_02430 8486 9937 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208542.1 protein_id gnl|my_center|LOCUS_02430 9981 10805 gene locus_tag LOCUS_02440 9981 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 11073 11561 gene locus_tag LOCUS_02450 11073 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11558 12121 gene locus_tag LOCUS_02460 gene pilV 11558 12121 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207814.1 protein_id gnl|my_center|LOCUS_02460 12121 13230 gene locus_tag LOCUS_02470 12121 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 13275 14195 gene locus_tag LOCUS_02480 13275 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 14248 18195 gene locus_tag LOCUS_02490 14248 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 18188 18784 gene locus_tag LOCUS_02500 18188 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 18787 19209 gene locus_tag LOCUS_02510 gene pilE 18787 19209 CDS product pilus assembly protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_02510 19530 19952 gene locus_tag LOCUS_02520 gene pilA 19530 19952 CDS product type IV pilin protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070777.1 protein_id gnl|my_center|LOCUS_02520 20058 20459 gene locus_tag LOCUS_02530 20058 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 20887 20564 gene locus_tag LOCUS_02540 gene fdxA 20887 20564 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_02540 <21811 20981 gene locus_tag LOCUS_02550 <21811 20981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KUI6:DNA mismatch repair protein MutS >Feature sequence012 336 932 gene locus_tag LOCUS_02560 336 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_02560 973 3867 gene locus_tag LOCUS_02570 973 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3990 4910 gene locus_tag LOCUS_02580 3990 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 5003 6145 gene locus_tag LOCUS_02590 gene serC 5003 6145 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL81 protein_id gnl|my_center|LOCUS_02590 6591 8288 gene locus_tag LOCUS_02600 6591 8288 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 protein_id gnl|my_center|LOCUS_02600 8427 9206 gene locus_tag LOCUS_02610 gene gloB 8427 9206 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7J0 protein_id gnl|my_center|LOCUS_02610 9305 10375 gene locus_tag LOCUS_02620 9305 10375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_02620 10375 11448 gene locus_tag LOCUS_02630 gene yejE 10375 11448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 protein_id gnl|my_center|LOCUS_02630 11450 13132 gene locus_tag LOCUS_02640 gene yejF 11450 13132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 protein_id gnl|my_center|LOCUS_02640 13436 14740 gene locus_tag LOCUS_02650 13436 14740 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_02650 14982 16196 gene locus_tag LOCUS_02660 gene msrAB 14982 16196 CDS product peptide methionine sulfoxide reductase MsrA/MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLX6 protein_id gnl|my_center|LOCUS_02660 16921 16310 gene locus_tag LOCUS_02670 gene folE 16921 16310 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS1 protein_id gnl|my_center|LOCUS_02670 17353 18162 gene locus_tag LOCUS_02680 gene fabI 17353 18162 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS9 protein_id gnl|my_center|LOCUS_02680 18289 18969 gene locus_tag LOCUS_02690 18289 18969 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_02690 19223 19062 gene locus_tag LOCUS_02700 19223 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 19595 21016 gene locus_tag LOCUS_02710 19595 21016 CDS product transporter divalent anion:Na+ symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223903.1 protein_id gnl|my_center|LOCUS_02710 21145 21285 gene locus_tag LOCUS_02720 21145 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence013 38 367 gene locus_tag LOCUS_02730 38 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809253.1 protein_id gnl|my_center|LOCUS_02730 1081 476 gene locus_tag LOCUS_02740 1081 476 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919980.1 protein_id gnl|my_center|LOCUS_02740 1565 1843 gene locus_tag LOCUS_02750 gene rpmE2 1565 1843 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG9 protein_id gnl|my_center|LOCUS_02750 2798 1932 gene locus_tag LOCUS_02760 2798 1932 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206941.1 protein_id gnl|my_center|LOCUS_02760 4189 2792 gene locus_tag LOCUS_02770 4189 2792 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_02770 5431 4364 gene locus_tag LOCUS_02780 5431 4364 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_02780 6272 5643 gene locus_tag LOCUS_02790 gene gst 6272 5643 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811283.1 protein_id gnl|my_center|LOCUS_02790 6685 6518 gene locus_tag LOCUS_02800 6685 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 6925 7608 gene locus_tag LOCUS_02810 gene nfuA 6925 7608 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGT7 protein_id gnl|my_center|LOCUS_02810 7800 9122 gene locus_tag LOCUS_02820 gene metY 7800 9122 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_02820 10333 9320 gene locus_tag LOCUS_02830 10333 9320 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_02830 11315 10383 gene locus_tag LOCUS_02840 gene rsmI 11315 10383 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH08 protein_id gnl|my_center|LOCUS_02840 11493 11930 gene locus_tag LOCUS_02850 11493 11930 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WX3 protein_id gnl|my_center|LOCUS_02850 12139 12936 gene locus_tag LOCUS_02860 12139 12936 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_02860 13182 14240 gene locus_tag LOCUS_02870 13182 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14405 14656 gene locus_tag LOCUS_02880 14405 14656 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_02880 14768 16036 gene locus_tag LOCUS_02890 gene murA 14768 16036 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH0 protein_id gnl|my_center|LOCUS_02890 16102 16824 gene locus_tag LOCUS_02900 gene hisG 16102 16824 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_02900 17076 18371 gene locus_tag LOCUS_02910 gene hisD 17076 18371 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH2 protein_id gnl|my_center|LOCUS_02910 18447 19580 gene locus_tag LOCUS_02920 gene hisC 18447 19580 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH3 protein_id gnl|my_center|LOCUS_02920 <21225 19685 gene locus_tag LOCUS_02930 <21225 19685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208422.1:p-aminobenzoate synthetase >Feature sequence014 <1 1262 gene locus_tag LOCUS_02940 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530984.1:MATE family efflux transporter 2125 1409 gene locus_tag LOCUS_02950 2125 1409 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 protein_id gnl|my_center|LOCUS_02950 2343 2597 gene locus_tag LOCUS_02960 2343 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2942 3919 gene locus_tag LOCUS_02970 gene mecR 2942 3919 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383116.1 protein_id gnl|my_center|LOCUS_02970 4062 5066 gene locus_tag LOCUS_02980 4062 5066 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_02980 5689 5153 gene locus_tag LOCUS_02990 5689 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6262 5810 gene locus_tag LOCUS_03000 6262 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 6946 6425 gene locus_tag LOCUS_03010 6946 6425 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_03010 8831 7236 gene locus_tag LOCUS_03020 gene guaA 8831 7236 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJE6 protein_id gnl|my_center|LOCUS_03020 8947 9102 gene locus_tag LOCUS_03030 8947 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 9089 9529 gene locus_tag LOCUS_03040 9089 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10181 12118 gene locus_tag LOCUS_03050 10181 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 12298 13311 gene locus_tag LOCUS_03060 12298 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 14627 13473 gene locus_tag LOCUS_03070 14627 13473 CDS product cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378885.1 protein_id gnl|my_center|LOCUS_03070 14817 15311 gene locus_tag LOCUS_03080 14817 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 15466 16710 gene locus_tag LOCUS_03090 15466 16710 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH69 protein_id gnl|my_center|LOCUS_03090 16700 19036 gene locus_tag LOCUS_03100 16700 19036 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 protein_id gnl|my_center|LOCUS_03100 19033 19878 gene locus_tag LOCUS_03110 19033 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 <20804 20073 gene locus_tag LOCUS_03120 <20804 20073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086719.1:enoyl-CoA hydratase >Feature sequence015 1135 506 gene locus_tag LOCUS_03130 gene ampD 1135 506 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_03130 1320 3461 gene locus_tag LOCUS_03140 1320 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_03140 3522 4361 gene locus_tag LOCUS_03150 3522 4361 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 protein_id gnl|my_center|LOCUS_03150 4435 5418 gene locus_tag LOCUS_03160 4435 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5480 6184 gene locus_tag LOCUS_03170 gene pyrE 5480 6184 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_03170 6249 7220 gene locus_tag LOCUS_03180 gene gshB 6249 7220 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_03180 7439 8524 gene locus_tag LOCUS_03190 gene murG 7439 8524 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC8 protein_id gnl|my_center|LOCUS_03190 8594 10033 gene locus_tag LOCUS_03200 gene murC 8594 10033 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_03200 10067 11146 gene locus_tag LOCUS_03210 gene ddlB 10067 11146 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_03210 11770 12441 gene locus_tag LOCUS_03220 11770 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 12620 13912 gene locus_tag LOCUS_03230 gene ftsA 12620 13912 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC4 protein_id gnl|my_center|LOCUS_03230 14186 15385 gene locus_tag LOCUS_03240 gene ftsZ 14186 15385 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC3 protein_id gnl|my_center|LOCUS_03240 15641 16603 gene locus_tag LOCUS_03250 gene lpxC 15641 16603 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC2 protein_id gnl|my_center|LOCUS_03250 17417 16902 gene locus_tag LOCUS_03260 17417 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 17665 18393 gene locus_tag LOCUS_03270 17665 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 19294 18569 gene locus_tag LOCUS_03280 19294 18569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 19823 19512 gene locus_tag LOCUS_03290 19823 19512 CDS product putative RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95453 protein_id gnl|my_center|LOCUS_03290 >Feature sequence016 73 597 gene locus_tag LOCUS_03300 73 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610214.1 protein_id gnl|my_center|LOCUS_03300 800 1798 gene locus_tag LOCUS_03310 gene add 800 1798 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_03310 2709 1909 gene locus_tag LOCUS_03320 gene cobB 2709 1909 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGG3 protein_id gnl|my_center|LOCUS_03320 2745 3107 gene locus_tag LOCUS_03330 2745 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4054 3659 gene locus_tag LOCUS_03340 4054 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4433 6796 gene locus_tag LOCUS_03350 4433 6796 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704240.1 protein_id gnl|my_center|LOCUS_03350 6796 8109 gene locus_tag LOCUS_03360 6796 8109 CDS product restriction modification system DNA specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_03360 8176 8934 gene locus_tag LOCUS_03370 8176 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 9102 9824 gene locus_tag LOCUS_03380 9102 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10041 13340 gene locus_tag LOCUS_03390 10041 13340 CDS product type I restriction-modification system, restriction (R) subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_03390 16362 13804 gene locus_tag LOCUS_03400 16362 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16644 16366 gene locus_tag LOCUS_03410 16644 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 17724 16768 gene locus_tag LOCUS_03420 17724 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 19410 17899 gene locus_tag LOCUS_03430 19410 17899 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218804.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence017 1784 675 gene locus_tag LOCUS_03440 gene czcD 1784 675 CDS product cadmium, cobalt and zinc/H(+)-K(+) antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07084 protein_id gnl|my_center|LOCUS_03440 4262 1974 gene locus_tag LOCUS_03450 gene priA 4262 1974 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE7 protein_id gnl|my_center|LOCUS_03450 4769 4389 gene locus_tag LOCUS_03460 4769 4389 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_03460 7113 4915 gene locus_tag LOCUS_03470 gene spoT 7113 4915 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 protein_id gnl|my_center|LOCUS_03470 7728 7468 gene locus_tag LOCUS_03480 gene rpoZ 7728 7468 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ3 protein_id gnl|my_center|LOCUS_03480 8544 7918 gene locus_tag LOCUS_03490 gene gmk 8544 7918 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ2 protein_id gnl|my_center|LOCUS_03490 8897 9853 gene locus_tag LOCUS_03500 gene ispH 8897 9853 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFZ1 protein_id gnl|my_center|LOCUS_03500 9895 10143 gene locus_tag LOCUS_03510 9895 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10167 10982 gene locus_tag LOCUS_03520 10167 10982 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206444.1 protein_id gnl|my_center|LOCUS_03520 11429 13390 gene locus_tag LOCUS_03530 gene htpG 11429 13390 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKR1 protein_id gnl|my_center|LOCUS_03530 13790 15187 gene locus_tag LOCUS_03540 13790 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_03540 15288 16178 gene locus_tag LOCUS_03550 gene esd 15288 16178 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ7 protein_id gnl|my_center|LOCUS_03550 16243 16686 gene locus_tag LOCUS_03560 16243 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 16795 17484 gene locus_tag LOCUS_03570 gene rpe 16795 17484 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ9 protein_id gnl|my_center|LOCUS_03570 17596 17970 gene locus_tag LOCUS_03580 17596 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 18078 18389 gene locus_tag LOCUS_03590 18078 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 18624 18935 gene locus_tag LOCUS_03600 18624 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence018 1765 2310 gene locus_tag LOCUS_03610 1765 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3117 2332 gene locus_tag LOCUS_03620 gene pdxJ 3117 2332 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK8 protein_id gnl|my_center|LOCUS_03620 4009 3233 gene locus_tag LOCUS_03630 gene recO 4009 3233 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCX7 protein_id gnl|my_center|LOCUS_03630 5183 4077 gene locus_tag LOCUS_03640 gene era 5183 4077 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL1 protein_id gnl|my_center|LOCUS_03640 6182 5385 gene locus_tag LOCUS_03650 gene rnc 6182 5385 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL2 protein_id gnl|my_center|LOCUS_03650 6675 6283 gene locus_tag LOCUS_03660 6675 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7708 6806 gene locus_tag LOCUS_03670 gene lepB 7708 6806 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL4 protein_id gnl|my_center|LOCUS_03670 9610 7811 gene locus_tag LOCUS_03680 gene lepA 9610 7811 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKL5 protein_id gnl|my_center|LOCUS_03680 11165 9984 gene locus_tag LOCUS_03690 gene kpsS 11165 9984 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161834.1 protein_id gnl|my_center|LOCUS_03690 13843 11366 gene locus_tag LOCUS_03700 gene lipA 13843 11366 CDS product capsule polysaccharide modification protein LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05013 protein_id gnl|my_center|LOCUS_03700 15690 13918 gene locus_tag LOCUS_03710 gene kpsD 15690 13918 CDS product polysialic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976921.1 protein_id gnl|my_center|LOCUS_03710 16762 15746 gene locus_tag LOCUS_03720 gene kpsE 16762 15746 CDS product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 protein_id gnl|my_center|LOCUS_03720 17501 16830 gene locus_tag LOCUS_03730 17501 16830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590233.1 protein_id gnl|my_center|LOCUS_03730 18328 17516 gene locus_tag LOCUS_03740 18328 17516 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EL37 protein_id gnl|my_center|LOCUS_03740 18619 18543 gene locus_tag LOCUS_t00060 18619 18543 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 <1 890 gene locus_tag LOCUS_03750 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DV10:phosphoenolpyruvate carboxylase 1289 1819 gene locus_tag LOCUS_03760 1289 1819 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 protein_id gnl|my_center|LOCUS_03760 1825 2586 gene locus_tag LOCUS_03770 gene ecpD 1825 2586 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036572.1 protein_id gnl|my_center|LOCUS_03770 2684 5008 gene locus_tag LOCUS_03780 gene fasD 2684 5008 CDS product outer membrane usher protein FasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636753.2 protein_id gnl|my_center|LOCUS_03780 5077 6075 gene locus_tag LOCUS_03790 5077 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974108.1 protein_id gnl|my_center|LOCUS_03790 7048 6146 gene locus_tag LOCUS_03800 7048 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7301 8311 gene locus_tag LOCUS_03810 gene benM 7301 8311 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206214.1 protein_id gnl|my_center|LOCUS_03810 8607 9893 gene locus_tag LOCUS_03820 8607 9893 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697398.1 protein_id gnl|my_center|LOCUS_03820 10263 11156 gene locus_tag LOCUS_03830 gene prpB 10263 11156 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSC2 protein_id gnl|my_center|LOCUS_03830 11227 12354 gene locus_tag LOCUS_03840 gene prpC 11227 12354 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_03840 12431 13060 gene locus_tag LOCUS_03850 12431 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 13116 15788 gene locus_tag LOCUS_03860 13116 15788 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_03860 15889 16653 gene locus_tag LOCUS_03870 15889 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16704 17945 gene locus_tag LOCUS_03880 16704 17945 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence020 528 1664 gene locus_tag LOCUS_03890 528 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2039 1869 gene locus_tag LOCUS_03900 2039 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2016 2585 gene locus_tag LOCUS_03910 2016 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 3430 2681 gene locus_tag LOCUS_03920 gene aguR 3430 2681 CDS product transcriptional regulator AguR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_03920 4630 3611 gene locus_tag LOCUS_03930 4630 3611 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970133.1 protein_id gnl|my_center|LOCUS_03930 5340 4828 gene locus_tag LOCUS_03940 5340 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7191 5581 gene locus_tag LOCUS_03950 gene glpK 7191 5581 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RT38 protein_id gnl|my_center|LOCUS_03950 7697 9355 gene locus_tag LOCUS_03960 7697 9355 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073794.1 protein_id gnl|my_center|LOCUS_03960 9581 10447 gene locus_tag LOCUS_03970 9581 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721655.1 protein_id gnl|my_center|LOCUS_03970 10496 11659 gene locus_tag LOCUS_03980 10496 11659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464702.1 protein_id gnl|my_center|LOCUS_03980 11663 12901 gene locus_tag LOCUS_03990 11663 12901 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464455.1 protein_id gnl|my_center|LOCUS_03990 12901 14103 gene locus_tag LOCUS_04000 gene ybhR 12901 14103 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 protein_id gnl|my_center|LOCUS_04000 15841 14192 gene locus_tag LOCUS_04010 gene sthA 15841 14192 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 protein_id gnl|my_center|LOCUS_04010 16319 15918 gene locus_tag LOCUS_04020 16319 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 17285 16389 gene locus_tag LOCUS_04030 17285 16389 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU2 protein_id gnl|my_center|LOCUS_04030 >Feature sequence021 3 2321 gene locus_tag LOCUS_04040 gene iutA 3 2321 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_04040 3351 4697 gene locus_tag LOCUS_04050 3351 4697 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_04050 4937 6622 gene locus_tag LOCUS_04060 gene maeA 4937 6622 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHR8 protein_id gnl|my_center|LOCUS_04060 7023 6947 gene locus_tag LOCUS_t00070 7023 6947 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7930 7118 gene locus_tag LOCUS_04070 gene ptr1 7930 7118 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_04070 9129 7942 gene locus_tag LOCUS_04080 gene cca 9129 7942 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7ND45 protein_id gnl|my_center|LOCUS_04080 11612 9294 gene locus_tag LOCUS_04090 gene maeB 11612 9294 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_04090 13426 11960 gene locus_tag LOCUS_04100 13426 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 protein_id gnl|my_center|LOCUS_04100 15156 13753 gene locus_tag LOCUS_04110 gene olE1 15156 13753 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_04110 16127 15399 gene locus_tag LOCUS_04120 gene ugpQ 16127 15399 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 protein_id gnl|my_center|LOCUS_04120 16485 17432 gene locus_tag LOCUS_04130 16485 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence022 2044 482 gene locus_tag LOCUS_04140 2044 482 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886731.1 protein_id gnl|my_center|LOCUS_04140 3432 2302 gene locus_tag LOCUS_04150 gene areB 3432 2302 CDS product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_04150 4616 3729 gene locus_tag LOCUS_04160 gene gcvA 4616 3729 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208464.1 protein_id gnl|my_center|LOCUS_04160 4784 5392 gene locus_tag LOCUS_04170 gene rhtC 4784 5392 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208463.1 protein_id gnl|my_center|LOCUS_04170 5526 5663 gene locus_tag LOCUS_04180 5526 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8317 5855 gene locus_tag LOCUS_04190 gene pirA 8317 5855 CDS product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112590.1 protein_id gnl|my_center|LOCUS_04190 8730 9644 gene locus_tag LOCUS_04200 8730 9644 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 protein_id gnl|my_center|LOCUS_04200 11140 9689 gene locus_tag LOCUS_04210 gene puuC 11140 9689 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071494.1 protein_id gnl|my_center|LOCUS_04210 11546 11166 gene locus_tag LOCUS_04220 11546 11166 CDS product gamma-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 protein_id gnl|my_center|LOCUS_04220 12230 11577 gene locus_tag LOCUS_04230 12230 11577 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973665.1 protein_id gnl|my_center|LOCUS_04230 12428 13030 gene locus_tag LOCUS_04240 12428 13030 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967417.1 protein_id gnl|my_center|LOCUS_04240 13044 13880 gene locus_tag LOCUS_04250 13044 13880 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703491.1 protein_id gnl|my_center|LOCUS_04250 13916 14827 gene locus_tag LOCUS_04260 gene ntaB 13916 14827 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206412.1 protein_id gnl|my_center|LOCUS_04260 14920 15957 gene locus_tag LOCUS_04270 14920 15957 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887779.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence023 44 119 gene locus_tag LOCUS_t00080 44 119 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 393 1046 gene locus_tag LOCUS_04280 393 1046 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_04280 1202 1978 gene locus_tag LOCUS_04290 1202 1978 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_04290 2054 3163 gene locus_tag LOCUS_04300 2054 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3433 3891 gene locus_tag LOCUS_04310 3433 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4837 3941 gene locus_tag LOCUS_04320 4837 3941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708655.1 protein_id gnl|my_center|LOCUS_04320 5261 6220 gene locus_tag LOCUS_04330 5261 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9152 6312 gene locus_tag LOCUS_04340 gene rpfA 9152 6312 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9K3 protein_id gnl|my_center|LOCUS_04340 10586 9543 gene locus_tag LOCUS_04350 10586 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_04350 10713 11429 gene locus_tag LOCUS_04360 10713 11429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_04360 11489 12031 gene locus_tag LOCUS_04370 11489 12031 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F4Y1 protein_id gnl|my_center|LOCUS_04370 12489 12028 gene locus_tag LOCUS_04380 12489 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 13703 12492 gene locus_tag LOCUS_04390 13703 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 14687 13776 gene locus_tag LOCUS_04400 14687 13776 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687345.1 protein_id gnl|my_center|LOCUS_04400 15029 14691 gene locus_tag LOCUS_04410 15029 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16342 15101 gene locus_tag LOCUS_04420 gene thrB 16342 15101 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_04420 >Feature sequence024 1943 75 gene locus_tag LOCUS_04430 1943 75 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_04430 2208 1948 gene locus_tag LOCUS_04440 2208 1948 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_04440 5334 3574 gene locus_tag LOCUS_04450 gene etfD 5334 3574 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 protein_id gnl|my_center|LOCUS_04450 5665 6348 gene locus_tag LOCUS_04460 5665 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 protein_id gnl|my_center|LOCUS_04460 6511 7515 gene locus_tag LOCUS_04470 gene murI 6511 7515 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF8 protein_id gnl|my_center|LOCUS_04470 7682 8683 gene locus_tag LOCUS_04480 7682 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8906 9205 gene locus_tag LOCUS_04490 8906 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 10784 9324 gene locus_tag LOCUS_04500 gene mltB 10784 9324 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 protein_id gnl|my_center|LOCUS_04500 11091 12578 gene locus_tag LOCUS_04510 11091 12578 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_04510 12565 13170 gene locus_tag LOCUS_04520 12565 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 13907 13194 gene locus_tag LOCUS_04530 13907 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 14686 13967 gene locus_tag LOCUS_04540 gene tpm 14686 13967 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q4 protein_id gnl|my_center|LOCUS_04540 15398 14877 gene locus_tag LOCUS_04550 gene msrA 15398 14877 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_04550 15629 16414 gene locus_tag LOCUS_04560 gene cmoA 15629 16414 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A3 protein_id gnl|my_center|LOCUS_04560 >Feature sequence025 525 235 gene locus_tag LOCUS_04570 525 235 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM8 protein_id gnl|my_center|LOCUS_04570 2377 1004 gene locus_tag LOCUS_04580 gene argH 2377 1004 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKM9 protein_id gnl|my_center|LOCUS_04580 2491 3642 gene locus_tag LOCUS_04590 2491 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3756 3541 gene locus_tag LOCUS_04600 3756 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3878 4615 gene locus_tag LOCUS_04610 gene algR 3878 4615 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_04610 4804 5838 gene locus_tag LOCUS_04620 gene hemC 4804 5838 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_04620 5989 6903 gene locus_tag LOCUS_04630 gene hemD 5989 6903 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 protein_id gnl|my_center|LOCUS_04630 6963 8000 gene locus_tag LOCUS_04640 6963 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 8054 8542 gene locus_tag LOCUS_04650 8054 8542 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_04650 9787 8675 gene locus_tag LOCUS_04660 gene ribB 9787 8675 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 protein_id gnl|my_center|LOCUS_04660 11387 10098 gene locus_tag LOCUS_04670 gene rarA 11387 10098 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 protein_id gnl|my_center|LOCUS_04670 11797 12330 gene locus_tag LOCUS_04680 11797 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 12415 13359 gene locus_tag LOCUS_04690 12415 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 14773 13493 gene locus_tag LOCUS_04700 gene gltA 14773 13493 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME8 protein_id gnl|my_center|LOCUS_04700 >Feature sequence026 1190 1561 gene locus_tag LOCUS_04710 gene yffB 1190 1561 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_04710 1819 1583 gene locus_tag LOCUS_04720 1819 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2750 1833 gene locus_tag LOCUS_04730 gene argB 2750 1833 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL8 protein_id gnl|my_center|LOCUS_04730 4700 2817 gene locus_tag LOCUS_04740 4700 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5342 4878 gene locus_tag LOCUS_04750 gene dut 5342 4878 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL6 protein_id gnl|my_center|LOCUS_04750 6813 5410 gene locus_tag LOCUS_04760 6813 5410 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE0 protein_id gnl|my_center|LOCUS_04760 8946 6913 gene locus_tag LOCUS_04770 gene rep 8946 6913 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL5 protein_id gnl|my_center|LOCUS_04770 9755 10378 gene locus_tag LOCUS_04780 9755 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 10516 11184 gene locus_tag LOCUS_04790 gene nuoB 10516 11184 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES5 protein_id gnl|my_center|LOCUS_04790 11311 13086 gene locus_tag LOCUS_04800 gene nuoC 11311 13086 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KES6 protein_id gnl|my_center|LOCUS_04800 13234 13743 gene locus_tag LOCUS_04810 gene nuoE 13234 13743 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_04810 13740 15164 gene locus_tag LOCUS_04820 gene nuoF 13740 15164 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence027 1627 812 gene locus_tag LOCUS_04830 1627 812 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136261.1 protein_id gnl|my_center|LOCUS_04830 2233 2967 gene locus_tag LOCUS_04840 2233 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4324 2984 gene locus_tag LOCUS_04850 4324 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5867 4665 gene locus_tag LOCUS_04860 gene nhaA 5867 4665 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBX2 protein_id gnl|my_center|LOCUS_04860 6473 7228 gene locus_tag LOCUS_04870 gene yfcA 6473 7228 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB6 protein_id gnl|my_center|LOCUS_04870 8695 7319 gene locus_tag LOCUS_04880 8695 7319 CDS product proton/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_04880 12070 9173 gene locus_tag LOCUS_04890 gene fadE 12070 9173 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 protein_id gnl|my_center|LOCUS_04890 13114 12425 gene locus_tag LOCUS_04900 13114 12425 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_04900 13243 14565 gene locus_tag LOCUS_04910 gene dfp 13243 14565 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 protein_id gnl|my_center|LOCUS_04910 14641 15423 gene locus_tag LOCUS_04920 14641 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212540.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence028 361 74 gene locus_tag LOCUS_04930 361 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 protein_id gnl|my_center|LOCUS_04930 2695 464 gene locus_tag LOCUS_04940 gene tgpA 2695 464 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 protein_id gnl|my_center|LOCUS_04940 3708 2692 gene locus_tag LOCUS_04950 3708 2692 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_04950 4844 3816 gene locus_tag LOCUS_04960 4844 3816 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072205.1 protein_id gnl|my_center|LOCUS_04960 5393 4893 gene locus_tag LOCUS_04970 5393 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7497 5410 gene locus_tag LOCUS_04980 gene fimX 7497 5410 CDS product protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_04980 9585 7828 gene locus_tag LOCUS_04990 9585 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9562 9768 gene locus_tag LOCUS_05000 9562 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 10883 9876 gene locus_tag LOCUS_05010 10883 9876 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_05010 11042 11614 gene locus_tag LOCUS_05020 gene efp 11042 11614 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJV8 protein_id gnl|my_center|LOCUS_05020 13581 11767 gene locus_tag LOCUS_05030 13581 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 14472 13591 gene locus_tag LOCUS_05040 14472 13591 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 protein_id gnl|my_center|LOCUS_05040 <15267 14543 gene locus_tag LOCUS_05050 <15267 14543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208373.1:hydrolase >Feature sequence029 2078 1464 gene locus_tag LOCUS_05060 2078 1464 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705925.1 protein_id gnl|my_center|LOCUS_05060 4066 2117 gene locus_tag LOCUS_05070 4066 2117 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262771.1 protein_id gnl|my_center|LOCUS_05070 5511 4309 gene locus_tag LOCUS_05080 gene dapL 5511 4309 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 protein_id gnl|my_center|LOCUS_05080 5772 6443 gene locus_tag LOCUS_05090 5772 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9235 6479 gene locus_tag LOCUS_05100 gene glnD 9235 6479 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM5 protein_id gnl|my_center|LOCUS_05100 10256 9462 gene locus_tag LOCUS_05110 gene map 10256 9462 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY1 protein_id gnl|my_center|LOCUS_05110 10553 11629 gene locus_tag LOCUS_05120 gene lip 10553 11629 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26876 protein_id gnl|my_center|LOCUS_05120 11689 12789 gene locus_tag LOCUS_05130 gene lifO 11689 12789 CDS product lipase chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q01725 protein_id gnl|my_center|LOCUS_05130 12963 13094 gene locus_tag LOCUS_05140 12963 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13517 14005 gene locus_tag LOCUS_05150 13517 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 >Feature sequence030 <1 484 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcacccgtgatgggtgcgaa 632 495 gene locus_tag LOCUS_05160 632 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1022 732 gene locus_tag LOCUS_05170 gene cas 1022 732 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8P1 protein_id gnl|my_center|LOCUS_05170 2093 1062 gene locus_tag LOCUS_05180 gene cas1-2 2093 1062 CDS product CRISPR-associated endonuclease Cas1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RW61 protein_id gnl|my_center|LOCUS_05180 2794 2153 gene locus_tag LOCUS_05190 2794 2153 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388587.1 protein_id gnl|my_center|LOCUS_05190 3171 2881 gene locus_tag LOCUS_05200 3171 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4297 3410 gene locus_tag LOCUS_05210 4297 3410 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_05210 6207 4345 gene locus_tag LOCUS_05220 6207 4345 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932805.1 protein_id gnl|my_center|LOCUS_05220 6887 6204 gene locus_tag LOCUS_05230 6887 6204 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_05230 9438 6961 gene locus_tag LOCUS_05240 9438 6961 CDS product CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_05240 9515 9805 gene locus_tag LOCUS_05250 9515 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11617 10133 gene locus_tag LOCUS_05260 11617 10133 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224963.1 protein_id gnl|my_center|LOCUS_05260 12540 11752 gene locus_tag LOCUS_05270 12540 11752 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_05270 13546 13728 gene locus_tag LOCUS_05280 13546 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence031 641 174 gene locus_tag LOCUS_05290 641 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 12052 644 gene locus_tag LOCUS_05300 12052 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13916 12123 gene locus_tag LOCUS_05310 gene shlB 13916 12123 CDS product hemolysin activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206788.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence032 215 739 gene locus_tag LOCUS_05320 215 739 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_05320 782 2512 gene locus_tag LOCUS_05330 782 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2565 3713 gene locus_tag LOCUS_05340 gene miaA 2565 3713 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH83 protein_id gnl|my_center|LOCUS_05340 4119 4646 gene locus_tag LOCUS_05350 gene hfq 4119 4646 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH82 protein_id gnl|my_center|LOCUS_05350 4862 5854 gene locus_tag LOCUS_05360 gene kdsD 4862 5854 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX3 protein_id gnl|my_center|LOCUS_05360 5936 6502 gene locus_tag LOCUS_05370 gene kdsC 5936 6502 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 protein_id gnl|my_center|LOCUS_05370 6499 7083 gene locus_tag LOCUS_05380 6499 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 7120 7722 gene locus_tag LOCUS_05390 gene lptA 7120 7722 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX6 protein_id gnl|my_center|LOCUS_05390 7792 8568 gene locus_tag LOCUS_05400 7792 8568 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 protein_id gnl|my_center|LOCUS_05400 8835 10274 gene locus_tag LOCUS_05410 gene radA 8835 10274 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL98 protein_id gnl|my_center|LOCUS_05410 10978 10364 gene locus_tag LOCUS_05420 10978 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12630 11899 gene locus_tag LOCUS_05430 12630 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 12996 12700 gene locus_tag LOCUS_05440 12996 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05440 13367 14287 gene locus_tag LOCUS_05450 13367 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence033 <1 1110 gene locus_tag LOCUS_05460 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036454.1:methylmalonate-semialdehyde dehydrogenase (acylating) 1308 2468 gene locus_tag LOCUS_05470 1308 2468 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483354.1 protein_id gnl|my_center|LOCUS_05470 2501 3283 gene locus_tag LOCUS_05480 2501 3283 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_05480 3348 4634 gene locus_tag LOCUS_05490 3348 4634 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811746.1 protein_id gnl|my_center|LOCUS_05490 4721 5665 gene locus_tag LOCUS_05500 4721 5665 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H47 protein_id gnl|my_center|LOCUS_05500 6577 5819 gene locus_tag LOCUS_05510 6577 5819 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085878.1 protein_id gnl|my_center|LOCUS_05510 7169 8035 gene locus_tag LOCUS_05520 7169 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_05520 8680 8156 gene locus_tag LOCUS_05530 8680 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9631 9113 gene locus_tag LOCUS_05540 gene pal 9631 9113 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 protein_id gnl|my_center|LOCUS_05540 10508 9894 gene locus_tag LOCUS_05550 10508 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 10809 13451 gene locus_tag LOCUS_05560 gene pepN 10809 13451 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207081.1 protein_id gnl|my_center|LOCUS_05560 <14366 13647 gene locus_tag LOCUS_05570 <14366 13647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN07:phospho-2-dehydro-3-deoxyheptonate aldolase >Feature sequence034 558 1124 gene locus_tag LOCUS_05580 558 1124 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 protein_id gnl|my_center|LOCUS_05580 1531 1283 gene locus_tag LOCUS_05590 1531 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2028 3605 gene locus_tag LOCUS_05600 2028 3605 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 protein_id gnl|my_center|LOCUS_05600 3862 5310 gene locus_tag LOCUS_05610 3862 5310 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244998.1 protein_id gnl|my_center|LOCUS_05610 5938 5501 gene locus_tag LOCUS_05620 5938 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6498 6166 gene locus_tag LOCUS_05630 gene blh 6498 6166 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_05630 6906 6568 gene locus_tag LOCUS_05640 gene blh 6906 6568 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_05640 8835 7126 gene locus_tag LOCUS_05650 8835 7126 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_05650 9258 8890 gene locus_tag LOCUS_05660 9258 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 9518 9306 gene locus_tag LOCUS_05670 9518 9306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9546 10418 gene locus_tag LOCUS_05680 9546 10418 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_05680 10554 10994 gene locus_tag LOCUS_05690 gene trx 10554 10994 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_05690 11519 11118 gene locus_tag LOCUS_05700 11519 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 12059 11700 gene locus_tag LOCUS_05710 12059 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 12453 12133 gene locus_tag LOCUS_05720 gene bolA 12453 12133 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_05720 13494 12682 gene locus_tag LOCUS_05730 13494 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence035 1 666 gene locus_tag LOCUS_05740 1 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 667 1227 gene locus_tag LOCUS_05750 667 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_05750 1342 2166 gene locus_tag LOCUS_05760 gene trpA 1342 2166 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU1 protein_id gnl|my_center|LOCUS_05760 2615 3565 gene locus_tag LOCUS_05770 gene accD 2615 3565 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU0 protein_id gnl|my_center|LOCUS_05770 3807 5156 gene locus_tag LOCUS_05780 gene folC 3807 5156 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 protein_id gnl|my_center|LOCUS_05780 5404 6534 gene locus_tag LOCUS_05790 gene iga 5404 6534 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 protein_id gnl|my_center|LOCUS_05790 6794 7324 gene locus_tag LOCUS_05800 6794 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 8283 7321 gene locus_tag LOCUS_05810 8283 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 protein_id gnl|my_center|LOCUS_05810 9584 8667 gene locus_tag LOCUS_05820 9584 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 10744 10343 gene locus_tag LOCUS_05830 10744 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 <13961 12201 gene locus_tag LOCUS_05840 <13961 12201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence036 <1 1076 gene locus_tag LOCUS_05850 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206588.1:phosphotransferase 1126 1860 gene locus_tag LOCUS_05860 gene mpg1 1126 1860 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_05860 3200 2184 gene locus_tag LOCUS_05870 3200 2184 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886238.1 protein_id gnl|my_center|LOCUS_05870 4705 3200 gene locus_tag LOCUS_05880 4705 3200 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598577.1 protein_id gnl|my_center|LOCUS_05880 7622 5157 gene locus_tag LOCUS_05890 7622 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206519.1 protein_id gnl|my_center|LOCUS_05890 8791 7988 gene locus_tag LOCUS_05900 8791 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8892 9161 gene locus_tag LOCUS_05910 8892 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 9898 9254 gene locus_tag LOCUS_05920 gene coq7 9898 9254 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHR2 protein_id gnl|my_center|LOCUS_05920 11425 10094 gene locus_tag LOCUS_05930 gene lplT 11425 10094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence037 829 59 gene locus_tag LOCUS_05940 829 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1585 1094 gene locus_tag LOCUS_05950 1585 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2418 1702 gene locus_tag LOCUS_05960 gene rph 2418 1702 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP5 protein_id gnl|my_center|LOCUS_05960 4397 2598 gene locus_tag LOCUS_05970 gene fadD 4397 2598 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_05970 6666 4939 gene locus_tag LOCUS_05980 gene fadD 6666 4939 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 protein_id gnl|my_center|LOCUS_05980 7492 9750 gene locus_tag LOCUS_05990 gene parC 7492 9750 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK17 protein_id gnl|my_center|LOCUS_05990 10464 9979 gene locus_tag LOCUS_06000 10464 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 11312 10824 gene locus_tag LOCUS_06010 11312 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 12109 11618 gene locus_tag LOCUS_06020 12109 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12971 12378 gene locus_tag LOCUS_06030 12971 12378 CDS product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531899.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence038 366 1205 gene locus_tag LOCUS_06040 366 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1208 2251 gene locus_tag LOCUS_06050 gene thiL 1208 2251 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ5 protein_id gnl|my_center|LOCUS_06050 2255 2860 gene locus_tag LOCUS_06060 2255 2860 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU1 protein_id gnl|my_center|LOCUS_06060 3079 4404 gene locus_tag LOCUS_06070 gene glmU 3079 4404 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ7 protein_id gnl|my_center|LOCUS_06070 4550 6394 gene locus_tag LOCUS_06080 gene glmS 4550 6394 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHZ8 protein_id gnl|my_center|LOCUS_06080 8217 6964 gene locus_tag LOCUS_06090 8217 6964 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008540630.1 protein_id gnl|my_center|LOCUS_06090 8491 9258 gene locus_tag LOCUS_06100 8491 9258 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_06100 9975 9571 gene locus_tag LOCUS_06110 9975 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11034 10234 gene locus_tag LOCUS_06120 11034 10234 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_06120 11610 11119 gene locus_tag LOCUS_06130 gene rutF 11610 11119 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 protein_id gnl|my_center|LOCUS_06130 12732 11689 gene locus_tag LOCUS_06140 gene metE 12732 11689 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035573.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence039 <1 807 gene locus_tag LOCUS_06150 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ75:elongation factor Ts 1785 979 gene locus_tag LOCUS_06160 gene vII 1785 979 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 protein_id gnl|my_center|LOCUS_06160 2895 2206 gene locus_tag LOCUS_06170 gene lrgB 2895 2206 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 protein_id gnl|my_center|LOCUS_06170 3346 2912 gene locus_tag LOCUS_06180 3346 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 protein_id gnl|my_center|LOCUS_06180 5104 3677 gene locus_tag LOCUS_06190 gene hflX 5104 3677 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ5 protein_id gnl|my_center|LOCUS_06190 5411 6211 gene locus_tag LOCUS_06200 gene plsC 5411 6211 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_06200 7387 6347 gene locus_tag LOCUS_06210 gene tas 7387 6347 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206188.1 protein_id gnl|my_center|LOCUS_06210 7932 7435 gene locus_tag LOCUS_06220 gene yaaD 7932 7435 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM2 protein_id gnl|my_center|LOCUS_06220 8103 8762 gene locus_tag LOCUS_06230 8103 8762 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_06230 9475 8861 gene locus_tag LOCUS_06240 9475 8861 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_06240 9704 10600 gene locus_tag LOCUS_06250 9704 10600 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372093.1 protein_id gnl|my_center|LOCUS_06250 11358 10702 gene locus_tag LOCUS_06260 11358 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 <13561 11351 gene locus_tag LOCUS_06270 <13561 11351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIM4:isoleucine--tRNA ligase >Feature sequence040 27 1499 gene locus_tag LOCUS_06280 gene guaB 27 1499 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB3 protein_id gnl|my_center|LOCUS_06280 1697 3064 gene locus_tag LOCUS_06290 gene glmM 1697 3064 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHB2 protein_id gnl|my_center|LOCUS_06290 3135 3800 gene locus_tag LOCUS_06300 gene pdxH 3135 3800 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX20 protein_id gnl|my_center|LOCUS_06300 5190 3895 gene locus_tag LOCUS_06310 5190 3895 CDS product multidrug resistance efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638835.2 protein_id gnl|my_center|LOCUS_06310 6967 5279 gene locus_tag LOCUS_06320 gene rmrB 6967 5279 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638834.2 protein_id gnl|my_center|LOCUS_06320 7967 7338 gene locus_tag LOCUS_06330 7967 7338 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704478.1 protein_id gnl|my_center|LOCUS_06330 8649 7972 gene locus_tag LOCUS_06340 8649 7972 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268356.1 protein_id gnl|my_center|LOCUS_06340 9972 8923 gene locus_tag LOCUS_06350 9972 8923 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 protein_id gnl|my_center|LOCUS_06350 11353 10142 gene locus_tag LOCUS_06360 gene yqhD 11353 10142 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074098.1 protein_id gnl|my_center|LOCUS_06360 12219 11614 gene locus_tag LOCUS_06370 12219 11614 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence041 <1 586 gene locus_tag LOCUS_06380 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815858.1:hemolysin secretion protein D 686 2683 gene locus_tag LOCUS_06390 gene macB 686 2683 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT1 protein_id gnl|my_center|LOCUS_06390 2867 2942 gene locus_tag LOCUS_t00090 2867 2942 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3145 3220 gene locus_tag LOCUS_t00100 3145 3220 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4083 3295 gene locus_tag LOCUS_06400 4083 3295 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490904.1 protein_id gnl|my_center|LOCUS_06400 6451 4364 gene locus_tag LOCUS_06410 gene katE 6451 4364 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBL0 protein_id gnl|my_center|LOCUS_06410 6875 7666 gene locus_tag LOCUS_06420 6875 7666 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120630.1 protein_id gnl|my_center|LOCUS_06420 8430 7786 gene locus_tag LOCUS_06430 8430 7786 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_06430 8971 8510 gene locus_tag LOCUS_06440 8971 8510 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908387.1 protein_id gnl|my_center|LOCUS_06440 9389 8976 gene locus_tag LOCUS_06450 gene osmC 9389 8976 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_06450 10771 9449 gene locus_tag LOCUS_06460 10771 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 11298 10912 gene locus_tag LOCUS_06470 11298 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 11873 11400 gene locus_tag LOCUS_06480 11873 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 <13413 12022 gene locus_tag LOCUS_06490 <13413 12022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815882.1:amidohydrolase >Feature sequence042 11 86 gene locus_tag LOCUS_t00110 11 86 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 277 609 gene locus_tag LOCUS_06500 277 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 962 1693 gene locus_tag LOCUS_06510 962 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2162 1986 gene locus_tag LOCUS_06520 2162 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2826 2736 gene locus_tag LOCUS_t00120 2826 2736 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4067 2919 gene locus_tag LOCUS_06530 gene epD 4067 2919 CDS product D-erythrose 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_06530 6123 4177 gene locus_tag LOCUS_06540 gene pif1 6123 4177 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_06540 6450 7976 gene locus_tag LOCUS_06550 gene aldA 6450 7976 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_06550 8171 8497 gene locus_tag LOCUS_06560 8171 8497 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 protein_id gnl|my_center|LOCUS_06560 8727 10355 gene locus_tag LOCUS_06570 8727 10355 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_06570 10852 12492 gene locus_tag LOCUS_06580 gene dppA 10852 12492 CDS product periplasmic dipeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523055.1 protein_id gnl|my_center|LOCUS_06580 12675 12499 gene locus_tag LOCUS_06590 12675 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence043 1086 49 gene locus_tag LOCUS_06600 1086 49 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 protein_id gnl|my_center|LOCUS_06600 2253 1447 gene locus_tag LOCUS_06610 gene yadH 2253 1447 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ65 protein_id gnl|my_center|LOCUS_06610 3212 2250 gene locus_tag LOCUS_06620 3212 2250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_06620 4148 3507 gene locus_tag LOCUS_06630 4148 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4517 4593 gene locus_tag LOCUS_t00130 4517 4593 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5083 4724 gene locus_tag LOCUS_06640 5083 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5117 5920 gene locus_tag LOCUS_06650 5117 5920 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_06650 7042 6047 gene locus_tag LOCUS_06660 gene add 7042 6047 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_06660 7759 7235 gene locus_tag LOCUS_06670 7759 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610214.1 protein_id gnl|my_center|LOCUS_06670 9066 7882 gene locus_tag LOCUS_06680 9066 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9816 9190 gene locus_tag LOCUS_06690 9816 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 protein_id gnl|my_center|LOCUS_06690 10824 12362 gene locus_tag LOCUS_06700 gene acp 10824 12362 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207419.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence044 1571 990 gene locus_tag LOCUS_06710 1571 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 protein_id gnl|my_center|LOCUS_06710 2591 1974 gene locus_tag LOCUS_06720 gene metW 2591 1974 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 protein_id gnl|my_center|LOCUS_06720 4027 2588 gene locus_tag LOCUS_06730 gene metX 4027 2588 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_06730 4384 5403 gene locus_tag LOCUS_06740 gene hemH 4384 5403 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG0 protein_id gnl|my_center|LOCUS_06740 5563 6411 gene locus_tag LOCUS_06750 5563 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6873 6523 gene locus_tag LOCUS_06760 6873 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 7677 7141 gene locus_tag LOCUS_06770 7677 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10943 7956 gene locus_tag LOCUS_06780 gene polA 10943 7956 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 protein_id gnl|my_center|LOCUS_06780 11570 11157 gene locus_tag LOCUS_06790 gene osmC 11570 11157 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 protein_id gnl|my_center|LOCUS_06790 11824 12726 gene locus_tag LOCUS_06800 11824 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence045 2446 479 gene locus_tag LOCUS_06810 2446 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4038 2617 gene locus_tag LOCUS_06820 gene engA 4038 2617 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_06820 5544 4324 gene locus_tag LOCUS_06830 gene bamB 5544 4324 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P980 protein_id gnl|my_center|LOCUS_06830 6455 5661 gene locus_tag LOCUS_06840 6455 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7826 6525 gene locus_tag LOCUS_06850 gene hisS 7826 6525 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP9 protein_id gnl|my_center|LOCUS_06850 9066 7951 gene locus_tag LOCUS_06860 gene ispG 9066 7951 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_06860 10011 9196 gene locus_tag LOCUS_06870 10011 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10919 10008 gene locus_tag LOCUS_06880 gene pilF 10919 10008 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_06880 12364 11132 gene locus_tag LOCUS_06890 gene rlmN 12364 11132 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMP4 protein_id gnl|my_center|LOCUS_06890 >Feature sequence046 <1 834 gene locus_tag LOCUS_06900 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9Y9:tRNA pseudouridine synthase D 2129 885 gene locus_tag LOCUS_06910 2129 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3546 2665 gene locus_tag LOCUS_06920 gene trpH 3546 2665 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 protein_id gnl|my_center|LOCUS_06920 3881 4432 gene locus_tag LOCUS_06930 gene ispZ 3881 4432 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNZ2 protein_id gnl|my_center|LOCUS_06930 4524 4841 gene locus_tag LOCUS_06940 4524 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 protein_id gnl|my_center|LOCUS_06940 4838 5269 gene locus_tag LOCUS_06950 4838 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064163.1 protein_id gnl|my_center|LOCUS_06950 5400 7493 gene locus_tag LOCUS_06960 gene mnmC 5400 7493 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPC7 protein_id gnl|my_center|LOCUS_06960 8132 7575 gene locus_tag LOCUS_06970 8132 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 8282 8914 gene locus_tag LOCUS_06980 8282 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 8922 9356 gene locus_tag LOCUS_06990 8922 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_06990 9439 10080 gene locus_tag LOCUS_07000 9439 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10894 10220 gene locus_tag LOCUS_07010 10894 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207443.1 protein_id gnl|my_center|LOCUS_07010 11804 10887 gene locus_tag LOCUS_07020 gene ubiA 11804 10887 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ7 protein_id gnl|my_center|LOCUS_07020 12150 11911 gene locus_tag LOCUS_07030 12150 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 <12846 12268 gene locus_tag LOCUS_07040 <12846 12268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNZ5:ribosomal RNA small subunit methyltransferase J >Feature sequence047 431 880 gene locus_tag LOCUS_07050 431 880 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 protein_id gnl|my_center|LOCUS_07050 2494 956 gene locus_tag LOCUS_07060 2494 956 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ0 protein_id gnl|my_center|LOCUS_07060 2971 3438 gene locus_tag LOCUS_07070 2971 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3518 4543 gene locus_tag LOCUS_07080 gene rpoH 3518 4543 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK7 protein_id gnl|my_center|LOCUS_07080 4568 4942 gene locus_tag LOCUS_07090 4568 4942 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_07090 5101 5301 gene locus_tag LOCUS_07100 5101 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5899 5519 gene locus_tag LOCUS_07110 gene yfiA-2 5899 5519 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_07110 7895 6258 gene locus_tag LOCUS_07120 gene rpoN 7895 6258 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE5 protein_id gnl|my_center|LOCUS_07120 8194 9093 gene locus_tag LOCUS_07130 8194 9093 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 protein_id gnl|my_center|LOCUS_07130 10154 9129 gene locus_tag LOCUS_07140 gene xerC 10154 9129 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL90 protein_id gnl|my_center|LOCUS_07140 11084 10197 gene locus_tag LOCUS_07150 gene dapF 11084 10197 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2V327 protein_id gnl|my_center|LOCUS_07150 12666 11290 gene locus_tag LOCUS_07160 gene lysA 12666 11290 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL94 protein_id gnl|my_center|LOCUS_07160 >Feature sequence048 1394 600 gene locus_tag LOCUS_07170 gene tsx 1394 600 CDS product ion channel protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_07170 2424 1894 gene locus_tag LOCUS_07180 gene allA 2424 1894 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVG9 protein_id gnl|my_center|LOCUS_07180 3542 2424 gene locus_tag LOCUS_07190 gene alc1 3542 2424 CDS product putative allantoicase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T53 protein_id gnl|my_center|LOCUS_07190 4625 3645 gene locus_tag LOCUS_07200 4625 3645 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705419.1 protein_id gnl|my_center|LOCUS_07200 6063 4708 gene locus_tag LOCUS_07210 6063 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6524 6156 gene locus_tag LOCUS_07220 6524 6156 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHE6 protein_id gnl|my_center|LOCUS_07220 7195 6674 gene locus_tag LOCUS_07230 gene uao 7195 6674 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207943.1 protein_id gnl|my_center|LOCUS_07230 7692 8366 gene locus_tag LOCUS_07240 7692 8366 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_07240 9886 8480 gene locus_tag LOCUS_07250 9886 8480 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103273.1 protein_id gnl|my_center|LOCUS_07250 11678 10386 gene locus_tag LOCUS_07260 gene tolB 11678 10386 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL57 protein_id gnl|my_center|LOCUS_07260 >Feature sequence049 1529 888 gene locus_tag LOCUS_07270 1529 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_07270 4128 1996 gene locus_tag LOCUS_07280 gene slt 4128 1996 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_07280 4476 5969 gene locus_tag LOCUS_07290 gene miaB 4476 5969 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPX9 protein_id gnl|my_center|LOCUS_07290 6907 6062 gene locus_tag LOCUS_07300 6907 6062 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266208.1 protein_id gnl|my_center|LOCUS_07300 7289 7053 gene locus_tag LOCUS_07310 7289 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 8636 7422 gene locus_tag LOCUS_07320 gene rtcB 8636 7422 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA2 protein_id gnl|my_center|LOCUS_07320 10192 9464 gene locus_tag LOCUS_07330 10192 9464 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530383.1 protein_id gnl|my_center|LOCUS_07330 11585 10347 gene locus_tag LOCUS_07340 11585 10347 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML86 protein_id gnl|my_center|LOCUS_07340 12330 11677 gene locus_tag LOCUS_07350 12330 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence050 <1 918 gene locus_tag LOCUS_07360 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLN4:ribosome-binding ATPase YchF 1047 1634 gene locus_tag LOCUS_07370 1047 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1713 3122 gene locus_tag LOCUS_07380 gene dgt 1713 3122 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 protein_id gnl|my_center|LOCUS_07380 3296 3907 gene locus_tag LOCUS_07390 3296 3907 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 protein_id gnl|my_center|LOCUS_07390 4987 3929 gene locus_tag LOCUS_07400 gene xcpX 4987 3929 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD0 protein_id gnl|my_center|LOCUS_07400 5847 5035 gene locus_tag LOCUS_07410 gene xcpW 5847 5035 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206597.1 protein_id gnl|my_center|LOCUS_07410 6344 5844 gene locus_tag LOCUS_07420 6344 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 7168 6341 gene locus_tag LOCUS_07430 7168 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7998 7315 gene locus_tag LOCUS_07440 7998 7315 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_07440 9025 8237 gene locus_tag LOCUS_07450 gene ycfH 9025 8237 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_07450 10987 9200 gene locus_tag LOCUS_07460 gene xcpR 10987 9200 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_07460 11903 11046 gene locus_tag LOCUS_07470 11903 11046 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence051 474 1178 gene locus_tag LOCUS_07480 474 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038143.1 protein_id gnl|my_center|LOCUS_07480 2694 1372 gene locus_tag LOCUS_07490 gene rnd 2694 1372 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_07490 3425 2832 gene locus_tag LOCUS_07500 gene recR 3425 2832 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN26 protein_id gnl|my_center|LOCUS_07500 3851 3522 gene locus_tag LOCUS_07510 3851 3522 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN25 protein_id gnl|my_center|LOCUS_07510 5254 3965 gene locus_tag LOCUS_07520 gene metZ 5254 3965 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN23 protein_id gnl|my_center|LOCUS_07520 5576 5349 gene locus_tag LOCUS_07530 5576 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5682 7325 gene locus_tag LOCUS_07540 5682 7325 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808335.1 protein_id gnl|my_center|LOCUS_07540 7544 8848 gene locus_tag LOCUS_07550 7544 8848 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095517.1 protein_id gnl|my_center|LOCUS_07550 8992 9963 gene locus_tag LOCUS_07560 gene dusA 8992 9963 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNA5 protein_id gnl|my_center|LOCUS_07560 10815 10030 gene locus_tag LOCUS_07570 10815 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 11774 10884 gene locus_tag LOCUS_07580 11774 10884 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_07580 <12492 11947 gene locus_tag LOCUS_07590 <12492 11947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207400.1:peptidase S49 >Feature sequence052 <1 1785 gene locus_tag LOCUS_07600 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKQ3:DNA-directed RNA polymerase subunit beta' 1949 2473 gene locus_tag LOCUS_07610 1949 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_07610 5202 2569 gene locus_tag LOCUS_07620 gene ponA 5202 2569 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 protein_id gnl|my_center|LOCUS_07620 5425 6450 gene locus_tag LOCUS_07630 gene pilM 5425 6450 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804529.1 protein_id gnl|my_center|LOCUS_07630 6450 7100 gene locus_tag LOCUS_07640 gene pilN 6450 7100 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 protein_id gnl|my_center|LOCUS_07640 7097 7831 gene locus_tag LOCUS_07650 gene pilO 7097 7831 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207831.1 protein_id gnl|my_center|LOCUS_07650 7831 8364 gene locus_tag LOCUS_07660 gene pilP 7831 8364 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_07660 8392 10749 gene locus_tag LOCUS_07670 gene pilQ 8392 10749 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_07670 10954 11508 gene locus_tag LOCUS_07680 gene aroK 10954 11508 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG11 protein_id gnl|my_center|LOCUS_07680 >Feature sequence053 2503 3969 gene locus_tag LOCUS_07690 gene degP 2503 3969 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207372.1 protein_id gnl|my_center|LOCUS_07690 4198 5406 gene locus_tag LOCUS_07700 4198 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5853 6758 gene locus_tag LOCUS_07710 gene dapA 5853 6758 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_07710 6884 7213 gene locus_tag LOCUS_07720 6884 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 7339 8052 gene locus_tag LOCUS_07730 gene purC 7339 8052 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_07730 8717 8277 gene locus_tag LOCUS_07740 8717 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 9088 9720 gene locus_tag LOCUS_07750 9088 9720 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_07750 9758 10069 gene locus_tag LOCUS_07760 9758 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771691.1 protein_id gnl|my_center|LOCUS_07760 10591 10211 gene locus_tag LOCUS_07770 10591 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 11362 10694 gene locus_tag LOCUS_07780 11362 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence054 358 552 gene locus_tag LOCUS_07790 358 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 542 1402 gene locus_tag LOCUS_07800 gene nadC 542 1402 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 protein_id gnl|my_center|LOCUS_07800 1473 1631 gene locus_tag LOCUS_07810 1473 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1621 2262 gene locus_tag LOCUS_07820 1621 2262 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ01 protein_id gnl|my_center|LOCUS_07820 3031 2429 gene locus_tag LOCUS_07830 3031 2429 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_07830 3190 3960 gene locus_tag LOCUS_07840 3190 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4117 4812 gene locus_tag LOCUS_07850 4117 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4880 5437 gene locus_tag LOCUS_07860 4880 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6489 5563 gene locus_tag LOCUS_07870 gene rluB 6489 5563 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_07870 6918 7796 gene locus_tag LOCUS_07880 gene folD 6918 7796 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLU9 protein_id gnl|my_center|LOCUS_07880 7891 8409 gene locus_tag LOCUS_07890 7891 8409 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_07890 9688 8474 gene locus_tag LOCUS_07900 gene corA 9688 8474 CDS product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_07900 10171 9782 gene locus_tag LOCUS_07910 10171 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 protein_id gnl|my_center|LOCUS_07910 10660 11952 gene locus_tag LOCUS_07920 gene hisZ 10660 11952 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI76 protein_id gnl|my_center|LOCUS_07920 >Feature sequence055 <1 1501 gene locus_tag LOCUS_07930 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206118.1:NADPH-dependent 2,4-dienoyl-CoA reductase 2519 1647 gene locus_tag LOCUS_07940 2519 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2940 2524 gene locus_tag LOCUS_07950 2940 2524 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_07950 4154 3150 gene locus_tag LOCUS_07960 gene lplA 4154 3150 CDS product lipoate-protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS71 protein_id gnl|my_center|LOCUS_07960 4798 4415 gene locus_tag LOCUS_07970 4798 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5363 6292 gene locus_tag LOCUS_07980 5363 6292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 protein_id gnl|my_center|LOCUS_07980 6518 7621 gene locus_tag LOCUS_07990 6518 7621 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 protein_id gnl|my_center|LOCUS_07990 8697 7726 gene locus_tag LOCUS_08000 8697 7726 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 protein_id gnl|my_center|LOCUS_08000 10098 8815 gene locus_tag LOCUS_08010 10098 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence056 771 76 gene locus_tag LOCUS_08020 gene dehII 771 76 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 protein_id gnl|my_center|LOCUS_08020 1453 800 gene locus_tag LOCUS_08030 1453 800 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_08030 1852 2508 gene locus_tag LOCUS_08040 1852 2508 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367810.1 protein_id gnl|my_center|LOCUS_08040 2930 3586 gene locus_tag LOCUS_08050 2930 3586 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968215.1 protein_id gnl|my_center|LOCUS_08050 3583 4575 gene locus_tag LOCUS_08060 3583 4575 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339125.1 protein_id gnl|my_center|LOCUS_08060 4578 7016 gene locus_tag LOCUS_08070 4578 7016 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339126.1 protein_id gnl|my_center|LOCUS_08070 7145 8443 gene locus_tag LOCUS_08080 gene pucA 7145 8443 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_08080 8436 9128 gene locus_tag LOCUS_08090 8436 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037855.1 protein_id gnl|my_center|LOCUS_08090 9145 9708 gene locus_tag LOCUS_08100 9145 9708 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 protein_id gnl|my_center|LOCUS_08100 9797 10891 gene locus_tag LOCUS_08110 9797 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 11553 10888 gene locus_tag LOCUS_08120 11553 10888 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence057 700 1764 gene locus_tag LOCUS_08130 gene bdh1 700 1764 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 protein_id gnl|my_center|LOCUS_08130 2879 1953 gene locus_tag LOCUS_08140 2879 1953 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_08140 3966 3121 gene locus_tag LOCUS_08150 3966 3121 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975379.1 protein_id gnl|my_center|LOCUS_08150 5060 4065 gene locus_tag LOCUS_08160 5060 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5454 5906 gene locus_tag LOCUS_08170 5454 5906 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_08170 6043 6867 gene locus_tag LOCUS_08180 6043 6867 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_08180 7046 8173 gene locus_tag LOCUS_08190 7046 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_08190 8503 9357 gene locus_tag LOCUS_08200 8503 9357 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_08200 9448 10512 gene locus_tag LOCUS_08210 9448 10512 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103266.1 protein_id gnl|my_center|LOCUS_08210 10589 10768 gene locus_tag LOCUS_08220 10589 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10889 11335 gene locus_tag LOCUS_08230 10889 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 <12044 11514 gene locus_tag LOCUS_08240 <12044 11514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206725.1:membrane dipeptidase >Feature sequence058 355 182 gene locus_tag LOCUS_08250 355 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 919 2151 gene locus_tag LOCUS_08260 gene ackA 919 2151 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM8 protein_id gnl|my_center|LOCUS_08260 2283 4430 gene locus_tag LOCUS_08270 gene pta 2283 4430 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM7 protein_id gnl|my_center|LOCUS_08270 4626 5540 gene locus_tag LOCUS_08280 4626 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 5671 6084 gene locus_tag LOCUS_08290 gene rsfS 5671 6084 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_08290 6295 7026 gene locus_tag LOCUS_08300 6295 7026 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185849.1 protein_id gnl|my_center|LOCUS_08300 7082 7582 gene locus_tag LOCUS_08310 7082 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347453.1 protein_id gnl|my_center|LOCUS_08310 7640 8467 gene locus_tag LOCUS_08320 7640 8467 CDS product anhydro-N-acetylmuramyl-tripeptide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016195.1 protein_id gnl|my_center|LOCUS_08320 9656 8550 gene locus_tag LOCUS_08330 9656 8550 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_08330 10113 9670 gene locus_tag LOCUS_08340 10113 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 10845 10564 gene locus_tag LOCUS_08350 10845 10564 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_08350 11170 10835 gene locus_tag LOCUS_08360 11170 10835 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 protein_id gnl|my_center|LOCUS_08360 <11988 11329 gene locus_tag LOCUS_08370 <11988 11329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL47:phosphoribosylformylglycinamidine synthase >Feature sequence059 <1 1831 gene locus_tag LOCUS_08380 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNT4:protein translocase subunit SecA 2077 2607 gene locus_tag LOCUS_08390 2077 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3274 2708 gene locus_tag LOCUS_08400 3274 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4365 3517 gene locus_tag LOCUS_08410 4365 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUR8 protein_id gnl|my_center|LOCUS_08410 6010 4829 gene locus_tag LOCUS_08420 gene thlA 6010 4829 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_08420 7514 6171 gene locus_tag LOCUS_08430 gene hom 7514 6171 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK50 protein_id gnl|my_center|LOCUS_08430 8656 7802 gene locus_tag LOCUS_08440 gene dsbC 8656 7802 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_08440 9035 9964 gene locus_tag LOCUS_08450 9035 9964 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence060 1373 393 gene locus_tag LOCUS_08460 1373 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2627 1482 gene locus_tag LOCUS_08470 gene rluD 2627 1482 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH4 protein_id gnl|my_center|LOCUS_08470 3446 4654 gene locus_tag LOCUS_08480 gene comL 3446 4654 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH3 protein_id gnl|my_center|LOCUS_08480 4811 7012 gene locus_tag LOCUS_08490 gene dnaG 4811 7012 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH2 protein_id gnl|my_center|LOCUS_08490 7487 9412 gene locus_tag LOCUS_08500 gene rpoD 7487 9412 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMF3 protein_id gnl|my_center|LOCUS_08500 9585 9409 gene locus_tag LOCUS_08510 9585 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 9678 10604 gene locus_tag LOCUS_08520 9678 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_08520 10773 11174 gene locus_tag LOCUS_08530 10773 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence061 <1 516 gene locus_tag LOCUS_08540 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555739.1:biotin carboxylase 534 1469 gene locus_tag LOCUS_08550 gene hmgcL 534 1469 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_08550 1511 2698 gene locus_tag LOCUS_08560 gene ivd 1511 2698 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_08560 3550 2822 gene locus_tag LOCUS_08570 gene coaX 3550 2822 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX0 protein_id gnl|my_center|LOCUS_08570 4563 3622 gene locus_tag LOCUS_08580 4563 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4727 5533 gene locus_tag LOCUS_08590 4727 5533 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_08590 5584 6525 gene locus_tag LOCUS_08600 5584 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6592 10524 gene locus_tag LOCUS_08610 gene smc 6592 10524 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX4 protein_id gnl|my_center|LOCUS_08610 >Feature sequence062 635 1732 gene locus_tag LOCUS_08620 635 1732 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_08620 1940 3058 gene locus_tag LOCUS_08630 1940 3058 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 protein_id gnl|my_center|LOCUS_08630 4110 3091 gene locus_tag LOCUS_08640 gene uge 4110 3091 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_08640 5276 4110 gene locus_tag LOCUS_08650 5276 4110 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_08650 6371 5370 gene locus_tag LOCUS_08660 6371 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_08660 6659 7780 gene locus_tag LOCUS_08670 gene wabH 6659 7780 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 protein_id gnl|my_center|LOCUS_08670 8648 7791 gene locus_tag LOCUS_08680 8648 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9545 8754 gene locus_tag LOCUS_08690 9545 8754 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121837.1 protein_id gnl|my_center|LOCUS_08690 10657 9680 gene locus_tag LOCUS_08700 gene htrB 10657 9680 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_08700 <11612 10725 gene locus_tag LOCUS_08710 <11612 10725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207630.1:aspartate--tRNA ligase >Feature sequence063 1332 490 gene locus_tag LOCUS_08720 gene uppP2 1332 490 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_08720 2151 1450 gene locus_tag LOCUS_08730 gene yeaZ 2151 1450 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 protein_id gnl|my_center|LOCUS_08730 3908 2364 gene locus_tag LOCUS_08740 gene ffh 3908 2364 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEW9 protein_id gnl|my_center|LOCUS_08740 4312 5103 gene locus_tag LOCUS_08750 4312 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 6108 5179 gene locus_tag LOCUS_08760 gene purU1 6108 5179 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM37 protein_id gnl|my_center|LOCUS_08760 >Feature sequence064 852 1109 gene locus_tag LOCUS_08770 852 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1346 2575 gene locus_tag LOCUS_08780 gene fadL 1346 2575 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206872.1 protein_id gnl|my_center|LOCUS_08780 2936 4273 gene locus_tag LOCUS_08790 2936 4273 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 protein_id gnl|my_center|LOCUS_08790 6253 4754 gene locus_tag LOCUS_08800 gene opuE 6253 4754 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181816.1 protein_id gnl|my_center|LOCUS_08800 7599 6727 gene locus_tag LOCUS_08810 gene gltC 7599 6727 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 protein_id gnl|my_center|LOCUS_08810 8066 9484 gene locus_tag LOCUS_08820 gene leuC 8066 9484 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM01 protein_id gnl|my_center|LOCUS_08820 9625 10275 gene locus_tag LOCUS_08830 gene leuD 9625 10275 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM02 protein_id gnl|my_center|LOCUS_08830 10431 11153 gene locus_tag LOCUS_08840 10431 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence065 547 1305 gene locus_tag LOCUS_08850 gene ompR 547 1305 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_08850 1385 2575 gene locus_tag LOCUS_08860 gene yeiR 1385 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_08860 2958 2692 gene locus_tag LOCUS_08870 2958 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367587.1 protein_id gnl|my_center|LOCUS_08870 3945 3109 gene locus_tag LOCUS_08880 gene yciK 3945 3109 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_08880 4757 4047 gene locus_tag LOCUS_08890 gene gph2 4757 4047 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_08890 5675 4827 gene locus_tag LOCUS_08900 gene ubiG 5675 4827 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN9 protein_id gnl|my_center|LOCUS_08900 6197 6817 gene locus_tag LOCUS_08910 gene dsbA 6197 6817 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_08910 7427 6915 gene locus_tag LOCUS_08920 7427 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 8442 7477 gene locus_tag LOCUS_08930 8442 7477 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KND0 protein_id gnl|my_center|LOCUS_08930 9394 8483 gene locus_tag LOCUS_08940 gene panC 9394 8483 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC9 protein_id gnl|my_center|LOCUS_08940 10247 9447 gene locus_tag LOCUS_08950 gene panB 10247 9447 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNC8 protein_id gnl|my_center|LOCUS_08950 10889 10365 gene locus_tag LOCUS_08960 gene folK 10889 10365 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43777 protein_id gnl|my_center|LOCUS_08960 >Feature sequence066 769 284 gene locus_tag LOCUS_08970 gene gpo 769 284 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_08970 1347 922 gene locus_tag LOCUS_08980 gene msrB 1347 922 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_08980 1699 1397 gene locus_tag LOCUS_08990 1699 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1767 3413 gene locus_tag LOCUS_09000 1767 3413 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206525.1 protein_id gnl|my_center|LOCUS_09000 5118 3511 gene locus_tag LOCUS_09010 5118 3511 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6H7 protein_id gnl|my_center|LOCUS_09010 7426 5750 gene locus_tag LOCUS_09020 7426 5750 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 protein_id gnl|my_center|LOCUS_09020 7813 8526 gene locus_tag LOCUS_09030 7813 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 8635 9705 gene locus_tag LOCUS_09040 gene ubiE 8635 9705 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD0 protein_id gnl|my_center|LOCUS_09040 9786 10490 gene locus_tag LOCUS_09050 9786 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence067 421 1377 gene locus_tag LOCUS_09060 421 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1364 1615 gene locus_tag LOCUS_09070 1364 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1635 3392 gene locus_tag LOCUS_09080 1635 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3892 4143 gene locus_tag LOCUS_09090 3892 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4220 4465 gene locus_tag LOCUS_09100 4220 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4863 6476 gene locus_tag LOCUS_09110 4863 6476 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705057.1 protein_id gnl|my_center|LOCUS_09110 6853 8223 gene locus_tag LOCUS_09120 6853 8223 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098233.1 protein_id gnl|my_center|LOCUS_09120 8516 9805 gene locus_tag LOCUS_09130 gene citN 8516 9805 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42308 protein_id gnl|my_center|LOCUS_09130 9828 11171 gene locus_tag LOCUS_09140 9828 11171 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence068 1383 334 gene locus_tag LOCUS_09150 1383 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2243 3376 gene locus_tag LOCUS_09160 2243 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3449 5251 gene locus_tag LOCUS_09170 gene acdA 3449 5251 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_09170 5433 6887 gene locus_tag LOCUS_09180 gene yfmT 5433 6887 CDS product putative aldehyde dehydrogenase YfmT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06478 protein_id gnl|my_center|LOCUS_09180 8438 7104 gene locus_tag LOCUS_09190 8438 7104 CDS product amino acid APC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706611.1 protein_id gnl|my_center|LOCUS_09190 9390 8449 gene locus_tag LOCUS_09200 9390 8449 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706612.1 protein_id gnl|my_center|LOCUS_09200 9858 10076 gene locus_tag LOCUS_09210 9858 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 10408 10905 gene locus_tag LOCUS_09220 10408 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence069 373 690 gene locus_tag LOCUS_09230 373 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1261 2943 gene locus_tag LOCUS_09240 gene yidC 1261 2943 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH0 protein_id gnl|my_center|LOCUS_09240 3136 4587 gene locus_tag LOCUS_09250 gene mnmE 3136 4587 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPG9 protein_id gnl|my_center|LOCUS_09250 4675 5133 gene locus_tag LOCUS_09260 gene nrdR 4675 5133 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK33 protein_id gnl|my_center|LOCUS_09260 5248 6303 gene locus_tag LOCUS_09270 gene ribD 5248 6303 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK34 protein_id gnl|my_center|LOCUS_09270 6754 7428 gene locus_tag LOCUS_09280 gene ribC 6754 7428 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 protein_id gnl|my_center|LOCUS_09280 10395 7531 gene locus_tag LOCUS_09290 10395 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence070 <1 1118 gene locus_tag LOCUS_09300 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87PG1:Cbb3-type cytochrome c oxidase subunit 1537 2949 gene locus_tag LOCUS_09310 1537 2949 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 protein_id gnl|my_center|LOCUS_09310 3128 3724 gene locus_tag LOCUS_09320 3128 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_09320 4955 3813 gene locus_tag LOCUS_09330 4955 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5384 6013 gene locus_tag LOCUS_09340 gene queC 5384 6013 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL37 protein_id gnl|my_center|LOCUS_09340 6299 6628 gene locus_tag LOCUS_09350 6299 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6849 7346 gene locus_tag LOCUS_09360 6849 7346 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880283.1 protein_id gnl|my_center|LOCUS_09360 7463 8953 gene locus_tag LOCUS_09370 7463 8953 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 protein_id gnl|my_center|LOCUS_09370 9168 10352 gene locus_tag LOCUS_09380 9168 10352 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886857.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence071 1516 2001 gene locus_tag LOCUS_09390 gene slyD 1516 2001 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_09390 4773 2560 gene locus_tag LOCUS_09400 gene prc 4773 2560 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 protein_id gnl|my_center|LOCUS_09400 5313 6398 gene locus_tag LOCUS_09410 gene nagZ 5313 6398 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN8 protein_id gnl|my_center|LOCUS_09410 8087 6495 gene locus_tag LOCUS_09420 8087 6495 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206198.1 protein_id gnl|my_center|LOCUS_09420 10141 8546 gene locus_tag LOCUS_09430 10141 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 10482 11090 gene locus_tag LOCUS_09440 10482 11090 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence072 1470 196 gene locus_tag LOCUS_09450 gene mutY 1470 196 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 protein_id gnl|my_center|LOCUS_09450 2299 1679 gene locus_tag LOCUS_09460 2299 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3355 2399 gene locus_tag LOCUS_09470 3355 2399 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I94 protein_id gnl|my_center|LOCUS_09470 6484 3506 gene locus_tag LOCUS_09480 6484 3506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 protein_id gnl|my_center|LOCUS_09480 7392 6655 gene locus_tag LOCUS_09490 7392 6655 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 protein_id gnl|my_center|LOCUS_09490 7553 8146 gene locus_tag LOCUS_09500 7553 8146 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI31 protein_id gnl|my_center|LOCUS_09500 9339 8170 gene locus_tag LOCUS_09510 9339 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 9674 9378 gene locus_tag LOCUS_09520 9674 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 9793 10656 gene locus_tag LOCUS_09530 gene corC 9793 10656 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence073 <1 1261 gene locus_tag LOCUS_09540 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMY6:cysteine desulfurase IscS 1415 1822 gene locus_tag LOCUS_09550 gene iscU 1415 1822 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57074 protein_id gnl|my_center|LOCUS_09550 2034 2354 gene locus_tag LOCUS_09560 2034 2354 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_09560 2438 3019 gene locus_tag LOCUS_09570 gene hscB 2438 3019 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z8 protein_id gnl|my_center|LOCUS_09570 3226 5097 gene locus_tag LOCUS_09580 gene hscA 3226 5097 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY2 protein_id gnl|my_center|LOCUS_09580 5189 5527 gene locus_tag LOCUS_09590 gene fdx 5189 5527 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_09590 6721 5612 gene locus_tag LOCUS_09600 6721 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7802 7371 gene locus_tag LOCUS_09610 7802 7371 CDS product histidine triad domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_09610 <11099 7971 gene locus_tag LOCUS_09620 <11099 7971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMX8:transcription-repair-coupling factor >Feature sequence074 165 869 gene locus_tag LOCUS_09630 165 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2035 1061 gene locus_tag LOCUS_09640 2035 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 protein_id gnl|my_center|LOCUS_09640 2334 3101 gene locus_tag LOCUS_09650 2334 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3350 4495 gene locus_tag LOCUS_09660 3350 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4505 5452 gene locus_tag LOCUS_09670 4505 5452 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 protein_id gnl|my_center|LOCUS_09670 5694 6965 gene locus_tag LOCUS_09680 5694 6965 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268482.1 protein_id gnl|my_center|LOCUS_09680 7039 8481 gene locus_tag LOCUS_09690 7039 8481 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268483.1 protein_id gnl|my_center|LOCUS_09690 8618 10108 gene locus_tag LOCUS_09700 8618 10108 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406390.1 protein_id gnl|my_center|LOCUS_09700 10307 10927 gene locus_tag LOCUS_09710 10307 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence075 180 1964 gene locus_tag LOCUS_09720 gene leuA-2 180 1964 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_09720 2241 2867 gene locus_tag LOCUS_09730 2241 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4408 3047 gene locus_tag LOCUS_09740 gene accC 4408 3047 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115704.1 protein_id gnl|my_center|LOCUS_09740 4965 4534 gene locus_tag LOCUS_09750 gene accB 4965 4534 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 protein_id gnl|my_center|LOCUS_09750 6573 5206 gene locus_tag LOCUS_09760 gene norM 6573 5206 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 protein_id gnl|my_center|LOCUS_09760 7512 7024 gene locus_tag LOCUS_09770 7512 7024 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_09770 7828 9135 gene locus_tag LOCUS_09780 7828 9135 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 protein_id gnl|my_center|LOCUS_09780 9371 9231 gene locus_tag LOCUS_09790 9371 9231 CDS product entericidin, EcnA/B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 protein_id gnl|my_center|LOCUS_09790 9634 10191 gene locus_tag LOCUS_09800 gene trmL 9634 10191 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLR4 protein_id gnl|my_center|LOCUS_09800 10662 10300 gene locus_tag LOCUS_09810 gene tusE 10662 10300 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGF7 protein_id gnl|my_center|LOCUS_09810 >Feature sequence076 <1 924 gene locus_tag LOCUS_09820 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225586.1:Na+/H+ antiporter NhaC 1624 1983 gene locus_tag LOCUS_09830 1624 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_09830 2169 2897 gene locus_tag LOCUS_09840 2169 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2902 3435 gene locus_tag LOCUS_09850 2902 3435 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 protein_id gnl|my_center|LOCUS_09850 3435 3848 gene locus_tag LOCUS_09860 3435 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4810 3905 gene locus_tag LOCUS_09870 4810 3905 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_09870 5043 5756 gene locus_tag LOCUS_09880 5043 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_09880 5824 6777 gene locus_tag LOCUS_09890 5824 6777 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D3 protein_id gnl|my_center|LOCUS_09890 6986 7597 gene locus_tag LOCUS_09900 6986 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 protein_id gnl|my_center|LOCUS_09900 8205 7771 gene locus_tag LOCUS_09910 8205 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 protein_id gnl|my_center|LOCUS_09910 9164 8430 gene locus_tag LOCUS_09920 gene pnuC 9164 8430 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263385.1 protein_id gnl|my_center|LOCUS_09920 10328 9285 gene locus_tag LOCUS_09930 gene nadR 10328 9285 CDS product trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209221.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence077 1284 226 gene locus_tag LOCUS_09940 1284 226 CDS product acetylpolyamine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526398.1 protein_id gnl|my_center|LOCUS_09940 2608 1400 gene locus_tag LOCUS_09950 gene caiB 2608 1400 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206431.1 protein_id gnl|my_center|LOCUS_09950 3998 2814 gene locus_tag LOCUS_09960 3998 2814 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_09960 4174 5004 gene locus_tag LOCUS_09970 4174 5004 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_09970 6821 5049 gene locus_tag LOCUS_09980 6821 5049 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HG0 protein_id gnl|my_center|LOCUS_09980 8521 6818 gene locus_tag LOCUS_09990 8521 6818 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882787.1 protein_id gnl|my_center|LOCUS_09990 8758 9663 gene locus_tag LOCUS_10000 8758 9663 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_10000 <10515 9914 gene locus_tag LOCUS_10010 <10515 9914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122266.1:Fis family transcriptional regulator >Feature sequence078 577 2463 gene locus_tag LOCUS_10020 gene parE 577 2463 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHF2 protein_id gnl|my_center|LOCUS_10020 2819 3343 gene locus_tag LOCUS_10030 gene plsC2 2819 3343 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 protein_id gnl|my_center|LOCUS_10030 4232 3450 gene locus_tag LOCUS_10040 4232 3450 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_10040 4527 6002 gene locus_tag LOCUS_10050 4527 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 7803 6133 gene locus_tag LOCUS_10060 7803 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 protein_id gnl|my_center|LOCUS_10060 8266 8997 gene locus_tag LOCUS_10070 gene fklB 8266 8997 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_10070 10406 9099 gene locus_tag LOCUS_10080 gene argA 10406 9099 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIN4 protein_id gnl|my_center|LOCUS_10080 >Feature sequence079 <1 1653 gene locus_tag LOCUS_10090 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208390.1:hybrid sensor histidine kinase/response regulator 1859 2671 gene locus_tag LOCUS_10100 gene ech1 1859 2671 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_10100 2743 3546 gene locus_tag LOCUS_10110 2743 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3860 5119 gene locus_tag LOCUS_10120 gene bcr 3860 5119 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 protein_id gnl|my_center|LOCUS_10120 5463 6329 gene locus_tag LOCUS_10130 5463 6329 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_10130 6342 8552 gene locus_tag LOCUS_10140 6342 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 8615 8977 gene locus_tag LOCUS_10150 gene cheY 8615 8977 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4H5 protein_id gnl|my_center|LOCUS_10150 9008 9457 gene locus_tag LOCUS_10160 9008 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 9496 9945 gene locus_tag LOCUS_10170 9496 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence080 859 2274 gene locus_tag LOCUS_10180 859 2274 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_10180 2627 4732 gene locus_tag LOCUS_10190 gene metG 2627 4732 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV3 protein_id gnl|my_center|LOCUS_10190 5259 4855 gene locus_tag LOCUS_10200 5259 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5881 6942 gene locus_tag LOCUS_10210 5881 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_10210 7051 8085 gene locus_tag LOCUS_10220 7051 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064003.1 protein_id gnl|my_center|LOCUS_10220 8527 9426 gene locus_tag LOCUS_10230 8527 9426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 protein_id gnl|my_center|LOCUS_10230 9491 10285 gene locus_tag LOCUS_10240 9491 10285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195287.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence081 2128 1265 gene locus_tag LOCUS_10250 2128 1265 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114205.1 protein_id gnl|my_center|LOCUS_10250 2805 4061 gene locus_tag LOCUS_10260 2805 4061 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_10260 4247 4942 gene locus_tag LOCUS_10270 4247 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5752 5096 gene locus_tag LOCUS_10280 5752 5096 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088392.1 protein_id gnl|my_center|LOCUS_10280 6104 7393 gene locus_tag LOCUS_10290 6104 7393 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891864.1 protein_id gnl|my_center|LOCUS_10290 7999 9018 gene locus_tag LOCUS_10300 7999 9018 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071167.1 protein_id gnl|my_center|LOCUS_10300 9136 9591 gene locus_tag LOCUS_10310 gene tctB 9136 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208457.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence082 2060 183 gene locus_tag LOCUS_10320 gene secD 2060 183 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY6 protein_id gnl|my_center|LOCUS_10320 2752 2423 gene locus_tag LOCUS_10330 gene yajC 2752 2423 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_10330 3538 3344 gene locus_tag LOCUS_10340 3538 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3537 4547 gene locus_tag LOCUS_10350 3537 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_10350 4776 5270 gene locus_tag LOCUS_10360 4776 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5581 8589 gene locus_tag LOCUS_10370 gene mltD 5581 8589 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 protein_id gnl|my_center|LOCUS_10370 9943 8735 gene locus_tag LOCUS_10380 gene yfhD 9943 8735 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence083 55 222 gene locus_tag LOCUS_10390 55 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2146 446 gene locus_tag LOCUS_10400 2146 446 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_10400 2505 3698 gene locus_tag LOCUS_10410 2505 3698 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_10410 3700 5130 gene locus_tag LOCUS_10420 3700 5130 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_10420 5157 6536 gene locus_tag LOCUS_10430 gene alkT 5157 6536 CDS product Rubredoxin-NAD(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK9 protein_id gnl|my_center|LOCUS_10430 6547 7863 gene locus_tag LOCUS_10440 6547 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_10440 7882 8232 gene locus_tag LOCUS_10450 7882 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 8446 9369 gene locus_tag LOCUS_10460 8446 9369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527957.1 protein_id gnl|my_center|LOCUS_10460 <10261 9400 gene locus_tag LOCUS_10470 <10261 9400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967910.1:AraC family transcriptional regulator >Feature sequence084 <1 742 gene locus_tag LOCUS_10480 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038380.1:flavin monoamine oxidase 846 1547 gene locus_tag LOCUS_10490 846 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2007 1594 gene locus_tag LOCUS_10500 2007 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_10500 2624 2082 gene locus_tag LOCUS_10510 2624 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3368 2667 gene locus_tag LOCUS_10520 3368 2667 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_10520 5207 3447 gene locus_tag LOCUS_10530 5207 3447 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_10530 6363 5425 gene locus_tag LOCUS_10540 6363 5425 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_10540 6811 6389 gene locus_tag LOCUS_10550 6811 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7575 7111 gene locus_tag LOCUS_10560 7575 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 <10227 7658 gene locus_tag LOCUS_10570 <10227 7658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205034.1:outer membrane protein >Feature sequence085 1239 517 gene locus_tag LOCUS_10580 1239 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1841 1311 gene locus_tag LOCUS_10590 gene moaB1 1841 1311 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX98 protein_id gnl|my_center|LOCUS_10590 3053 1953 gene locus_tag LOCUS_10600 gene moaA 3053 1953 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC0 protein_id gnl|my_center|LOCUS_10600 4470 3175 gene locus_tag LOCUS_10610 gene moeA 4470 3175 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45210 protein_id gnl|my_center|LOCUS_10610 6144 4918 gene locus_tag LOCUS_10620 6144 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_10620 7065 6286 gene locus_tag LOCUS_10630 gene nlpD 7065 6286 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 protein_id gnl|my_center|LOCUS_10630 8098 7247 gene locus_tag LOCUS_10640 gene surE 8098 7247 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX0 protein_id gnl|my_center|LOCUS_10640 8701 9045 gene locus_tag LOCUS_10650 8701 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence086 934 374 gene locus_tag LOCUS_10660 934 374 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 protein_id gnl|my_center|LOCUS_10660 1380 2903 gene locus_tag LOCUS_10670 1380 2903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217121.1 protein_id gnl|my_center|LOCUS_10670 3056 4900 gene locus_tag LOCUS_10680 gene uvrC 3056 4900 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS7 protein_id gnl|my_center|LOCUS_10680 5585 4998 gene locus_tag LOCUS_10690 gene folA 5585 4998 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM43 protein_id gnl|my_center|LOCUS_10690 6525 5665 gene locus_tag LOCUS_10700 gene thyA 6525 5665 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM44 protein_id gnl|my_center|LOCUS_10700 7308 6574 gene locus_tag LOCUS_10710 7308 6574 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074041.1 protein_id gnl|my_center|LOCUS_10710 8208 7324 gene locus_tag LOCUS_10720 gene lgt 8208 7324 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM47 protein_id gnl|my_center|LOCUS_10720 9218 8520 gene locus_tag LOCUS_10730 9218 8520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 protein_id gnl|my_center|LOCUS_10730 <10182 9352 gene locus_tag LOCUS_10740 <10182 9352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269028.1:ABC transporter ATP-binding protein >Feature sequence087 389 1597 gene locus_tag LOCUS_10750 389 1597 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 protein_id gnl|my_center|LOCUS_10750 1758 3125 gene locus_tag LOCUS_10760 gene des6 1758 3125 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_10760 3350 3643 gene locus_tag LOCUS_10770 3350 3643 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810239.1 protein_id gnl|my_center|LOCUS_10770 3753 4046 gene locus_tag LOCUS_10780 gene pcbD 3753 4046 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L66 protein_id gnl|my_center|LOCUS_10780 4309 4154 gene locus_tag LOCUS_10790 4309 4154 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI32 protein_id gnl|my_center|LOCUS_10790 4722 6008 gene locus_tag LOCUS_10800 4722 6008 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_10800 6515 7345 gene locus_tag LOCUS_10810 6515 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7611 8141 gene locus_tag LOCUS_10820 7611 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 <10155 8265 gene locus_tag LOCUS_10830 <10155 8265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116875.1:RNA-binding transcriptional accessory protein >Feature sequence088 1685 549 gene locus_tag LOCUS_10840 1685 549 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 protein_id gnl|my_center|LOCUS_10840 3463 2084 gene locus_tag LOCUS_10850 gene hemA 3463 2084 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T4 protein_id gnl|my_center|LOCUS_10850 4200 4021 gene locus_tag LOCUS_10860 4200 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4278 5963 gene locus_tag LOCUS_10870 4278 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 protein_id gnl|my_center|LOCUS_10870 6200 6763 gene locus_tag LOCUS_10880 gene lolB 6200 6763 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG8 protein_id gnl|my_center|LOCUS_10880 6854 7816 gene locus_tag LOCUS_10890 gene ispE 6854 7816 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG7 protein_id gnl|my_center|LOCUS_10890 8727 7828 gene locus_tag LOCUS_10900 8727 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 9137 8835 gene locus_tag LOCUS_10910 9137 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 9749 9309 gene locus_tag LOCUS_10920 9749 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 10045 10120 gene locus_tag LOCUS_t00140 10045 10120 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 1853 21 gene locus_tag LOCUS_10930 gene ilvI 1853 21 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT6 protein_id gnl|my_center|LOCUS_10930 2686 3183 gene locus_tag LOCUS_10940 2686 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4998 3202 gene locus_tag LOCUS_10950 gene yjeF 4998 3202 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM73 protein_id gnl|my_center|LOCUS_10950 5246 6415 gene locus_tag LOCUS_10960 gene queG 5246 6415 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM72 protein_id gnl|my_center|LOCUS_10960 7034 6525 gene locus_tag LOCUS_10970 gene ygaU 7034 6525 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_10970 7530 7294 gene locus_tag LOCUS_10980 gene acpP 7530 7294 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ5 protein_id gnl|my_center|LOCUS_10980 8519 7791 gene locus_tag LOCUS_10990 gene fabG 8519 7791 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_10990 9484 8516 gene locus_tag LOCUS_11000 gene fabD 9484 8516 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ3 protein_id gnl|my_center|LOCUS_11000 10087 9905 gene locus_tag LOCUS_11010 gene rpmF 10087 9905 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ2 protein_id gnl|my_center|LOCUS_11010 >Feature sequence090 795 1496 gene locus_tag LOCUS_11020 795 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1545 3740 gene locus_tag LOCUS_11030 1545 3740 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_11030 5184 3832 gene locus_tag LOCUS_11040 gene dadA 5184 3832 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930578.1 protein_id gnl|my_center|LOCUS_11040 6004 5249 gene locus_tag LOCUS_11050 6004 5249 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 protein_id gnl|my_center|LOCUS_11050 6327 6680 gene locus_tag LOCUS_11060 gene phnA 6327 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_11060 6787 8088 gene locus_tag LOCUS_11070 gene hemL 6787 8088 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF5 protein_id gnl|my_center|LOCUS_11070 8371 10092 gene locus_tag LOCUS_11080 gene fadD 8371 10092 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206871.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence091 866 1489 gene locus_tag LOCUS_11090 gene trpG 866 1489 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_11090 1572 2690 gene locus_tag LOCUS_11100 gene trpD 1572 2690 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJR5 protein_id gnl|my_center|LOCUS_11100 2801 3646 gene locus_tag LOCUS_11110 gene trpC 2801 3646 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A03 protein_id gnl|my_center|LOCUS_11110 3740 4471 gene locus_tag LOCUS_11120 3740 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_11120 4642 5274 gene locus_tag LOCUS_11130 4642 5274 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 protein_id gnl|my_center|LOCUS_11130 7164 5317 gene locus_tag LOCUS_11140 7164 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7675 8457 gene locus_tag LOCUS_11150 7675 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11150 8458 9567 gene locus_tag LOCUS_11160 8458 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11160 >Feature sequence092 432 995 gene locus_tag LOCUS_11170 432 995 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_11170 1449 2198 gene locus_tag LOCUS_11180 gene etfB 1449 2198 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 protein_id gnl|my_center|LOCUS_11180 2340 3272 gene locus_tag LOCUS_11190 gene etfA 2340 3272 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_11190 4272 3478 gene locus_tag LOCUS_11200 4272 3478 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 protein_id gnl|my_center|LOCUS_11200 5352 4369 gene locus_tag LOCUS_11210 gene fbp 5352 4369 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL60 protein_id gnl|my_center|LOCUS_11210 5739 6812 gene locus_tag LOCUS_11220 gene pyrB 5739 6812 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI91 protein_id gnl|my_center|LOCUS_11220 6872 8083 gene locus_tag LOCUS_11230 gene pyrX 6872 8083 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_11230 8140 8625 gene locus_tag LOCUS_11240 8140 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 <9842 8738 gene locus_tag LOCUS_11250 <9842 8738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405216.1:sodium:proton antiporter >Feature sequence093 190 966 gene locus_tag LOCUS_11260 190 966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022136.1 protein_id gnl|my_center|LOCUS_11260 1795 956 gene locus_tag LOCUS_11270 1795 956 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234132.1 protein_id gnl|my_center|LOCUS_11270 2074 2970 gene locus_tag LOCUS_11280 gene queF 2074 2970 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ66 protein_id gnl|my_center|LOCUS_11280 4764 3046 gene locus_tag LOCUS_11290 gene proS 4764 3046 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN72 protein_id gnl|my_center|LOCUS_11290 5354 6094 gene locus_tag LOCUS_11300 5354 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7739 6117 gene locus_tag LOCUS_11310 7739 6117 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097551.1 protein_id gnl|my_center|LOCUS_11310 7951 8622 gene locus_tag LOCUS_11320 gene trpF 7951 8622 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNU7 protein_id gnl|my_center|LOCUS_11320 >Feature sequence094 7128 2671 gene locus_tag LOCUS_11330 7128 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 7531 8058 gene locus_tag LOCUS_11340 7531 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8132 8941 gene locus_tag LOCUS_11350 8132 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9012 9087 gene locus_tag LOCUS_t00150 9012 9087 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence095 <1 1158 gene locus_tag LOCUS_11360 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208146.1:membrane protein 1943 1260 gene locus_tag LOCUS_11370 1943 1260 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206937.1 protein_id gnl|my_center|LOCUS_11370 2228 3145 gene locus_tag LOCUS_11380 2228 3145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_11380 3771 3358 gene locus_tag LOCUS_11390 gene osmC 3771 3358 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 protein_id gnl|my_center|LOCUS_11390 3937 4797 gene locus_tag LOCUS_11400 3937 4797 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477402.1 protein_id gnl|my_center|LOCUS_11400 4843 5631 gene locus_tag LOCUS_11410 4843 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5912 6241 gene locus_tag LOCUS_11420 5912 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7132 6380 gene locus_tag LOCUS_11430 7132 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7795 7301 gene locus_tag LOCUS_11440 7795 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 <9614 7986 gene locus_tag LOCUS_11450 <9614 7986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206207.1:ATP-dependent helicase >Feature sequence096 787 1686 gene locus_tag LOCUS_11460 gene aaeR 787 1686 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 protein_id gnl|my_center|LOCUS_11460 2980 1799 gene locus_tag LOCUS_11470 gene argD 2980 1799 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT7 protein_id gnl|my_center|LOCUS_11470 3213 3022 gene locus_tag LOCUS_11480 gene yacG 3213 3022 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLG2 protein_id gnl|my_center|LOCUS_11480 3396 4067 gene locus_tag LOCUS_11490 gene trmB 3396 4067 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 protein_id gnl|my_center|LOCUS_11490 5604 4198 gene locus_tag LOCUS_11500 gene cabC1 5604 4198 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_11500 7301 5991 gene locus_tag LOCUS_11510 gene purD 7301 5991 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW7 protein_id gnl|my_center|LOCUS_11510 7423 7629 gene locus_tag LOCUS_11520 7423 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence097 2028 1378 gene locus_tag LOCUS_11530 2028 1378 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_11530 2166 3029 gene locus_tag LOCUS_11540 2166 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4204 3143 gene locus_tag LOCUS_11550 4204 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4985 4410 gene locus_tag LOCUS_11560 4985 4410 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_11560 6371 5082 gene locus_tag LOCUS_11570 gene hmgB 6371 5082 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_11570 7766 6570 gene locus_tag LOCUS_11580 gene tyrB 7766 6570 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYA1 protein_id gnl|my_center|LOCUS_11580 8871 7924 gene locus_tag LOCUS_11590 8871 7924 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975043.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence098 1677 721 gene locus_tag LOCUS_11600 1677 721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364557.1 protein_id gnl|my_center|LOCUS_11600 2048 3253 gene locus_tag LOCUS_11610 2048 3253 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_11610 3479 4447 gene locus_tag LOCUS_11620 3479 4447 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124947.1 protein_id gnl|my_center|LOCUS_11620 4502 5323 gene locus_tag LOCUS_11630 4502 5323 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_11630 5363 6088 gene locus_tag LOCUS_11640 5363 6088 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_11640 6182 6850 gene locus_tag LOCUS_11650 6182 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_11650 6943 7986 gene locus_tag LOCUS_11660 6943 7986 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_11660 9044 8151 gene locus_tag LOCUS_11670 gene mtnP 9044 8151 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 protein_id gnl|my_center|LOCUS_11670 >Feature sequence099 737 78 gene locus_tag LOCUS_11680 737 78 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_11680 968 2119 gene locus_tag LOCUS_11690 gene tgt 968 2119 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY4 protein_id gnl|my_center|LOCUS_11690 2363 2229 gene locus_tag LOCUS_11700 2363 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3910 2393 gene locus_tag LOCUS_11710 3910 2393 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL7 protein_id gnl|my_center|LOCUS_11710 4976 4197 gene locus_tag LOCUS_11720 gene lpxA2 4976 4197 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 protein_id gnl|my_center|LOCUS_11720 5686 5150 gene locus_tag LOCUS_11730 gene fabZ 5686 5150 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC6 protein_id gnl|my_center|LOCUS_11730 6751 5735 gene locus_tag LOCUS_11740 gene lpxD 6751 5735 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC7 protein_id gnl|my_center|LOCUS_11740 9276 6898 gene locus_tag LOCUS_11750 gene yaeT 9276 6898 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGC9 protein_id gnl|my_center|LOCUS_11750 >Feature sequence100 360 1088 gene locus_tag LOCUS_11760 360 1088 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366939.1 protein_id gnl|my_center|LOCUS_11760 1092 1715 gene locus_tag LOCUS_11770 gene pcaG 1092 1715 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 protein_id gnl|my_center|LOCUS_11770 1797 3017 gene locus_tag LOCUS_11780 1797 3017 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268471.1 protein_id gnl|my_center|LOCUS_11780 3063 3737 gene locus_tag LOCUS_11790 gene catI 3063 3737 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 protein_id gnl|my_center|LOCUS_11790 3734 4384 gene locus_tag LOCUS_11800 gene pcaJ 3734 4384 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_11800 4617 5144 gene locus_tag LOCUS_11810 4617 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5141 6430 gene locus_tag LOCUS_11820 5141 6430 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_11820 6575 6793 gene locus_tag LOCUS_11830 6575 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_11830 6958 8010 gene locus_tag LOCUS_11840 6958 8010 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_11840 8052 8657 gene locus_tag LOCUS_11850 8052 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9243 8701 gene locus_tag LOCUS_11860 9243 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence101 685 1959 gene locus_tag LOCUS_11870 685 1959 CDS product UPF0053 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44717 protein_id gnl|my_center|LOCUS_11870 2801 2064 gene locus_tag LOCUS_11880 gene yggS 2801 2064 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 protein_id gnl|my_center|LOCUS_11880 3171 4226 gene locus_tag LOCUS_11890 gene pilT 3171 4226 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_11890 4353 5474 gene locus_tag LOCUS_11900 gene pilU 4353 5474 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 protein_id gnl|my_center|LOCUS_11900 6044 5610 gene locus_tag LOCUS_11910 gene fur 6044 5610 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_11910 6380 6784 gene locus_tag LOCUS_11920 gene bamE 6380 6784 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_11920 7201 6827 gene locus_tag LOCUS_11930 7201 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8319 7189 gene locus_tag LOCUS_11940 8319 7189 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205981.1 protein_id gnl|my_center|LOCUS_11940 <9362 8632 gene locus_tag LOCUS_11950 <9362 8632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074258.1:cytochrome c >Feature sequence102 1826 1149 gene locus_tag LOCUS_11960 1826 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2025 2927 gene locus_tag LOCUS_11970 2025 2927 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262935.1 protein_id gnl|my_center|LOCUS_11970 3178 3645 gene locus_tag LOCUS_11980 3178 3645 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890146.1 protein_id gnl|my_center|LOCUS_11980 3836 4189 gene locus_tag LOCUS_11990 3836 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11990 4410 5219 gene locus_tag LOCUS_12000 4410 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 6496 5402 gene locus_tag LOCUS_12010 gene frp 6496 5402 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035562.1 protein_id gnl|my_center|LOCUS_12010 7559 6669 gene locus_tag LOCUS_12020 7559 6669 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930020.1 protein_id gnl|my_center|LOCUS_12020 7747 8520 gene locus_tag LOCUS_12030 7747 8520 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704586.1 protein_id gnl|my_center|LOCUS_12030 8517 8858 gene locus_tag LOCUS_12040 8517 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence103 876 478 gene locus_tag LOCUS_12050 876 478 CDS product DUF962 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207325.1 protein_id gnl|my_center|LOCUS_12050 1323 2840 gene locus_tag LOCUS_12060 gene ppx 1323 2840 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_12060 3006 3809 gene locus_tag LOCUS_12070 gene accA 3006 3809 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF1 protein_id gnl|my_center|LOCUS_12070 3976 5538 gene locus_tag LOCUS_12080 3976 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 6083 5571 gene locus_tag LOCUS_12090 6083 5571 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462440.1 protein_id gnl|my_center|LOCUS_12090 6302 7135 gene locus_tag LOCUS_12100 gene proC 6302 7135 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 protein_id gnl|my_center|LOCUS_12100 7278 7847 gene locus_tag LOCUS_12110 7278 7847 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 protein_id gnl|my_center|LOCUS_12110 8784 7990 gene locus_tag LOCUS_12120 gene thiED 8784 7990 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 protein_id gnl|my_center|LOCUS_12120 9128 9217 gene locus_tag LOCUS_t00160 9128 9217 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104 <1 762 gene locus_tag LOCUS_12130 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208238.1:2-octaprenylphenol hydroxylase 859 2286 gene locus_tag LOCUS_12140 859 2286 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310399.1 protein_id gnl|my_center|LOCUS_12140 3368 2385 gene locus_tag LOCUS_12150 gene ruvB 3368 2385 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL50 protein_id gnl|my_center|LOCUS_12150 4160 3540 gene locus_tag LOCUS_12160 gene ruvA 4160 3540 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL49 protein_id gnl|my_center|LOCUS_12160 5282 4248 gene locus_tag LOCUS_12170 gene fba 5282 4248 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 protein_id gnl|my_center|LOCUS_12170 6064 5678 gene locus_tag LOCUS_12180 6064 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7533 6319 gene locus_tag LOCUS_12190 gene pgk 7533 6319 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMA8 protein_id gnl|my_center|LOCUS_12190 7965 8294 gene locus_tag LOCUS_12200 7965 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8993 8322 gene locus_tag LOCUS_12210 gene thiE 8993 8322 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKF6 protein_id gnl|my_center|LOCUS_12210 >Feature sequence105 576 1664 gene locus_tag LOCUS_12220 576 1664 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 protein_id gnl|my_center|LOCUS_12220 1761 2531 gene locus_tag LOCUS_12230 1761 2531 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 protein_id gnl|my_center|LOCUS_12230 3919 2630 gene locus_tag LOCUS_12240 3919 2630 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_12240 4322 4597 gene locus_tag LOCUS_12250 4322 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4670 6088 gene locus_tag LOCUS_12260 4670 6088 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_12260 6160 6807 gene locus_tag LOCUS_12270 gene trpG 6160 6807 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_12270 7541 7185 gene locus_tag LOCUS_12280 7541 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8066 9019 gene locus_tag LOCUS_12290 8066 9019 CDS product drug/metabolite transporter 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867202.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence106 49 948 gene locus_tag LOCUS_12300 49 948 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_12300 1892 1068 gene locus_tag LOCUS_12310 1892 1068 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_12310 5274 1921 gene locus_tag LOCUS_12320 5274 1921 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_12320 6897 5824 gene locus_tag LOCUS_12330 6897 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963134.1 protein_id gnl|my_center|LOCUS_12330 8198 6972 gene locus_tag LOCUS_12340 8198 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8955 8188 gene locus_tag LOCUS_12350 8955 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12350 >Feature sequence107 65 1009 gene locus_tag LOCUS_12360 gene cysW 65 1009 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225368.1 protein_id gnl|my_center|LOCUS_12360 1122 1844 gene locus_tag LOCUS_12370 1122 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2309 1980 gene locus_tag LOCUS_12380 2309 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2672 2863 gene locus_tag LOCUS_12390 2672 2863 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214037.1 protein_id gnl|my_center|LOCUS_12390 3247 3735 gene locus_tag LOCUS_12400 3247 3735 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8H9 protein_id gnl|my_center|LOCUS_12400 3796 4278 gene locus_tag LOCUS_12410 gene bfrB 3796 4278 CDS product putative bacterioferritin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63700 protein_id gnl|my_center|LOCUS_12410 4813 4328 gene locus_tag LOCUS_12420 gene yjaB 4813 4328 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_12420 6205 4829 gene locus_tag LOCUS_12430 6205 4829 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244170.1 protein_id gnl|my_center|LOCUS_12430 6565 7404 gene locus_tag LOCUS_12440 6565 7404 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368536.1 protein_id gnl|my_center|LOCUS_12440 7658 8749 gene locus_tag LOCUS_12450 gene rpfI 7658 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence108 2834 1059 gene locus_tag LOCUS_12460 2834 1059 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536471.1 protein_id gnl|my_center|LOCUS_12460 4389 3142 gene locus_tag LOCUS_12470 gene norW 4389 3142 CDS product nitric oxide reductase FlRd-NAD(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CL7 protein_id gnl|my_center|LOCUS_12470 5104 4493 gene locus_tag LOCUS_12480 5104 4493 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_12480 6058 5255 gene locus_tag LOCUS_12490 6058 5255 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268728.1 protein_id gnl|my_center|LOCUS_12490 6040 6216 gene locus_tag LOCUS_12500 6040 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6832 6161 gene locus_tag LOCUS_12510 6832 6161 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_12510 7575 6829 gene locus_tag LOCUS_12520 7575 6829 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082767.1 protein_id gnl|my_center|LOCUS_12520 8651 7665 gene locus_tag LOCUS_12530 8651 7665 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence109 <1 919 gene locus_tag LOCUS_12540 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116482.1:AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit 955 4182 gene locus_tag LOCUS_12550 gene acrB2 955 4182 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_12550 4182 5990 gene locus_tag LOCUS_12560 gene oprM 4182 5990 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 protein_id gnl|my_center|LOCUS_12560 6281 7288 gene locus_tag LOCUS_12570 gene hemB 6281 7288 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFN7 protein_id gnl|my_center|LOCUS_12570 8387 7410 gene locus_tag LOCUS_12580 8387 7410 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence110 <1 675 gene locus_tag LOCUS_12590 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004201777.1:peptidase 809 1294 gene locus_tag LOCUS_12600 809 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1421 1969 gene locus_tag LOCUS_12610 1421 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2089 2544 gene locus_tag LOCUS_12620 gene rlmH 2089 2544 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ0 protein_id gnl|my_center|LOCUS_12620 2704 3519 gene locus_tag LOCUS_12630 2704 3519 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_12630 5057 3564 gene locus_tag LOCUS_12640 5057 3564 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_12640 8579 5286 gene locus_tag LOCUS_12650 8579 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence111 718 3729 gene locus_tag LOCUS_12660 gene lptD 718 3729 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB2 protein_id gnl|my_center|LOCUS_12660 3979 5280 gene locus_tag LOCUS_12670 gene surA 3979 5280 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMB1 protein_id gnl|my_center|LOCUS_12670 6981 5803 gene locus_tag LOCUS_12680 6981 5803 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_12680 7362 8495 gene locus_tag LOCUS_12690 gene asd 7362 8495 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM13 protein_id gnl|my_center|LOCUS_12690 >Feature sequence112 50 913 gene locus_tag LOCUS_12700 gene corC 50 913 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 protein_id gnl|my_center|LOCUS_12700 1190 2767 gene locus_tag LOCUS_12710 gene lnt 1190 2767 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLF2 protein_id gnl|my_center|LOCUS_12710 2952 3410 gene locus_tag LOCUS_12720 2952 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3723 5288 gene locus_tag LOCUS_12730 3723 5288 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816066.1 protein_id gnl|my_center|LOCUS_12730 5778 7595 gene locus_tag LOCUS_12740 5778 7595 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951270.1 protein_id gnl|my_center|LOCUS_12740 8490 7705 gene locus_tag LOCUS_12750 8490 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence113 501 1562 gene locus_tag LOCUS_12760 501 1562 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807202.1 protein_id gnl|my_center|LOCUS_12760 1635 2882 gene locus_tag LOCUS_12770 gene amaB 1635 2882 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708998.1 protein_id gnl|my_center|LOCUS_12770 3211 4638 gene locus_tag LOCUS_12780 3211 4638 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729850.1 protein_id gnl|my_center|LOCUS_12780 4694 6349 gene locus_tag LOCUS_12790 4694 6349 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 protein_id gnl|my_center|LOCUS_12790 6729 7652 gene locus_tag LOCUS_12800 6729 7652 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818443.1 protein_id gnl|my_center|LOCUS_12800 <8535 7977 gene locus_tag LOCUS_12810 <8535 7977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229008.1:MFS transporter >Feature sequence114 549 896 gene locus_tag LOCUS_12820 gene pilZ 549 896 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 protein_id gnl|my_center|LOCUS_12820 2123 1026 gene locus_tag LOCUS_12830 2123 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_12830 3915 2308 gene locus_tag LOCUS_12840 gene fadI 3915 2308 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 protein_id gnl|my_center|LOCUS_12840 3948 4157 gene locus_tag LOCUS_12850 3948 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4488 5888 gene locus_tag LOCUS_12860 4488 5888 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_12860 6200 7117 gene locus_tag LOCUS_12870 6200 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_12870 7169 7690 gene locus_tag LOCUS_12880 7169 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence115 <1 2453 gene locus_tag LOCUS_12890 <1 2453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM24:DNA topoisomerase 1 3010 2534 gene locus_tag LOCUS_12900 gene yojM 3010 2534 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ4 protein_id gnl|my_center|LOCUS_12900 3487 3287 gene locus_tag LOCUS_12910 3487 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3805 3491 gene locus_tag LOCUS_12920 3805 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4402 4013 gene locus_tag LOCUS_12930 4402 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7142 4542 gene locus_tag LOCUS_12940 gene lon 7142 4542 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence116 <1 1215 gene locus_tag LOCUS_12950 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207571.1:pyrimidine utilization transport protein G 2303 1371 gene locus_tag LOCUS_12960 2303 1371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 protein_id gnl|my_center|LOCUS_12960 2823 3737 gene locus_tag LOCUS_12970 2823 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4894 3845 gene locus_tag LOCUS_12980 4894 3845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_12980 5086 4922 gene locus_tag LOCUS_12990 gene rubA 5086 4922 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_12990 5486 6001 gene locus_tag LOCUS_13000 gene apt 5486 6001 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_13000 6577 6098 gene locus_tag LOCUS_13010 6577 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7624 6683 gene locus_tag LOCUS_13020 gene tal 7624 6683 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK81 protein_id gnl|my_center|LOCUS_13020 >Feature sequence117 <1 756 gene locus_tag LOCUS_13030 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121458.1:cobyric acid synthase CobQ 861 2018 gene locus_tag LOCUS_13040 861 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2172 2885 gene locus_tag LOCUS_13050 2172 2885 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_13050 2939 3370 gene locus_tag LOCUS_13060 gene exbD 2939 3370 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_13060 3465 5252 gene locus_tag LOCUS_13070 gene msbA 3465 5252 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC0 protein_id gnl|my_center|LOCUS_13070 5355 6485 gene locus_tag LOCUS_13080 gene lpxK 5355 6485 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC1 protein_id gnl|my_center|LOCUS_13080 6533 7345 gene locus_tag LOCUS_13090 gene kdsB 6533 7345 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMC2 protein_id gnl|my_center|LOCUS_13090 >Feature sequence118 465 2315 gene locus_tag LOCUS_13100 gene typA 465 2315 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 protein_id gnl|my_center|LOCUS_13100 2588 3031 gene locus_tag LOCUS_13110 gene mscL 2588 3031 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_13110 3583 3143 gene locus_tag LOCUS_13120 3583 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4787 3858 gene locus_tag LOCUS_13130 gene mutM 4787 3858 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN93 protein_id gnl|my_center|LOCUS_13130 7378 4841 gene locus_tag LOCUS_13140 gene relA 7378 4841 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence119 659 1831 gene locus_tag LOCUS_13150 gene fadA 659 1831 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKS0 protein_id gnl|my_center|LOCUS_13150 2138 2713 gene locus_tag LOCUS_13160 2138 2713 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941667.1 protein_id gnl|my_center|LOCUS_13160 2833 3462 gene locus_tag LOCUS_13170 2833 3462 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_13170 4386 3553 gene locus_tag LOCUS_13180 gene psd 4386 3553 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_13180 4501 4953 gene locus_tag LOCUS_13190 gene dtd 4501 4953 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY7 protein_id gnl|my_center|LOCUS_13190 5066 5770 gene locus_tag LOCUS_13200 gene phoB 5066 5770 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_13200 5849 6946 gene locus_tag LOCUS_13210 5849 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 7591 7001 gene locus_tag LOCUS_13220 7591 7001 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887243.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence120 3435 1987 gene locus_tag LOCUS_13230 3435 1987 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429527.1 protein_id gnl|my_center|LOCUS_13230 4983 3496 gene locus_tag LOCUS_13240 4983 3496 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101377.1 protein_id gnl|my_center|LOCUS_13240 5898 5035 gene locus_tag LOCUS_13250 5898 5035 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246249.1 protein_id gnl|my_center|LOCUS_13250 7240 5993 gene locus_tag LOCUS_13260 7240 5993 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 protein_id gnl|my_center|LOCUS_13260 <8038 7310 gene locus_tag LOCUS_13270 <8038 7310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206386.1:hydroxyproline-2-epimerase >Feature sequence121 3757 4863 gene locus_tag LOCUS_13280 3757 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6078 4936 gene locus_tag LOCUS_13290 6078 4936 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_13290 7349 6075 gene locus_tag LOCUS_13300 7349 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7695 7426 gene locus_tag LOCUS_13310 7695 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence122 1519 692 gene locus_tag LOCUS_13320 1519 692 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 protein_id gnl|my_center|LOCUS_13320 2072 1749 gene locus_tag LOCUS_13330 gene hvrA 2072 1749 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_13330 2942 2505 gene locus_tag LOCUS_13340 2942 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_13340 3518 3000 gene locus_tag LOCUS_13350 3518 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 protein_id gnl|my_center|LOCUS_13350 4255 3602 gene locus_tag LOCUS_13360 4255 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5575 4949 gene locus_tag LOCUS_13370 gene ssb 5575 4949 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGR6 protein_id gnl|my_center|LOCUS_13370 6378 5821 gene locus_tag LOCUS_13380 6378 5821 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104051.1 protein_id gnl|my_center|LOCUS_13380 7881 6517 gene locus_tag LOCUS_13390 gene yajR 7881 6517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence123 1509 1195 gene locus_tag LOCUS_13400 gene gatC 1509 1195 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN38 protein_id gnl|my_center|LOCUS_13400 2170 3198 gene locus_tag LOCUS_13410 gene mreB 2170 3198 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_13410 3429 4283 gene locus_tag LOCUS_13420 gene mreC 3429 4283 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN35 protein_id gnl|my_center|LOCUS_13420 4416 4901 gene locus_tag LOCUS_13430 gene mreD 4416 4901 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRJ1 protein_id gnl|my_center|LOCUS_13430 4975 5679 gene locus_tag LOCUS_13440 4975 5679 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LC4 protein_id gnl|my_center|LOCUS_13440 5843 7447 gene locus_tag LOCUS_13450 gene rng 5843 7447 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence124 120 491 gene locus_tag LOCUS_13460 120 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 698 1039 gene locus_tag LOCUS_13470 698 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2848 1205 gene locus_tag LOCUS_13480 2848 1205 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_13480 4218 2992 gene locus_tag LOCUS_13490 gene yliI 4218 2992 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_13490 7013 4416 gene locus_tag LOCUS_13500 gene clpB 7013 4416 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI86 protein_id gnl|my_center|LOCUS_13500 >Feature sequence125 959 711 gene locus_tag LOCUS_13510 959 711 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_13510 1557 1042 gene locus_tag LOCUS_13520 gene coaD 1557 1042 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN4 protein_id gnl|my_center|LOCUS_13520 1782 2285 gene locus_tag LOCUS_13530 gene smpB 1782 2285 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFH7 protein_id gnl|my_center|LOCUS_13530 3442 2435 gene locus_tag LOCUS_13540 3442 2435 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44579 protein_id gnl|my_center|LOCUS_13540 3721 4188 gene locus_tag LOCUS_13550 3721 4188 CDS product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44580 protein_id gnl|my_center|LOCUS_13550 4326 5078 gene locus_tag LOCUS_13560 4326 5078 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469191.1 protein_id gnl|my_center|LOCUS_13560 5801 5184 gene locus_tag LOCUS_13570 5801 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7191 5812 gene locus_tag LOCUS_13580 gene amt 7191 5812 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_13580 >Feature sequence126 <1 1305 gene locus_tag LOCUS_13590 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004789757.1:FAD-linked oxidase 2031 1402 gene locus_tag LOCUS_13600 2031 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2565 4202 gene locus_tag LOCUS_13610 2565 4202 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_13610 4311 4868 gene locus_tag LOCUS_13620 4311 4868 CDS product thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43787 protein_id gnl|my_center|LOCUS_13620 6405 5047 gene locus_tag LOCUS_13630 6405 5047 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 protein_id gnl|my_center|LOCUS_13630 7147 6443 gene locus_tag LOCUS_13640 7147 6443 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972743.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence127 1580 1092 gene locus_tag LOCUS_13650 1580 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2192 1605 gene locus_tag LOCUS_13660 2192 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 4239 2365 gene locus_tag LOCUS_13670 4239 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 5434 6822 gene locus_tag LOCUS_13680 5434 6822 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016669.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence128 <1 908 gene locus_tag LOCUS_13690 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207339.1:serine protease 1869 1018 gene locus_tag LOCUS_13700 1869 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 2589 2149 gene locus_tag LOCUS_13710 2589 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3396 2785 gene locus_tag LOCUS_13720 gene rluE 3396 2785 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFQ3 protein_id gnl|my_center|LOCUS_13720 5997 3778 gene locus_tag LOCUS_13730 gene icd2 5997 3778 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence129 <1 3619 gene locus_tag LOCUS_13740 <1 3619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2Q2:methionine synthase 5880 3709 gene locus_tag LOCUS_13750 gene yfjK 5880 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52126 protein_id gnl|my_center|LOCUS_13750 6828 5884 gene locus_tag LOCUS_13760 6828 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837429.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence130 <1 1448 gene locus_tag LOCUS_13770 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107137.1:aldehyde dehydrogenase 1809 1564 gene locus_tag LOCUS_13780 1809 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2036 3403 gene locus_tag LOCUS_13790 gene cry 2036 3403 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JP5 protein_id gnl|my_center|LOCUS_13790 4356 3610 gene locus_tag LOCUS_13800 4356 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5203 4457 gene locus_tag LOCUS_13810 5203 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5655 6884 gene locus_tag LOCUS_13820 5655 6884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence131 12 1640 gene locus_tag LOCUS_13830 12 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2156 1656 gene locus_tag LOCUS_13840 2156 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816335.1 protein_id gnl|my_center|LOCUS_13840 2507 2782 gene locus_tag LOCUS_13850 2507 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 5132 2874 gene locus_tag LOCUS_13860 gene rnr 5132 2874 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPZ5 protein_id gnl|my_center|LOCUS_13860 6517 5273 gene locus_tag LOCUS_13870 6517 5273 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887770.1 protein_id gnl|my_center|LOCUS_13870 7352 6849 gene locus_tag LOCUS_13880 gene infC 7352 6849 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65138 protein_id gnl|my_center|LOCUS_13880 >Feature sequence132 3504 2218 gene locus_tag LOCUS_13890 gene serS 3504 2218 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG7 protein_id gnl|my_center|LOCUS_13890 4004 4663 gene locus_tag LOCUS_13900 4004 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 protein_id gnl|my_center|LOCUS_13900 4864 5340 gene locus_tag LOCUS_13910 4864 5340 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_13910 6152 5454 gene locus_tag LOCUS_13920 6152 5454 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 protein_id gnl|my_center|LOCUS_13920 7028 6225 gene locus_tag LOCUS_13930 gene dnaA 7028 6225 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence133 261 1265 gene locus_tag LOCUS_13940 gene lplA 261 1265 CDS product lipoate-protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPK8 protein_id gnl|my_center|LOCUS_13940 1350 2369 gene locus_tag LOCUS_13950 1350 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4605 2470 gene locus_tag LOCUS_13960 gene fadH 4605 2470 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 protein_id gnl|my_center|LOCUS_13960 5012 6676 gene locus_tag LOCUS_13970 5012 6676 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184654.1 protein_id gnl|my_center|LOCUS_13970 7192 6773 gene locus_tag LOCUS_13980 7192 6773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence134 71 691 gene locus_tag LOCUS_13990 71 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1235 2890 gene locus_tag LOCUS_14000 gene gpmI 1235 2890 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK43 protein_id gnl|my_center|LOCUS_14000 3262 4572 gene locus_tag LOCUS_14010 3262 4572 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_14010 6377 4650 gene locus_tag LOCUS_14020 6377 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 <7441 6560 gene locus_tag LOCUS_14030 <7441 6560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P33639:sensor protein PilS >Feature sequence135 <1 507 gene locus_tag LOCUS_14040 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KN39:glutamyl-tRNA(Gln) amidotransferase subunit A 507 2018 gene locus_tag LOCUS_14050 gene gatB 507 2018 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN40 protein_id gnl|my_center|LOCUS_14050 2133 2209 gene locus_tag LOCUS_t00170 2133 2209 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2373 3614 gene locus_tag LOCUS_14060 2373 3614 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 protein_id gnl|my_center|LOCUS_14060 3733 4758 gene locus_tag LOCUS_14070 3733 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4921 5211 gene locus_tag LOCUS_14080 4921 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5215 5469 gene locus_tag LOCUS_14090 5215 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5466 5741 gene locus_tag LOCUS_14100 5466 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6266 6850 gene locus_tag LOCUS_14110 6266 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence136 908 261 gene locus_tag LOCUS_14120 908 261 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_14120 1397 2077 gene locus_tag LOCUS_14130 gene yfcG 1397 2077 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261713.1 protein_id gnl|my_center|LOCUS_14130 2466 3050 gene locus_tag LOCUS_14140 2466 3050 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 protein_id gnl|my_center|LOCUS_14140 4063 3134 gene locus_tag LOCUS_14150 gene dhmA 4063 3134 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_14150 5554 4286 gene locus_tag LOCUS_14160 5554 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5741 6505 gene locus_tag LOCUS_14170 gene fhuC 5741 6505 CDS product iron-hydroxamate transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167185.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence137 <1 1138 gene locus_tag LOCUS_14180 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116088.1:acyl-CoA dehydrogenase 1372 2787 gene locus_tag LOCUS_14190 1372 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 2866 3822 gene locus_tag LOCUS_14200 2866 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14200 4631 5410 gene locus_tag LOCUS_14210 4631 5410 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_14210 5728 5537 gene locus_tag LOCUS_14220 5728 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 6642 5806 gene locus_tag LOCUS_14230 gene apaH 6642 5806 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPJ9 protein_id gnl|my_center|LOCUS_14230 <7339 6686 gene locus_tag LOCUS_14240 <7339 6686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I5U5:ribosomal RNA small subunit methyltransferase A >Feature sequence138 993 1157 gene locus_tag LOCUS_14250 993 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1196 1843 gene locus_tag LOCUS_14260 1196 1843 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_14260 3030 1984 gene locus_tag LOCUS_14270 3030 1984 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089533.1 protein_id gnl|my_center|LOCUS_14270 4510 3158 gene locus_tag LOCUS_14280 4510 3158 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267447.1 protein_id gnl|my_center|LOCUS_14280 4550 5332 gene locus_tag LOCUS_14290 4550 5332 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929695.1 protein_id gnl|my_center|LOCUS_14290 5856 6881 gene locus_tag LOCUS_14300 5856 6881 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence139 1454 522 gene locus_tag LOCUS_14310 1454 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2427 1522 gene locus_tag LOCUS_14320 2427 1522 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_14320 3354 2557 gene locus_tag LOCUS_14330 3354 2557 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_14330 4455 3658 gene locus_tag LOCUS_14340 4455 3658 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407276.1 protein_id gnl|my_center|LOCUS_14340 5156 4857 gene locus_tag LOCUS_14350 5156 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5556 6857 gene locus_tag LOCUS_14360 gene proA 5556 6857 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_14360 >Feature sequence140 790 137 gene locus_tag LOCUS_14370 790 137 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM55 protein_id gnl|my_center|LOCUS_14370 1318 1947 gene locus_tag LOCUS_14380 gene sodB 1318 1947 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ94 protein_id gnl|my_center|LOCUS_14380 2209 2766 gene locus_tag LOCUS_14390 2209 2766 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389882.1 protein_id gnl|my_center|LOCUS_14390 2832 3251 gene locus_tag LOCUS_14400 2832 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4128 3574 gene locus_tag LOCUS_14410 4128 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5343 4210 gene locus_tag LOCUS_14420 5343 4210 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064041.1 protein_id gnl|my_center|LOCUS_14420 6194 5376 gene locus_tag LOCUS_14430 6194 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 protein_id gnl|my_center|LOCUS_14430 <7320 6237 gene locus_tag LOCUS_14440 <7320 6237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207519.1:(2E,6E)-farnesyl diphosphate synthase >Feature sequence141 2134 1268 gene locus_tag LOCUS_14450 gene tatC 2134 1268 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_14450 2517 2131 gene locus_tag LOCUS_14460 2517 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2857 2573 gene locus_tag LOCUS_14470 2857 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5625 2938 gene locus_tag LOCUS_14480 5625 2938 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_14480 6044 5766 gene locus_tag LOCUS_14490 6044 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6961 6476 gene locus_tag LOCUS_14500 6961 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence142 1192 890 gene locus_tag LOCUS_14510 gene ureA 1192 890 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN10 protein_id gnl|my_center|LOCUS_14510 2339 1272 gene locus_tag LOCUS_14520 gene ureD 2339 1272 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX0 protein_id gnl|my_center|LOCUS_14520 3236 3910 gene locus_tag LOCUS_14530 gene clpP 3236 3910 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHI5 protein_id gnl|my_center|LOCUS_14530 4097 5371 gene locus_tag LOCUS_14540 gene clpX 4097 5371 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_14540 5658 6674 gene locus_tag LOCUS_14550 gene ephD 5658 6674 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence143 159 1229 gene locus_tag LOCUS_14560 159 1229 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44579 protein_id gnl|my_center|LOCUS_14560 1469 2539 gene locus_tag LOCUS_14570 1469 2539 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44579 protein_id gnl|my_center|LOCUS_14570 2741 3409 gene locus_tag LOCUS_14580 2741 3409 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 protein_id gnl|my_center|LOCUS_14580 3512 3784 gene locus_tag LOCUS_14590 3512 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3860 5005 gene locus_tag LOCUS_14600 gene rnz 3860 5005 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ23 protein_id gnl|my_center|LOCUS_14600 5965 5021 gene locus_tag LOCUS_14610 5965 5021 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 protein_id gnl|my_center|LOCUS_14610 6031 7026 gene locus_tag LOCUS_14620 6031 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence144 184 1809 gene locus_tag LOCUS_14630 gene nuoM 184 1809 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 protein_id gnl|my_center|LOCUS_14630 1813 3291 gene locus_tag LOCUS_14640 gene nuoN 1813 3291 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KET6 protein_id gnl|my_center|LOCUS_14640 3457 4284 gene locus_tag LOCUS_14650 gene fpr 3457 4284 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 protein_id gnl|my_center|LOCUS_14650 5165 4386 gene locus_tag LOCUS_14660 5165 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 protein_id gnl|my_center|LOCUS_14660 5509 6396 gene locus_tag LOCUS_14670 gene tonB 5509 6396 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence145 1056 451 gene locus_tag LOCUS_14680 1056 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2319 1219 gene locus_tag LOCUS_14690 gene phoL 2319 1219 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_14690 2912 4222 gene locus_tag LOCUS_14700 gene ubiH 2912 4222 CDS product ubiquinone biosynthesis protein UbiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 protein_id gnl|my_center|LOCUS_14700 4328 5587 gene locus_tag LOCUS_14710 gene ubiF 4328 5587 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 protein_id gnl|my_center|LOCUS_14710 5683 6300 gene locus_tag LOCUS_14720 5683 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence146 52 903 gene locus_tag LOCUS_14730 52 903 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_14730 1636 938 gene locus_tag LOCUS_14740 1636 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063765.1 protein_id gnl|my_center|LOCUS_14740 3223 1739 gene locus_tag LOCUS_14750 3223 1739 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673390.1 protein_id gnl|my_center|LOCUS_14750 3955 3284 gene locus_tag LOCUS_14760 3955 3284 CDS product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 protein_id gnl|my_center|LOCUS_14760 4592 3993 gene locus_tag LOCUS_14770 4592 3993 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704514.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence147 1291 464 gene locus_tag LOCUS_14780 1291 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2919 1504 gene locus_tag LOCUS_14790 2919 1504 CDS product amino acid APC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_14790 4472 3048 gene locus_tag LOCUS_14800 4472 3048 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_14800 5668 6468 gene locus_tag LOCUS_14810 5668 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence148 3405 3007 gene locus_tag LOCUS_14820 gene clpS 3405 3007 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR2 protein_id gnl|my_center|LOCUS_14820 4441 3572 gene locus_tag LOCUS_14830 4441 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5612 4545 gene locus_tag LOCUS_14840 gene argC 5612 4545 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR4 protein_id gnl|my_center|LOCUS_14840 6857 5721 gene locus_tag LOCUS_14850 gene hemE 6857 5721 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJS6 protein_id gnl|my_center|LOCUS_14850 >Feature sequence149 1140 910 gene locus_tag LOCUS_14860 1140 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3012 2329 gene locus_tag LOCUS_14870 3012 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 protein_id gnl|my_center|LOCUS_14870 4083 3220 gene locus_tag LOCUS_14880 4083 3220 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_14880 4392 4925 gene locus_tag LOCUS_14890 gene yaiL 4392 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121466.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence150 1185 556 gene locus_tag LOCUS_14900 1185 556 CDS product lysine exporter protein LysE/YggA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532487.1 protein_id gnl|my_center|LOCUS_14900 1540 2424 gene locus_tag LOCUS_14910 1540 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2437 2997 gene locus_tag LOCUS_14920 2437 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3032 4207 gene locus_tag LOCUS_14930 3032 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4485 4204 gene locus_tag LOCUS_14940 4485 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4678 5397 gene locus_tag LOCUS_14950 4678 5397 CDS product structural protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_313351.2 protein_id gnl|my_center|LOCUS_14950 5399 5851 gene locus_tag LOCUS_14960 5399 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6311 5886 gene locus_tag LOCUS_14970 6311 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6466 6687 gene locus_tag LOCUS_14980 6466 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 6843 6691 gene locus_tag LOCUS_14990 6843 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence151 <1 1101 gene locus_tag LOCUS_15000 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIK3:ATP-dependent RNA helicase RhlB 2079 1210 gene locus_tag LOCUS_15010 2079 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2452 2177 gene locus_tag LOCUS_15020 2452 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3284 2577 gene locus_tag LOCUS_15030 3284 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4488 3340 gene locus_tag LOCUS_15040 gene murB 4488 3340 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGJ6 protein_id gnl|my_center|LOCUS_15040 5079 4582 gene locus_tag LOCUS_15050 gene ptpA 5079 4582 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_15050 5673 5251 gene locus_tag LOCUS_15060 gene hslR 5673 5251 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW4 protein_id gnl|my_center|LOCUS_15060 6825 5845 gene locus_tag LOCUS_15070 6825 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence152 40 1626 gene locus_tag LOCUS_15080 gene aceA 40 1626 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_15080 1785 3365 gene locus_tag LOCUS_15090 1785 3365 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064458.1 protein_id gnl|my_center|LOCUS_15090 3967 3452 gene locus_tag LOCUS_15100 3967 3452 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_15100 4109 5368 gene locus_tag LOCUS_15110 4109 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 6749 5511 gene locus_tag LOCUS_15120 gene argG 6749 5511 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_15120 >Feature sequence153 1943 324 gene locus_tag LOCUS_15130 1943 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM35 protein_id gnl|my_center|LOCUS_15130 3611 2046 gene locus_tag LOCUS_15140 3611 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3904 4521 gene locus_tag LOCUS_15150 3904 4521 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_15150 4647 5099 gene locus_tag LOCUS_15160 4647 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 6010 5240 gene locus_tag LOCUS_15170 6010 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_15170 6457 6747 gene locus_tag LOCUS_15180 gene groS 6457 6747 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLT8 protein_id gnl|my_center|LOCUS_15180 >Feature sequence154 600 2003 gene locus_tag LOCUS_15190 gene envZ 600 2003 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_15190 2212 2033 gene locus_tag LOCUS_15200 2212 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4029 2341 gene locus_tag LOCUS_15210 gene rstB 4029 2341 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 protein_id gnl|my_center|LOCUS_15210 5067 4351 gene locus_tag LOCUS_15220 gene rstA 5067 4351 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_15220 6093 5677 gene locus_tag LOCUS_15230 gene atpC 6093 5677 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH0 protein_id gnl|my_center|LOCUS_15230 <6788 6209 gene locus_tag LOCUS_15240 <6788 6209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJG9:ATP synthase subunit beta >Feature sequence155 614 2332 gene locus_tag LOCUS_15250 614 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 protein_id gnl|my_center|LOCUS_15250 2431 4224 gene locus_tag LOCUS_15260 gene dld 2431 4224 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06149 protein_id gnl|my_center|LOCUS_15260 4208 5614 gene locus_tag LOCUS_15270 4208 5614 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153658.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence156 539 207 gene locus_tag LOCUS_15280 539 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1467 601 gene locus_tag LOCUS_15290 gene mazG 1467 601 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 protein_id gnl|my_center|LOCUS_15290 1718 3205 gene locus_tag LOCUS_15300 gene manB 1718 3205 CDS product bifunctional protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_15300 4672 3290 gene locus_tag LOCUS_15310 4672 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6384 4708 gene locus_tag LOCUS_15320 gene pgi 6384 4708 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIS2 protein_id gnl|my_center|LOCUS_15320 >Feature sequence157 16 3195 gene locus_tag LOCUS_15330 gene nasA 16 3195 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 protein_id gnl|my_center|LOCUS_15330 3333 4265 gene locus_tag LOCUS_15340 3333 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5719 4613 gene locus_tag LOCUS_15350 5719 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6281 5919 gene locus_tag LOCUS_15360 6281 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence158 1424 3493 gene locus_tag LOCUS_15370 1424 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3549 5135 gene locus_tag LOCUS_15380 3549 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 5898 5383 gene locus_tag LOCUS_15390 5898 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence159 492 2030 gene locus_tag LOCUS_15400 gene kdtA 492 2030 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105256.1 protein_id gnl|my_center|LOCUS_15400 2027 2749 gene locus_tag LOCUS_15410 2027 2749 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHA4 protein_id gnl|my_center|LOCUS_15410 3036 4169 gene locus_tag LOCUS_15420 3036 4169 CDS product putative binding protein component of ABC iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX3 protein_id gnl|my_center|LOCUS_15420 4331 6007 gene locus_tag LOCUS_15430 4331 6007 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103094.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence160 1780 734 gene locus_tag LOCUS_15440 1780 734 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 protein_id gnl|my_center|LOCUS_15440 2348 3346 gene locus_tag LOCUS_15450 2348 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 3455 4150 gene locus_tag LOCUS_15460 gene exbB 3455 4150 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 protein_id gnl|my_center|LOCUS_15460 4202 4603 gene locus_tag LOCUS_15470 gene exbD 4202 4603 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_15470 5353 4820 gene locus_tag LOCUS_15480 5353 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5755 6360 gene locus_tag LOCUS_15490 5755 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6607 6464 gene locus_tag LOCUS_15500 6607 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence161 6030 4945 gene locus_tag LOCUS_15510 6030 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence162 1279 107 gene locus_tag LOCUS_15520 gene proB 1279 107 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ0 protein_id gnl|my_center|LOCUS_15520 2561 1356 gene locus_tag LOCUS_15530 gene yhbZ 2561 1356 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ1 protein_id gnl|my_center|LOCUS_15530 4281 2848 gene locus_tag LOCUS_15540 gene gap 4281 2848 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKJ4 protein_id gnl|my_center|LOCUS_15540 5861 4653 gene locus_tag LOCUS_15550 5861 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence163 <1 4937 gene locus_tag LOCUS_15560 <1 4937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207109.1:DUF490 domain-containing protein 5233 5069 gene locus_tag LOCUS_15570 5233 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence164 1035 2735 gene locus_tag LOCUS_15580 gene fadD 1035 2735 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_15580 3692 2823 gene locus_tag LOCUS_15590 3692 2823 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_15590 4613 3852 gene locus_tag LOCUS_15600 gene gpmA 4613 3852 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 protein_id gnl|my_center|LOCUS_15600 5900 4656 gene locus_tag LOCUS_15610 5900 4656 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence165 492 728 gene locus_tag LOCUS_15620 492 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 977 1534 gene locus_tag LOCUS_15630 977 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_15630 1644 2078 gene locus_tag LOCUS_15640 1644 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2172 2708 gene locus_tag LOCUS_15650 2172 2708 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_15650 3053 3976 gene locus_tag LOCUS_15660 3053 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_15660 5314 4163 gene locus_tag LOCUS_15670 5314 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence166 <1 1298 gene locus_tag LOCUS_15680 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFT1:signal recognition particle receptor FtsY 1353 1925 gene locus_tag LOCUS_15690 1353 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2790 2041 gene locus_tag LOCUS_15700 2790 2041 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLP9 protein_id gnl|my_center|LOCUS_15700 3109 3939 gene locus_tag LOCUS_15710 3109 3939 CDS product potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_15710 5277 3976 gene locus_tag LOCUS_15720 gene adcK4 5277 3976 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_15720 5956 5417 gene locus_tag LOCUS_15730 gene aroQ 5956 5417 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJF5 protein_id gnl|my_center|LOCUS_15730 >Feature sequence167 983 1111 gene locus_tag LOCUS_15740 983 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3628 1277 gene locus_tag LOCUS_15750 3628 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3978 4904 gene locus_tag LOCUS_15760 gene ylbK 3978 4904 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_15760 5667 5077 gene locus_tag LOCUS_15770 5667 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence168 848 189 gene locus_tag LOCUS_15780 848 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_15780 1151 2833 gene locus_tag LOCUS_15790 gene cstA 1151 2833 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_15790 2963 3265 gene locus_tag LOCUS_15800 2963 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3314 4339 gene locus_tag LOCUS_15810 3314 4339 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_15810 6047 4368 gene locus_tag LOCUS_15820 6047 4368 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence169 479 1030 gene locus_tag LOCUS_15830 gene vdlD 479 1030 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_15830 1458 2303 gene locus_tag LOCUS_15840 1458 2303 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775844.1 protein_id gnl|my_center|LOCUS_15840 2329 2892 gene locus_tag LOCUS_15850 2329 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3492 3010 gene locus_tag LOCUS_15860 gene dps 3492 3010 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCK6 protein_id gnl|my_center|LOCUS_15860 4485 3715 gene locus_tag LOCUS_15870 4485 3715 CDS product guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876603.1 protein_id gnl|my_center|LOCUS_15870 5050 4601 gene locus_tag LOCUS_15880 5050 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence170 2694 2843 gene locus_tag LOCUS_15890 2694 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2853 3809 gene locus_tag LOCUS_15900 gene cysM 2853 3809 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB9 protein_id gnl|my_center|LOCUS_15900 3867 4688 gene locus_tag LOCUS_15910 3867 4688 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence171 388 1452 gene locus_tag LOCUS_15920 gene pheS 388 1452 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE3 protein_id gnl|my_center|LOCUS_15920 1535 3940 gene locus_tag LOCUS_15930 gene pheT 1535 3940 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE4 protein_id gnl|my_center|LOCUS_15930 4176 4475 gene locus_tag LOCUS_15940 gene ihfA 4176 4475 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE5 protein_id gnl|my_center|LOCUS_15940 5067 4705 gene locus_tag LOCUS_15950 5067 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence172 573 2063 gene locus_tag LOCUS_15960 573 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence173 27 103 gene locus_tag LOCUS_t00180 27 103 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 446 637 gene locus_tag LOCUS_15970 446 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 763 1071 gene locus_tag LOCUS_15980 763 1071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948422.1 protein_id gnl|my_center|LOCUS_15980 1169 2395 gene locus_tag LOCUS_15990 1169 2395 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706311.1 protein_id gnl|my_center|LOCUS_15990 3442 2711 gene locus_tag LOCUS_16000 3442 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3836 3402 gene locus_tag LOCUS_16010 3836 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5929 4277 gene locus_tag LOCUS_16020 5929 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence174 1960 1697 gene locus_tag LOCUS_16030 1960 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3081 2320 gene locus_tag LOCUS_16040 gene sdhB 3081 2320 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 protein_id gnl|my_center|LOCUS_16040 5105 3255 gene locus_tag LOCUS_16050 gene sdhA 5105 3255 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME4 protein_id gnl|my_center|LOCUS_16050 5841 5434 gene locus_tag LOCUS_16060 gene sdhD 5841 5434 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME5 protein_id gnl|my_center|LOCUS_16060 >Feature sequence175 1 306 gene locus_tag LOCUS_16070 1 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2081 435 gene locus_tag LOCUS_16080 2081 435 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_16080 4746 2239 gene locus_tag LOCUS_16090 4746 2239 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706546.1 protein_id gnl|my_center|LOCUS_16090 <6191 4965 gene locus_tag LOCUS_16100 <6191 4965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206844.1:methylmalonate-semialdehyde dehydrogenase (acylating) >Feature sequence176 1155 310 gene locus_tag LOCUS_16110 1155 310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_16110 2225 1155 gene locus_tag LOCUS_16120 2225 1155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112319.1 protein_id gnl|my_center|LOCUS_16120 4050 2236 gene locus_tag LOCUS_16130 4050 2236 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 protein_id gnl|my_center|LOCUS_16130 5631 4279 gene locus_tag LOCUS_16140 5631 4279 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence177 1743 244 gene locus_tag LOCUS_16150 gene fbh1 1743 244 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC4 protein_id gnl|my_center|LOCUS_16150 2787 1909 gene locus_tag LOCUS_16160 gene tatC 2787 1909 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_16160 3446 2787 gene locus_tag LOCUS_16170 3446 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3715 3473 gene locus_tag LOCUS_16180 3715 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4739 3903 gene locus_tag LOCUS_16190 gene hisI 4739 3903 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLC5 protein_id gnl|my_center|LOCUS_16190 5352 4909 gene locus_tag LOCUS_16200 5352 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 5793 5990 gene locus_tag LOCUS_16210 gene rpmI 5793 5990 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_16210 >Feature sequence178 <1 867 gene locus_tag LOCUS_16220 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLL5:tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ 1078 1989 gene locus_tag LOCUS_16230 gene cysE 1078 1989 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_16230 2688 2140 gene locus_tag LOCUS_16240 2688 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3100 2663 gene locus_tag LOCUS_16250 gene folB 3100 2663 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW6 protein_id gnl|my_center|LOCUS_16250 4106 3156 gene locus_tag LOCUS_16260 4106 3156 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I633 protein_id gnl|my_center|LOCUS_16260 <6058 4330 gene locus_tag LOCUS_16270 <6058 4330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ26:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence179 2084 450 gene locus_tag LOCUS_16280 gene cysG3 2084 450 CDS product siroheme synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQJ4 protein_id gnl|my_center|LOCUS_16280 2356 3096 gene locus_tag LOCUS_16290 2356 3096 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_16290 3873 3235 gene locus_tag LOCUS_16300 gene cysH 3873 3235 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEB8 protein_id gnl|my_center|LOCUS_16300 4515 3925 gene locus_tag LOCUS_16310 4515 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 <6048 4508 gene locus_tag LOCUS_16320 <6048 4508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098180.1:sulfite reductase >Feature sequence180 408 962 gene locus_tag LOCUS_16330 gene frr 408 962 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD5 protein_id gnl|my_center|LOCUS_16330 1260 2009 gene locus_tag LOCUS_16340 gene ispU 1260 2009 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD4 protein_id gnl|my_center|LOCUS_16340 2194 3003 gene locus_tag LOCUS_16350 gene cdsA 2194 3003 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD3 protein_id gnl|my_center|LOCUS_16350 3216 4424 gene locus_tag LOCUS_16360 gene dxr 3216 4424 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD2 protein_id gnl|my_center|LOCUS_16360 4508 5890 gene locus_tag LOCUS_16370 4508 5890 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY3 protein_id gnl|my_center|LOCUS_16370 >Feature sequence181 <1 567 gene locus_tag LOCUS_16380 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207472.1:neutral zinc metallopeptidase 956 729 gene locus_tag LOCUS_16390 956 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2547 1279 gene locus_tag LOCUS_16400 gene rho 2547 1279 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE8 protein_id gnl|my_center|LOCUS_16400 3397 3071 gene locus_tag LOCUS_16410 3397 3071 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 protein_id gnl|my_center|LOCUS_16410 3789 4502 gene locus_tag LOCUS_16420 gene rluA 3789 4502 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence182 1423 521 gene locus_tag LOCUS_16430 1423 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2409 1933 gene locus_tag LOCUS_16440 gene greA 2409 1933 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW2 protein_id gnl|my_center|LOCUS_16440 5999 2736 gene locus_tag LOCUS_16450 gene carB 5999 2736 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence183 513 725 gene locus_tag LOCUS_16460 513 725 CDS product stress-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 protein_id gnl|my_center|LOCUS_16460 1113 2180 gene locus_tag LOCUS_16470 gene glyQ 1113 2180 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B7 protein_id gnl|my_center|LOCUS_16470 2190 4283 gene locus_tag LOCUS_16480 gene glyS 2190 4283 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFD5 protein_id gnl|my_center|LOCUS_16480 4533 4829 gene locus_tag LOCUS_16490 4533 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 5423 4977 gene locus_tag LOCUS_16500 5423 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5971 5531 gene locus_tag LOCUS_16510 5971 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence184 1138 1308 gene locus_tag LOCUS_16520 1138 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3524 1305 gene locus_tag LOCUS_16530 3524 1305 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_16530 4578 3862 gene locus_tag LOCUS_16540 gene ycgM 4578 3862 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_16540 5409 4684 gene locus_tag LOCUS_16550 5409 4684 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_16550 <5991 5422 gene locus_tag LOCUS_16560 <5991 5422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003342249.1:ABC transporter permease >Feature sequence185 682 32 gene locus_tag LOCUS_16570 682 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1081 2217 gene locus_tag LOCUS_16580 gene dnaJ 1081 2217 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI50 protein_id gnl|my_center|LOCUS_16580 2415 3245 gene locus_tag LOCUS_16590 gene dapB 2415 3245 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI48 protein_id gnl|my_center|LOCUS_16590 3280 4179 gene locus_tag LOCUS_16600 3280 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5443 4262 gene locus_tag LOCUS_16610 5443 4262 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368674.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence186 1 258 gene locus_tag LOCUS_16620 1 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 270 962 gene locus_tag LOCUS_16630 270 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2314 1130 gene locus_tag LOCUS_16640 2314 1130 CDS product putative ribosomal oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44683 protein_id gnl|my_center|LOCUS_16640 2433 2618 gene locus_tag LOCUS_16650 2433 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3261 2623 gene locus_tag LOCUS_16660 gene yjdF 3261 2623 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 protein_id gnl|my_center|LOCUS_16660 4685 3294 gene locus_tag LOCUS_16670 gene purB 4685 3294 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX8 protein_id gnl|my_center|LOCUS_16670 5107 5241 gene locus_tag LOCUS_16680 5107 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 <5888 5355 gene locus_tag LOCUS_16690 <5888 5355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJX6:tRNA-specific 2-thiouridylase MnmA >Feature sequence187 1680 184 gene locus_tag LOCUS_16700 gene trpE 1680 184 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 protein_id gnl|my_center|LOCUS_16700 3030 1918 gene locus_tag LOCUS_16710 3030 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3990 3145 gene locus_tag LOCUS_16720 3990 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5812 4217 gene locus_tag LOCUS_16730 gene prfC 5812 4217 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMU2 protein_id gnl|my_center|LOCUS_16730 >Feature sequence188 606 70 gene locus_tag LOCUS_16740 606 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2181 781 gene locus_tag LOCUS_16750 gene pntB 2181 781 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNB1 protein_id gnl|my_center|LOCUS_16750 2564 2178 gene locus_tag LOCUS_16760 2564 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3789 2638 gene locus_tag LOCUS_16770 gene pntA1 3789 2638 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_16770 4312 5124 gene locus_tag LOCUS_16780 4312 5124 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZU5 protein_id gnl|my_center|LOCUS_16780 >Feature sequence189 2264 915 gene locus_tag LOCUS_16790 gene ordL1 2264 915 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 protein_id gnl|my_center|LOCUS_16790 3609 2266 gene locus_tag LOCUS_16800 3609 2266 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 protein_id gnl|my_center|LOCUS_16800 4123 4863 gene locus_tag LOCUS_16810 gene puuD 4123 4863 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704980.1 protein_id gnl|my_center|LOCUS_16810 4838 5602 gene locus_tag LOCUS_16820 4838 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence190 175 1092 gene locus_tag LOCUS_16830 175 1092 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703861.1 protein_id gnl|my_center|LOCUS_16830 1439 2395 gene locus_tag LOCUS_16840 gene pqqB 1439 2395 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP45 protein_id gnl|my_center|LOCUS_16840 2417 3178 gene locus_tag LOCUS_16850 gene pqqC 2417 3178 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP46 protein_id gnl|my_center|LOCUS_16850 3175 3471 gene locus_tag LOCUS_16860 gene pqqD 3175 3471 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP47 protein_id gnl|my_center|LOCUS_16860 3468 4625 gene locus_tag LOCUS_16870 gene pqqE 3468 4625 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP48 protein_id gnl|my_center|LOCUS_16870 4628 5677 gene locus_tag LOCUS_16880 4628 5677 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206725.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence191 941 384 gene locus_tag LOCUS_16890 gene gloA 941 384 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCX6 protein_id gnl|my_center|LOCUS_16890 1734 1096 gene locus_tag LOCUS_16900 gene cynT 1734 1096 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGU2 protein_id gnl|my_center|LOCUS_16900 2167 3408 gene locus_tag LOCUS_16910 gene potA 2167 3408 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E586 protein_id gnl|my_center|LOCUS_16910 3408 4286 gene locus_tag LOCUS_16920 3408 4286 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 protein_id gnl|my_center|LOCUS_16920 4286 5074 gene locus_tag LOCUS_16930 gene potC 4286 5074 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389180.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence192 1780 251 gene locus_tag LOCUS_16940 gene lysS 1780 251 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV7 protein_id gnl|my_center|LOCUS_16940 3390 2302 gene locus_tag LOCUS_16950 gene prfA 3390 2302 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT1 protein_id gnl|my_center|LOCUS_16950 4769 3624 gene locus_tag LOCUS_16960 gene fabH 4769 3624 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence193 1089 133 gene locus_tag LOCUS_16970 gene hvrB 1089 133 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206551.1 protein_id gnl|my_center|LOCUS_16970 1264 1683 gene locus_tag LOCUS_16980 1264 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2784 1813 gene locus_tag LOCUS_16990 gene dppF 2784 1813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_16990 3854 2781 gene locus_tag LOCUS_17000 3854 2781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112857.1 protein_id gnl|my_center|LOCUS_17000 4770 3856 gene locus_tag LOCUS_17010 gene dppC 4770 3856 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550972.1 protein_id gnl|my_center|LOCUS_17010 <5685 4919 gene locus_tag LOCUS_17020 <5685 4919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525885.1:peptide ABC transporter permease >Feature sequence194 1128 268 gene locus_tag LOCUS_17030 1128 268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708750.1 protein_id gnl|my_center|LOCUS_17030 2995 1370 gene locus_tag LOCUS_17040 2995 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5113 2999 gene locus_tag LOCUS_17050 gene ligA 5113 2999 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX6 protein_id gnl|my_center|LOCUS_17050 >Feature sequence195 394 591 gene locus_tag LOCUS_17060 394 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 739 1692 gene locus_tag LOCUS_17070 739 1692 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_17070 2740 1694 gene locus_tag LOCUS_17080 2740 1694 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195311.1 protein_id gnl|my_center|LOCUS_17080 3041 3976 gene locus_tag LOCUS_17090 3041 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5101 3977 gene locus_tag LOCUS_17100 5101 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence196 3735 2311 gene locus_tag LOCUS_17110 gene nuoF 3735 2311 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 protein_id gnl|my_center|LOCUS_17110 4241 3732 gene locus_tag LOCUS_17120 gene nuoE 4241 3732 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_17120 <5464 4389 gene locus_tag LOCUS_17130 <5464 4389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0J9:NADH-quinone oxidoreductase subunit C/D >Feature sequence197 552 1046 gene locus_tag LOCUS_17140 552 1046 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887789.1 protein_id gnl|my_center|LOCUS_17140 1427 1924 gene locus_tag LOCUS_17150 1427 1924 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887789.1 protein_id gnl|my_center|LOCUS_17150 2817 2089 gene locus_tag LOCUS_17160 gene pgsA 2817 2089 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_17160 4617 3448 gene locus_tag LOCUS_17170 4617 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 <5454 4902 gene locus_tag LOCUS_17180 <5454 4902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y999:acetyl-coenzyme A synthetase >Feature sequence198 2440 770 gene locus_tag LOCUS_17190 gene kdc 2440 770 CDS product alpha-keto-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U140 protein_id gnl|my_center|LOCUS_17190 2708 2782 gene locus_tag LOCUS_t00190 2708 2782 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4215 2920 gene locus_tag LOCUS_17200 4215 2920 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267237.1 protein_id gnl|my_center|LOCUS_17200 4640 4212 gene locus_tag LOCUS_17210 4640 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404410.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence199 382 1302 gene locus_tag LOCUS_17220 382 1302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528965.1 protein_id gnl|my_center|LOCUS_17220 1503 3434 gene locus_tag LOCUS_17230 1503 3434 CDS product Fe3+-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 protein_id gnl|my_center|LOCUS_17230 3512 4924 gene locus_tag LOCUS_17240 3512 4924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267796.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence200 279 2906 gene locus_tag LOCUS_17250 gene gyrB 279 2906 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH7 protein_id gnl|my_center|LOCUS_17250 3033 3602 gene locus_tag LOCUS_17260 3033 3602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877414.1 protein_id gnl|my_center|LOCUS_17260 4732 3710 gene locus_tag LOCUS_17270 gene rlmF 4732 3710 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRM2 protein_id gnl|my_center|LOCUS_17270 >Feature sequence201 <1 1012 gene locus_tag LOCUS_17280 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHG2:glutamate--cysteine ligase 1081 1608 gene locus_tag LOCUS_17290 gene dsbB 1081 1608 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHG1 protein_id gnl|my_center|LOCUS_17290 2174 2013 gene locus_tag LOCUS_17300 2174 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2173 2685 gene locus_tag LOCUS_17310 2173 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2947 4434 gene locus_tag LOCUS_17320 gene mpl 2947 4434 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF6 protein_id gnl|my_center|LOCUS_17320 4766 5020 gene locus_tag LOCUS_17330 4766 5020 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378385.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence202 1594 539 gene locus_tag LOCUS_17340 1594 539 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089533.1 protein_id gnl|my_center|LOCUS_17340 2590 1664 gene locus_tag LOCUS_17350 2590 1664 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_17350 3715 2762 gene locus_tag LOCUS_17360 gene vanB 3715 2762 CDS product vanillate monooxygenase oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206907.1 protein_id gnl|my_center|LOCUS_17360 4823 4080 gene locus_tag LOCUS_17370 4823 4080 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703348.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence203 >Feature sequence204 489 55 gene locus_tag LOCUS_17380 489 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1005 2624 gene locus_tag LOCUS_17390 1005 2624 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455312.1 protein_id gnl|my_center|LOCUS_17390 3464 2781 gene locus_tag LOCUS_17400 3464 2781 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK12 protein_id gnl|my_center|LOCUS_17400 3768 4733 gene locus_tag LOCUS_17410 3768 4733 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 protein_id gnl|my_center|LOCUS_17410 5188 4775 gene locus_tag LOCUS_17420 5188 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence205 652 2097 gene locus_tag LOCUS_17430 gene dnaA 652 2097 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH3 protein_id gnl|my_center|LOCUS_17430 2258 3433 gene locus_tag LOCUS_17440 gene dnaN 2258 3433 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_17440 3572 4783 gene locus_tag LOCUS_17450 gene recF 3572 4783 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPH6 protein_id gnl|my_center|LOCUS_17450 >Feature sequence206 447 851 gene locus_tag LOCUS_17460 447 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 975 2249 gene locus_tag LOCUS_17470 gene gltS 975 2249 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 protein_id gnl|my_center|LOCUS_17470 2430 3128 gene locus_tag LOCUS_17480 2430 3128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730514.1 protein_id gnl|my_center|LOCUS_17480 3762 3304 gene locus_tag LOCUS_17490 3762 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4769 4029 gene locus_tag LOCUS_17500 4769 4029 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_17500 5153 4860 gene locus_tag LOCUS_17510 5153 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence207 1676 342 gene locus_tag LOCUS_17520 1676 342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_17520 2171 4153 gene locus_tag LOCUS_17530 gene pbpA 2171 4153 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_17530 4243 4926 gene locus_tag LOCUS_17540 gene rsmD 4243 4926 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX9 protein_id gnl|my_center|LOCUS_17540 >Feature sequence208 655 2199 gene locus_tag LOCUS_17550 655 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2363 2896 gene locus_tag LOCUS_17560 2363 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3143 3745 gene locus_tag LOCUS_17570 gene tpm 3143 3745 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_17570 4394 3723 gene locus_tag LOCUS_17580 4394 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_17580 5101 4418 gene locus_tag LOCUS_17590 5101 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence209 1329 916 gene locus_tag LOCUS_17600 1329 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202812.1 protein_id gnl|my_center|LOCUS_17600 2178 1615 gene locus_tag LOCUS_17610 2178 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3438 2212 gene locus_tag LOCUS_17620 3438 2212 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIJ8 protein_id gnl|my_center|LOCUS_17620 3982 3524 gene locus_tag LOCUS_17630 3982 3524 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 protein_id gnl|my_center|LOCUS_17630 <5096 4115 gene locus_tag LOCUS_17640 <5096 4115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIK0:glycerol-3-phosphate dehydrogenase [NAD(P)+] >Feature sequence210 694 1683 gene locus_tag LOCUS_17650 gene nahR 694 1683 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_17650 2053 3426 gene locus_tag LOCUS_17660 2053 3426 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_17660 4296 3604 gene locus_tag LOCUS_17670 gene purN 4296 3604 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL71 protein_id gnl|my_center|LOCUS_17670 <5082 4296 gene locus_tag LOCUS_17680 <5082 4296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FIF8:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence211 1127 2809 gene locus_tag LOCUS_17690 gene xdhA 1127 2809 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence212 740 886 gene locus_tag LOCUS_17700 740 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17700 968 1738 gene locus_tag LOCUS_17710 gene add 968 1738 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17710 2639 1839 gene locus_tag LOCUS_17720 2639 1839 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_17720 2735 3037 gene locus_tag LOCUS_17730 2735 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3365 3688 gene locus_tag LOCUS_17740 3365 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3688 4062 gene locus_tag LOCUS_17750 3688 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence213 3020 960 gene locus_tag LOCUS_17760 gene dxs 3020 960 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC1 protein_id gnl|my_center|LOCUS_17760 3546 4217 gene locus_tag LOCUS_17770 gene ribA 3546 4217 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFC2 protein_id gnl|my_center|LOCUS_17770 >Feature sequence214 2681 969 gene locus_tag LOCUS_17780 2681 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 3708 2833 gene locus_tag LOCUS_17790 3708 2833 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ88 protein_id gnl|my_center|LOCUS_17790 4842 3994 gene locus_tag LOCUS_17800 gene metF 4842 3994 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ87 protein_id gnl|my_center|LOCUS_17800 >Feature sequence215 <1 778 gene locus_tag LOCUS_17810 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705611.1:phenylacetic acid degradation protein 871 1641 gene locus_tag LOCUS_17820 gene paaF 871 1641 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206399.1 protein_id gnl|my_center|LOCUS_17820 1641 2432 gene locus_tag LOCUS_17830 gene paaG 1641 2432 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_17830 2435 3985 gene locus_tag LOCUS_17840 gene paaH 2435 3985 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206401.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence216 2398 743 gene locus_tag LOCUS_17850 gene dnaQ 2398 743 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHH4 protein_id gnl|my_center|LOCUS_17850 2850 3356 gene locus_tag LOCUS_17860 2850 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3396 3752 gene locus_tag LOCUS_17870 3396 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4333 3854 gene locus_tag LOCUS_17880 4333 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence217 <1 1179 gene locus_tag LOCUS_17890 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_010923.2:type I restriction-modification enzyme, S subunit 1169 2221 gene locus_tag LOCUS_17900 1169 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2283 2963 gene locus_tag LOCUS_17910 2283 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3154 4146 gene locus_tag LOCUS_17920 3154 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence218 235 981 gene locus_tag LOCUS_17930 235 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020083.1 protein_id gnl|my_center|LOCUS_17930 1183 1821 gene locus_tag LOCUS_17940 1183 1821 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_17940 2044 2706 gene locus_tag LOCUS_17950 2044 2706 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_17950 3037 3975 gene locus_tag LOCUS_17960 3037 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4696 4112 gene locus_tag LOCUS_17970 gene ruvC 4696 4112 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM75 protein_id gnl|my_center|LOCUS_17970 >Feature sequence219 763 401 gene locus_tag LOCUS_17980 763 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_17980 2326 1001 gene locus_tag LOCUS_17990 gene hutI 2326 1001 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZLW0 protein_id gnl|my_center|LOCUS_17990 3435 2389 gene locus_tag LOCUS_18000 gene hutG 3435 2389 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ59 protein_id gnl|my_center|LOCUS_18000 <4877 3463 gene locus_tag LOCUS_18010 <4877 3463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU85:histidine ammonia-lyase >Feature sequence220 <1 676 gene locus_tag LOCUS_18020 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMD7:30S ribosomal protein S1 998 1303 gene locus_tag LOCUS_18030 gene himD 998 1303 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD8 protein_id gnl|my_center|LOCUS_18030 1361 1768 gene locus_tag LOCUS_18040 1361 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1842 2540 gene locus_tag LOCUS_18050 gene pyrF 1842 2540 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KME0 protein_id gnl|my_center|LOCUS_18050 2755 3552 gene locus_tag LOCUS_18060 2755 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_18060 3668 4543 gene locus_tag LOCUS_18070 gene gpmA 3668 4543 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence221 1858 1496 gene locus_tag LOCUS_18080 1858 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2979 2038 gene locus_tag LOCUS_18090 2979 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4357 3431 gene locus_tag LOCUS_18100 gene prmA 4357 3431 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHW3 protein_id gnl|my_center|LOCUS_18100 >Feature sequence222 463 3243 gene locus_tag LOCUS_18110 463 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4065 3343 gene locus_tag LOCUS_18120 4065 3343 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 protein_id gnl|my_center|LOCUS_18120 4392 4616 gene locus_tag LOCUS_18130 4392 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence223 783 1796 gene locus_tag LOCUS_18140 783 1796 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948183.1 protein_id gnl|my_center|LOCUS_18140 2653 1922 gene locus_tag LOCUS_18150 2653 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3288 4553 gene locus_tag LOCUS_18160 3288 4553 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218900.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence224 500 1279 gene locus_tag LOCUS_18170 500 1279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_18170 2818 1304 gene locus_tag LOCUS_18180 gene prpD 2818 1304 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_18180 3592 2966 gene locus_tag LOCUS_18190 3592 2966 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_18190 <4761 3663 gene locus_tag LOCUS_18200 <4761 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438014.1:multidrug ABC transporter ATP-binding protein >Feature sequence225 3695 4450 gene locus_tag LOCUS_18210 3695 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence226 240 443 gene locus_tag LOCUS_18220 240 443 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_18220 1349 1723 gene locus_tag LOCUS_18230 1349 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2157 1846 gene locus_tag LOCUS_18240 2157 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_18240 2829 2197 gene locus_tag LOCUS_18250 2829 2197 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN92 protein_id gnl|my_center|LOCUS_18250 4757 4224 gene locus_tag LOCUS_18260 4757 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence227 74 1126 gene locus_tag LOCUS_18270 gene recA 74 1126 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFW5 protein_id gnl|my_center|LOCUS_18270 1173 2258 gene locus_tag LOCUS_18280 1173 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3098 2385 gene locus_tag LOCUS_18290 3098 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 protein_id gnl|my_center|LOCUS_18290 3802 3353 gene locus_tag LOCUS_18300 3802 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4136 3855 gene locus_tag LOCUS_18310 4136 3855 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_18310 <4751 4173 gene locus_tag LOCUS_18320 <4751 4173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLV3:dihydropteroate synthase >Feature sequence228 682 1398 gene locus_tag LOCUS_18330 gene queE 682 1398 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL36 protein_id gnl|my_center|LOCUS_18330 1485 2585 gene locus_tag LOCUS_18340 1485 2585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940923.1 protein_id gnl|my_center|LOCUS_18340 2688 3323 gene locus_tag LOCUS_18350 2688 3323 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_18350 3404 4069 gene locus_tag LOCUS_18360 3404 4069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_18360 <4737 4143 gene locus_tag LOCUS_18370 <4737 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771237.1:single-stranded-DNA-specific exonuclease >Feature sequence229 1447 941 gene locus_tag LOCUS_18380 1447 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2035 1637 gene locus_tag LOCUS_18390 2035 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3283 2288 gene locus_tag LOCUS_18400 3283 2288 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_18400 4655 3465 gene locus_tag LOCUS_18410 4655 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence230 1688 2512 gene locus_tag LOCUS_18420 gene thiG 1688 2512 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL0 protein_id gnl|my_center|LOCUS_18420 2633 4060 gene locus_tag LOCUS_18430 2633 4060 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_18430 <4690 4118 gene locus_tag LOCUS_18440 <4690 4118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207766.1:inositol monophosphatase >Feature sequence231 1360 128 gene locus_tag LOCUS_18450 1360 128 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888T2 protein_id gnl|my_center|LOCUS_18450 2571 1423 gene locus_tag LOCUS_18460 2571 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 protein_id gnl|my_center|LOCUS_18460 2835 4100 gene locus_tag LOCUS_18470 gene terA 2835 4100 CDS product tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345377.2 protein_id gnl|my_center|LOCUS_18470 >Feature sequence232 <1 516 gene locus_tag LOCUS_18480 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KGX4:urease subunit alpha 697 1323 gene locus_tag LOCUS_18490 697 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1313 2107 gene locus_tag LOCUS_18500 gene ureF 1313 2107 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX6 protein_id gnl|my_center|LOCUS_18500 2165 2854 gene locus_tag LOCUS_18510 gene ureG 2165 2854 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGX7 protein_id gnl|my_center|LOCUS_18510 2906 3658 gene locus_tag LOCUS_18520 gene ureJ 2906 3658 CDS product urease accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 protein_id gnl|my_center|LOCUS_18520 <4659 3864 gene locus_tag LOCUS_18530 <4659 3864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMM1:trigger factor >Feature sequence233 3695 1983 gene locus_tag LOCUS_18540 3695 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence234 <1 739 gene locus_tag LOCUS_18550 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9CEY6:putative agmatine deiminase 867 2240 gene locus_tag LOCUS_18560 867 2240 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731292.1 protein_id gnl|my_center|LOCUS_18560 3757 2315 gene locus_tag LOCUS_18570 3757 2315 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252933.1 protein_id gnl|my_center|LOCUS_18570 <4619 4049 gene locus_tag LOCUS_18580 <4619 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464684.1:4-aminobutyrate transaminase >Feature sequence235 493 2607 gene locus_tag LOCUS_18590 gene ligA 493 2607 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX6 protein_id gnl|my_center|LOCUS_18590 2675 3526 gene locus_tag LOCUS_18600 2675 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4372 3653 gene locus_tag LOCUS_18610 4372 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence236 1567 338 gene locus_tag LOCUS_18620 gene mrp 1567 338 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEV5 protein_id gnl|my_center|LOCUS_18620 2597 1794 gene locus_tag LOCUS_18630 gene bdhA-2 2597 1794 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198122.1 protein_id gnl|my_center|LOCUS_18630 3357 2728 gene locus_tag LOCUS_18640 3357 2728 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_18640 4174 3461 gene locus_tag LOCUS_18650 gene atoD 4174 3461 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence237 127 663 gene locus_tag LOCUS_18660 127 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18660 793 1419 gene locus_tag LOCUS_18670 793 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2040 1429 gene locus_tag LOCUS_18680 2040 1429 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_18680 2286 3353 gene locus_tag LOCUS_18690 gene ribF 2286 3353 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM5 protein_id gnl|my_center|LOCUS_18690 3673 3434 gene locus_tag LOCUS_18700 3673 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771165.1 protein_id gnl|my_center|LOCUS_18700 <4605 3945 gene locus_tag LOCUS_18710 <4605 3945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RXI8:malate dehydrogenase >Feature sequence238 2894 507 gene locus_tag LOCUS_18720 2894 507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940950.1 protein_id gnl|my_center|LOCUS_18720 4364 2931 gene locus_tag LOCUS_18730 4364 2931 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940951.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence239 510 1004 gene locus_tag LOCUS_18740 510 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545799.1 protein_id gnl|my_center|LOCUS_18740 <4584 3853 gene locus_tag LOCUS_18750 <4584 3853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086719.1:enoyl-CoA hydratase >Feature sequence240 525 1631 gene locus_tag LOCUS_18760 gene alr 525 1631 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV4 protein_id gnl|my_center|LOCUS_18760 1841 2761 gene locus_tag LOCUS_18770 gene argF 1841 2761 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_18770 3544 2885 gene locus_tag LOCUS_18780 gene rpiA 3544 2885 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFR7 protein_id gnl|my_center|LOCUS_18780 >Feature sequence241 748 83 gene locus_tag LOCUS_18790 748 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 975 1463 gene locus_tag LOCUS_18800 975 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2375 2094 gene locus_tag LOCUS_18810 2375 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18810 3533 2529 gene locus_tag LOCUS_18820 3533 2529 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_18820 <4560 3841 gene locus_tag LOCUS_18830 <4560 3841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204943.1:GntR family transcriptional regulator >Feature sequence242 342 2717 gene locus_tag LOCUS_18840 gene katG1 342 2717 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E981 protein_id gnl|my_center|LOCUS_18840 3049 3978 gene locus_tag LOCUS_18850 gene gltC 3049 3978 CDS product cys regulon transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence243 3 3359 gene locus_tag LOCUS_18860 3 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence244 <1 1956 gene locus_tag LOCUS_18870 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM84:transketolase 2231 2773 gene locus_tag LOCUS_18880 2231 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2958 3374 gene locus_tag LOCUS_18890 2958 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3448 4443 gene locus_tag LOCUS_18900 3448 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence245 725 1783 gene locus_tag LOCUS_18910 725 1783 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089533.1 protein_id gnl|my_center|LOCUS_18910 2570 2091 gene locus_tag LOCUS_18920 2570 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2708 3871 gene locus_tag LOCUS_18930 gene gatA 2708 3871 CDS product Glu-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence246 <1 876 gene locus_tag LOCUS_18940 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000382837.1:tripartite tricarboxylate transporter TctA 2324 1107 gene locus_tag LOCUS_18950 gene fdmA2 2324 1107 CDS product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_18950 3536 2604 gene locus_tag LOCUS_18960 3536 2604 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_18960 <4484 3570 gene locus_tag LOCUS_18970 <4484 3570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003124441.1:two-component sensor >Feature sequence247 222 617 gene locus_tag LOCUS_18980 222 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 643 1158 gene locus_tag LOCUS_18990 643 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1372 2448 gene locus_tag LOCUS_19000 gene tsaD 1372 2448 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII7 protein_id gnl|my_center|LOCUS_19000 2449 2820 gene locus_tag LOCUS_19010 gene crcB 2449 2820 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9N0 protein_id gnl|my_center|LOCUS_19010 3757 3041 gene locus_tag LOCUS_19020 3757 3041 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104022.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence248 1423 584 gene locus_tag LOCUS_19030 1423 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2687 1416 gene locus_tag LOCUS_19040 2687 1416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924694.1 protein_id gnl|my_center|LOCUS_19040 <4471 3086 gene locus_tag LOCUS_19050 <4471 3086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMI4:valine--tRNA ligase >Feature sequence249 810 64 gene locus_tag LOCUS_19060 810 64 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123287.1 protein_id gnl|my_center|LOCUS_19060 3302 996 gene locus_tag LOCUS_19070 3302 996 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705823.1 protein_id gnl|my_center|LOCUS_19070 <4386 3427 gene locus_tag LOCUS_19080 <4386 3427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098002.1:multidrug ABC transporter permease/ATP-binding protein >Feature sequence250 1 210 gene locus_tag LOCUS_19090 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 276 1577 gene locus_tag LOCUS_19100 gene paaK 276 1577 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKA3 protein_id gnl|my_center|LOCUS_19100 1645 2580 gene locus_tag LOCUS_19110 gene paaX 1645 2580 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062822.1 protein_id gnl|my_center|LOCUS_19110 2646 3245 gene locus_tag LOCUS_19120 gene paaY 2646 3245 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206404.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence251 <1 549 gene locus_tag LOCUS_19130 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004699892.1:tol-pal system-associated acyl-CoA thioesterase 803 1393 gene locus_tag LOCUS_19140 803 1393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535853.1 protein_id gnl|my_center|LOCUS_19140 1488 2273 gene locus_tag LOCUS_19150 1488 2273 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence252 229 1263 gene locus_tag LOCUS_19160 gene cmoB 229 1263 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5W0 protein_id gnl|my_center|LOCUS_19160 1348 2451 gene locus_tag LOCUS_19170 1348 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207540.1 protein_id gnl|my_center|LOCUS_19170 2777 2559 gene locus_tag LOCUS_19180 2777 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence253 638 42 gene locus_tag LOCUS_19190 638 42 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 protein_id gnl|my_center|LOCUS_19190 853 2313 gene locus_tag LOCUS_19200 gene cysS 853 2313 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIX2 protein_id gnl|my_center|LOCUS_19200 >Feature sequence254 569 1192 gene locus_tag LOCUS_19210 569 1192 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246674.1 protein_id gnl|my_center|LOCUS_19210 1972 1178 gene locus_tag LOCUS_19220 1972 1178 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888364.1 protein_id gnl|my_center|LOCUS_19220 2505 2068 gene locus_tag LOCUS_19230 gene sspB 2505 2068 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_19230 3243 2629 gene locus_tag LOCUS_19240 gene sspA 3243 2629 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_19240 4157 3441 gene locus_tag LOCUS_19250 4157 3441 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence255 <1 671 gene locus_tag LOCUS_19260 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104662.1:membrane protein 841 2355 gene locus_tag LOCUS_19270 841 2355 CDS product transport-related membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535997.1 protein_id gnl|my_center|LOCUS_19270 2488 3468 gene locus_tag LOCUS_19280 2488 3468 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705419.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence256 105 1526 gene locus_tag LOCUS_19290 gene gltD 105 1526 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_19290 1732 2943 gene locus_tag LOCUS_19300 1732 2943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208824.1 protein_id gnl|my_center|LOCUS_19300 4145 3018 gene locus_tag LOCUS_19310 gene potD 4145 3018 CDS product spermidine/putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2C8 protein_id gnl|my_center|LOCUS_19310 >Feature sequence257 1864 191 gene locus_tag LOCUS_19320 1864 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2228 2440 gene locus_tag LOCUS_19330 2228 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4002 2599 gene locus_tag LOCUS_19340 4002 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence258 123 566 gene locus_tag LOCUS_19350 123 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 protein_id gnl|my_center|LOCUS_19350 1456 659 gene locus_tag LOCUS_19360 gene fabM 1456 659 CDS product trans-2-decenoyl-[acyl-carrier-protein] isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DSN0 protein_id gnl|my_center|LOCUS_19360 1782 2594 gene locus_tag LOCUS_19370 gene pcaD 1782 2594 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_19370 3855 2716 gene locus_tag LOCUS_19380 3855 2716 CDS product citrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266643.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence259 1272 70 gene locus_tag LOCUS_19390 gene queA 1272 70 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNY3 protein_id gnl|my_center|LOCUS_19390 2550 1450 gene locus_tag LOCUS_19400 gene dinB 2550 1450 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_19400 3057 3302 gene locus_tag LOCUS_19410 3057 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3466 3380 gene locus_tag LOCUS_t00200 3466 3380 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <4126 3603 gene locus_tag LOCUS_19420 <4126 3603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091832.1:ferredoxin--NADP(+) reductase >Feature sequence260 1737 1498 gene locus_tag LOCUS_19430 1737 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4091 2091 gene locus_tag LOCUS_19440 4091 2091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948071.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence261 607 185 gene locus_tag LOCUS_19450 607 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 994 1641 gene locus_tag LOCUS_19460 gene hisB 994 1641 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL4 protein_id gnl|my_center|LOCUS_19460 1641 2285 gene locus_tag LOCUS_19470 gene hisH 1641 2285 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL5 protein_id gnl|my_center|LOCUS_19470 2315 2845 gene locus_tag LOCUS_19480 2315 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4106 2883 gene locus_tag LOCUS_19490 gene avtA 4106 2883 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225657.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence262 1294 683 gene locus_tag LOCUS_19500 1294 683 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY7 protein_id gnl|my_center|LOCUS_19500 2200 1361 gene locus_tag LOCUS_19510 2200 1361 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 protein_id gnl|my_center|LOCUS_19510 2811 2206 gene locus_tag LOCUS_19520 gene mdmC 2811 2206 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_19520 3899 2829 gene locus_tag LOCUS_19530 gene trpS 3899 2829 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYQ9 protein_id gnl|my_center|LOCUS_19530 >Feature sequence263 3192 331 gene locus_tag LOCUS_19540 3192 331 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208210.1 protein_id gnl|my_center|LOCUS_19540 3834 3340 gene locus_tag LOCUS_19550 3834 3340 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence264 219 1019 gene locus_tag LOCUS_19560 219 1019 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_19560 1147 2349 gene locus_tag LOCUS_19570 1147 2349 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_19570 2491 2736 gene locus_tag LOCUS_19580 2491 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence265 262 2001 gene locus_tag LOCUS_19590 gene glnS2 262 2001 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH76 protein_id gnl|my_center|LOCUS_19590 2200 2751 gene locus_tag LOCUS_19600 2200 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2976 3614 gene locus_tag LOCUS_19610 2976 3614 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence266 2079 868 gene locus_tag LOCUS_19620 gene pcaF 2079 868 CDS product beta-ketoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6R0 protein_id gnl|my_center|LOCUS_19620 3077 2352 gene locus_tag LOCUS_19630 3077 2352 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267908.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence267 469 1926 gene locus_tag LOCUS_19640 469 1926 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261810.1 protein_id gnl|my_center|LOCUS_19640 2153 3802 gene locus_tag LOCUS_19650 2153 3802 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261811.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence268 <1 765 gene locus_tag LOCUS_19660 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIL4:methionyl-tRNA formyltransferase 846 2432 gene locus_tag LOCUS_19670 gene sun 846 2432 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIL5 protein_id gnl|my_center|LOCUS_19670 2479 3900 gene locus_tag LOCUS_19680 gene thrC 2479 3900 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence269 704 1267 gene locus_tag LOCUS_19690 704 1267 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_19690 <4015 1372 gene locus_tag LOCUS_19700 <4015 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206955.1:peptidase M16 >Feature sequence270 158 1174 gene locus_tag LOCUS_19710 gene poxA 158 1174 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLA0 protein_id gnl|my_center|LOCUS_19710 1996 1355 gene locus_tag LOCUS_19720 1996 1355 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_19720 2677 2228 gene locus_tag LOCUS_19730 2677 2228 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCF8 protein_id gnl|my_center|LOCUS_19730 <3975 2677 gene locus_tag LOCUS_19740 <3975 2677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPF3:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence271 65 571 gene locus_tag LOCUS_19750 gene rplI 65 571 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_19750 914 1153 gene locus_tag LOCUS_19760 914 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1581 2939 gene locus_tag LOCUS_19770 1581 2939 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482895.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence272 91 18 gene locus_tag LOCUS_t00210 91 18 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1370 324 gene locus_tag LOCUS_19780 gene fdhD 1370 324 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLQ7 protein_id gnl|my_center|LOCUS_19780 3695 1377 gene locus_tag LOCUS_19790 gene ydeP 3695 1377 CDS product oxidoreductase molybdopterin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207424.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence273 419 871 gene locus_tag LOCUS_19800 419 871 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064706.1 protein_id gnl|my_center|LOCUS_19800 1253 969 gene locus_tag LOCUS_19810 1253 969 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3E3 protein_id gnl|my_center|LOCUS_19810 2345 1296 gene locus_tag LOCUS_19820 gene prfB 2345 1296 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN98 protein_id gnl|my_center|LOCUS_19820 3214 2510 gene locus_tag LOCUS_19830 3214 2510 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 protein_id gnl|my_center|LOCUS_19830 3908 3372 gene locus_tag LOCUS_19840 3908 3372 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence274 71 850 gene locus_tag LOCUS_19850 71 850 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_19850 1052 2104 gene locus_tag LOCUS_19860 1052 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3382 2429 gene locus_tag LOCUS_19870 3382 2429 CDS product ferredoxin:oxidoreductase FAD/NAD(P)-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence275 730 263 gene locus_tag LOCUS_19880 gene dgkA 730 263 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216810.1 protein_id gnl|my_center|LOCUS_19880 2322 961 gene locus_tag LOCUS_19890 2322 961 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_19890 3043 2342 gene locus_tag LOCUS_19900 gene colR 3043 2342 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_19900 3884 3117 gene locus_tag LOCUS_19910 3884 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence276 1653 556 gene locus_tag LOCUS_19920 gene sbp 1653 556 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225284.1 protein_id gnl|my_center|LOCUS_19920 2955 1939 gene locus_tag LOCUS_19930 gene sbp 2955 1939 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225284.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence277 837 376 gene locus_tag LOCUS_19940 gene tolR 837 376 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_19940 1562 834 gene locus_tag LOCUS_19950 1562 834 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_19950 2114 3409 gene locus_tag LOCUS_19960 2114 3409 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence278 1989 277 gene locus_tag LOCUS_19970 gene hutU 1989 277 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MIU2 protein_id gnl|my_center|LOCUS_19970 2291 3043 gene locus_tag LOCUS_19980 2291 3043 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075034.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence279 199 954 gene locus_tag LOCUS_19990 199 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1016 2230 gene locus_tag LOCUS_20000 gene dapE 1016 2230 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_20000 2972 2310 gene locus_tag LOCUS_20010 2972 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3544 3041 gene locus_tag LOCUS_20020 3544 3041 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966759.1 protein_id gnl|my_center|LOCUS_20020 3820 3611 gene locus_tag LOCUS_20030 3820 3611 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence280 1633 1094 gene locus_tag LOCUS_20040 1633 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2182 1832 gene locus_tag LOCUS_20050 gene grxD 2182 1832 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_20050 2869 2369 gene locus_tag LOCUS_20060 gene ispF 2869 2369 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE4 protein_id gnl|my_center|LOCUS_20060 >Feature sequence281 33 108 gene locus_tag LOCUS_t00220 33 108 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 934 326 gene locus_tag LOCUS_20070 934 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1970 1224 gene locus_tag LOCUS_20080 gene ispD 1970 1224 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFP3 protein_id gnl|my_center|LOCUS_20080 2392 2084 gene locus_tag LOCUS_20090 2392 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 <3803 2553 gene locus_tag LOCUS_20100 <3803 2553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFP8:enolase >Feature sequence282 <1 983 gene locus_tag LOCUS_20110 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066859.1:alkane 1-monooxygenase 1032 1202 gene locus_tag LOCUS_20120 1032 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2259 1300 gene locus_tag LOCUS_20130 2259 1300 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_20130 <3774 2496 gene locus_tag LOCUS_20140 <3774 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KHW1:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence283 308 784 gene locus_tag LOCUS_20150 308 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1298 864 gene locus_tag LOCUS_20160 1298 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2144 1332 gene locus_tag LOCUS_20170 gene aat 2144 1332 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK3 protein_id gnl|my_center|LOCUS_20170 3167 2145 gene locus_tag LOCUS_20180 gene trxB 3167 2145 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFK4 protein_id gnl|my_center|LOCUS_20180 >Feature sequence284 <1 1067 gene locus_tag LOCUS_20190 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815901.1:c-type cytochrome biogenesis protein CcmI 1284 1940 gene locus_tag LOCUS_20200 gene adk 1284 1940 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY3 protein_id gnl|my_center|LOCUS_20200 2622 2170 gene locus_tag LOCUS_20210 gene secB 2622 2170 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS3 protein_id gnl|my_center|LOCUS_20210 3062 2799 gene locus_tag LOCUS_20220 gene grx 3062 2799 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence285 1895 1017 gene locus_tag LOCUS_20230 gene rnhB 1895 1017 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF1 protein_id gnl|my_center|LOCUS_20230 3234 1918 gene locus_tag LOCUS_20240 gene lpxB 3234 1918 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN14 protein_id gnl|my_center|LOCUS_20240 >Feature sequence286 <1 1138 gene locus_tag LOCUS_20250 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124764.1:reverse transcriptase 1825 1184 gene locus_tag LOCUS_20260 1825 1184 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_20260 2244 3419 gene locus_tag LOCUS_20270 2244 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20270 >Feature sequence287 1540 305 gene locus_tag LOCUS_20280 gene fabB 1540 305 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_20280 2105 3187 gene locus_tag LOCUS_20290 2105 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence288 2046 1111 gene locus_tag LOCUS_20300 gene ywfM 2046 1111 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208185.1 protein_id gnl|my_center|LOCUS_20300 2849 2139 gene locus_tag LOCUS_20310 2849 2139 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948251.1 protein_id gnl|my_center|LOCUS_20310 3693 2902 gene locus_tag LOCUS_20320 3693 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence289 <1 688 gene locus_tag LOCUS_20330 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM04:3-isopropylmalate dehydrogenase 977 2245 gene locus_tag LOCUS_20340 977 2245 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 protein_id gnl|my_center|LOCUS_20340 2704 2483 gene locus_tag LOCUS_20350 gene infA 2704 2483 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM07 protein_id gnl|my_center|LOCUS_20350 3665 2826 gene locus_tag LOCUS_20360 gene truA 3665 2826 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM09 protein_id gnl|my_center|LOCUS_20360 >Feature sequence290 1582 653 gene locus_tag LOCUS_20370 gene ilvE 1582 653 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_20370 <3641 1890 gene locus_tag LOCUS_20380 <3641 1890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNY1:glutamate-ammonia-ligase adenylyltransferase >Feature sequence291 <1 3176 gene locus_tag LOCUS_20390 <1 3176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:type I secretion C-terminal target domain-containing protein >Feature sequence292 1700 1092 gene locus_tag LOCUS_20400 gene nqrE 1700 1092 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_20400 2371 1700 gene locus_tag LOCUS_20410 gene nqrD 2371 1700 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHC9 protein_id gnl|my_center|LOCUS_20410 3275 2373 gene locus_tag LOCUS_20420 gene nqrC 3275 2373 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_20420 >Feature sequence293 2051 576 gene locus_tag LOCUS_20430 2051 576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882878.1 protein_id gnl|my_center|LOCUS_20430 2851 2048 gene locus_tag LOCUS_20440 2851 2048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882876.1 protein_id gnl|my_center|LOCUS_20440 <3576 2936 gene locus_tag LOCUS_20450 <3576 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000161523.1:ABC transporter permease >Feature sequence294 3176 1536 gene locus_tag LOCUS_20460 gene clsA 3176 1536 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU8 protein_id gnl|my_center|LOCUS_20460 >Feature sequence295 1944 187 gene locus_tag LOCUS_20470 gene glnG 1944 187 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368973.1 protein_id gnl|my_center|LOCUS_20470 3394 2027 gene locus_tag LOCUS_20480 gene ntrB 3394 2027 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103111.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence296 679 155 gene locus_tag LOCUS_20490 679 155 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 protein_id gnl|my_center|LOCUS_20490 1329 679 gene locus_tag LOCUS_20500 1329 679 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 protein_id gnl|my_center|LOCUS_20500 1692 1814 gene locus_tag LOCUS_20510 1692 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2227 1889 gene locus_tag LOCUS_20520 2227 1889 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_20520 3040 2228 gene locus_tag LOCUS_20530 3040 2228 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence297 964 1929 gene locus_tag LOCUS_20540 gene yihG 964 1929 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 protein_id gnl|my_center|LOCUS_20540 2277 3362 gene locus_tag LOCUS_20550 2277 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence298 1188 2138 gene locus_tag LOCUS_20560 gene paaA 1188 2138 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206395.1 protein_id gnl|my_center|LOCUS_20560 2182 2472 gene locus_tag LOCUS_20570 gene paaB 2182 2472 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984048.1 protein_id gnl|my_center|LOCUS_20570 2488 3243 gene locus_tag LOCUS_20580 gene paaC 2488 3243 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206396.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence299 <1 671 gene locus_tag LOCUS_20590 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_207754.2:ribonucleotide-diphosphate reductase subunit beta 811 1080 gene locus_tag LOCUS_20600 811 1080 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 protein_id gnl|my_center|LOCUS_20600 2412 1195 gene locus_tag LOCUS_20610 gene algW 2412 1195 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence300 <1 1454 gene locus_tag LOCUS_20620 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000591593.1:glycine/betaine ABC transporter 2585 1590 gene locus_tag LOCUS_20630 2585 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3264 2785 gene locus_tag LOCUS_20640 3264 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence301 <1 1569 gene locus_tag LOCUS_20650 <1 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002219125.1:RNA helicase 1831 3075 gene locus_tag LOCUS_20660 1831 3075 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence302 172 1275 gene locus_tag LOCUS_20670 gene aroC 172 1275 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNJ2 protein_id gnl|my_center|LOCUS_20670 <3459 1728 gene locus_tag LOCUS_20680 <3459 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208147.1:two-component system sensor histidine kinase CreC >Feature sequence303 470 18 gene locus_tag LOCUS_20690 470 18 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200865.1 protein_id gnl|my_center|LOCUS_20690 2420 522 gene locus_tag LOCUS_20700 gene hcaC 2420 522 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206156.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence304 859 695 gene locus_tag LOCUS_20710 859 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1358 1131 gene locus_tag LOCUS_20720 1358 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2398 1442 gene locus_tag LOCUS_20730 2398 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2895 2725 gene locus_tag LOCUS_20740 2895 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence305 1078 1482 gene locus_tag LOCUS_20750 gene pcaC 1078 1482 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 protein_id gnl|my_center|LOCUS_20750 1630 2673 gene locus_tag LOCUS_20760 gene lipA 1630 2673 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ82 protein_id gnl|my_center|LOCUS_20760 <3318 2818 gene locus_tag LOCUS_20770 <3318 2818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869733.1:C4-dicarboxylate ABC transporter >Feature sequence306 3 1520 gene locus_tag LOCUS_20780 3 1520 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_20780 1560 2528 gene locus_tag LOCUS_20790 1560 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence307 1065 217 gene locus_tag LOCUS_20800 1065 217 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 protein_id gnl|my_center|LOCUS_20800 2028 1360 gene locus_tag LOCUS_20810 2028 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2543 2223 gene locus_tag LOCUS_20820 2543 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence308 3077 2589 gene locus_tag LOCUS_20830 3077 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210404.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence309 2084 2944 gene locus_tag LOCUS_20840 2084 2944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708750.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence310 <1 1291 gene locus_tag LOCUS_20850 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KF52:amine oxidase 1457 2881 gene locus_tag LOCUS_20860 1457 2881 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_20860 3254 3036 gene locus_tag LOCUS_20870 3254 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20870 >Feature sequence311 <1 960 gene locus_tag LOCUS_20880 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K0L8:aminomethyltransferase 1078 1458 gene locus_tag LOCUS_20890 gene gcvH 1078 1458 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0L7 protein_id gnl|my_center|LOCUS_20890 1738 2529 gene locus_tag LOCUS_20900 1738 2529 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence312 2143 1271 gene locus_tag LOCUS_20910 2143 1271 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_20910 <3203 2207 gene locus_tag LOCUS_20920 <3203 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207773.1:putative DNA modification/repair radical SAM protein >Feature sequence313 1884 955 gene locus_tag LOCUS_20930 gene glsA 1884 955 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence314 75 638 gene locus_tag LOCUS_20940 75 638 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_20940 2907 730 gene locus_tag LOCUS_20950 2907 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence315 1406 639 gene locus_tag LOCUS_20960 gene cmk1 1406 639 CDS product cytidylate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43892 protein_id gnl|my_center|LOCUS_20960 2056 1586 gene locus_tag LOCUS_20970 gene tadA 2056 1586 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ57 protein_id gnl|my_center|LOCUS_20970 2905 2168 gene locus_tag LOCUS_20980 gene ung 2905 2168 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_20980 >Feature sequence316 63 1685 gene locus_tag LOCUS_20990 63 1685 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_20990 1687 2340 gene locus_tag LOCUS_21000 gene dsbE 1687 2340 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_21000 2337 2894 gene locus_tag LOCUS_21010 2337 2894 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence317 195 722 gene locus_tag LOCUS_21020 195 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 802 1743 gene locus_tag LOCUS_21030 gene rtcA 802 1743 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46849 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21030 >Feature sequence318 249 1184 gene locus_tag LOCUS_21040 gene yeiE 249 1184 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548286.1 protein_id gnl|my_center|LOCUS_21040 1748 1287 gene locus_tag LOCUS_21050 1748 1287 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR97 protein_id gnl|my_center|LOCUS_21050 2385 1924 gene locus_tag LOCUS_21060 2385 1924 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZR97 protein_id gnl|my_center|LOCUS_21060 >Feature sequence319 701 1486 gene locus_tag LOCUS_21070 701 1486 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_21070 1521 2261 gene locus_tag LOCUS_21080 1521 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_21080 <3133 2294 gene locus_tag LOCUS_21090 <3133 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RYW8:UvrABC system protein A >Feature sequence320 3063 391 gene locus_tag LOCUS_21100 gene alaS 3063 391 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI74 protein_id gnl|my_center|LOCUS_21100 >Feature sequence321 999 346 gene locus_tag LOCUS_21110 999 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1278 2150 gene locus_tag LOCUS_21120 1278 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence322 466 1272 gene locus_tag LOCUS_21130 466 1272 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence323 1896 1060 gene locus_tag LOCUS_21140 gene trmB 1896 1060 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI97 protein_id gnl|my_center|LOCUS_21140 2089 3018 gene locus_tag LOCUS_21150 2089 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence324 <1 1130 gene locus_tag LOCUS_21160 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002049199.1:chorismate mutase 1206 2348 gene locus_tag LOCUS_21170 gene hisC2 1206 2348 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_21170 >Feature sequence325 1445 2080 gene locus_tag LOCUS_21180 gene gacA 1445 2080 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence326 <3077 317 gene locus_tag LOCUS_21190 <3077 317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KES9:NADH-quinone oxidoreductase >Feature sequence327 1591 410 gene locus_tag LOCUS_21200 1591 410 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_21200 1833 2618 gene locus_tag LOCUS_21210 1833 2618 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_21210 2763 3054 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcacccgtgatgggtgcgaa >Feature sequence328 65 661 gene locus_tag LOCUS_21220 65 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_21220 840 1859 gene locus_tag LOCUS_21230 840 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224842.1 protein_id gnl|my_center|LOCUS_21230 1912 2454 gene locus_tag LOCUS_21240 1912 2454 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 protein_id gnl|my_center|LOCUS_21240 2637 3014 gene locus_tag LOCUS_21250 2637 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence329 2389 1829 gene locus_tag LOCUS_21260 2389 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 <3047 2367 gene locus_tag LOCUS_21270 <3047 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878139.1:C4-dicarboxylate ABC transporter substrate-binding protein >Feature sequence330 314 943 gene locus_tag LOCUS_21280 314 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1092 1616 gene locus_tag LOCUS_21290 1092 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2555 1644 gene locus_tag LOCUS_21300 2555 1644 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706734.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence331 948 469 gene locus_tag LOCUS_21310 948 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2817 1114 gene locus_tag LOCUS_21320 2817 1114 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence332 <1 644 gene locus_tag LOCUS_21330 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37511:putative transporter YyaM 1609 692 gene locus_tag LOCUS_21340 1609 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 <3000 1882 gene locus_tag LOCUS_21350 <3000 1882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038044.1:two-component system sensor histidine kinase/response regulator >Feature sequence333 80 5 gene locus_tag LOCUS_t00230 80 5 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1389 610 gene locus_tag LOCUS_21360 gene rnt 1389 610 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI2 protein_id gnl|my_center|LOCUS_21360 2632 1562 gene locus_tag LOCUS_21370 gene pyrC 2632 1562 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHI3 protein_id gnl|my_center|LOCUS_21370 >Feature sequence334 577 1479 gene locus_tag LOCUS_21380 577 1479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086538.1 protein_id gnl|my_center|LOCUS_21380 <2985 1510 gene locus_tag LOCUS_21390 <2985 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_207451.1:K(+)/H(+) antiporter >Feature sequence335 <2980 1502 gene locus_tag LOCUS_21400 <2980 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103012.1:long-chain-fatty-acid--CoA ligase >Feature sequence336 975 382 gene locus_tag LOCUS_21410 975 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_21410 1152 1871 gene locus_tag LOCUS_21420 1152 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2114 2734 gene locus_tag LOCUS_21430 2114 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence337 2005 956 gene locus_tag LOCUS_21440 gene holA 2005 956 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_21440 2901 2191 gene locus_tag LOCUS_21450 2901 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence338 >Feature sequence339 1292 168 gene locus_tag LOCUS_21460 gene frmA 1292 168 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFC7 protein_id gnl|my_center|LOCUS_21460 1594 2460 gene locus_tag LOCUS_21470 1594 2460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence340 2067 1255 gene locus_tag LOCUS_21480 2067 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 <2898 2134 gene locus_tag LOCUS_21490 <2898 2134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092223.1:FMN-binding glutamate synthase family protein >Feature sequence341 <1 1097 gene locus_tag LOCUS_21500 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111339.1:L-serine dehydratase 1600 1202 gene locus_tag LOCUS_21510 1600 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 <2898 2011 gene locus_tag LOCUS_21520 <2898 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KP07:arginine biosynthesis bifunctional protein ArgJ >Feature sequence342 2312 1287 gene locus_tag LOCUS_21530 gene ispB 2312 1287 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence343 <1 579 gene locus_tag LOCUS_21540 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002244109.1:threonine synthase 868 2013 gene locus_tag LOCUS_21550 868 2013 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence344 1661 207 gene locus_tag LOCUS_21560 gene lpdG 1661 207 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLX9 protein_id gnl|my_center|LOCUS_21560 <2876 1918 gene locus_tag LOCUS_21570 <2876 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLY0:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence345 2136 1120 gene locus_tag LOCUS_21580 gene ilvC 2136 1120 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMT8 protein_id gnl|my_center|LOCUS_21580 2768 2271 gene locus_tag LOCUS_21590 gene ilvH 2768 2271 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence346 >Feature sequence347 1512 673 gene locus_tag LOCUS_21600 1512 673 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RF6 protein_id gnl|my_center|LOCUS_21600 >Feature sequence348 1432 422 gene locus_tag LOCUS_21610 gene rluC 1432 422 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0PCI6 protein_id gnl|my_center|LOCUS_21610 >Feature sequence349 2016 1120 gene locus_tag LOCUS_21620 gene pssA 2016 1120 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_21620 <2812 2051 gene locus_tag LOCUS_21630 <2812 2051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPX2:ribosomal RNA large subunit methyltransferase J >Feature sequence350 1349 1924 gene locus_tag LOCUS_21640 1349 1924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_21640 2285 1977 gene locus_tag LOCUS_21650 2285 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2796 2452 gene locus_tag LOCUS_21660 2796 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence351 <2798 392 gene locus_tag LOCUS_21670 <2798 392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ35:penicillin-binding protein 1B >Feature sequence352 490 1596 gene locus_tag LOCUS_21680 gene yhcM 490 1596 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMV3 protein_id gnl|my_center|LOCUS_21680 1686 2345 gene locus_tag LOCUS_21690 1686 2345 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence353 113 817 gene locus_tag LOCUS_21700 113 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence354 <1 844 gene locus_tag LOCUS_21710 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338014.1:Na+/H+ antiporter NhaC 862 2148 gene locus_tag LOCUS_21720 862 2148 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112529.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence355 19 95 gene locus_tag LOCUS_t00240 19 95 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 538 1038 gene locus_tag LOCUS_21730 gene rimP 538 1038 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB2 protein_id gnl|my_center|LOCUS_21730 1175 2659 gene locus_tag LOCUS_21740 gene nusA 1175 2659 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLB3 protein_id gnl|my_center|LOCUS_21740 >Feature sequence356 2 1006 gene locus_tag LOCUS_21750 2 1006 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600796.1 protein_id gnl|my_center|LOCUS_21750 1230 1655 gene locus_tag LOCUS_21760 1230 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528789.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence357 1075 374 gene locus_tag LOCUS_21770 1075 374 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 protein_id gnl|my_center|LOCUS_21770 1435 2094 gene locus_tag LOCUS_21780 gene upp 1435 2094 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K048 protein_id gnl|my_center|LOCUS_21780 >Feature sequence358 222 1847 gene locus_tag LOCUS_21790 222 1847 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464476.1 protein_id gnl|my_center|LOCUS_21790 1887 2120 gene locus_tag LOCUS_21800 1887 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence359 1342 821 gene locus_tag LOCUS_21810 gene menG 1342 821 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_21810 2134 1433 gene locus_tag LOCUS_21820 2134 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence360 170 1144 gene locus_tag LOCUS_21830 170 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 protein_id gnl|my_center|LOCUS_21830 1688 1299 gene locus_tag LOCUS_21840 1688 1299 CDS product SCP-2 sterol transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence361 819 244 gene locus_tag LOCUS_21850 819 244 CDS product chemical-damaging agent resistance protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266647.1 protein_id gnl|my_center|LOCUS_21850 <2582 1079 gene locus_tag LOCUS_21860 <2582 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI89:ribosomal RNA large subunit methyltransferase K/L >Feature sequence362 102 1688 gene locus_tag LOCUS_21870 gene yliG 102 1688 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD7 protein_id gnl|my_center|LOCUS_21870 >Feature sequence363 883 2346 gene locus_tag LOCUS_21880 gene gabD 883 2346 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence364 439 1419 gene locus_tag LOCUS_21890 gene hslO 439 1419 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLE5 protein_id gnl|my_center|LOCUS_21890 2152 1535 gene locus_tag LOCUS_21900 2152 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence365 1260 61 gene locus_tag LOCUS_21910 gene sotB 1260 61 CDS product putative sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3G0D1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence366 228 1049 gene locus_tag LOCUS_21920 228 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1046 1471 gene locus_tag LOCUS_21930 1046 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1786 1526 gene locus_tag LOCUS_21940 1786 1526 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence367 <2554 715 gene locus_tag LOCUS_21950 <2554 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207012.1:nitrate reductase >Feature sequence368 >Feature sequence369 1557 964 gene locus_tag LOCUS_21960 1557 964 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972227.1 protein_id gnl|my_center|LOCUS_21960 1897 1559 gene locus_tag LOCUS_21970 1897 1559 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311727.1 protein_id gnl|my_center|LOCUS_21970 2404 2479 gene locus_tag LOCUS_t00250 2404 2479 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence370 647 1033 gene locus_tag LOCUS_21980 647 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence371 <1 554 gene locus_tag LOCUS_21990 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963487.1:ABC transporter permease 744 1580 gene locus_tag LOCUS_22000 744 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1593 2309 gene locus_tag LOCUS_22010 1593 2309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence372 509 96 gene locus_tag LOCUS_22020 gene yaeJ 509 96 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_22020 1440 568 gene locus_tag LOCUS_22030 1440 568 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064995.1 protein_id gnl|my_center|LOCUS_22030 2405 1644 gene locus_tag LOCUS_22040 gene dhrS4 2405 1644 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence373 1 2406 gene locus_tag LOCUS_22050 gene gcvP 1 2406 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F761 protein_id gnl|my_center|LOCUS_22050 >Feature sequence374 <1 1622 gene locus_tag LOCUS_22060 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267702.1:methionine synthase >Feature sequence375 <1 822 gene locus_tag LOCUS_22070 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJF4:arginine--tRNA ligase 910 1704 gene locus_tag LOCUS_22080 910 1704 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208120.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence376 >Feature sequence377 <1 894 gene locus_tag LOCUS_22090 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205978.1:acyltransferase 1010 1705 gene locus_tag LOCUS_22100 1010 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 <2475 1795 gene locus_tag LOCUS_22110 <2475 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208471.1:secretion protein HlyD >Feature sequence378 293 667 gene locus_tag LOCUS_22120 293 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence379 734 399 gene locus_tag LOCUS_22130 734 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1126 1893 gene locus_tag LOCUS_22140 gene engB 1126 1893 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFA1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence380 262 1530 gene locus_tag LOCUS_22150 gene dcaK 262 1530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206439.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence381 1513 1968 gene locus_tag LOCUS_22160 gene tusD 1513 1968 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 protein_id gnl|my_center|LOCUS_22160 2036 2359 gene locus_tag LOCUS_22170 2036 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence382 431 144 gene locus_tag LOCUS_22180 431 144 CDS product RelE toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889208.1 protein_id gnl|my_center|LOCUS_22180 672 421 gene locus_tag LOCUS_22190 672 421 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMA1 protein_id gnl|my_center|LOCUS_22190 883 743 gene locus_tag LOCUS_22200 883 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2247 997 gene locus_tag LOCUS_22210 2247 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036786.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence383 2332 1091 gene locus_tag LOCUS_22220 gene nspC 2332 1091 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TG9 protein_id gnl|my_center|LOCUS_22220 >Feature sequence384 6 770 gene locus_tag LOCUS_22230 6 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence385 1448 894 gene locus_tag LOCUS_22240 1448 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144040.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence386 1284 220 gene locus_tag LOCUS_22250 1284 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2321 1617 gene locus_tag LOCUS_22260 2321 1617 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM54 protein_id gnl|my_center|LOCUS_22260 >Feature sequence387 <2389 345 gene locus_tag LOCUS_22270 <2389 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268745.1:glucose dehydrogenase >Feature sequence388 814 161 gene locus_tag LOCUS_22280 814 161 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126999.1 protein_id gnl|my_center|LOCUS_22280 993 1253 gene locus_tag LOCUS_22290 993 1253 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 protein_id gnl|my_center|LOCUS_22290 2081 1614 gene locus_tag LOCUS_22300 2081 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence389 >Feature sequence390 878 48 gene locus_tag LOCUS_22310 878 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309375.1 protein_id gnl|my_center|LOCUS_22310 2237 921 gene locus_tag LOCUS_22320 2237 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209072.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence391 1333 740 gene locus_tag LOCUS_22330 1333 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1685 1425 gene locus_tag LOCUS_22340 1685 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence392 1062 2060 gene locus_tag LOCUS_22350 1062 2060 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766545.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence393 <2313 1503 gene locus_tag LOCUS_22360 <2313 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085584.1:protein kinase >Feature sequence394 >Feature sequence395 263 850 gene locus_tag LOCUS_22370 263 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 917 1492 gene locus_tag LOCUS_22380 917 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 protein_id gnl|my_center|LOCUS_22380 1512 1970 gene locus_tag LOCUS_22390 1512 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence396 978 520 gene locus_tag LOCUS_22400 978 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_22400 1466 996 gene locus_tag LOCUS_22410 1466 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 <2272 1484 gene locus_tag LOCUS_22420 <2272 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8X6Z8:RNA-splicing ligase RtcB >Feature sequence397 859 254 gene locus_tag LOCUS_22430 859 254 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268480.1 protein_id gnl|my_center|LOCUS_22430 1180 2220 gene locus_tag LOCUS_22440 1180 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence398 >Feature sequence399 1022 1453 gene locus_tag LOCUS_22450 1022 1453 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887955.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence400 1397 525 gene locus_tag LOCUS_22460 gene hemK 1397 525 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHT0 protein_id gnl|my_center|LOCUS_22460 <2231 1446 gene locus_tag LOCUS_22470 <2231 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387908.1:MFS transporter >Feature sequence401 <1 1740 gene locus_tag LOCUS_22480 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLV4:ATP-dependent zinc metalloprotease FtsH >Feature sequence402 448 1794 gene locus_tag LOCUS_22490 448 1794 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence403 1086 574 gene locus_tag LOCUS_22500 1086 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22500 1348 2127 gene locus_tag LOCUS_22510 1348 2127 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_22510 >Feature sequence404 <2202 569 gene locus_tag LOCUS_22520 <2202 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207474.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence405 447 67 gene locus_tag LOCUS_22530 447 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 <2188 519 gene locus_tag LOCUS_22540 <2188 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLL6:DNA-directed DNA polymerase >Feature sequence406 >Feature sequence407 942 205 gene locus_tag LOCUS_22550 gene hisA 942 205 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGL8 protein_id gnl|my_center|LOCUS_22550 >Feature sequence408 <1 1383 gene locus_tag LOCUS_22560 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJQ9:glutamine synthetase >Feature sequence409 >Feature sequence410 <2136 1027 gene locus_tag LOCUS_22570 <2136 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206394.1:bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase >Feature sequence411 873 202 gene locus_tag LOCUS_22580 873 202 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_22580 1187 1969 gene locus_tag LOCUS_22590 gene creB 1187 1969 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208148.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence412 1497 1856 gene locus_tag LOCUS_22600 1497 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941585.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence413 1011 4 gene locus_tag LOCUS_22610 1011 4 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_22610 <2079 1034 gene locus_tag LOCUS_22620 <2079 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266447.1:acyl-CoA dehydrogenase >Feature sequence414 202 1167 gene locus_tag LOCUS_22630 gene apaH 202 1167 CDS product diadenosine tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_22630 1267 1818 gene locus_tag LOCUS_22640 gene purE 1267 1818 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF4 protein_id gnl|my_center|LOCUS_22640 >Feature sequence415 >Feature sequence416 >Feature sequence417 359 1003 gene locus_tag LOCUS_22650 359 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1451 1960 gene locus_tag LOCUS_22660 1451 1960 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence418 1454 564 gene locus_tag LOCUS_22670 1454 564 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence419 1975 665 gene locus_tag LOCUS_22680 1975 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence420 62 1465 gene locus_tag LOCUS_22690 gene sldC 62 1465 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383155.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence421 <1 719 gene locus_tag LOCUS_22700 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZGV9:NAD/NADP-dependent betaine aldehyde dehydrogenase >Feature sequence422 115 336 gene locus_tag LOCUS_22710 115 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1086 583 gene locus_tag LOCUS_22720 1086 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 1326 1661 gene locus_tag LOCUS_22730 1326 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence423 1374 127 gene locus_tag LOCUS_22740 1374 127 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence424 31 624 gene locus_tag LOCUS_22750 31 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 626 943 gene locus_tag LOCUS_22760 626 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence425 <1956 911 gene locus_tag LOCUS_22770 <1956 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KPS1:Na(+)-translocating NADH-quinone reductase subunit A >Feature sequence426 252 1277 gene locus_tag LOCUS_22780 252 1277 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358614.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence427 >Feature sequence428 >Feature sequence429 1423 1043 gene locus_tag LOCUS_22790 gene panD 1423 1043 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF03 protein_id gnl|my_center|LOCUS_22790 >Feature sequence430 <1 1370 gene locus_tag LOCUS_22800 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KMF3:RNA polymerase sigma factor RpoD >Feature sequence431 698 1813 gene locus_tag LOCUS_22810 gene catB 698 1813 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence432 <1 522 gene locus_tag LOCUS_22820 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EFV6:ubiquinol oxidase subunit 2 >Feature sequence433 <1905 623 gene locus_tag LOCUS_22830 <1905 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208297.1:ABC transporter ATP-binding protein >Feature sequence434 1807 461 gene locus_tag LOCUS_22840 gene secY 1807 461 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ12 protein_id gnl|my_center|LOCUS_22840 >Feature sequence435 >Feature sequence436 <1 938 gene locus_tag LOCUS_22850 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNY7:protein-export membrane protein SecF >Feature sequence437 672 58 gene locus_tag LOCUS_22860 672 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455876.1 protein_id gnl|my_center|LOCUS_22860 1640 846 gene locus_tag LOCUS_22870 1640 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence438 <1 874 gene locus_tag LOCUS_22880 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_207754.2:ribonucleotide-diphosphate reductase subunit beta 1012 1281 gene locus_tag LOCUS_22890 1012 1281 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence439 1171 383 gene locus_tag LOCUS_22900 1171 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071717.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence440 273 1541 gene locus_tag LOCUS_22910 gene sat 273 1541 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_22910 >Feature sequence441 <1841 178 gene locus_tag LOCUS_22920 <1841 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207110.1:outer membrane protein assembly factor >Feature sequence442 <1 554 gene locus_tag LOCUS_22930 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KLT7:60 kDa chaperonin 1282 827 gene locus_tag LOCUS_22940 1282 827 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477216.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence443 <1 1251 gene locus_tag LOCUS_22950 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MB15:nuclease SbcCD subunit C >Feature sequence444 1820 621 gene locus_tag LOCUS_22960 1820 621 CDS product histidine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066807.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence445 >Feature sequence446 163 1098 gene locus_tag LOCUS_22970 163 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1103 1324 gene locus_tag LOCUS_22980 1103 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 1370 1810 gene locus_tag LOCUS_22990 1370 1810 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105589.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence447 291 1178 gene locus_tag LOCUS_23000 gene lpxH 291 1178 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH78 protein_id gnl|my_center|LOCUS_23000 >Feature sequence448 <1 870 gene locus_tag LOCUS_23010 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KEW6:tRNA-dihydrouridine(16) synthase 1345 917 gene locus_tag LOCUS_23020 1345 917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 protein_id gnl|my_center|LOCUS_23020 1770 1357 gene locus_tag LOCUS_23030 1770 1357 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence449 >Feature sequence450 1352 291 gene locus_tag LOCUS_23040 1352 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence451 1326 922 gene locus_tag LOCUS_23050 gene erpA 1326 922 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPI5 protein_id gnl|my_center|LOCUS_23050 >Feature sequence452 <1 1766 gene locus_tag LOCUS_23060 <1 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267157.1:peptidoglycan-binding protein >Feature sequence453 >Feature sequence454 499 1605 gene locus_tag LOCUS_23070 gene rp630 499 1605 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence455 <1 809 gene locus_tag LOCUS_23080 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207044.1:esterase <1764 861 gene locus_tag LOCUS_23090 <1764 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389104.1:cation transporter >Feature sequence456 <1763 581 gene locus_tag LOCUS_23100 <1763 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KP48:coenzyme PQQ synthesis protein E >Feature sequence457 >Feature sequence458 1431 307 gene locus_tag LOCUS_23110 1431 307 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45290 protein_id gnl|my_center|LOCUS_23110 >Feature sequence459 <1728 888 gene locus_tag LOCUS_23120 <1728 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029981.1:xanthine dehydrogenase accessory protein XdhC >Feature sequence460 113 38 gene locus_tag LOCUS_t00260 113 38 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 339 264 gene locus_tag LOCUS_t00270 339 264 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 827 462 gene locus_tag LOCUS_23130 827 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 <1723 942 gene locus_tag LOCUS_23140 <1723 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KG28:glutamate--tRNA ligase >Feature sequence461 <1 577 gene locus_tag LOCUS_23150 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206091.1:iron-sulfur protein 669 1364 gene locus_tag LOCUS_23160 gene nth 669 1364 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGY5 protein_id gnl|my_center|LOCUS_23160 >Feature sequence462 1275 184 gene locus_tag LOCUS_23170 gene htrB 1275 184 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM17 protein_id gnl|my_center|LOCUS_23170 >Feature sequence463 <1 579 gene locus_tag LOCUS_23180 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVY4:ubiquinol-cytochrome c reductase iron-sulfur subunit >Feature sequence464 >Feature sequence465 363 1031 gene locus_tag LOCUS_23190 363 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence466 >Feature sequence467 1692 802 gene locus_tag LOCUS_23200 1692 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence468 1360 611 gene locus_tag LOCUS_23210 1360 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence469 1349 96 gene locus_tag LOCUS_23220 1349 96 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence470 29 1264 gene locus_tag LOCUS_23230 gene lolC 29 1264 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence471 92 1375 gene locus_tag LOCUS_23240 92 1375 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence472 <1 589 gene locus_tag LOCUS_23250 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002113693.1:catechol 1,2-dioxygenase 1333 740 gene locus_tag LOCUS_23260 1333 740 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence473 >Feature sequence474 >Feature sequence475 <1 775 gene locus_tag LOCUS_23270 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KJ34:NAD kinase 840 1151 gene locus_tag LOCUS_23280 840 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_23280 1606 1232 gene locus_tag LOCUS_23290 1606 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence476 <1 623 gene locus_tag LOCUS_23300 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119725.1:O-antigen translocase 1491 835 gene locus_tag LOCUS_23310 1491 835 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence477 988 83 gene locus_tag LOCUS_23320 gene pstA 988 83 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSV4 protein_id gnl|my_center|LOCUS_23320 1651 1049 gene locus_tag LOCUS_23330 1651 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence478 <1647 6 gene locus_tag LOCUS_23340 <1647 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KL86:DNA gyrase subunit A >Feature sequence479 767 1177 gene locus_tag LOCUS_23350 767 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence480 <1636 856 gene locus_tag LOCUS_23360 <1636 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74C48:L-aspartate oxidase >Feature sequence481 438 1238 gene locus_tag LOCUS_23370 gene bdhA-2 438 1238 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198122.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence482 654 1532 gene locus_tag LOCUS_23380 654 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence483 530 889 gene locus_tag LOCUS_23390 530 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225039.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence484 >Feature sequence485 19 127 gene locus_tag LOCUS_r00010 19 127 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 325 945 gene locus_tag LOCUS_23400 325 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1020 1388 gene locus_tag LOCUS_23410 1020 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence486 2 757 gene locus_tag LOCUS_23420 2 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 991 1419 gene locus_tag LOCUS_23430 991 1419 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence487 <1608 554 gene locus_tag LOCUS_23440 <1608 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116919.1:D-3-phosphoglycerate dehydrogenase >Feature sequence488 <1606 244 gene locus_tag LOCUS_23450 <1606 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MA98:nuclease SbcCD subunit D >Feature sequence489 2 1033 gene locus_tag LOCUS_23460 2 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1603 1046 gene locus_tag LOCUS_23470 1603 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence490 <1 672 gene locus_tag LOCUS_23480 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KGC1:adenosylmethionine-8-amino-7-oxononanoate aminotransferase 675 1394 gene locus_tag LOCUS_23490 gene bioD 675 1394 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K085 protein_id gnl|my_center|LOCUS_23490 >Feature sequence491 <1 812 gene locus_tag LOCUS_23500 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015323.1:pyridine nucleotide-disulfide oxidoreductase 899 1495 gene locus_tag LOCUS_23510 899 1495 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence492 51 905 gene locus_tag LOCUS_23520 51 905 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence493 <1 1235 gene locus_tag LOCUS_23530 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527057.1:betaine-aldehyde dehydrogenase >Feature sequence494 39 614 gene locus_tag LOCUS_23540 39 614 CDS product tellurium resistance protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888851.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence495 268 900 gene locus_tag LOCUS_23550 gene rlmE 268 900 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLV5 protein_id gnl|my_center|LOCUS_23550 >Feature sequence496 1346 522 gene locus_tag LOCUS_23560 1346 522 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 protein_id gnl|my_center|LOCUS_23560 1296 1436 gene locus_tag LOCUS_23570 1296 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence497 >Feature sequence498 575 1276 gene locus_tag LOCUS_23580 gene modC 575 1276 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064503.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence499 <1 749 gene locus_tag LOCUS_23590 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117074.1:AI-2E family transporter >Feature sequence500 1494 253 gene locus_tag LOCUS_23600 gene carA 1494 253 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW0 protein_id gnl|my_center|LOCUS_23600 >Feature sequence501 >Feature sequence502 1502 903 gene locus_tag LOCUS_23610 1502 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence503 1334 777 gene locus_tag LOCUS_23620 1334 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence504 <1 1229 gene locus_tag LOCUS_23630 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267830.1:secretion protein HlyD >Feature sequence505 <1 560 gene locus_tag LOCUS_23640 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369891.1:acyl-CoA dehydrogenase 633 992 gene locus_tag LOCUS_23650 633 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387554.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence506 >Feature sequence507 <1468 940 gene locus_tag LOCUS_23660 <1468 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205494.1:cytochrome c subunit II >Feature sequence508 <1 804 gene locus_tag LOCUS_23670 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464330.1:thermostable hemolysin delta-VPH >Feature sequence509 <1454 393 gene locus_tag LOCUS_23680 <1454 393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I426:cytochrome bo(3) ubiquinol oxidase subunit 1 >Feature sequence510 >Feature sequence511 >Feature sequence512 >Feature sequence513 422 997 gene locus_tag LOCUS_23690 422 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence514 >Feature sequence515 1201 737 gene locus_tag LOCUS_23700 1201 737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence516 >Feature sequence517 >Feature sequence518 <1379 674 gene locus_tag LOCUS_23710 <1379 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464328.1:sodium:proton antiporter >Feature sequence519 728 339 gene locus_tag LOCUS_23720 728 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence520 <1 679 gene locus_tag LOCUS_23730 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000343613.1:IS256 family transposase >Feature sequence521 >Feature sequence522 48 881 gene locus_tag LOCUS_23740 gene minC 48 881 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFL1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence523 223 504 gene locus_tag LOCUS_23750 gene moaD 223 504 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_23750 558 1049 gene locus_tag LOCUS_23760 gene moaE 558 1049 CDS product molybdopterin-converting factor chain 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence524 <1340 532 gene locus_tag LOCUS_23770 <1340 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206435.1:acetyl-CoA acetyltransferase >Feature sequence525 >Feature sequence526 65 892 gene locus_tag LOCUS_23780 65 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence527 <1 1238 gene locus_tag LOCUS_23790 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWB9:arsenical pump membrane protein >Feature sequence528 >Feature sequence529 1143 91 gene locus_tag LOCUS_23800 1143 91 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073247.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence530 263 790 gene locus_tag LOCUS_23810 gene allA 263 790 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YX3 protein_id gnl|my_center|LOCUS_23810 >Feature sequence531 248 589 gene locus_tag LOCUS_23820 248 589 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_23820 >Feature sequence532 >Feature sequence533 >Feature sequence534 <1301 557 gene locus_tag LOCUS_23830 <1301 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207755.1:acyl-CoA thioesterase II >Feature sequence535 8 202 gene locus_tag LOCUS_23840 8 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 294 551 gene locus_tag LOCUS_23850 gene rpmA 294 551 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL7 protein_id gnl|my_center|LOCUS_23850 >Feature sequence536 >Feature sequence537 556 122 gene locus_tag LOCUS_23860 556 122 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_23860 <1288 704 gene locus_tag LOCUS_23870 <1288 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KM71:biotin synthase >Feature sequence538 >Feature sequence539 >Feature sequence540 <1 1070 gene locus_tag LOCUS_23880 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114679.1:xanthine dehydrogenase molybdopterin binding subunit >Feature sequence541 462 995 gene locus_tag LOCUS_23890 gene alkB 462 995 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124954.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence542 1230 565 gene locus_tag LOCUS_23900 1230 565 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence543 >Feature sequence544 <1 601 gene locus_tag LOCUS_23910 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:pyridine nucleotide-disulfide oxidoreductase <1253 727 gene locus_tag LOCUS_23920 <1253 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709512.1:betaine-aldehyde dehydrogenase >Feature sequence545 <1253 77 gene locus_tag LOCUS_23930 <1253 77 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405115.1:NADH:ubiquinone oxidoreductase subunit L >Feature sequence546 <1250 334 gene locus_tag LOCUS_23940 <1250 334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206859.1:LysR family transcriptional regulator >Feature sequence547 <1 682 gene locus_tag LOCUS_23950 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPK2:4-hydroxythreonine-4-phosphate dehydrogenase >Feature sequence548 >Feature sequence549 >Feature sequence550 <1 727 gene locus_tag LOCUS_23960 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000339028.1:peptidyl-prolyl cis-trans isomerase >Feature sequence551 >Feature sequence552 1156 473 gene locus_tag LOCUS_23970 gene rplY 1156 473 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C7 protein_id gnl|my_center|LOCUS_23970 >Feature sequence553 <1220 104 gene locus_tag LOCUS_23980 <1220 104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KPI7:anhydro-N-acetylmuramic acid kinase >Feature sequence554 >Feature sequence555 >Feature sequence556 >Feature sequence557 1079 300 gene locus_tag LOCUS_23990 1079 300 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence558 >Feature sequence559 >Feature sequence560 15 88 gene locus_tag LOCUS_t00280 15 88 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 192 266 gene locus_tag LOCUS_t00290 192 266 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence561 <1196 480 gene locus_tag LOCUS_24000 <1196 480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705183.1:sodium:calcium antiporter >Feature sequence562 <1190 167 gene locus_tag LOCUS_24010 <1190 167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KI77:adenylosuccinate synthetase >Feature sequence563 >Feature sequence564 183 761 gene locus_tag LOCUS_24020 183 761 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 protein_id gnl|my_center|LOCUS_24020 793 1032 gene locus_tag LOCUS_24030 793 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence565 >Feature sequence566 >Feature sequence567 >Feature sequence568 >Feature sequence569 276 22 gene locus_tag LOCUS_24040 276 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 941 273 gene locus_tag LOCUS_24050 941 273 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGZ2 protein_id gnl|my_center|LOCUS_24050 >Feature sequence570 <1 1140 gene locus_tag LOCUS_24060 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877263.1:anthranilate synthase component I >Feature sequence571 934 53 gene locus_tag LOCUS_24070 934 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence572 765 262 gene locus_tag LOCUS_24080 gene ubiC 765 262 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJQ8 protein_id gnl|my_center|LOCUS_24080 >Feature sequence573 >Feature sequence574 <1 587 gene locus_tag LOCUS_24090 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001246756.1:N-carbamoylputrescine amidase >Feature sequence575 792 259 gene locus_tag LOCUS_24100 gene rimM 792 259 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFY2 protein_id gnl|my_center|LOCUS_24100 >Feature sequence576 >Feature sequence577 >Feature sequence578 <1100 517 gene locus_tag LOCUS_24110 <1100 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208195.1:type II secretion system protein GspD >Feature sequence579 190 996 gene locus_tag LOCUS_24120 190 996 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence580 <1099 314 gene locus_tag LOCUS_24130 <1099 314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KNJ2:chorismate synthase >Feature sequence581 >Feature sequence582 >Feature sequence583 >Feature sequence584 >Feature sequence585 194 952 gene locus_tag LOCUS_24140 194 952 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947003.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence586 >Feature sequence587 >Feature sequence588 387 659 gene locus_tag LOCUS_24150 gene hup 387 659 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence589 >Feature sequence590 763 392 gene locus_tag LOCUS_24160 763 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence591 >Feature sequence592 >Feature sequence593 >Feature sequence594 1 420 gene locus_tag LOCUS_24170 1 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 871 530 gene locus_tag LOCUS_24180 871 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388929.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence595 >Feature sequence596 665 369 gene locus_tag LOCUS_24190 gene pqqD 665 369 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP47 protein_id gnl|my_center|LOCUS_24190 >Feature sequence597 >Feature sequence598 >Feature sequence599 >Feature sequence600 <1012 83 gene locus_tag LOCUS_24200 <1012 83 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071817.1:phenylalanine 4-monooxygenase >Feature sequence601 >Feature sequence602 110 961 gene locus_tag LOCUS_24210 110 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence603